TypeRacer Data Leaders Texts Months Universes Import About

View profile:

November 2021

Sorted by most races

Rank	Username	Races	Month	Best Race	Wins	Win %
1.	-MarkVS- (mark40511)	5,686	116.91	163.77	2,084	36.65
2.	(vixt)	5,134	120.93	187.30	2,738	53.33
3.	noobnoob (garblovian)	4,051	101.91	143.99	1,525	37.65
4.	Cole (colemakingprocess)	3,919	67.00	110.43	896	22.86
5.	🐟🐟🐟🐟hn (deliber...	3,509	132.61	171.45	2,279	64.95
6.	(poem)	3,453	134.69	207.30	2,183	63.22
7.	Stas (tracersm)	3,332	79.46	100.16	825	24.76
8.	sykelolxd (sykelolxd)	3,192	123.32	170.24	1,918	60.09
9.	MS (damanthc)	3,050	93.74	128.35	1,066	34.95
10.	Shashank (kingshashank12)	3,036	90.82	147.10	1,061	34.95
11.	Sam Aka 😏 (sam_at_40wpm)	3,000	72.86	109.73	802	26.73
12.	Cristiano (christiano_ronaldo)	2,891	60.33	91.23	578	19.99
13.	paperboy ditty (wordracer888)	2,864	140.45	191.79	1,968	68.72
14.	makeout (wastingtimexd)	2,795	73.94	107.97	648	23.18
15.	joel (jouel1234567)	2,666	70.17	101.92	618	23.18
16.	skr_j (saikiranj)	2,650	79.27	116.22	778	29.36
17.	(scraex)	2,633	113.80	191.09	2,076	78.85
18.	tstats[tshafer3] (tshafer3)	2,586	118.39	149.72	1,481	57.27
19.	WatchDominion.org (lithox2)	2,573	149.93	207.24	1,095	42.56
20.	lavé (traben)	2,569	156.92	224.33	756	29.43
21.	Ghost racing medalists suck...	2,550	84.93	117.14	733	28.75
22.	Diego (divarela)	2,505	84.10	111.84	730	29.14
23.	k (mc0sta)	2,283	86.99	116.13	704	30.84
24.	fatih (webfox)	2,281	83.50	113.09	732	32.09
25.	praks (praks01)	2,233	93.70	124.74	813	36.41
26.	Ramsey (tackheads)	2,221	87.10	123.05	684	30.80
27.	neno (nenobid428)	2,189	95.05	129.29	956	43.67
28.	chom (chomchomchomchomchom)	2,172	113.50	170.78	1,083	49.86
29.	(sura5)	2,161	116.32	176.11	1,252	57.94
30.	Ben (koppix)	2,154	67.83	87.41	450	20.89
31.	(dawittymidget)	2,139	130.27	165.29	1,310	61.24
32.	Colin (geosyog)	2,117	107.14	150.55	987	46.62
33.	rilee_h443 (rilee_h443)	2,109	101.80	152.48	900	42.67
34.	¯\_(ツ)_/¯ (glandock1)	2,095	104.68	140.81	941	44.92
35.	David (davelish)	2,094	54.00	76.71	280	13.37
36.	Md Ubaid (mdubaid_ulllah000)	2,082	60.78	99.99	478	22.96
37.	Martin (martinwong)	2,049	93.73	121.93	756	36.90
38.	Kinesis (kinesis_quake)	2,032	130.27	159.09	1,331	65.50
39.	Ton (2001or2)	2,023	104.03	147.28	905	44.74
40.	tebond (tebond)	2,014	112.03	158.67	1,054	52.33
41.	oneguardsam (oneguardsam)	2,000	84.45	120.98	526	26.30
42.	tstats[joshuarose] 🇵🇸...	1,982	96.17	137.15	730	36.83
43.	Am1n (vividus)	1,973	97.01	121.10	791	40.09
44.	Wise (wiseuser)	1,952	90.79	133.60	532	27.25
45.	Reaching (breakingpoint1)	1,947	73.12	106.82	508	26.09
46.	Global (global_typer69)	1,930	78.16	113.55	525	27.20
47.	wrists parallel (cheffray)	1,929	131.77	177.70	1,257	65.16
48.	Bleedy Basket! (ninjismo)	1,921	83.36	110.71	556	28.94
49.	(jasimk)	1,889	99.54	170.13	740	39.17
50.	Hemant (hemu_sakunde)	1,870	71.34	102.54	490	26.20
51.	LABUBU_APOCALYPSE¯\_(ツ)_...	1,866	103.02	144.83	813	43.57
52.	(mononym_jisoo)	1,862	138.50	228.44	1,803	96.83
53.	sdr4wkc48 (sdr4wkc48)	1,827	69.29	97.55	431	23.59
54.	Mirkhad (cmirkhad)	1,825	86.21	129.22	659	36.11
55.	(flaneur)	1,822	184.67	282.30	795	43.63
56.	adsfjk (jbcabintoy14)	1,818	93.31	124.85	669	36.80
57.	infinite (infinite_wotah)	1,802	64.92	93.98	374	20.75
58.	Cowbell (morris_l)	1,763	120.55	188.85	995	56.44
59.	meow (xrelative)	1,743	145.56	202.54	1,387	79.58
60.	MUPH (muphine)	1,724	81.93	119.83	470	27.26
61.	Adam (adamjason804)	1,719	105.40	151.08	744	43.28
62.	swapneel (swapneel_das)	1,715	57.58	85.07	258	15.04
63.	Stefan (fortress_king)	1,709	94.69	130.84	609	35.63
64.	Julius (solenopsis)	1,705	103.83	131.54	730	42.82
65.	unnamed (unnamedflower)	1,701	85.38	110.81	515	30.28
66.	Naut38 (naut38)	1,697	77.24	105.51	354	20.86
67.	stalkers (stalkers0418)	1,689	81.01	126.99	516	30.55
68.	Dal (astronerd)	1,688	102.36	146.26	656	38.86
69.	WheelieTron3000 (wheelietro...	1,686	83.66	109.68	502	29.77
70.	Stupid (stupididiot9)	1,651	85.73	121.00	525	31.80
71.	Des (desl)	1,638	75.76	114.00	458	27.96
72.	Tom (tomme2009)	1,632	70.65	98.99	349	21.38
73.	Grandpa (thedengue)	1,628	94.86	163.03	27	1.66
74.	Sumit (smtchahal2)	1,628	149.44	193.79	1,348	82.80
75.	King (kingthiccness)	1,626	86.84	116.41	508	31.24
76.	Christos (__christos__)	1,623	70.08	94.26	410	25.26
77.	Soufiane (shinigami25)	1,598	68.22	98.18	367	22.97
78.	Rachel (rmsitar)	1,597	129.15	164.89	935	58.55
79.	bayu (bayurespati)	1,574	66.98	100.21	355	22.55
80.	Marco (ankush12)	1,568	61.93	102.47	315	20.09
81.	nilb (nilb)	1,568	72.89	97.28	362	23.09
82.	Angelic (angelic_devil)	1,549	108.59	146.70	791	51.07
83.	(treje)	1,535	93.23	143.68	687	44.76
84.	Amit (amit__123)	1,534	54.75	92.21	259	16.88
85.	James Paul (ap1ng)	1,527	53.79	75.04	206	13.49
86.	Ninaad (saklas_33)	1,519	61.24	112.88	308	20.28
87.	Bill Tinn (tearsinrain)	1,518	112.56	164.30	782	51.52
88.	harshil (monsta_001)	1,514	69.64	96.12	372	24.57
89.	qwerty (qwerty235)	1,509	84.51	105.98	461	30.55
90.	Ryan (potatoz10)	1,498	102.01	137.06	700	46.73
91.	oussama (oussama2000)	1,495	45.19	62.04	141	9.43
92.	Elkotte (elkotte)	1,495	110.31	143.76	775	51.84
93.	asdf (blackbirdsigloo)	1,494	55.12	84.64	184	12.32
94.	Suikyo (suikyo)	1,491	78.65	117.51	391	26.22
95.	trick20 (trick2001)	1,490	81.17	116.17	386	25.91
96.	griV (griv)	1,489	82.03	117.63	384	25.79
97.	Davit (sonofar)	1,472	67.25	105.98	34	2.31
98.	Gabriel (tacbacjack)	1,469	89.86	134.41	516	35.13
99.	n o t h i n g (whyme__)	1,461	106.98	147.95	647	44.28
100.	Tyler (exilereject)	1,458	83.76	125.50	405	27.78
101.	Ja-kobe (jrutz26)	1,456	85.69	119.89	413	28.37
102.	Ashish (almessi10)	1,454	72.39	98.37	386	26.55
103.	Charles (charlesduran27)	1,452	114.66	144.45	731	50.34
104.	bryan (bryan2010)	1,452	42.61	71.87	116	7.99
105.	JP (supertyperguy2020)	1,449	57.35	74.45	202	13.94
106.	monners (monners)	1,449	76.80	100.38	468	32.30
107.	La Familia (xquyen)	1,442	93.24	123.99	534	37.03
108.	Cosmic (aji3)	1,440	101.46	151.88	596	41.39
109.	Cepheus's 🌌 (parkevan27)	1,434	131.43	175.04	881	61.44
110.	Josh (cobra04)	1,434	48.66	69.06	94	6.56
111.	swapneel (swapneel1121)	1,431	50.29	77.76	151	10.55
112.	(charlieog)	1,428	131.92	224.05	1,052	73.67
113.	(ginoo75)	1,427	137.55	249.12	1,057	74.07
114.	Ad (shmldb)	1,417	50.80	70.42	122	8.61
115.	Sudhir (sudhir_123)	1,414	52.06	70.54	131	9.26
116.	Clarence (ha_saahn)	1,412	106.82	152.80	660	46.74
117.	Nyiela (ncs1020)	1,411	68.67	100.40	346	24.52
118.	Anku (gurooatwork)	1,410	60.20	81.11	263	18.65
119.	Anh (_azh_)	1,402	81.87	124.74	410	29.24
120.	Chris (chrishewson)	1,402	133.17	169.84	988	70.47
121.	Luis (luisaes)	1,397	69.35	96.68	315	22.55
122.	the alpina annihilator (qui...	1,394	191.68	251.98	1,346	96.56
123.	Mor (morti_20)	1,394	74.72	107.73	331	23.74
124.	enminnrawr (zxcvbnm2001)	1,394	71.18	101.07	344	24.68
125.	Aditya (adityapatel103)	1,393	55.42	72.33	175	12.56
126.	Sagi (sagi73)	1,383	87.11	125.20	440	31.81
127.	Abdulrahman karkalar (safi3...	1,375	48.30	79.45	130	9.45
128.	スレトロン (slethron)	1,371	104.52	132.69	607	44.27
129.	Eli Ferdinand Edralin (elfe...	1,371	98.65	132.99	564	41.14
130.	A (dicktucker)	1,371	104.41	137.52	621	45.30
131.	Eukalyptusbonbon (vogel_adler)	1,364	110.42	138.48	668	48.97
132.	Ivan_Eagle (ivan_julia)	1,351	67.68	93.42	347	25.68
133.	Claudio (tato41)	1,350	68.60	93.65	296	21.93
134.	Sharif (sharif4747)	1,350	82.64	129.37	421	31.19
135.	Derf (derfmongrel)	1,350	70.30	99.77	289	21.41
136.	তন্ময়_2 (better_t...	1,349	104.16	139.74	635	47.07
137.	Kapa (kassyk)	1,347	50.77	71.76	131	9.73
138.	HD (hdcodecj)	1,347	81.54	108.18	362	26.87
139.	Plinkiplonk (plinkiplonk)	1,325	111.30	156.63	610	46.04
140.	Ishit soni (isrhtu_114)	1,316	57.54	84.08	257	19.53
141.	yesman (yesman9527)	1,314	84.89	141.81	412	31.35
142.	Shahil Suresh (roylar_range...	1,309	67.44	100.45	287	21.93
143.	Elias (el_typo_jr)	1,300	74.73	109.47	302	23.23
144.	Lucas (st3ezy)	1,291	76.58	102.58	318	24.63
145.	Lara (chuiicdhk)	1,289	80.40	120.64	413	32.04
146.	dinqissa (dinqissa)	1,287	80.46	128.64	324	25.17
147.	tivo (tivotavo)	1,287	96.96	147.87	518	40.25
148.	Abhisek (_typing_)	1,284	88.10	113.56	411	32.01
149.	auoaeu (aoeuhe)	1,283	81.04	106.58	358	27.90
150.	Can (cazzed)	1,279	87.04	124.04	388	30.34
151.	Gerben05 (gerbenklapwijk)	1,273	61.02	85.18	228	17.91
152.	tbj77 (tbj77)	1,270	65.30	86.93	317	24.96
153.	Chen Yik (xxmlgsniperxx)	1,264	110.17	148.36	595	47.07
154.	Gon (frixgon)	1,260	75.61	98.65	316	25.08
155.	Sylvie (eat_my_dust_batches)	1,259	83.90	118.84	387	30.74
156.	tstats[yju98039] (yju98039)	1,258	90.54	141.59	452	35.93
157.	Drews (drwsmnlpg)	1,253	85.11	113.22	373	29.77
158.	Benjamin (tryingtouse10fing...	1,250	97.22	131.83	487	38.96
159.	Manmit (manny_the_potato)	1,247	83.36	116.64	327	26.22
160.	Ra (rayap1010)	1,246	79.45	106.83	346	27.77
161.	s3rez (s3rez)	1,238	140.65	186.85	967	78.11
162.	صبر (morocco01)	1,231	86.60	123.33	397	32.25
163.	Abdulaziz (mubailesh)	1,220	88.87	116.71	400	32.79
164.	David (davidpit)	1,219	49.89	73.21	180	14.77
165.	Gustaf (gusco933)	1,214	90.69	132.95	382	31.47
166.	Logan (theperson60)	1,206	117.30	151.69	612	50.75
167.	KIARA (atherynbane)	1,202	83.52	123.90	357	29.70
168.	Deshant (djtype2124)	1,199	60.78	93.83	248	20.68
169.	Dark (dark_byte)	1,198	79.92	114.42	340	28.38
170.	Manol (ari3s)	1,198	81.38	111.90	329	27.46
171.	WILMER (handsometomato)	1,195	63.16	94.88	222	18.58
172.	Nguyen (rainfall1611)	1,187	93.64	129.59	450	37.91
173.	adsf (max_m7)	1,182	101.04	144.36	467	39.51
174.	Jaska (jarlewski)	1,182	73.91	103.28	295	24.96
175.	Alien (half_alien)	1,181	85.60	117.04	366	30.99
176.	jacktheboy211 (jacktheboy211)	1,180	106.92	144.66	547	46.36
177.	Ali (ali_pro)	1,180	55.80	80.05	154	13.05
178.	Ramses (boinkey)	1,179	87.63	125.10	335	28.41
179.	Henry (henry_21)	1,177	43.66	63.16	96	8.16
180.	trendy (strongly_typed_trendy)	1,175	59.41	90.32	215	18.30
181.	LockStock (lockstock)	1,170	99.69	129.66	442	37.78
182.	Michael (kedalg)	1,170	63.59	86.26	222	18.97
183.	AKGD (akgd)	1,170	90.75	115.09	425	36.32
184.	雲煙成雨 (1eonardo)	1,167	75.74	108.83	302	25.88
185.	Dang Hai (haidanghoang178)	1,165	78.39	104.53	301	25.84
186.	ankit (ankitthegreat)	1,160	86.44	109.88	361	31.12
187.	Shukuphido (shukuphido)	1,154	66.68	83.29	259	22.44
188.	fdsafdsa (szesz)	1,150	77.40	103.32	283	24.61
189.	👋youtu.be/AXNeUMDP3no (o...	1,144	95.65	143.28	482	42.13
190.	Zohaib (atazoa)	1,144	59.20	93.35	222	19.41
191.	chopst1cksss (chopst1cksss)	1,134	118.12	147.30	660	58.20
192.	arijan (arijan_dh)	1,134	130.38	189.19	775	68.34
193.	pythagoras (123pythagoras123)	1,134	86.27	119.93	309	27.25
194.	Richard (dicklash)	1,131	99.33	128.73	438	38.73
195.	SPEXINDER (forest7)	1,129	108.91	152.46	561	49.69
196.	Wayne (samehadenough)	1,128	84.00	114.53	342	30.32
197.	Typeracerer (typeracerer2020)	1,120	65.47	84.73	242	21.61
198.	Colemak Lost (_champ_)	1,111	121.84	175.75	622	55.99
199.	Maters (maters48)	1,109	62.86	86.95	210	18.94
200.	kim (kim_1409)	1,109	125.54	185.81	706	63.66
201.	HudYA (hudyusuf)	1,108	69.32	95.17	250	22.56
202.	0O00O0O0O0O0O0 (bunnystacker)	1,107	79.81	111.72	304	27.46
203.	Joel (joel6677)	1,103	105.01	138.08	490	44.42
204.	Ritik (beast2402)	1,099	56.56	79.71	155	14.10
205.	Ivan (expl1icity)	1,098	83.66	107.49	301	27.41
206.	i love typing!!! (hebibuki)	1,096	104.96	142.13	454	41.42
207.	Shivam Kumar (sks123_)	1,096	64.42	97.44	234	21.35
208.	Erdenebat (speed8019)	1,091	65.19	93.55	259	23.74
209.	Korezu (nyanuwin)	1,090	69.67	97.66	223	20.46
210.	lobus (lobus_rec)	1,089	97.05	128.26	420	38.57
211.	Tinumír (tinumir)	1,086	100.38	125.01	481	44.29
212.	zyyy (zyyyyyyyz)	1,077	64.75	94.65	251	23.31
213.	(pastashapes)	1,075	148.50	269.30	757	70.42
214.	Ji (urzz4eva)	1,074	113.17	157.52	544	50.65
215.	Artem (gushinartem)	1,071	87.88	135.69	364	33.99
216.	Sandro🇬🇪 (jolskey)	1,069	87.02	128.17	338	31.62
217.	Operation Sindoor Rocks (pr...	1,063	56.99	86.44	175	16.46
218.	fella (fellasaurus)	1,060	60.73	78.25	171	16.13
219.	glerou (tudesci)	1,058	90.04	124.52	339	32.04
220.	Daniel (smartdevilno)	1,058	76.60	99.37	250	23.63
221.	subham (subhamrawat)	1,054	85.59	120.22	269	25.52
222.	james (awesome4aces115)	1,053	80.17	133.39	275	26.12
223.	tstats[brandonisstupid] (br...	1,048	89.91	126.27	355	33.87
224.	Innocent (saquelain)	1,048	68.02	98.94	222	21.18
225.	Type (granwizard)	1,046	85.91	117.41	376	35.95
226.	lettel (lettel)	1,037	89.07	114.84	315	30.38
227.	shuffled neurons (spicytuna1)	1,036	143.75	194.81	69	6.66
228.	pakistan palestine zindabad...	1,033	97.89	127.16	427	41.34
229.	Jashe (freshfastjashe)	1,029	167.66	212.33	826	80.27
230.	(peaceinchrist)	1,027	120.30	160.56	577	56.18
231.	Tim (timlee)	1,024	36.20	51.76	54	5.27
232.	Σπύρος (asos11)	1,020	62.26	91.38	198	19.41
233.	Andrè (andrree)	1,020	77.62	109.45	251	24.61
234.	Typerx (newtyperx)	1,016	95.23	131.95	370	36.42
235.	Carmel (m_carmel)	1,008	111.38	147.10	489	48.51
236.	🎈k (konnomon)	1,000	92.43	115.84	357	35.70
237.	new kb keychron v6 (jlam555...	1,000	126.53	170.26	631	63.10
238.	Matthew (kylehyde)	997	86.67	116.61	279	27.98
239.	jk5621 (jk5621)	995	59.99	82.95	188	18.89
240.	🐍🐍🐍 (despot)	993	154.99	222.45	755	76.03
241.	shadmehr (megacrocodile)	990	71.64	101.76	221	22.32
242.	Finley (blindfish)	988	77.81	112.40	233	23.58
243.	alshbalasle (hadisulfe)	988	47.30	70.68	101	10.22
244.	Adarsh M A (adarshm39)	986	51.33	67.55	130	13.18
245.	Orka (orka)	979	60.58	78.98	186	19.00
246.	Ovidiu (ofydd)	979	111.49	136.99	469	47.91
247.	Tommy (dextonjl)	978	114.92	160.00	489	50.00
248.	Adrian (adrianvn789)	975	97.47	132.01	423	43.38
249.	Huy (cross546)	973	55.19	74.45	116	11.92
250.	(´・ω・｀) (gahama)	973	126.57	172.14	643	66.08
251.	Slow (giorgiv4)	972	95.50	135.17	390	40.12
252.	juswawawa (juswawawawawa)	970	93.05	133.28	368	37.94
253.	💀💀💀 (gospell)	970	113.82	162.29	486	50.10
254.	Om (omkashyap007)	965	58.70	85.07	170	17.62
255.	Cloud (cloud_bolssom)	965	77.12	115.77	235	24.35
256.	jaso (jasocanfly)	957	89.54	133.61	316	33.02
257.	AJ (aayushjoshi)	957	57.46	86.20	187	19.54
258.	φσ (phi_sigma)	956	62.29	81.65	191	19.98
259.	Md Shamim (cseshamim47)	950	62.53	85.62	182	19.16
260.	neeraj (neeraj902)	949	73.92	100.09	248	26.13
261.	144p 1998 VW Beetle (stryke...	945	111.69	156.19	467	49.42
262.	Birdman (birdman13)	944	79.60	104.40	314	33.26
263.	(◍•ᴗ•◍) (ibi4645)	944	67.88	111.04	561	59.43
264.	TypingMaster3 (typingmaster...	938	100.68	136.27	384	40.94
265.	Xi Jinping (wuhan_virus)	933	69.94	98.12	217	23.26
266.	Amarjot (apandher)	933	113.77	155.82	465	49.84
267.	Type like never before! (re...	932	101.36	143.82	393	42.17
268.	Nyamsick Adrian (minyamisu)	932	55.12	84.26	134	14.38
269.	lhdrive (kickmic)	931	63.09	85.92	189	20.30
270.	Prithbiraj (prithy)	930	62.93	90.33	239	25.70
271.	mamoud (__mahmoud__)	930	47.49	66.46	83	8.92
272.	Paolo (invelt)	929	109.46	139.53	484	52.10
273.	mohammad (the_slow_typer_14...	929	46.92	66.02	88	9.47
274.	Edward (kailhreds)	924	84.99	109.75	269	29.11
275.	mohan (mohan2002)	924	73.99	99.58	240	25.97
276.	Mazhar Andalib (mazharandalib)	923	79.75	117.58	284	30.77
277.	Ara Ara (vinhwiu)	922	74.21	106.60	239	25.92
278.	Jason (jasonjohnsj27)	922	95.03	141.27	378	41.00
279.	Michael (michaelch)	921	97.05	136.99	366	39.74
280.	cheikh (cheikhbr)	921	59.28	84.57	158	17.16
281.	Yash (yashshingade28)	921	87.40	116.14	341	37.02
282.	Saucter (saucter)	920	88.03	118.87	296	32.17
283.	kekw (kekwomegalul)	920	132.07	173.98	638	69.35
284.	L (easymoneysniper1)	920	131.31	184.00	556	60.43
285.	FoTGbigGhost (fotg_reckless)	916	103.31	130.51	388	42.36
286.	jun (jun0sck)	914	79.68	112.41	228	24.95
287.	onii-chan (cinnamonorange)	911	76.18	110.02	234	25.69
288.	BBB (beermindnor)	910	70.49	96.06	221	24.29
289.	monochrome (artemis_05)	910	101.32	132.00	361	39.67
290.	sməxy (smexyflako)	910	102.52	136.70	361	39.67
291.	Kevin (zhengfeilong)	908	127.07	167.55	539	59.36
292.	Ricky (suthxx)	907	36.56	56.72	72	7.94
293.	Surya (maurice_mordor)	906	43.22	64.03	60	6.62
294.	Anthony (goldfrog)	906	55.56	88.54	116	12.80
295.	Jacobo (inztincz)	905	75.82	117.56	224	24.75
296.	mrgiorgoulis (mrgiorgoulis)	904	80.97	123.10	248	27.43
297.	J-Money (jacobbeaudway)	902	78.42	108.96	239	26.50
298.	Lactophenol Cotton Boy (tpy...	901	103.18	140.58	389	43.17
299.	Brendan (brendalandan)	900	85.95	115.72	218	24.22
300.	Ez (ezpass)	897	78.48	112.82	292	32.55
301.	abdullah (abdullah_ui)	897	108.58	149.91	461	51.39
302.	Nick (1truelipstick)	895	111.78	161.78	436	48.72
303.	The cute girl likes pink (o...	895	117.96	152.37	506	56.54
304.	Leo (leotwelve)	891	79.84	101.29	223	25.03
305.	Ankit Kumar (ankitnain)	889	87.38	119.81	612	68.84
306.	(yeekidd)	889	95.81	146.01	339	38.13
307.	account deleted (concurrent)	889	100.10	137.17	21	2.36
308.	keiwpie (keikuuuu)	887	93.19	124.21	350	39.46
309.	sdfg (nerus_k)	886	39.68	58.49	76	8.58
310.	jello_jello (jello_jello)	885	109.20	137.06	454	51.30
311.	Abu (abu_hussain_03)	885	76.87	100.68	231	26.10
312.	Zak (villzzz420)	885	50.43	76.75	109	12.32
313.	matan (malsonic)	883	77.87	127.21	240	27.18
314.	Sayandip (sayandip199309)	883	76.60	99.45	232	26.27
315.	sudheer singh (justsudheer)	882	65.50	91.00	211	23.92
316.	Calvin Low (benderium_123)	881	79.94	100.19	244	27.70
317.	Adarsh (krishnan7)	879	60.06	81.55	147	16.72
318.	Oliver (rgroli)	878	60.84	81.20	147	16.74
319.	Ravi (ravishankarr)	877	47.67	69.41	96	10.95
320.	omar (omar_elsayed)	876	56.95	84.40	125	14.27
321.	Carlos (carloszapata)	874	63.97	90.14	207	23.68
322.	Please use an appropriate n...	873	49.99	71.46	95	10.88
323.	(khronic)	873	119.40	154.56	522	59.79
324.	Dan (cantdecidedan)	872	65.01	96.90	230	26.38
325.	Vashista (vashista)	870	70.69	98.13	208	23.91
326.	Densetsu (densetsunobattousai)	869	74.44	98.91	266	30.61
327.	SimplyOrange (simplyorange)	867	92.85	122.47	302	34.83
328.	Petar (petar17)	866	62.06	82.20	163	18.82
329.	heartbeats (jack777)	864	105.91	145.75	366	42.36
330.	farzan (farzanhges)	862	93.52	131.23	378	43.85
331.	Thinh (thinhtr)	861	78.53	103.84	261	30.31
332.	Keira (keiradawn)	856	93.41	119.94	323	37.73
333.	(rayer)	856	117.09	168.57	459	53.62
334.	philiplol (philiplollll)	855	65.52	91.07	164	19.18
335.	John (happyguy2000)	855	52.12	66.38	69	8.07
336.	Jonathon (goodstuff11)	852	101.79	148.11	347	40.73
337.	dotdotdot (atuladhar1)	848	67.34	97.85	188	22.17
338.	Fauggesim (fauggesim)	845	40.25	56.57	60	7.10
339.	(paceyq)	845	132.77	172.58	547	64.73
340.	Ivan (ivannechaiev)	845	82.12	106.77	230	27.22
341.	Nightmare (zhanarbek)	844	69.06	96.29	197	23.34
342.	Ahnaf (stallion1145)	844	73.97	102.60	198	23.46
343.	Rishav (rishavmngo)	841	76.82	105.41	211	25.09
344.	Big k (lawda)	839	59.82	91.62	168	20.02
345.	Lil Mama (ckennedy07)	839	87.95	109.80	232	27.65
346.	Vanshraj (vrsempire601)	837	73.13	102.11	208	24.85
347.	Almaz (almazzz1)	835	64.05	91.42	225	26.95
348.	Winnie (win_)	834	84.55	104.38	228	27.34
349.	mahmoud shalhoub (mahmoud77)	833	35.97	52.55	83	9.96
350.	Snail (kelvin_paul)	833	98.50	122.83	306	36.73
351.	Cameron (sigmaimu)	832	99.40	134.70	284	34.13
352.	Free Palestine 🩸🫸 (mo...	832	100.64	141.61	304	36.54
353.	Sewnkin (sewnkin23gg)	827	91.43	122.05	296	35.79
354.	Kerb (kerby_berby)	827	124.71	175.80	468	56.59
355.	Omni (omzi)	826	72.99	116.05	214	25.91
356.	Mishel (holosight)	824	76.27	113.70	190	23.06
357.	Akash (swfu_akash)	821	75.47	106.67	221	26.92
358.	Chrism4 (chrisman44)	818	59.72	86.15	147	17.97
359.	Miccalo (miccalo_dv)	817	48.99	92.52	98	12.00
360.	QwertyBaguette (smellybague...	817	98.07	121.63	330	40.39
361.	Brenden (embracesc2)	812	65.34	96.19	186	22.91
362.	Lara (goddess_111)	811	94.29	147.81	294	36.25
363.	sugdese (sugdese)	809	69.18	97.58	179	22.13
364.	big daddy (shivdatt_op)	809	64.68	98.52	170	21.01
365.	Nabeel (nabeelz)	809	76.24	99.79	205	25.34
366.	Josh (the_josh)	805	95.36	128.79	317	39.38
367.	travdong (travdong)	800	80.52	107.92	197	24.63
368.	Max (maxijazz)	799	98.93	132.55	361	45.18
369.	rinas (dont_look_at_keyboard)	797	30.86	43.85	74	9.28
370.	Trung (danghoangtrung)	797	54.90	82.09	95	11.92
371.	Blue (terry25031069)	796	82.20	105.56	210	26.38
372.	Saulius (zemfry)	793	91.84	115.31	256	32.28
373.	Youssef (sec5x)	793	99.26	125.01	317	39.97
374.	subham (syt03)	792	45.64	64.98	99	12.50
375.	bleh (devcappy)	792	97.60	146.50	297	37.50
376.	David (tintedrange)	790	79.62	110.32	216	27.34
377.	Alenygam (provola23)	789	115.48	154.43	425	53.87
378.	skippi (skippie)	788	130.53	175.06	490	62.18
379.	sharaf (sharaf_makk)	788	62.40	80.90	137	17.39
380.	Dhruv (codenta)	788	45.74	66.54	72	9.14
381.	Workman (dagl200)	786	87.13	115.06	245	31.17
382.	अध्ययन Adhyan (...	786	50.28	74.54	95	12.09
383.	Daniel (kool_beenz)	786	66.57	95.05	158	20.10
384.	John Anthony (therewere3)	785	61.48	80.92	155	19.75
385.	Ramsudhan (sudhanlee)	784	58.22	75.26	115	14.67
386.	An (iaman)	783	93.27	118.91	282	36.02
387.	John Paul (jp_ramolete16)	782	48.21	65.69	84	10.74
388.	mimi (xvni)	777	67.81	86.75	157	20.21
389.	Jarod (terminuszwei)	776	102.32	149.66	323	41.62
390.	NiteCyperTTV (nitecyper2)	774	137.90	180.98	555	71.71
391.	ARK (qwerty account) (arkfr...	773	81.34	105.10	196	25.36
392.	Andrea (andreavanderjagt)	772	91.17	128.19	250	32.38
393.	AxiomDestroyer (axiomdestro...	772	108.78	135.73	368	47.67
394.	ros (heyokay1234)	772	70.49	102.02	188	24.35
395.	uty (tisurend)	771	101.63	145.17	315	40.86
396.	ASIAN47 (asian47)	771	90.82	131.77	284	36.84
397.	danniponcho (dponchos)	770	95.09	128.65	276	35.84
398.	Anant (hero_shukla)	770	96.30	128.56	303	39.35
399.	nauyu (nauyusimi_)	770	108.83	133.43	351	45.58
400.	Filip (hummelur)	769	74.23	98.25	205	26.66
401.	Gagan (gagan18)	768	90.01	132.29	269	35.03
402.	liz (hamid__)	767	109.18	136.27	373	48.63
403.	Tejas (crimcrim)	767	74.42	104.26	196	25.55
404.	Tewtadle (tewtadledesktop)	767	91.33	123.96	263	34.29
405.	SLSL (slslz)	767	74.07	116.03	185	24.12
406.	ghost (theghostbehindyou)	764	56.69	83.86	111	14.53
407.	fasttyperLoading (fast_type...	763	37.41	55.04	58	7.60
408.	tstats[barockt] (barockt)	763	95.32	119.99	279	36.57
409.	(joshua728)	762	221.42	310.07	728	95.54
410.	InCredH (harsh_hegishte)	762	83.08	132.63	231	30.31
411.	Ayvan (dharmablade)	761	86.68	118.34	231	30.35
412.	wakeupvarn (varnontyperacer)	760	101.57	133.09	302	39.74
413.	peeush (piefkr)	760	38.67	63.72	49	6.45
414.	Anguu (anguubeef)	760	99.23	125.22	301	39.61
415.	Ahmad (ahmadmozaffar)	759	73.50	114.70	185	24.37
416.	Amar (supatypaxxx)	758	89.96	123.90	273	36.02
417.	Turi (haditoori)	758	78.43	109.56	235	31.00
418.	Dana (danayi)	758	126.37	173.49	491	64.78
419.	tstats[parth812] (parth812)	758	55.37	79.60	100	13.19
420.	C (ccc123)	757	94.81	123.16	263	34.74
421.	LastSlice (cezara)	756	60.19	84.84	118	15.61
422.	tstats[hellisgood] (hellisg...	756	62.32	81.88	166	21.96
423.	🌹 Black Rose 🌹 (rosew...	755	149.54	184.99	600	79.47
424.	Samuel (sambabzz)	754	46.34	68.51	65	8.62
425.	yuupoipoi (mimicclone)	754	68.39	89.95	175	23.21
426.	piconeeks (piconeeks)	752	98.76	133.71	285	37.90
427.	flyaway (saltybaby)	751	69.54	102.10	294	39.15
428.	run thru the finish line (p...	750	137.21	170.19	515	68.67
429.	PicturingFrames (frame_abil...	750	87.51	135.92	235	31.33
430.	Callum (cal_a_mari)	750	53.61	72.43	87	11.60
431.	goraput (boom1749)	747	74.22	110.13	187	25.03
432.	Feynex (imhidayat)	747	103.16	145.43	300	40.16
433.	t̶̢̤͇̪̱̮̿̓̓̕͜ͅ...	746	95.57	132.42	273	36.60
434.	arena (arenacloser204)	745	90.66	136.63	219	29.40
435.	Ivan (ivantakashi)	745	90.11	138.20	243	32.62
436.	Laith (chaoscontrol_jr)	744	63.69	87.44	210	28.23
437.	bub (bubmaley)	742	106.29	138.33	333	44.88
438.	Mr.Pemguimn (nhatltm)	741	78.10	132.09	250	33.74
439.	Felix (promeneraren)	740	113.42	162.61	337	45.54
440.	nonquitvinpho (nonquitrainb...	740	115.53	164.74	324	43.78
441.	john (nothisisjohn)	738	170.54	205.37	687	93.09
442.	Mohammad (mhmmdkholani)	738	38.66	59.58	58	7.86
443.	Tang (tangvt97)	736	63.99	83.23	145	19.70
444.	Rika (infric)	735	132.11	161.68	36	4.90
445.	Ryan (rjbunge99)	734	81.59	105.25	190	25.89
446.	Baked and Buttered (mcallen...	730	114.48	167.97	338	46.30
447.	Milka (mille993)	728	50.73	67.13	66	9.07
448.	anurag tara (fastest_racer)	728	52.00	74.95	85	11.68
449.	Aggy (tuigovno)	728	78.78	111.19	226	31.04
450.	Idris (kakashirero)	727	77.51	114.03	233	32.05
451.	⠈⠁ᵀ ᴱ ᴵ ᴸ ᴼ�...	724	117.63	154.07	364	50.28
452.	uzi (cray_f)	724	72.48	98.88	172	23.76
453.	derusting (paradoxpigeon)	722	154.93	195.52	652	90.30
454.	Aelyos learns to type (aely...	721	50.85	71.29	82	11.37
455.	Tiddy (tiddytwister)	721	94.75	128.19	250	34.67
456.	Tobbe (tobbedman)	720	80.30	107.01	190	26.39
457.	Qwerty (qwerty80801)	720	96.16	126.22	265	36.81
458.	(naturaladoption)	719	95.67	156.42	234	32.55
459.	Chaddley (chadracer69)	719	94.43	129.14	240	33.38
460.	Said (saidenhide)	717	91.69	129.01	260	36.26
461.	szymi_gold (szymi_gold)	715	66.80	90.85	156	21.82
462.	RIP BYRON (sk8terboi723)	715	145.43	187.97	540	75.52
463.	ឡានប្រណាំ...	714	64.41	95.30	162	22.69
464.	Luis (chapibol)	714	74.04	95.14	152	21.29
465.	akash (akash_sharma)	714	53.23	69.71	120	16.81
466.	Ali (imtew_much)	713	81.33	106.21	192	26.93
467.	Ravi (ravimajhi)	712	49.25	70.10	83	11.66
468.	JCRueco (shizile)	710	83.94	113.44	223	31.41
469.	LB (man_onatree)	708	104.07	139.93	324	45.76
470.	stop! (ademke)	708	119.21	164.85	387	54.66
471.	maxbaldy (maxbaldy)	708	40.47	56.76	44	6.21
472.	Ornstein (eliggett)	708	90.16	115.10	241	34.04
473.	Derek (derekkeiley)	706	72.92	92.32	151	21.39
474.	Vroom! (laptopguy)	706	96.32	137.48	271	38.39
475.	asdfjkl; (deskripper)	704	146.26	201.84	536	76.14
476.	sir (zenzir)	704	86.80	119.30	222	31.53
477.	waterismagnificent (wateris...	704	100.91	136.98	299	42.47
478.	Upmanyu (abhishek2175)	704	78.85	100.51	191	27.13
479.	Anupam (plaanupam)	703	80.92	103.09	201	28.59
480.	Nibblet (nibbletdaking)	700	57.57	79.28	83	11.86
481.	Jackalope (jackalopy)	699	107.29	131.11	329	47.07
482.	tstats[inbredturtle] (inbre...	699	94.94	130.63	252	36.05
483.	Billy (oatmeal417)	698	102.34	131.49	319	45.70
484.	Zhuldyzay (zhuz12)	698	64.45	90.58	156	22.35
485.	Nika (tinysalmon90)	698	103.46	130.39	299	42.84
486.	Gatsu (ace27)	696	52.58	71.68	76	10.92
487.	JollyImpulse (jollyimpulse)	694	107.61	140.92	303	43.66
488.	Noah (nodigermanium)	694	89.25	118.09	207	29.83
489.	Jun Sheng (my40789)	692	71.23	95.36	184	26.59
490.	Lane (laneondvorak)	691	85.70	130.96	193	27.93
491.	Slethron (fastslethron)	689	102.44	133.57	295	42.82
492.	Vignesh (viggie)	688	77.11	100.75	191	27.76
493.	Steve (stev_cubed)	688	151.84	189.63	595	86.48
494.	camelCase (saisrikantta2)	688	65.12	85.31	137	19.91
495.	phlofy (phlofy)	687	135.66	183.84	479	69.72
496.	GiftedOtter (giftedotter)	686	106.35	144.88	298	43.44
497.	David (dcohen91)	685	98.35	142.14	275	40.15
498.	daksh (daksh_2106)	683	65.57	85.69	148	21.67
499.	Andy (andy3j)	683	64.79	83.31	161	23.57
500.	Max (tehbomb123)	681	79.94	109.36	142	20.85
501.	Guddu Jaisawal (suraj_6732786)	680	47.07	70.92	65	9.56
502.	Rauhan (rauhan1998)	680	64.80	92.59	160	23.53
503.	Manish (mkn0079)	680	54.53	80.27	103	15.15
504.	OneRandom (one_random_typer)	679	78.59	100.25	166	24.45
505.	LeBaby (funnypoopyeater)	679	99.14	133.88	268	39.47
506.	Juan Martín (juanma2700)	675	95.47	117.95	226	33.48
507.	raghu (r_strike9437)	674	68.84	90.94	168	24.93
508.	E (weihceinre)	670	150.57	202.92	558	83.28
509.	Vasanth Raja (vasanthraja)	668	93.67	121.98	214	32.04
510.	Gaussian (ndrous20)	668	80.36	105.39	154	23.05
511.	John (jakw93)	668	61.02	78.21	134	20.06
512.	EconEdgeLinch (linch8)	667	84.69	109.53	192	28.79
513.	Jay (dicknm)	667	65.58	87.64	143	21.44
514.	Mohammed (modh_)	666	54.88	72.02	56	8.41
515.	Aaron (liron2007)	666	38.68	58.60	53	7.96
516.	Grzesiu (grzesiubonzo)	665	73.49	102.26	151	22.71
517.	mohit (madara989)	664	48.97	70.39	68	10.24
518.	Kok Kun (kokkun92)	664	82.12	117.99	188	28.31
519.	ayorgo (ayorgo)	664	72.32	90.79	168	25.30
520.	Gabe (dyrozang)	662	115.18	158.61	335	50.60
521.	J (ckfhd1234)	660	63.17	77.12	133	20.15
522.	🔰Rayster (rayster1)	660	85.51	117.06	197	29.85
523.	Gerard (gerard_m_m)	659	70.57	100.46	185	28.07
524.	name (anson001)	659	111.15	152.57	289	43.85
525.	aaaaaa (hagemanto)	658	83.20	107.44	173	26.29
526.	DrLawL (drlawc2)	658	150.74	191.10	553	84.04
527.	Siri (sireon)	657	62.62	83.37	127	19.33
528.	Nicholas (nicholaswong03)	657	91.45	148.10	236	35.92
529.	Shaurya (shaurya2399)	656	106.67	131.36	365	55.64
530.	katapi (catapie)	653	98.46	125.37	249	38.13
531.	varun (vakot)	651	55.34	74.36	98	15.05
532.	Apollo (ahollo)	651	76.86	101.33	170	26.11
533.	Prasant (man_iac)	650	96.90	124.60	266	40.92
534.	ben (benwang1)	649	80.26	108.54	175	26.96
535.	tstats[medo_1010] (medo_1010)	648	79.98	116.37	171	26.39
536.	tstats[siriusvega] (siriusv...	648	133.15	168.96	452	69.75
537.	👶 (a_baby)	646	128.20	159.59	417	64.55
538.	jazk (axaladyx)	646	100.08	134.50	259	40.09
539.	Ayan (ayan_007)	645	60.94	78.25	128	19.84
540.	fratelecarol (fratelecarol)	643	76.75	110.95	185	28.77
541.	Tiago (doodoo11)	643	82.06	111.89	169	26.28
542.	Gerardo (sewingbunion9)	643	57.70	82.69	100	15.55
543.	Karl (relentlesstyper)	643	96.16	124.88	238	37.01
544.	PMC (pmcc)	642	75.78	105.79	144	22.43
545.	itsmin (itsminbin)	642	83.95	112.02	182	28.35
546.	Indeed (indeed001)	642	64.12	90.83	148	23.05
547.	Tyler (tjking12)	641	88.55	121.87	208	32.45
548.	Kevin (kevincamilo)	640	76.58	100.17	130	20.31
549.	hyp (hyprix)	640	92.05	136.22	193	30.16
550.	Santiago (drebexler)	640	97.79	137.88	229	35.78
551.	atef (atef_7534)	640	67.10	111.47	160	25.00
552.	Dvorak (blazeencryption)	639	106.89	151.58	259	40.53
553.	Marvuw (hotdog1234444)	639	72.65	99.79	145	22.69
554.	starry nights (iamsatanic)	638	77.58	122.36	152	23.82
555.	Ryan (direwolf05)	637	103.27	131.52	227	35.64
556.	Pranav (pgracer25)	636	48.06	81.39	59	9.28
557.	Theo (theodosis_aga)	635	93.37	134.14	198	31.18
558.	Nicolas (typekaiser)	632	70.85	101.49	165	26.11
559.	Taylor (taylor_1121)	632	81.90	114.09	193	30.54
560.	corrode (nothanksgiving)	632	119.05	168.51	314	49.68
561.	Kabir (kabir_1234)	632	54.57	75.30	88	13.92
562.	dva main (thedragonemperor)	631	149.76	209.71	486	77.02
563.	a (3lim64)	627	98.54	128.37	221	35.25
564.	amanullah (amanullah32)	626	85.02	115.39	208	33.23
565.	Nico (monnerford)	626	69.68	85.70	138	22.04
566.	MrButtersworth (flapjackstax)	626	114.33	137.22	300	47.92
567.	Shivam (exergo)	626	74.18	97.88	164	26.20
568.	China (dvorak_king)	625	95.70	146.30	230	36.80
569.	Nobody (anhddo)	625	77.83	102.38	159	25.44
570.	Habib (habibmalik)	624	83.65	111.09	189	30.29
571.	Pragyan (satisfiedmagma)	623	52.44	74.96	91	14.61
572.	Mrinal Anand (mrinal_anand)	623	46.93	63.65	61	9.79
573.	Serg (drgsus)	623	115.54	156.18	305	48.96
574.	timefaker (timeassassin)	622	79.19	109.16	151	24.28
575.	Lagom (thelagom)	622	91.19	149.10	208	33.44
576.	Ryo (ashida4)	621	99.72	132.69	246	39.61
577.	Arash (me_races)	620	50.32	81.54	88	14.19
578.	George (stamoulohta)	619	67.48	86.52	148	23.91
579.	Andre (andr_ehh)	619	74.82	106.51	161	26.01
580.	anty (antyboi)	618	110.17	149.30	285	46.12
581.	(floofyaltaria)	618	129.92	169.97	390	63.11
582.	floof (flooffy)	617	95.48	127.40	211	34.20
583.	Aryav (aryav123)	617	78.67	116.81	184	29.82
584.	Raja (mmahmoodh)	617	82.13	105.68	184	29.82
585.	Shahbaz (thisisshahbazsb)	616	64.61	80.03	133	21.59
586.	abhishek (abhi1912)	616	46.36	68.63	134	21.75
587.	Don't bully me plz (dontbul...	615	77.58	114.62	165	26.83
588.	Vivek (kill3rking)	615	69.64	91.84	150	24.39
589.	Swifty2997 (swifty2997)	615	60.25	76.13	100	16.26
590.	Moronic Typer (yong955143)	614	103.04	127.30	278	45.28
591.	Charly (swagzzzzz)	613	78.06	121.71	140	22.84
592.	mainto (manito7)	613	58.39	80.44	106	17.29
593.	Julish (julish13)	613	45.08	59.66	58	9.46
594.	kunal (kunalmachra)	612	84.49	113.10	181	29.58
595.	Zi Hao (im_getting_there)	612	77.29	111.29	165	26.96
596.	Nguyen (nanoforge)	612	66.29	86.18	128	20.92
597.	Neodymium (neodytrium)	611	106.81	143.76	269	44.03
598.	🚀 🚀 🚀 (patrickhirsh)	610	76.25	107.91	117	19.18
599.	F (lawlnoodle)	610	95.50	123.72	220	36.07
600.	初めは40wmp (hajime40)	610	92.39	118.60	212	34.75
601.	Mike (mikety1)	609	49.63	66.84	47	7.72
602.	Tien (thetientran)	608	114.70	181.20	331	54.44
603.	hafizh (effortlesshuman)	608	47.85	70.07	51	8.39
604.	Koupka (koupka)	607	76.96	108.13	168	27.68
605.	rishh_ (imrishitpant)	606	65.51	113.82	148	24.42
606.	Supporting Israel (zombiesw...	606	176.20	256.87	436	71.95
607.	maltinyu (maltinyu)	605	64.40	94.88	136	22.48
608.	Started from 3wpm (the_op_p...	603	36.89	60.08	48	7.96
609.	Hassan (hamoro)	602	80.18	105.89	135	22.43
610.	(e6f4e37l)	602	158.13	213.08	533	88.54
611.	Helloween (tranduclocbkmail1)	601	66.77	83.92	146	24.29
612.	Electronica__ (electronica__)	600	99.73	126.40	263	43.83
613.	Naman (naman1601)	600	86.48	133.22	295	49.17
614.	P (kwerta)	600	81.10	105.65	164	27.33
615.	wil (wilruns)	599	120.92	159.14	339	56.59
616.	Joe (joetelefair)	598	89.91	116.42	227	37.96
617.	hilpitome (hilpitome)	598	40.75	61.77	57	9.53
618.	i_type_fast_with_good_postu...	597	73.35	112.75	169	28.31
619.	Dev (devgupta55)	595	70.99	94.07	134	22.52
620.	Harshith (ghvsama_123)	594	55.84	77.48	103	17.34
621.	Xander (xandejesus)	594	107.86	133.61	264	44.44
622.	Markycuh420 (theitfactor)	594	93.22	127.83	210	35.35
623.	ginginggaang (cremleme)	593	86.30	120.33	181	30.52
624.	Saiyn (saiynssgssyr)	592	79.11	107.93	141	23.82
625.	Lex (pyxelwolf)	592	86.22	110.97	175	29.56
626.	shui (sammi76)	591	86.91	115.49	193	32.66
627.	Springfield (springfield1903)	591	62.77	87.37	151	25.55
628.	Jwickblack (hellwood)	591	83.86	114.22	185	31.30
629.	hi (ihssm)	589	51.93	72.18	62	10.53
630.	Franco (rubikute)	589	76.52	102.05	143	24.28
631.	rocket (mythicalrocket)	589	178.50	222.91	516	87.61
632.	Lemonade on Meth (riqlemonade)	588	81.07	116.90	170	28.91
633.	CJ (bighiest)	587	99.93	139.10	266	45.32
634.	Choco (choco22)	586	101.03	159.91	241	41.13
635.	typeyMcTypeFace (mslib9)	586	98.65	129.78	248	42.32
636.	(majernja)	585	72.96	97.57	128	21.88
637.	Vincent (filtertype)	585	83.90	114.07	188	32.14
638.	Nick (coyote96)	585	97.32	119.00	237	40.51
639.	Juliet 3 (buckles7809)	585	78.61	104.99	158	27.01
640.	Sam (imeowyou)	583	81.97	112.16	183	31.39
641.	Beige (beigedaddy)	582	101.76	143.24	270	46.39
642.	Fexo (fexer)	581	94.49	124.33	189	32.53
643.	Chris (rykthos)	581	81.68	109.52	158	27.19
644.	taylor (pastford)	581	56.57	78.50	80	13.77
645.	Crooked (crookediyoung)	580	32.90	54.03	70	12.07
646.	Guest (train9013c)	580	78.51	103.44	134	23.10
647.	Knight_Oikos (knight_oikos)	580	128.17	166.09	320	55.17
648.	Ben (bk100)	579	80.80	116.21	173	29.88
649.	DF (df__)	578	73.34	102.26	174	30.10
650.	Sam (maedrescher)	578	65.41	85.71	116	20.07
651.	Mohamed (medsebri)	578	78.62	113.89	155	26.82
652.	Vu (kroken_keyboard)	577	65.79	90.61	127	22.01
653.	Abhay (abhay_hadez)	577	91.57	124.55	227	39.34
654.	tofe (tofetofe)	577	52.30	72.50	67	11.61
655.	Chris (immortaljason)	575	25.29	41.41	110	19.13
656.	Nozune (nostar)	574	126.46	178.53	353	61.50
657.	Sian Caleb (promechanics)	573	121.26	151.03	336	58.64
658.	touch grass (midca)	573	92.87	129.47	196	34.21
659.	kaffarell (kaffarell)	573	83.22	117.51	150	26.18
660.	carve (carve)	573	109.30	144.78	269	46.95
661.	lhdk2712 (lhdk2712)	572	87.07	110.19	178	31.12
662.	anas (qanass)	571	40.72	61.25	43	7.53
663.	Fiesty (fiesty_cushion)	570	52.74	73.65	73	12.81
664.	Sander (5andos)	570	82.57	103.60	146	25.61
665.	vinoth0708 (vinoth0708)	570	47.82	77.10	59	10.35
666.	Dr. Sector (sharkychompers)	569	77.71	99.77	139	24.43
667.	Abu (kabu22)	567	86.16	113.28	154	27.16
668.	raptor (raptor234)	567	68.30	92.85	127	22.40
669.	Khoi (khoitran)	565	100.41	128.62	253	44.78
670.	Mohammad Rizwaan (freshkebab)	565	83.21	113.21	155	27.43
671.	Enxyon (enxyon)	565	123.93	150.60	361	63.89
672.	Sourav (yashsaha555)	565	74.37	101.39	141	24.96
673.	Pouya (pouyal)	564	57.51	77.34	79	14.01
674.	Andrew (monochromeocean)	564	94.09	122.02	195	34.57
675.	Marc (marcmalha)	564	83.90	102.94	167	29.61
676.	utsab (utsab987)	563	62.47	82.16	104	18.47
677.	Daniel (tempguan)	563	75.23	97.60	143	25.40
678.	cruise control (terminator_...	562	113.55	148.85	275	48.93
679.	Hyunsu (onlyu0923)	562	88.02	115.31	161	28.65
680.	ChmpionL (lu_fattori)	560	60.33	75.24	5	0.89
681.	zapelots (zapelots)	559	78.22	105.52	157	28.09
682.	player (writer35)	558	74.64	119.79	139	24.91
683.	Harshal (bitbeast18)	558	76.01	106.44	132	23.66
684.	Naved (naved_razi)	558	39.92	62.68	46	8.24
685.	the one (qaisianas)	557	32.98	48.81	37	6.64
686.	Mandip (memandip)	556	59.19	81.13	120	21.58
687.	Kathryn (kathryns)	555	72.96	94.60	119	21.44
688.	Hamza (hamzaalali)	555	70.16	97.05	110	19.82
689.	duong (anhhungcolao)	554	81.19	101.07	145	26.17
690.	Satwik (satwik2708)	554	96.71	127.96	214	38.63
691.	ChangeS (changes99)	554	82.05	115.97	154	27.80
692.	ThisIsHowWeRoll!! (another_...	553	111.12	134.44	279	50.45
693.	Train (trainm8)	552	78.16	108.31	138	25.00
694.	Shypolarbear (shypolarbear)	552	90.15	131.15	178	32.25
695.	Miguel (quevangel)	550	114.40	158.59	301	54.73
696.	Arararararararararagi (manaso)	550	81.45	110.97	134	24.36
697.	Pongpan (pongpan)	549	55.64	69.71	77	14.03
698.	Harmonygrams (harmonygrams)	548	66.08	91.03	128	23.36
699.	huu duy (huu_duy99)	548	82.30	107.22	145	26.46
700.	mike (captaincapitalism)	548	93.43	121.42	202	36.86
701.	pavan (pavan_)	547	43.42	63.01	46	8.41
702.	Jean (orangedrum)	547	90.86	119.89	178	32.54
703.	Jagadeshrao (jagadeshrao)	546	56.12	80.01	83	15.20
704.	Wusien (wusien)	546	88.65	120.61	172	31.50
705.	doquan (doquannnn)	543	92.17	134.59	210	38.67
706.	JD (ruminant_robot)	542	82.08	102.72	144	26.57
707.	Joshua (paper_astronaut)	542	95.55	119.46	170	31.37
708.	Ramseus (master_r)	542	92.58	113.93	180	33.21
709.	Tushar (tushar23651)	541	78.29	102.15	140	25.88
710.	DustySheep (smowbog)	540	86.66	120.04	150	27.78
711.	Jacob (jmbreche)	540	89.10	121.49	198	36.67
712.	⁹⁻¹⁰ᵍᵐ (green910)	539	96.39	121.75	215	39.89
713.	JimBob (jasperjimbob)	538	105.97	142.13	272	50.56
714.	Miras (mirabil)	538	48.54	66.52	47	8.74
715.	Eufalasio (eufalasio_11)	538	67.34	90.04	121	22.49
716.	Ananta (anantaraha)	538	66.58	86.50	124	23.05
717.	Chiradeep (chiradeep)	538	68.34	107.43	132	24.54
718.	fakaped (fakaped)	537	72.56	97.01	149	27.75
719.	Aviral (aviral_uchiha)	537	106.46	133.74	198	36.87
720.	Away From Keyboard (AFK) (d...	536	90.70	111.32	209	38.99
721.	akirasendoh07 (akirasendoh07)	536	72.26	103.37	141	26.31
722.	Adzenys XR-ODT (iromuanya)	536	107.47	144.95	252	47.01
723.	Nistiarius (nistiarius)	536	85.21	122.20	134	25.00
724.	Alexander (dencyh)	535	70.44	96.29	140	26.17
725.	jack (jackerdd)	534	89.17	113.78	166	31.09
726.	Howdy (abinder)	532	115.90	160.24	318	59.77
727.	michael (banane_1)	529	118.21	161.69	285	53.88
728.	yassin mohamed (yassin123)	528	69.57	90.63	122	23.11
729.	Tanawat (rxrmzriw)	528	38.64	61.04	49	9.28
730.	Eduardo (elbodrogo1977)	527	56.85	75.80	75	14.23
731.	dhikshith (dhikshith)	527	86.14	109.90	131	24.86
732.	Bobby (bton)	526	88.83	121.07	192	36.50
733.	Luke (lukell)	526	96.41	131.99	181	34.41
734.	Luke (lukeg1209)	525	55.95	73.45	73	13.90
735.	Prithvi (prithvi18)	525	48.25	69.84	104	19.81
736.	Piyush (lanslord11)	524	72.48	93.05	132	25.19
737.	parth (parthvaghela)	523	78.64	107.65	155	29.64
738.	daniel (danieledward13)	522	89.50	131.62	165	31.61
739.	Erik (vofflan)	521	71.67	89.07	119	22.84
740.	Arvin (vin_ar)	520	87.72	113.94	190	36.54
741.	Mohit (mohit2208)	520	86.95	115.51	162	31.15
742.	brahmastra (brahmastra)	520	57.86	73.44	83	15.96
743.	N (natejam)	519	120.26	182.62	347	66.86
744.	Alan (erical77)	518	75.47	100.47	125	24.13
745.	BigChungus (vynzvynz)	517	100.17	142.68	223	43.13
746.	Lucas (supermug)	517	100.02	138.14	208	40.23
747.	Mohammad (abdel3leam)	517	68.92	95.57	103	19.92
748.	Jacque (jrobyabich)	517	64.70	87.53	107	20.70
749.	satwik (satwik_060)	517	89.21	127.11	175	33.85
750.	AJ (jaded_aj)	516	81.82	117.90	161	31.20
751.	f1_racer (f1_racer_car)	516	92.40	112.77	223	43.22
752.	EatingFromTrashcan (namtrac...	515	102.75	137.40	202	39.22
753.	julsdgreat (julsdgreat)	515	68.50	92.99	127	24.66
754.	Juri (jurida)	514	73.86	106.69	110	21.40
755.	luz (luzyb92109)	513	48.41	76.32	62	12.09
756.	Liz (liasokol)	513	132.68	189.86	328	63.94
757.	penrose (penrosecat)	513	84.85	117.05	169	32.94
758.	boniu (wincentbugs)	512	84.49	122.79	151	29.49
759.	Nick (nicoboo)	511	61.26	76.56	91	17.81
760.	laPampara (lapampara69)	511	94.20	125.71	164	32.09
761.	Lance (lancelot_29)	510	89.27	128.66	139	27.25
762.	yeeth (yeeth_)	510	94.86	126.17	169	33.14
763.	Symoun (sim1ong)	510	62.05	79.45	104	20.39
764.	vatsu (nify)	508	65.08	104.74	104	20.47
765.	AcidSid009 (acidsid)	507	74.80	114.33	144	28.40
766.	tristen (unitristen)	505	87.10	103.87	163	32.28
767.	smoky_ (sahuvipul)	504	60.98	93.75	143	28.37
768.	🫐🌺Ruby (reuben_yeager)	504	91.62	121.78	158	31.35
769.	Brian (vance071)	503	70.10	96.56	118	23.46
770.	xoceankingx (xoceankingx)	502	98.68	132.58	221	44.02
771.	Benjamin (fatjammin)	502	98.35	131.87	187	37.25
772.	Nishchit (mr0bn0xi0us)	502	74.71	96.85	125	24.90
773.	Maneeb (maneebdin)	501	64.04	92.30	111	22.16
774.	Sebastian (grommonon)	501	82.31	110.37	143	28.54
775.	amoz r (amoz11)	501	109.53	145.57	227	45.31
776.	Kishan (69_420_ez)	500	43.32	69.47	92	18.40
777.	the ë (inconsistency)	500	189.99	233.65	448	89.60
778.	humisar (humisar)	500	50.65	83.11	55	11.00
779.	hereugo (hereugo)	500	91.46	125.27	177	35.40
780.	M8l8th (glitchsolo)	499	107.99	149.00	225	45.09
781.	Tri Dung (phantridung123)	499	85.56	119.36	124	24.85
782.	adderal junkie (dari0)	499	71.89	108.06	137	27.45
783.	Balmorax (balmorax)	499	75.62	101.56	141	28.26
784.	nana (goomi)	498	86.55	118.31	143	28.71
785.	aswanathck.ramesh (aswanath...	498	46.39	62.65	46	9.24
786.	Sim (simron_)	497	66.36	91.69	118	23.74
787.	mmmagalex (nonquit4ever)	497	122.87	175.93	267	53.72
788.	Jorawar (dumb_daas)	496	68.13	100.49	130	26.21
789.	Razor Red Rage (ayyaz_nemesis)	496	96.44	137.75	164	33.06
790.	ayush (rocky1708)	495	87.18	116.52	158	31.92
791.	Carter (thecartel)	495	100.86	131.59	201	40.61
792.	Shroomer (zergkiller)	494	106.84	136.90	234	47.37
793.	kentlim (lsk133)	494	64.00	83.45	109	22.06
794.	Tea (naoto7010)	494	65.84	80.97	109	22.06
795.	Jose Ortiz (jortiz1496)	492	73.34	102.32	117	23.78
796.	Ҝ丨𝓝Ｇ𝕆 (hasnatahmad)	492	113.16	155.20	282	57.32
797.	Maria (marlab)	492	68.26	84.60	123	25.00
798.	anjumaaa (zenda254)	491	86.43	124.80	150	30.55
799.	kkobuk (kkobukchipp)	490	83.09	107.87	154	31.43
800.	Cakers (pvpcakers)	489	84.04	111.14	163	33.33
801.	CARDEER (cardeer)	489	107.64	136.82	229	46.83
802.	Mr. (dyldodyldo)	488	93.77	119.70	168	34.43
803.	Sssaajj (sanjisan)	488	79.77	111.07	138	28.28
804.	Évi (pinglei)	488	121.33	151.15	308	63.11
805.	Jimmy (zen529)	488	105.44	138.04	408	83.61
806.	Kevin (vektronic)	488	89.27	124.15	152	31.15
807.	Fahad (skyclasher_24)	487	76.63	101.47	142	29.16
808.	tstats[jancs] (jancs)	487	92.67	124.22	185	37.99
809.	RHell (kasiarhell)	486	58.27	79.25	73	15.02
810.	Duc (trungducdeptrai)	486	106.52	133.66	244	50.21
811.	Acer (core_viper)	486	45.35	63.50	49	10.08
812.	Priyanshu (neo_trinity)	486	77.10	111.23	142	29.22
813.	sakhaprox (rportnoy)	485	104.72	151.12	167	34.43
814.	Gilbert (gargoyletabbi)	485	62.28	83.90	99	20.41
815.	lelgetrekt (lelgetrekt)	484	98.15	127.27	181	37.40
816.	Jahed (jahed100)	484	101.44	122.47	264	54.55
817.	ケニー (schnitzelbr0t)	484	81.12	103.48	122	25.21
818.	Identitylessness (power_punch)	484	135.67	209.17	456	94.21
819.	Patrick (monkyoo)	484	68.04	90.91	108	22.31
820.	Sebstian (sedasti)	484	73.20	96.76	121	25.00
821.	Lawrence (wattfox)	483	108.20	132.28	199	41.20
822.	Pro (pro_01)	483	35.40	49.90	41	8.49
823.	nothisisleo (leofire)	483	84.16	108.02	143	29.61
824.	Naufal (naufalmahing)	482	72.63	103.64	97	20.12
825.	Mato (matoxz)	482	85.76	118.25	156	32.37
826.	Jayson (jayson22)	481	58.16	80.73	122	25.36
827.	Carter (therealwhiterice)	481	96.24	149.81	183	38.05
828.	Theo (theodoretliu)	480	122.11	158.69	257	53.54
829.	fruit (special_vegetable)	480	111.18	145.79	214	44.58
830.	いつき (huywee)	480	89.20	142.06	134	27.92
831.	Yani (theghak)	479	58.32	84.49	86	17.95
832.	Nima (eramthgin)	478	98.21	133.44	168	35.15
833.	Loc (loc_phan)	477	65.20	96.73	97	20.34
834.	_(=.=)_ (residober)	477	163.40	213.85	260	54.51
835.	I'm slower than before :sku...	477	133.64	169.88	357	74.84
836.	Roadsweeper Dropping D; (ka...	476	138.53	183.12	344	72.27
837.	garry (ganesh1998)	476	75.66	95.27	134	28.15
838.	Please use an appropriate n...	476	79.68	127.43	99	20.80
839.	Vishal Mishra (firethunder2)	476	41.83	71.50	45	9.45
840.	Aryaman (aryaman_verma)	476	46.52	62.82	37	7.77
841.	Ankur (ankur94516)	476	55.32	75.25	70	14.71
842.	KOSTOV (kostov)	475	59.75	87.63	87	18.32
843.	los (typossarevalid)	475	61.25	90.33	229	48.21
844.	csgo (professorxwing)	475	140.33	186.56	331	69.68
845.	Horny (bigben223)	474	88.96	115.14	154	32.49
846.	Arun (arunro45)	473	58.13	81.44	88	18.60
847.	Arnold (victorvolts_123)	473	76.05	110.59	116	24.52
848.	manthan (sixtynine_wpm)	473	52.16	77.53	252	53.28
849.	Fierce (littlekitten7)	473	106.84	136.02	269	56.87
850.	🎈bm (redly)	473	108.90	136.39	223	47.15
851.	Sachin Sharma (ragemodeon)	473	143.57	198.77	363	76.74
852.	Rakesh (rakesh69)	472	55.40	92.05	87	18.43
853.	kalmanfilter (eran_raviv)	472	69.37	91.88	89	18.86
854.	(carlibou)	471	168.11	215.48	416	88.32
855.	enigma_mf (enigma_mf)	470	108.29	147.65	231	49.15
856.	Nick (poppyc_ck)	470	65.26	86.00	101	21.49
857.	prateek (prateekdhiman)	470	54.89	72.44	55	11.70
858.	Samuel (sammassam)	469	53.04	67.55	49	10.45
859.	Jehar (rakhunb)	469	83.93	109.73	146	31.13
860.	Liban (hujala)	469	151.52	200.60	337	71.86
861.	I play tetris too (hkgwife)	469	126.36	163.71	289	61.62
862.	you deserve to exist (charmx)	468	111.96	166.24	3	0.64
863.	Armin (armino112)	467	48.69	62.75	40	8.57
864.	Thanos (thanossonofalars)	467	68.99	99.61	105	22.48
865.	Amit (amiteshore)	466	99.43	124.76	173	37.12
866.	Fakieshot (fakieshot)	465	51.74	69.91	54	11.61
867.	jek (jekkey)	465	71.67	98.76	95	20.43
868.	Dan (danvictor321)	464	93.71	118.95	163	35.13
869.	Tyler (tythal)	464	97.25	130.85	188	40.52
870.	Sapto (saptopriyono)	462	86.53	113.79	155	33.55
871.	drago (drag00me)	461	74.42	92.57	117	25.38
872.	CoveredInBees (coveredinbees)	461	81.93	123.19	137	29.72
873.	mike (purdah1234)	461	48.40	62.78	41	8.89
874.	Julian (robthephysician)	460	73.27	99.01	108	23.48
875.	Mr.IF (mr_if)	460	74.32	98.33	122	26.52
876.	Petruccio (lolbraumm)	460	89.76	120.39	178	38.70
877.	Davis (bengalman447)	460	115.06	140.51	218	47.39
878.	Enormity (enormity_op)	459	77.13	94.31	127	27.67
879.	furci (furci)	459	71.71	97.87	105	22.88
880.	Abhay (ab_hay)	458	48.78	84.09	56	12.23
881.	Giuseppe (shmebulock2)	457	84.97	123.86	171	37.42
882.	Stevne (juninight29)	457	77.01	94.28	80	17.51
883.	gojo (gojo9112)	457	71.52	90.00	111	24.29
884.	Claudia (aaaaccdillruyz)	456	63.46	79.59	100	21.93
885.	. (chocolatina)	456	135.90	190.73	297	65.13
886.	zero2 (deadz)	455	33.32	47.92	40	8.79
887.	Aisha (aishanick)	455	60.73	88.76	68	14.95
888.	NextGoal Avg. 115WPM (redjhon)	455	87.33	123.02	162	35.60
889.	Mikhail (mayham92)	454	77.14	99.85	117	25.77
890.	eric (ericliu04)	454	107.12	133.41	25	5.51
891.	Lin (lin_ming)	454	100.70	128.79	190	41.85
892.	Bakhtiyar (bakhtiyar17)	453	58.26	72.73	75	16.56
893.	satya (satya1110)	453	64.15	88.47	104	22.96
894.	Ω (tunfisk)	453	124.36	169.71	250	55.19
895.	Smelly (burdturglar)	452	81.09	98.74	127	28.10
896.	jia kang (awjack)	452	54.28	71.06	60	13.27
897.	Hossain (hossain95)	452	43.69	62.06	42	9.29
898.	Diepday (linhleo372)	451	77.85	105.99	130	28.82
899.	Jonatan (gustesmil)	451	104.95	148.46	198	43.90
900.	kunal (kunav)	450	77.59	106.05	123	27.33
901.	Jeannie (jeanniejackson)	450	63.05	86.56	102	22.67
902.	James (icecrusher)	450	88.66	125.10	144	32.00
903.	road to 170WPM (royaljaat)	450	104.43	145.45	285	63.33
904.	bowlingfan21317 (bowlingfan...	449	91.85	120.33	179	39.87
905.	Domen (antreu)	449	99.40	139.81	246	54.79
906.	abdullah (abdullah3325569)	449	47.65	68.71	50	11.14
907.	Andrew (xj04129)	449	91.04	112.85	155	34.52
908.	mlhhsid (mlhhsid)	448	101.52	120.29	178	39.73
909.	Marlon (mgr47)	448	66.17	88.02	105	23.44
910.	Brian (brainclash)	448	69.81	104.54	108	24.11
911.	rrono (3an_3an)	447	67.85	97.43	149	33.33
912.	Simiwag (simiwag)	447	94.52	134.21	156	34.90
913.	Luigi (jorge_da_borracha)	447	101.80	152.34	218	48.77
914.	Jay (kov_)	446	71.60	109.40	102	22.87
915.	Charles (n6w2)	446	48.15	64.46	31	6.95
916.	wilmanbarrios (wilmanbarrios)	446	67.31	90.42	88	19.73
917.	taj (taj256)	445	84.46	111.75	106	23.82
918.	Serjs (sedoy)	445	18.10	28.68	92	20.67
919.	Radamasz (madarasz)	445	82.51	104.80	116	26.07
920.	Jacob (jacob_dev)	445	51.09	66.44	36	8.09
921.	Dragon99999 (dragon99999)	444	86.35	118.84	139	31.31
922.	HasadBoii (hasadboii)	443	58.75	79.65	228	51.47
923.	something (kaibaboi)	442	131.14	171.34	47	10.63
924.	MAF1F (afif5287)	442	54.69	70.66	61	13.80
925.	Vinny (bullz3y3)	442	53.14	69.73	55	12.44
926.	FixioMG (fixio)	441	68.26	87.61	103	23.36
927.	jataro's dolphin (i_believe...	441	67.30	104.12	110	24.94
928.	Slatt. (nonquitpracticing)	441	129.96	181.44	276	62.59
929.	Nanar (nanarboursal)	441	64.45	93.36	91	20.63
930.	Moy (moy280)	441	102.84	134.96	159	36.05
931.	nyet (slickman)	441	79.18	102.59	109	24.72
932.	komi (rahul_kumayan)	440	64.53	95.31	111	25.23
933.	Unique (netb)	439	73.33	108.57	102	23.23
934.	Theo (mewtish)	439	81.49	108.53	115	26.20
935.	MINH (shinmyou)	439	105.52	137.03	189	43.05
936.	thanos (thanosmpath)	438	109.78	134.83	205	46.80
937.	(c_xor)	438	131.90	179.93	293	66.89
938.	Chaitanya (chaitanya608)	438	69.87	88.03	97	22.15
939.	Sun (headedead)	438	96.86	124.04	170	38.81
940.	Magishian (magishian)	437	61.57	103.97	117	26.77
941.	Free (just_free2318)	437	63.68	89.68	93	21.28
942.	Jesse (sarrod)	437	94.65	128.76	152	34.78
943.	Amelia (piclo7)	437	86.08	117.08	145	33.18
944.	mooshi (mooshidv)	437	58.47	78.18	61	13.96
945.	Lasi (lasileuka)	436	87.57	110.10	141	32.34
946.	Tovic (todave)	436	48.28	63.56	39	8.94
947.	Piotr (snooppiotr)	436	81.71	104.07	93	21.33
948.	andy (ajggormly)	435	79.62	105.99	112	25.75
949.	Rockodile (rockodile)	435	110.11	137.95	198	45.52
950.	🌄youtube.com/watch?v=Sa5...	435	158.71	203.40	372	85.52
951.	Chris (chris_p)	434	68.80	86.81	113	26.04
952.	batbaven (baislow)	434	47.99	62.51	42	9.68
953.	vbk (vbk_)	433	45.78	65.26	44	10.16
954.	Igor (skeef79)	433	103.88	130.35	210	48.50
955.	Johny (johnyt)	433	60.15	88.77	81	18.71
956.	Person (improbhighnotgonnalie)	433	103.08	137.22	187	43.19
957.	guy (grayeyes)	433	143.11	179.37	319	73.67
958.	vamshidhar (vamshidhar18)	432	59.30	84.00	87	20.14
959.	Radriar (slowtype_e)	432	57.84	78.83	62	14.35
960.	Anshuman (anshu_8)	431	58.72	79.48	78	18.10
961.	Pyren (pyren83)	430	89.29	113.01	136	31.63
962.	(dispidi)	430	130.75	179.62	287	66.74
963.	soldano (soldano)	430	106.92	139.05	205	47.67
964.	Toxic (toxicbaby3000)	429	70.76	101.95	103	24.01
965.	Mahmoud (sayed1)	429	85.31	106.58	106	24.71
966.	Kianoosh (kia_wp)	429	82.51	107.36	121	28.21
967.	Harry (harry_k)	429	80.77	118.63	110	25.64
968.	hunzai (alihunzai)	429	97.20	135.81	156	36.36
969.	why (believeable)	429	106.84	178.19	203	47.32
970.	gaitonde (gaitonde)	428	65.79	88.42	93	21.73
971.	andrei5 (mute_6)	428	78.15	107.63	110	25.70
972.	reuben (reuben_elias)	427	53.50	75.62	48	11.24
973.	discord# unsalek (mustafa_r...	427	86.18	112.91	123	28.81
974.	Ben (foereaper4k)	427	78.76	108.34	89	20.84
975.	GodSped (falsender)	426	79.07	115.22	108	25.35
976.	Ivan (blindingangel)	426	109.16	141.70	238	55.87
977.	Prydae (prydae_1)	426	79.54	125.78	109	25.59
978.	mr (buabaiban)	426	39.30	52.21	33	7.75
979.	Mark (ziggle)	425	61.27	85.42	78	18.35
980.	WhatTheHotDog (tdsar102094)	425	90.67	122.65	145	34.12
981.	Jake (laketype)	425	62.73	84.26	73	17.18
982.	how to type (iwanna_typefast)	424	122.33	164.47	214	50.47
983.	Cep (alhabiblidinillah)	424	81.71	100.26	99	23.35
984.	Pablo (p1blis81)	424	77.99	113.98	97	22.88
985.	Nobu (nobunakamura)	423	83.54	112.28	142	33.57
986.	JM (tuftycrayfish)	423	73.59	94.14	103	24.35
987.	himanshu (himanshu3198)	423	50.95	71.44	51	12.06
988.	Alan (alan2406)	422	66.06	92.54	84	19.91
989.	Poo (pooopooo)	422	93.68	124.00	113	26.78
990.	Dulguun (dulguun_)	422	82.25	117.37	120	28.44
991.	weird_virus (imsajan)	422	64.00	89.54	86	20.38
992.	Jay kay (imnoob167)	422	39.27	56.91	26	6.16
993.	Senpai Z (zlashers)	422	72.53	94.19	100	23.70
994.	MaxVerstappen33 (newrookie15)	421	75.40	116.69	123	29.22
995.	Karrrrtik (kartikkkk)	421	54.26	79.03	112	26.60
996.	Sonu (intellectualcreatures)	421	89.56	119.21	157	37.29
997.	Ayush (improve_buddy)	421	55.51	76.44	84	19.95
998.	Ibexus (ibexus)	421	164.27	208.60	388	92.16
999.	Ladybug (lady_bug_)	420	56.34	73.43	64	15.24
1000.	J (yunatan)	420	80.45	106.63	141	33.57
1001.	Ben (thebenman7dv)	420	59.36	82.27	52	12.38
1002.	Shashi (shashianand230)	420	45.54	61.30	51	12.14
1003.	Fang (fangalpha)	420	80.15	113.36	112	26.67
1004.	Mohammad (mr_loooop)	420	82.96	109.89	106	25.24
1005.	Optimus (optimusprime98)	419	72.97	90.55	104	24.82
1006.	khalil (khalilfa)	419	72.55	99.04	99	23.63
1007.	Ahmad (vectors_master)	418	66.50	95.59	83	19.86
1008.	SPQR (tringuyen29)	418	79.21	108.89	99	23.68
1009.	Crew (crewmate_sus)	418	117.22	159.37	224	53.59
1010.	Guest (ksaheb)	417	30.90	44.11	36	8.63
1011.	Sumeru_ (kenteezyx)	417	93.48	126.43	159	38.13
1012.	_____ (husixu1)	417	106.91	134.04	177	42.45
1013.	artist (apg21092002)	417	62.26	85.03	75	17.99
1014.	Maria (ladymariag)	417	86.47	109.08	126	30.22
1015.	Mark (pap1)	416	65.19	88.03	103	24.76
1016.	Shriram (shrirammc55)	416	93.37	117.02	146	35.10
1017.	Jerry_007 (jerry_007)	415	30.54	42.91	27	6.51
1018.	Sian-Yang (rgnerdplayer)	415	115.13	145.78	229	55.18
1019.	R (tumta)	414	68.71	96.67	97	23.43
1020.	Dale (livestrong12)	414	114.66	145.30	221	53.38
1021.	batbold (bb__)	412	107.80	154.85	193	46.84
1022.	Mandem (madem)	411	71.04	120.82	115	27.98
1023.	🅹🅰🆅🅴 (killer8hy...	411	105.94	143.49	183	44.53
1024.	Zeep (zeeppt)	411	82.85	100.87	95	23.11
1025.	Jiong Yang (yangfoo)	410	95.30	124.14	179	43.66
1026.	Nick (cvs_nick)	410	70.04	100.42	96	23.41
1027.	Weebmachine (weebmachine)	409	79.08	99.41	91	22.25
1028.	पलविंदर स�...	409	112.24	140.54	230	56.23
1029.	(๑•﹏•)⋆* ⁑⋆* ...	408	81.12	107.74	110	26.96
1030.	Razor (mr6pack)	408	63.88	83.35	70	17.16
1031.	aman (amanrai2802)	408	62.02	87.08	107	26.23
1032.	Alekva (alekva)	407	73.62	98.37	104	25.55
1033.	Stop (stop__)	407	47.84	63.38	37	9.09
1034.	xd (palmate)	407	77.49	108.63	110	27.03
1035.	sun (ny_dkxh)	407	72.01	98.09	124	30.47
1036.	uwu (mr_mint)	407	81.26	113.39	124	30.47
1037.	me_astr (me_astr)	407	59.18	78.75	79	19.41
1038.	Ngoune (tyrex1)	407	74.04	100.87	97	23.83
1039.	Soirstylo (soirstylo)	407	80.19	101.00	134	32.92
1040.	Vivek (vivektarun1234)	406	29.35	44.08	49	12.07
1041.	Onu Kajita (torek87)	406	109.76	145.81	287	70.69
1042.	sskhynix (sskhynix)	404	104.61	136.54	199	49.26
1043.	sayed (sayedeesam)	404	44.72	58.89	42	10.40
1044.	parham (parhamparsa)	404	43.12	66.08	46	11.39
1045.	Murad (memento_mori_s)	404	53.95	75.11	51	12.62
1046.	Anas (anasghawanmeh)	404	33.38	44.10	21	5.20
1047.	Adil (adisan_lc)	404	60.08	84.64	74	18.32
1048.	Abhay Shukla (abhayshukla)	404	27.42	41.46	69	17.08
1049.	Dilan (carnage2)	403	83.91	132.76	127	31.51
1050.	♥ W bren W abtech W zak L...	403	148.18	222.61	5	1.24
1051.	Yohannes (wintersolider)	403	62.01	90.83	91	22.58
1052.	Vaj (taychee)	403	75.40	105.23	105	26.05
1053.	Brian (taters613)	403	97.05	121.81	145	35.98
1054.	Ayong (larrylarogapro)	403	103.03	139.09	179	44.42
1055.	jeremy_bearimy (jeremy_bear...	403	92.36	114.17	147	36.48
1056.	Jordan (js_jordan)	402	71.60	107.02	87	21.64
1057.	Munir (munirgkm)	402	88.46	116.12	135	33.58
1058.	Amendity (amendity)	402	80.87	103.31	104	25.87
1059.	Adrem (akratic_adrem)	402	84.30	119.87	113	28.11
1060.	Go (gomar3n)	402	66.94	88.79	89	22.14
1061.	D (javieday)	402	40.27	61.33	33	8.21
1062.	pouya (pooyamz)	401	61.37	89.60	79	19.70
1063.	Pavan (pavantyperacer)	401	79.15	104.92	110	27.43
1064.	Hanny (monson312)	401	84.64	111.60	128	31.92
1065.	Guest (catg0ty0urlung)	401	111.00	137.13	219	54.61
1066.	damList (damanthm)	400	85.28	114.45	119	29.75
1067.	Allan (allandallon)	400	101.55	131.59	176	44.00
1068.	Adam (adam2002)	400	88.50	112.54	104	26.00
1069.	Yuji (yujixyuji)	400	72.50	95.07	109	27.25
1070.	Shuyu (stevenqi)	400	94.02	129.09	149	37.25
1071.	Dylan (dr_gammaray)	399	139.68	173.28	282	70.68
1072.	Sami Wilf (samiwilf)	399	106.42	139.17	180	45.11
1073.	Eetu (mandarilleri)	399	84.39	116.75	96	24.06
1074.	Irfan (irfan_is_the_best)	399	62.99	78.00	85	21.30
1075.	Cxlt (fujimaaa)	398	85.41	117.00	133	33.42
1076.	a (oimanquan)	398	104.68	139.10	194	48.74
1077.	Nivan (nivanr06)	398	86.47	117.26	95	23.87
1078.	KnightWithSword (mishras839...	398	63.17	89.46	68	17.09
1079.	John (xxcooldudexx)	398	107.26	144.22	179	44.97
1080.	Pedro (pedro5370)	397	91.92	124.80	132	33.25
1081.	Kotaro (kotaro_qwerty)	397	84.73	108.81	114	28.72
1082.	ILOVEPALESTINE (iamslow103)	396	145.03	217.38	367	92.68
1083.	Ocean (oceanlim)	396	109.58	165.26	190	47.98
1084.	MavrosOplarxigos (oplarxigos)	395	74.79	91.21	137	34.68
1085.	john (typeman_1234)	395	66.74	93.52	89	22.53
1086.	Rakib (rakib0hasan)	394	38.27	49.24	23	5.84
1087.	Luke (outlandish)	394	93.95	115.22	138	35.03
1088.	Louie (lewieee)	394	114.23	147.34	228	57.87
1089.	Godrod (god_of_rods)	394	87.57	111.22	111	28.17
1090.	Cheechu (cheechu)	394	85.49	114.06	113	28.68
1091.	MasterZero (mastrzero)	394	35.67	54.41	26	6.60
1092.	Ryzen (ryzen___)	394	38.16	49.71	20	5.08
1093.	Will (greggaz)	393	94.69	132.09	144	36.64
1094.	Kipper (ziuncati)	393	58.87	78.11	68	17.30
1095.	Dio (slado122)	392	85.80	108.63	130	33.16
1096.	Lewis (lewisisabo)	392	72.77	98.70	89	22.70
1097.	Hasan (hassanese)	392	56.29	80.33	51	13.01
1098.	Ai (aibah)	392	74.98	107.26	108	27.55
1099.	Nick (neepwithin)	392	88.28	108.08	150	38.27
1100.	Glen (alabaster45)	391	46.16	60.31	34	8.70
1101.	Zovi (zovi)	391	89.19	118.74	114	29.16
1102.	Re4per (light_exe)	390	56.83	77.25	62	15.90
1103.	H!P! (harsh_patel)	390	55.66	75.09	54	13.85
1104.	me slow (brandon69eduardo)	390	104.61	131.78	178	45.64
1105.	baby (babyshadow)	390	62.30	85.03	91	23.33
1106.	Amaury (raymaunet)	389	52.08	66.21	30	7.71
1107.	Ian (iyaan)	388	68.45	89.20	101	26.03
1108.	jim (pstengyawa)	388	87.20	120.04	133	34.28
1109.	Mooshi (mooshiboy_dvorak)	388	89.61	118.19	104	26.80
1110.	Rage (ragelad)	387	62.18	101.17	73	18.86
1111.	1_Death (1_death)	387	48.05	65.71	45	11.63
1112.	BonTear (b0ntear)	387	68.69	94.17	88	22.74
1113.	seven (seven_mark)	387	78.60	98.33	94	24.29
1114.	Ahead of you (wadehuangjr)	386	95.19	120.04	145	37.56
1115.	Andy (djentalman)	386	90.92	124.90	129	33.42
1116.	Matteo (atteo1000)	386	63.16	101.09	79	20.47
1117.	Tom (polaricecaps)	386	69.28	98.69	103	26.68
1118.	Noah (lorenpike)	386	70.20	93.60	75	19.43
1119.	Himanshu (himsingh11)	385	41.18	65.23	33	8.57
1120.	sara (sara1994)	385	40.25	51.56	27	7.01
1121.	eagle (e4gle)	384	66.33	84.30	98	25.52
1122.	(welltwell)	384	133.70	177.19	279	72.66
1123.	Jemma (jmmstvnsn)	384	84.07	106.19	93	24.22
1124.	chris (fscj4raxhel)	383	70.83	93.52	77	20.10
1125.	ccct (fastleopard)	383	49.80	67.92	45	11.75
1126.	Betting (buffhorse_)	383	67.27	90.37	73	19.06
1127.	Lei Paul (polley)	382	92.60	119.63	131	34.29
1128.	meiol (olete)	382	59.78	72.14	67	17.54
1129.	quack (shinonin)	382	145.05	166.00	287	75.13
1130.	Ben (caaakeeey)	381	77.28	101.82	103	27.03
1131.	Mukeem (bilawat)	380	90.22	119.14	155	40.79
1132.	iChoke@TheEnd (vidivinci)	380	75.64	101.99	102	26.84
1133.	Funeral Party (scudvirus2018)	380	65.81	83.94	76	20.00
1134.	. (apeninspaaace)	380	95.34	123.10	147	38.68
1135.	an4rchy1925 (an4rchy1925)	380	90.57	130.90	137	36.05
1136.	robbie (robbiemcfly)	380	90.16	120.28	132	34.74
1137.	Mikaela (mikaela_e)	380	77.74	105.39	99	26.05
1138.	Alex (tabkc7)	379	81.09	102.66	87	22.96
1139.	Aashish (albatross007)	379	64.34	87.17	83	21.90
1140.	Afterlife (afterlife71)	378	40.47	52.78	31	8.20
1141.	Nick (nidzoni)	378	103.77	131.82	178	47.09
1142.	George (linnypurple)	378	86.31	108.75	112	29.63
1143.	PMA (huy2272)	378	82.36	110.46	118	31.22
1144.	OmicronVirus (deathisnthend)	378	75.83	96.49	92	24.34
1145.	(daniel598)	378	155.48	205.79	308	81.48
1146.	DemonKing (zxzf)	378	53.43	69.03	53	14.02
1147.	Gabriel (wdarknessw)	378	80.62	103.25	103	27.25
1148.	Heet (heetpatel219)	377	58.42	74.57	78	20.69
1149.	raz🐢 (razman)	377	110.44	145.03	173	45.89
1150.	Raffa (raffadanendraa)	377	62.67	86.98	76	20.16
1151.	Peter (portiz121803)	377	80.26	114.51	77	20.42
1152.	prashik0 (prashik0)	376	76.08	113.73	106	28.19
1153.	Kimmo (kimorasa)	376	82.82	105.76	92	24.47
1154.	kaitlyn (katieostrander)	376	83.20	111.33	82	21.81
1155.	Gaurav (absurd_man)	376	70.44	93.32	96	25.53
1156.	Derek (thenyaz)	376	96.46	119.13	144	38.30
1157.	Human (supertypergrey)	376	60.62	88.02	59	15.69
1158.	han (stuckinatimezone)	376	67.35	93.54	98	26.06
1159.	Nick (wugangabbot)	375	61.97	80.29	81	21.60
1160.	S (suhaib_silwadi)	375	73.52	100.38	104	27.73
1161.	Marko (polarbear1229)	375	100.84	132.74	147	39.20
1162.	phauxy (phauxy)	375	68.32	91.33	103	27.47
1163.	khalid (khalidabououalid)	375	73.11	102.63	109	29.07
1164.	Cuong (c_nguyenthien)	375	95.84	118.83	144	38.40
1165.	Neon (neonman6)	374	46.68	68.65	50	13.37
1166.	Demogorgon (typeracer0110)	373	67.27	98.13	91	24.40
1167.	HotClaw (hotclaw)	373	96.72	121.41	160	42.90
1168.	Arin (arinkothari)	372	67.23	90.90	76	20.43
1169.	Smudge (cuteboi)	372	117.55	161.05	202	54.30
1170.	Zexceed (shorif)	372	92.57	155.25	177	47.58
1171.	Mez69 (mezx69)	371	73.20	96.28	84	22.64
1172.	Neel (jydoenwat)	371	66.17	88.00	76	20.49
1173.	It'sMe (freakinnickp)	371	109.29	141.27	173	46.63
1174.	Dolce (dolceparadise)	370	88.53	125.77	126	34.05
1175.	em (akosiem)	370	92.01	124.46	111	30.00
1176.	SnopeySnope (snopeysnope)	370	63.28	91.58	86	23.24
1177.	Nithin (useless_net)	369	99.80	147.25	163	44.17
1178.	Isaac (newton6674)	369	83.12	101.65	94	25.47
1179.	Chatpisut (uwu_werkmaine)	368	85.97	113.42	113	30.71
1180.	alostman (slowtypist199)	368	134.61	170.94	214	58.15
1181.	delfan (delfaaan)	368	88.91	113.30	118	32.07
1182.	Zephyr (lay_oreo)	368	93.68	131.18	120	32.61
1183.	Mehti (lylehti)	367	84.64	113.21	96	26.16
1184.	NickyPP (weenniecat)	367	82.49	117.47	118	32.15
1185.	Jeremiah (wetsock625)	367	53.26	69.40	39	10.63
1186.	NecroCW (necrocw)	367	81.66	109.46	107	29.16
1187.	Wali (captorcarbon)	367	74.07	102.29	103	28.07
1188.	Lucas (lukasyoi2)	366	71.08	103.01	121	33.06
1189.	Jack (jfragg)	366	77.78	110.28	73	19.95
1190.	david (twistybaer)	366	70.65	94.23	70	19.13
1191.	Scopic (scopic)	366	97.95	117.10	128	34.97
1192.	Puri (narthar)	365	78.26	113.10	104	28.49
1193.	Mahmood Thompson (mat_i)	365	115.94	155.42	209	57.26
1194.	Carlos (lufnys)	365	77.03	121.66	88	24.11
1195.	Jadon (j20lardo06)	365	77.48	98.73	81	22.19
1196.	3NKRYPT (3nkrypt)	365	54.76	77.62	38	10.41
1197.	kuzz (kuzz)	365	74.94	93.41	78	21.37
1198.	Maneesh (silentplayz5672)	365	59.02	75.70	67	18.36
1199.	Not_Stable (not_stable)	364	81.52	123.08	121	33.24
1200.	Mega (mega_mushroom)	364	75.87	99.28	83	22.80
1201.	Nguyễn Trần (dattran03)	363	86.39	110.96	115	31.68
1202.	Curly (curly98)	363	57.37	77.64	58	15.98
1203.	byron (bozzarf)	363	75.94	99.43	104	28.65
1204.	Glennis (biotic_god)	362	84.65	117.43	90	24.86
1205.	Jae (jaeha99)	362	64.01	94.10	84	23.20
1206.	lol (lolspedicey)	362	83.17	121.19	109	30.11
1207.	Gilbernet (gilbertonava7)	362	52.48	66.62	31	8.56
1208.	andrew (washedtyper)	362	93.31	116.39	150	41.44
1209.	Smulca (vicker)	362	61.71	84.40	99	27.35
1210.	v1step (v1ztep)	361	68.32	95.38	54	14.96
1211.	iglo3141 (iglo3141)	361	72.94	98.38	110	30.47
1212.	grace (graceneufeld)	361	78.52	101.20	167	46.26
1213.	Phish (phishphishphish)	361	109.30	136.14	165	45.71
1214.	Mazin (mmazincham)	360	81.50	101.33	73	20.28
1215.	Omer (omer_nukic)	359	59.60	81.13	70	19.50
1216.	himuman (ignis_05)	359	57.11	84.67	78	21.73
1217.	Connor DVORAK (deepwaterbus)	359	83.14	116.59	101	28.13
1218.	Declan (dg05)	358	76.89	103.23	83	23.18
1219.	Rick Astley (beardybeardy)	358	84.81	115.83	88	24.58
1220.	~ (katana4teen)	358	61.06	83.59	84	23.46
1221.	Aaron (heckndarn)	357	73.38	94.06	81	22.69
1222.	Curl2908 (curl2908)	357	49.01	64.90	37	10.36
1223.	Benjin (benjin7)	357	71.68	101.08	71	19.89
1224.	JheMee (ayyjhey)	357	63.23	87.78	68	19.05
1225.	An (ntan1210)	357	88.46	135.77	119	33.33
1226.	16/f/cali (ultrashibe)	357	131.80	171.33	233	65.27
1227.	George (tormanovi)	357	75.32	96.30	83	23.25
1228.	Speed_Reader (nagy_ssbm)	356	84.35	110.01	92	25.84
1229.	l502x (l502x)	356	108.64	136.01	160	44.94
1230.	bhautik (bhautik0126)	356	40.90	60.91	29	8.15
1231.	Alan (alan001)	356	75.18	101.81	82	23.03
1232.	DH (deeh_c)	355	81.03	109.85	107	30.14
1233.	Tom (ax99)	354	51.25	75.45	31	8.76
1234.	Kacsa (kacsa_janos)	354	45.90	67.84	39	11.02
1235.	つべ (tube_jp)	354	58.19	84.85	45	12.71
1236.	Eric (thicc_ricc)	354	112.07	145.63	160	45.20
1237.	i can't be asked (perfectio...	354	107.35	145.13	165	46.61
1238.	abs0lutz3r0c007 (abs0lutz3r...	354	84.58	105.74	83	23.45
1239.	Sumit (sumit_ghag)	353	91.32	130.18	122	34.56
1240.	Adrian (dinfus)	353	109.18	140.43	191	54.11
1241.	addy (epicshibexd)	352	102.79	131.79	154	43.75
1242.	Evan (__evab__)	352	83.74	113.47	88	25.00
1243.	typsterr (typsterr)	352	51.06	70.21	32	9.09
1244.	timtam420 (timtam420)	352	80.67	107.20	86	24.43
1245.	K (strongballs)	352	81.63	125.00	107	30.40
1246.	AngelCaveGTI (angelcavegtio...	352	88.69	121.31	107	30.40
1247.	Alaa Awamleh (alaa_awamleh)	351	68.29	87.28	104	29.63
1248.	Ibrahim (ibrahimtyper)	351	115.12	142.41	173	49.29
1249.	Ryan (ryan2723)	351	75.02	92.49	55	15.67
1250.	Felix (metr_x)	350	49.89	63.73	35	10.00
1251.	Dusan (dusan01)	350	59.47	84.12	65	18.57
1252.	Sudip (donda)	350	70.82	97.84	83	23.71
1253.	Daniel (danielpaanderson)	350	72.92	93.82	66	18.86
1254.	Sadat (based_chungus)	350	77.05	101.30	95	27.14
1255.	Arnaud (armatt)	350	81.92	106.17	104	29.71
1256.	Simon (wizard_sheep)	350	90.68	127.80	116	33.14
1257.	Invnty (invnty)	350	37.80	53.12	21	6.00
1258.	Zakaru (gaudo1991)	350	79.07	99.87	80	22.86
1259.	Marek (lypa)	349	103.78	125.50	167	47.85
1260.	Andrew (holocene_learning_d...	349	46.94	70.28	38	10.89
1261.	Duncan (dkbrk)	349	116.06	138.06	178	51.00
1262.	D (consumption)	349	80.32	104.62	92	26.36
1263.	typerinfection (z4k1n470r)	349	74.75	107.61	76	21.78
1264.	xSora (xsora)	348	114.54	155.76	220	63.22
1265.	Vincent (vincexodus)	348	56.51	76.11	52	14.94
1266.	L (thereddone)	348	76.26	96.47	78	22.41
1267.	Cray (kweikwei)	348	73.47	86.68	89	25.57
1268.	Helena (helenaa_26)	348	46.92	65.21	41	11.78
1269.	Taras (gavair)	348	59.35	75.10	59	16.95
1270.	Marvin (partass)	348	70.78	89.22	85	24.43
1271.	Aarvaan (aarvaan)	348	55.82	76.10	47	13.51
1272.	Sarvjot (sarvjot42)	348	73.85	97.36	86	24.71
1273.	🍉 Palestine Will be Free...	348	110.30	171.84	283	81.32
1274.	Dowon (dowon)	348	155.29	193.47	298	85.63
1275.	ChimChimChim (chimchimchim)	348	124.49	150.62	208	59.77
1276.	ニシャント (neokun)	347	60.38	81.30	66	19.02
1277.	Suren (strongsuren)	347	92.44	127.36	94	27.09
1278.	Mike (kb_acolite99)	347	55.42	79.45	45	12.97
1279.	chunky (wbcracer)	346	117.42	143.58	199	57.51
1280.	ravi (sravi4701)	346	77.08	100.40	78	22.54
1281.	dav (candyslug)	346	115.94	148.21	160	46.24
1282.	Bharat Rai (bratrai11)	346	28.91	38.73	37	10.69
1283.	yoyokeepitup (keepitup)	345	97.10	129.84	131	37.97
1284.	Salmon (pillowend)	345	110.97	151.27	181	52.46
1285.	🇲🇬 Rina (rina23)	344	104.18	154.58	177	51.45
1286.	Văn (pqvan20)	344	66.68	87.03	90	26.16
1287.	m (xxxaliaxxx)	344	87.00	106.02	94	27.33
1288.	Evelyn (evline)	344	70.66	86.98	85	24.71
1289.	Caxix (caxix)	344	63.21	81.84	72	20.93
1290.	Gajen (techgajen)	343	48.36	66.84	40	11.66
1291.	Son (memorrick)	343	80.86	101.31	96	27.99
1292.	Mudu (muduxd)	342	53.00	70.03	38	11.11
1293.	George (zorkkins)	342	64.79	82.91	69	20.18
1294.	Veniax (veniax)	342	57.32	87.76	64	18.71
1295.	Praggapan (silentmachine)	342	71.03	97.40	90	26.32
1296.	vaibhav (vaibhav6996)	341	80.17	101.41	196	57.48
1297.	Momen (momenarafa)	341	63.23	84.52	79	23.17
1298.	Will (freewillie18)	341	77.64	110.09	90	26.39
1299.	ahiraj (ahirajsingh)	341	19.98	32.62	43	12.61
1300.	Preston (prestonsteffenjr)	340	41.55	50.69	15	4.41
1301.	nilansh (pralaya)	340	96.59	121.04	188	55.29
1302.	Neko (pippaola)	340	91.87	126.40	108	31.76
1303.	Robert (nforcer)	340	91.16	117.96	116	34.12
1304.	LogicBS (logicbs)	340	62.16	84.02	72	21.18
1305.	s'gettifingers (spaghetti_f...	340	65.19	82.46	83	24.41
1306.	Jean (seawardsalmon6)	340	93.08	115.38	130	38.24
1307.	Elo (eloh)	340	74.88	94.57	80	23.53
1308.	:)) (brokenslowhand)	340	110.64	143.75	171	50.29
1309.	(dragusprime)	339	117.43	152.77	178	52.51
1310.	Bun (bunnypuc)	339	55.88	79.53	57	16.81
1311.	Iliya (hichkas_01)	339	47.53	69.09	39	11.50
1312.	allan (zhangerbanger)	339	122.82	154.71	198	58.41
1313.	Eric (ericnosarcasm)	338	75.11	99.88	82	24.26
1314.	Damon (damonc89)	338	90.35	115.63	93	27.51
1315.	Biggus (biggboii18)	338	87.51	117.49	94	27.81
1316.	emna (em203)	337	60.60	73.33	60	17.80
1317.	Timothy Tiew (timothytiew123)	337	109.80	142.59	157	46.59
1318.	khalid (khalidoo17)	337	51.25	70.65	39	11.57
1319.	Sam (samandthefourdogs)	337	66.48	96.26	73	21.66
1320.	ROG (roggy)	337	64.37	84.70	72	21.36
1321.	R (rc_da)	336	62.61	79.40	46	13.69
1322.	Ⓐⓝⓣⓞⓝ (racingisaw...	336	90.21	131.35	159	47.32
1323.	Lei (alnadnetrox)	336	88.66	117.22	120	35.71
1324.	Fangio (fangio)	336	79.11	98.48	73	21.73
1325.	Karl (xillionpro)	336	87.26	121.99	105	31.25
1326.	Vilmer (vien0701)	336	83.93	108.01	104	30.95
1327.	A.H.M. (arceen)	335	82.78	102.85	83	24.78
1328.	Macy (macylace)	335	71.07	95.60	81	24.18
1329.	Korra (grandesonnerie)	334	96.95	142.25	130	38.92
1330.	Olav (thederpygod)	334	90.27	123.20	90	26.95
1331.	Guest (superman_ha_ha)	333	76.52	108.40	80	24.02
1332.	Kian (kian32)	333	44.63	56.51	41	12.31
1333.	nimitz (nimitzpro)	333	92.34	119.17	127	38.14
1334.	Dominic (mickeyice3)	333	74.64	94.43	85	25.53
1335.	B (bsauter29)	333	89.88	118.34	109	32.73
1336.	alex (alex3213213)	333	94.98	134.95	127	38.14
1337.	Adrian (adrianc04)	332	93.75	120.00	89	26.81
1338.	AbdulQader (abdulqader)	332	74.38	95.49	75	22.59
1339.	yourfav (imyofav)	332	43.79	62.26	30	9.04
1340.	Rikki (rikki_leo)	332	86.98	118.22	101	30.42
1341.	- (ndca)	332	50.53	70.75	36	10.84
1342.	🤝🤝 (joejiunn)	332	92.68	116.79	106	31.93
1343.	tstats[totet] (totet)	331	68.83	89.30	67	20.24
1344.	eric (ericpr)	331	71.92	98.26	80	24.17
1345.	I love my thicc girlfriend ...	331	149.63	231.98	244	73.72
1346.	meow (catnoodles)	330	93.43	124.88	119	36.06
1347.	Keima (lereias_1)	330	67.41	89.92	77	23.33
1348.	Sam (sam77777)	330	80.52	101.75	75	22.73
1349.	Austin (quanglamtran346)	330	73.10	91.16	91	27.58
1350.	Blunt (blunt_machete)	330	67.66	92.10	67	20.30
1351.	tstats[pervez1020] (pervez1...	329	47.90	62.58	39	11.85
1352.	Moaz (mo3adh)	329	67.67	95.42	64	19.45
1353.	Faiq (faiq_lak)	329	63.01	93.11	75	22.80
1354.	Ryan (carefullyslow)	329	102.53	132.54	153	46.50
1355.	Artiur (artursaliyev)	329	41.33	59.03	29	8.81
1356.	Jackson (neatoburrito)	328	73.44	109.38	89	27.13
1357.	Mostafa (m2a_nj)	328	46.51	62.79	35	10.67
1358.	Kickass (vivekvikysharma)	328	60.40	79.05	61	18.60
1359.	Zak (zak_roger)	327	88.01	109.38	113	34.56
1360.	small (smalllittlesheep)	327	66.35	87.34	70	21.41
1361.	Captain (scrubwrecker666)	327	83.04	107.18	95	29.05
1362.	manthan (manthan123)	327	62.17	83.55	71	21.71
1363.	pärskis (borje)	326	76.06	97.48	83	25.46
1364.	sdagsad (asvasdba)	326	74.19	100.78	119	36.50
1365.	Liu (jazzkey)	326	92.81	112.40	129	39.57
1366.	Ridoy Chandra Dey (rkprite09)	325	63.21	82.07	64	19.69
1367.	Ed (raptorofli)	325	96.48	129.30	129	39.69
1368.	Iron Man (007_speed)	325	86.55	107.41	116	35.69
1369.	Emma (emma_boy)	325	50.46	72.04	36	11.08
1370.	XanderManCan (tacticaltoast)	325	73.35	94.52	71	21.85
1371.	Shoemaker-Levy 9 (atthetop)	325	161.64	231.45	227	69.85
1372.	eric (eric8)	324	86.99	108.57	92	28.40
1373.	Ibex (ibexdoyle)	324	34.68	44.92	25	7.72
1374.	Samandar1 (samandar1)	324	39.67	55.67	19	5.86
1375.	Ian (s0ft3n)	324	104.42	138.84	143	44.14
1376.	Sumanta (sumanta001)	324	54.84	75.46	45	13.89
1377.	A (suleil)	324	114.68	146.08	147	45.37
1378.	Racer09 (__nn____ds__)	323	43.69	56.33	24	7.43
1379.	Marti (ytram)	323	53.99	74.03	44	13.62
1380.	kenneth (tenick)	323	92.82	116.70	109	33.75
1381.	tambii (aid1337)	323	121.80	162.76	164	50.77
1382.	J (juuhhhstin)	323	141.41	166.88	263	81.42
1383.	Pawan (pawanpdn)	323	72.47	97.19	83	25.70
1384.	Orenji (orenji_0987)	323	58.06	80.35	32	9.91
1385.	random (myrandomusername)	323	67.17	92.40	83	25.70
1386.	Hasan (notelex)	322	88.67	111.32	97	30.12
1387.	Viktor (wector77y)	322	100.33	157.78	118	36.65
1388.	Jee Hoon (jeehoonoh)	322	139.43	193.61	243	75.47
1389.	Jeffrey (jeff7263)	321	91.80	119.44	89	27.73
1390.	18K.ca (hunterwoodchase)	321	104.20	131.33	134	41.74
1391.	Person (relearner)	321	98.75	116.97	131	40.81
1392.	davy (octopu5)	321	76.50	102.10	103	32.09
1393.	MantisTyping (mantistyping)	321	88.56	116.00	98	30.53
1394.	Rajesh (curseraj)	321	68.07	90.70	81	25.23
1395.	Hoe Hoe (yeyonghe)	321	76.90	98.46	74	23.05
1396.	Smudge on megamak uwu (snudge)	320	57.33	99.57	68	21.25
1397.	Lynn (pvequalsnrt)	320	82.82	105.61	99	30.94
1398.	Manik2375 (manik2375)	320	66.15	94.18	89	27.81
1399.	Allan (allanwchang)	320	76.08	99.54	78	24.38
1400.	Yashpal (ymanju)	319	29.26	44.59	51	15.99
1401.	Sahil (shahildhakre)	319	35.58	55.65	23	7.21
1402.	javier (jf1442)	319	67.03	87.53	62	19.44
1403.	Key (malformant)	318	80.26	106.62	91	28.62
1404.	🙃 (kryptoprocta)	318	67.25	92.30	76	23.90
1405.	Jwad (jaziz)	318	114.29	146.78	171	53.77
1406.	Tyler (tko42)	318	111.35	141.93	147	46.23
1407.	Ranak (rakibulranak)	318	61.81	85.48	66	20.75
1408.	Ugnius (popcorn325)	318	95.84	119.02	126	39.62
1409.	I type (carsftw)	318	107.02	137.06	160	50.31
1410.	Andy (wah_wah_wah)	317	63.39	86.97	75	23.66
1411.	Dhaliwal (vishaldhaliwal)	317	69.62	94.52	76	23.97
1412.	K (khanali2020)	317	95.26	116.17	129	40.69
1413.	Sephiroth (jukethehitman)	317	63.41	94.41	61	19.24
1414.	Ariful (arifulhaque24434)	317	46.11	59.56	35	11.04
1415.	Sylwester (rex1313)	317	71.17	108.84	90	28.39
1416.	how 2 type faster? (not_seg...	317	139.14	169.93	247	77.92
1417.	xena (scogx3281)	316	104.97	135.36	123	38.92
1418.	Russian (russianemu27)	316	105.53	141.66	130	41.14
1419.	ig: erik_toledoo (pepegacha...	316	69.70	91.17	83	26.27
1420.	ef (fankan1997)	316	43.64	55.33	33	10.44
1421.	Scattish (willierocknroll)	315	72.04	98.97	70	22.22
1422.	Ven (v4vendetta)	314	43.81	57.95	23	7.32
1423.	Timothy (timply)	314	83.87	117.01	96	30.57
1424.	sgbiscuits (snailzzy)	314	85.28	98.23	111	35.35
1425.	dayy (lordie)	314	59.28	85.17	63	20.06
1426.	Nour Hakim (scarfc)	314	49.67	66.74	46	14.65
1427.	Memming (qwerty) (memming)	314	102.65	130.16	147	46.82
1428.	Patt (rymt)	313	66.40	95.56	78	24.92
1429.	Lycin (smokzzzgaming)	313	68.91	96.87	73	23.32
1430.	Allistare (shinryu1324alt)	313	100.60	119.41	139	44.41
1431.	ChosilogRTX (chosilogrtx)	313	101.42	143.77	136	43.45
1432.	Tony (alpha_911)	313	46.84	64.71	37	11.82
1433.	Emad (emadgsamy)	312	38.02	59.50	23	7.37
1434.	Emma (emmasmith2005)	312	89.47	113.69	84	26.92
1435.	root (chroot)	312	71.36	125.93	79	25.32
1436.	Shelby (typo5)	312	92.13	121.69	95	30.45
1437.	ADFJEWI FF (weiyd)	311	99.22	129.90	138	44.37
1438.	Shendo (shend0)	311	50.71	71.03	26	8.36
1439.	chinguun (chinguun_0301)	311	80.26	100.16	75	24.12
1440.	Bruh (bruh_widow)	311	69.82	98.08	86	27.65
1441.	c (blaf)	311	72.79	92.70	68	21.86
1442.	Jakab (schttj)	311	104.31	140.58	128	41.16
1443.	qMark (renvanoss)	311	88.82	112.72	91	29.26
1444.	Philip (philipyoung)	311	66.45	88.12	69	22.19
1445.	Ansar (paxaq)	311	63.98	87.63	69	22.19
1446.	mwizard (mwizard)	311	127.55	157.21	192	61.74
1447.	Hari (thor_03)	311	45.72	69.07	33	10.61
1448.	Oatmeal (cp_oatmeal)	310	61.39	77.60	67	21.61
1449.	Berto (bertoisfast)	310	52.53	73.06	28	9.03
1450.	Lasse (lemlo)	309	82.10	112.52	82	26.54
1451.	Jason (typing_boi69)	309	76.83	105.07	71	22.98
1452.	Nikhil (nik9)	309	67.95	95.29	81	26.21
1453.	(macieje)	309	157.48	206.11	264	85.44
1454.	Nolan (kiwiq1)	309	88.83	104.64	83	26.86
1455.	Hersh (hbhargava)	308	115.69	145.44	165	53.57
1456.	Guest👽 (sinatraa68)	308	47.01	67.19	20	6.49
1457.	Daniela (danirmz)	308	55.83	84.33	37	12.01
1458.	Alex (bjartex)	308	79.38	124.45	83	26.95
1459.	light (light_06)	308	46.48	63.44	29	9.42
1460.	jone (jonesoldi)	308	54.77	72.48	45	14.61
1461.	ScocoPope (scocopal)	308	69.93	89.24	69	22.40
1462.	PinkPepper (pinkpepper)	308	94.41	128.84	104	33.77
1463.	MegaTron (megatron100101)	308	56.17	75.29	44	14.29
1464.	Sav (savcaruso)	307	98.01	146.87	126	41.04
1465.	the (rank1zen)	307	73.52	99.73	67	21.82
1466.	Charlie (cubez)	307	68.31	91.92	100	32.57
1467.	ttv.guspenseful (gusm09)	307	88.91	116.33	86	28.01
1468.	Sam (sharris11)	307	74.77	94.62	51	16.61
1469.	Tong (tongvu)	306	87.05	113.20	110	35.95
1470.	Oxey (oxey_was_taken_smh)	306	99.29	130.39	123	40.20
1471.	And (andzer0)	306	81.03	105.64	98	32.03
1472.	mahamad (mahamad017)	306	45.72	62.58	32	10.46
1473.	Max (17maxklivans)	305	118.42	158.87	165	54.10
1474.	zzr0t (sulj0o)	305	94.61	127.73	118	38.69
1475.	Jasnam (jazzygoesomnom)	305	65.50	89.79	68	22.30
1476.	b (bonkadonks)	305	91.89	118.64	102	33.44
1477.	Avaneesh (avaneeshasokan)	305	67.06	86.43	76	24.92
1478.	Reece Taylor (reeceybro28)	305	63.25	89.01	54	17.70
1479.	sloth (mitchie98)	304	96.01	132.43	42	13.82
1480.	Md. Mamun (mamun_sheikh)	304	67.47	98.83	76	25.00
1481.	Lam (lamnv)	304	49.15	65.21	33	10.86
1482.	Safraz (hypertyper94)	304	61.09	77.24	60	19.74
1483.	York (yorkay)	304	84.91	110.84	95	31.25
1484.	Thor (thorern00)	303	57.37	78.15	45	14.85
1485.	kaly (klay7)	303	24.86	41.55	72	23.76
1486.	Anthony (apesina)	303	53.74	72.83	26	8.58
1487.	Rydia (rydia_miwita)	303	38.63	54.43	17	5.61
1488.	Eddynsky (eddynsky432)	303	58.40	74.83	51	16.83
1489.	I really suk (cornmaster0411)	302	92.78	117.42	100	33.11
1490.	MAYANK (mayank_017)	302	31.66	43.11	37	12.25
1491.	Nidhal (yagamee)	302	73.38	99.18	76	25.17
1492.	TopGUN (wayhowma)	302	96.60	118.40	183	60.60
1493.	sks (sks6174)	302	74.96	100.54	73	24.17
1494.	Pham (iamphduc)	302	69.67	87.51	87	28.81
1495.	KH (gpx2ero)	302	79.60	102.83	77	25.50
1496.	Pietro (qiit)	302	79.36	114.14	57	18.87
1497.	sachin (sachin986)	301	65.89	88.38	66	21.93
1498.	ᴛᴀxɪ ᴅʀɪᴠᴇʀ �...	301	85.73	117.24	94	31.23
1499.	yzifioapj;;;🙈🙈 (pipur)	301	91.39	123.10	93	30.90
1500.	learn corne (tomgroenwoldt)	301	92.10	114.47	102	33.89
1501.	Torrin (t0rr1n)	301	87.83	110.24	96	31.89
1502.	Charlie (cduong04)	301	106.51	137.61	107	35.55
1503.	Kiara (katherynbane)	301	89.64	117.58	107	35.55
1504.	tstats[kaitokidokuroba] (ka...	301	88.78	124.02	98	32.56
1505.	J (leunidus)	300	105.17	130.86	115	38.33
1506.	Charon (just_you_and_me)	300	46.15	58.80	31	10.33
1507.	jmzg (jmzg)	300	79.71	106.92	80	26.67
1508.	😳hotmama😫 (h0tmama)	300	142.56	185.24	229	76.33
1509.	P. (psilva00)	300	84.27	108.41	96	32.00
1510.	Piyush (piyush41y08h)	300	61.77	80.33	57	19.00
1511.	ndr2 (ndr2)	300	105.49	128.13	131	43.67
1512.	Yaroslav (nashivan)	300	36.79	48.25	21	7.00
1513.	blue (bluedragon_)	300	96.97	136.91	117	39.00
1514.	Fouracle (fouracle)	299	155.23	188.96	265	88.63
1515.	King JF (foongtastic)	299	58.27	74.24	51	17.06
1516.	Ins (insanic10)	299	72.84	101.64	71	23.75
1517.	Sidharth (iamsidman17)	299	84.49	110.54	85	28.43
1518.	Jhari (hyunjintinapay)	299	60.41	79.47	58	19.40
1519.	Bijji (thatboywulfric)	299	100.11	125.26	138	46.15
1520.	Tiny Tank (anti_vax_cat)	299	98.69	127.80	106	35.45
1521.	Chuck (typer_inflation)	298	77.19	103.01	82	27.52
1522.	TypeLearner21 (typelearner21)	298	100.91	124.99	141	47.32
1523.	Sydney (sydholla)	298	87.62	115.41	82	27.52
1524.	Neb (cyanidetoast)	298	76.13	106.29	76	25.50
1525.	JACK (jackemon)	298	49.95	74.00	36	12.08
1526.	Macedonian King (ijittqerr_)	298	85.89	113.04	76	25.50
1527.	Silent_One (get_a_lif3)	298	133.97	170.26	219	73.49
1528.	­ ­­ (enqq)	297	71.88	99.63	75	25.25
1529.	Danica (7158dandan)	297	74.34	94.79	85	28.62
1530.	csl (csl11)	297	66.54	81.87	76	25.59
1531.	Jc9369 (trotterspiglet)	297	70.06	90.08	67	22.56
1532.	Samuel (samuel_7)	297	73.38	100.85	64	21.55
1533.	MNM (mnmnour)	297	104.33	128.37	135	45.45
1534.	chara (rin3)	296	94.07	125.59	113	38.18
1535.	Timothy (adral)	296	85.50	121.46	84	28.38
1536.	Catalin (catalinhimself)	296	71.44	97.16	70	23.65
1537.	Marius (darkmarox)	296	71.37	101.58	72	24.32
1538.	Sobuj (greensobuj)	296	58.16	82.93	59	19.93
1539.	MK-47 (construct)	296	63.94	82.81	63	21.28
1540.	Taru (tarukwon)	296	90.51	114.16	102	34.46
1541.	Someone (_some_one_)	295	90.16	120.02	95	32.20
1542.	(shaun022)	295	82.31	112.14	90	30.51
1543.	RoadTo69(hehe) (lord_hunter)	295	68.84	91.91	72	24.41
1544.	likun (likun)	295	36.98	49.28	21	7.12
1545.	kamalesan (kamalesan)	295	69.96	87.80	76	25.76
1546.	Ginger (ravens_loft)	295	74.04	99.14	74	25.08
1547.	Dvorak 9/16/2021 (mj_dvorak)	295	61.68	82.16	51	17.29
1548.	Nurasyl (black2ing)	295	49.12	62.45	30	10.17
1549.	Asm (asmsaikat)	295	57.96	74.40	41	13.90
1550.	Horst (feanor)	294	97.30	120.28	107	36.39
1551.	Macro (macro225)	294	82.49	99.74	60	20.41
1552.	inspirations (inspirations)	294	56.47	73.98	52	17.69
1553.	Kai (gigadelic)	294	91.74	120.65	99	33.67
1554.	Touchtyping (touchtypingpro...	294	76.49	112.79	95	32.31
1555.	Suhas (suhasmaddali007)	294	102.90	126.79	112	38.10
1556.	david (snobellprize)	294	88.68	114.13	98	33.33
1557.	:D (rathorr)	294	39.78	56.28	23	7.82
1558.	Anvar (only_aloner)	294	75.01	93.34	101	34.35
1559.	Nirmith (nirmith_akash)	293	55.29	72.81	41	13.99
1560.	27thave.bandcamp.com (xxcru...	293	146.15	188.92	233	79.52
1561.	Burint (brenolz)	293	72.41	95.11	75	25.60
1562.	Michael (lastobelus)	293	82.43	97.70	66	22.53
1563.	prints (ichigopurin)	293	110.60	154.59	167	57.00
1564.	bondservant (arenza)	293	91.78	121.57	108	36.86
1565.	Amarpreet Singh (amar123200)	293	72.10	100.16	84	28.67
1566.	ajit (ajit9999)	293	65.72	88.62	85	29.01
1567.	Aditya (adibhandari)	293	71.00	92.80	85	29.01
1568.	Logan (36beastgod)	293	72.94	94.91	86	29.35
1569.	reem (bacil123)	292	109.63	139.38	132	45.21
1570.	Omar (samura1)	292	65.37	92.38	69	23.63
1571.	Pink (pinkbass)	292	66.95	92.34	69	23.63
1572.	Veer (the_veer)	292	84.33	108.93	79	27.05
1573.	zheqe (zheqe)	291	109.95	133.42	148	50.86
1574.	Ujjval (ross_specter)	291	55.17	73.45	36	12.37
1575.	anonym_igelkott (anonym_ige...	291	119.96	143.19	163	56.01
1576.	Vanessa (abetterplace)	291	99.06	129.02	120	41.24
1577.	carrie (charmed4002)	291	42.97	58.79	22	7.56
1578.	Operation Sindoor 🇮🇳 ...	291	89.10	125.88	108	37.11
1579.	meerkat (dr_meerkat)	290	76.39	93.80	69	23.79
1580.	puthin_p2n (bugsmasher)	290	83.09	116.97	80	27.59
1581.	boiax (boiax)	290	60.92	86.95	65	22.41
1582.	aziz (azizkhanfar304)	290	59.86	75.53	57	19.66
1583.	Anthony S. (anthonyjshuey)	290	83.59	119.01	80	27.59
1584.	wdMahbub (wdmahbub)	290	32.27	44.49	23	7.93
1585.	t (zyxx)	290	93.32	129.84	115	39.66
1586.	Surely (surely_)	290	55.14	74.36	36	12.41
1587.	Loma (pbaloma)	290	99.90	123.26	104	35.86
1588.	Monotarinai (monotarinai)	290	70.76	93.83	73	25.17
1589.	leftovericecream (leftoveri...	290	96.14	121.75	125	43.10
1590.	Hello (julius1331)	290	84.50	109.01	87	30.00
1591.	a (jdlwahaha)	290	95.44	117.85	111	38.28
1592.	Rasmus (kennystarfighter_)	289	76.38	103.76	73	25.26
1593.	#1 Racist (gnadus)	289	53.83	69.93	26	9.00
1594.	Yeldos (yeldos1)	289	26.38	43.76	48	16.61
1595.	Im not a country (taiwankim)	289	88.63	114.78	93	32.18
1596.	Struasz (struasz)	289	35.99	52.27	24	8.30
1597.	Angela (angela_typeracer)	289	46.82	67.20	24	8.30
1598.	Kerim (keroma)	289	39.83	52.77	15	5.19
1599.	Ross (pyramidgg)	289	109.67	146.18	125	43.25
1600.	Navait (nkumar031)	289	59.08	83.48	59	20.42
1601.	pwp (fickypw)	288	81.54	99.24	64	22.22
1602.	ramen (lightning_poliwag)	288	85.21	119.12	98	34.03
1603.	Misha (ladyvander)	288	103.54	129.93	125	43.40
1604.	lurak (lurak2131)	287	75.17	97.18	69	24.04
1605.	KC Abhinav (kcabdn)	287	55.00	78.53	42	14.63
1606.	Pranjal (haanhaargaya)	287	51.52	65.06	25	8.71
1607.	Ewan (ewan121)	287	83.03	111.91	78	27.18
1608.	usagi704 (usagi704)	287	64.60	79.58	53	18.47
1609.	Nilanjan (nilthedev)	287	62.49	86.02	55	19.16
1610.	Abdzag (abdzag)	287	65.42	91.30	70	24.39
1611.	sierra (sierra05)	286	156.11	202.05	243	84.97
1612.	Krushna (krush111878)	286	51.72	72.17	34	11.89
1613.	Jhonny (jhonny_space0ut)	286	64.37	79.65	63	22.03
1614.	Danny (h4ndeye)	286	75.95	100.40	69	24.13
1615.	Catalin (georgecatalin)	286	78.58	103.56	64	22.38
1616.	Reddington ツ (ericliu17)	286	118.11	155.92	173	60.49
1617.	Sampharos (sampharos)	286	49.77	66.92	24	8.39
1618.	Maxim (mista7)	286	50.45	71.01	29	10.14
1619.	Raj (raxoltron)	285	67.64	95.29	84	29.47
1620.	Nursultan (nursultan23)	285	59.71	80.71	41	14.39
1621.	mayzerto (mayzerto)	285	68.96	85.66	58	20.35
1622.	Jack (jackthesnacc)	285	66.51	93.97	72	25.26
1623.	speedyqwertalez (i_am_a_nooby)	285	56.35	69.17	32	11.23
1624.	Joe (show_some_moe_joe)	285	57.63	74.61	33	11.58
1625.	Jandar (jandar)	285	70.96	91.76	69	24.21
1626.	ObiJuaan (obijuaan)	284	69.48	102.95	76	26.76
1627.	Zaynab (itsyou)	284	67.78	88.47	74	26.06
1628.	pwned (pwned1337)	284	47.20	63.14	41	14.44
1629.	Gopal (avengergopal)	284	34.83	53.03	25	8.80
1630.	James (jjhertz)	283	66.58	98.35	65	22.97
1631.	butttickler (james29091998)	283	53.77	72.02	41	14.49
1632.	Hayrra (hedooxx)	283	52.18	64.88	17	6.01
1633.	MazzaM (typingproxyz)	283	82.26	131.52	71	25.09
1634.	sly (slymaster11)	283	113.67	145.75	132	46.64
1635.	1 (shootingmonkey1)	283	67.83	89.64	66	23.32
1636.	Bob (octopus32)	283	107.17	128.89	153	54.06
1637.	Sam (numberonemega)	282	111.74	146.05	169	59.93
1638.	Jethro (jetthrower)	282	77.75	103.96	80	28.37
1639.	greenmantis (greenmantis)	282	111.44	145.48	154	54.61
1640.	quite fast (edonn)	282	118.13	148.06	125	44.33
1641.	AWE (awicek)	282	52.61	65.77	26	9.22
1642.	Jonah (workman04)	282	91.90	124.29	104	36.88
1643.	shark (sharkpause)	281	64.41	87.15	60	21.35
1644.	Michael (m1ch4el)	281	59.57	75.55	41	14.59
1645.	Nima (nimayaqmuri)	281	84.81	105.96	81	28.83
1646.	Eddie (eddie_08)	281	73.15	96.94	76	27.05
1647.	?? (form30to100)	280	28.94	45.60	41	14.64
1648.	anon (dontrun01)	280	39.41	55.21	22	7.86
1649.	Chicken (chicken807)	280	91.67	123.85	98	35.00
1650.	Joe (jgizzi21)	280	74.41	98.73	60	21.43
1651.	Anson (ansonso042802)	280	69.31	95.48	50	17.86
1652.	PURPLE_MAGE (grokestray)	280	71.21	95.89	72	25.71
1653.	Somogyi (vincture)	280	97.98	126.12	94	33.57
1654.	One last time (ubershah)	280	101.58	136.59	139	49.64
1655.	Taejas (taejas)	280	90.53	107.68	101	36.07
1656.	Shadow (shadow_monarch)	280	85.64	116.41	79	28.21
1657.	butter (rtporpmal)	280	71.85	94.90	62	22.14
1658.	Racer (racer_9)	280	55.41	80.13	30	10.71
1659.	Eugene (ptes77)	280	152.93	192.14	240	85.71
1660.	Ikenna (odogwu)	280	76.67	107.78	79	28.21
1661.	notkinruyuu (notkinruyuu)	280	53.89	82.03	33	11.79
1662.	Manel (mrnuke)	280	78.92	93.22	76	27.14
1663.	Mohamed Sadiq (mohamed_sadi...	280	29.46	39.60	30	10.71
1664.	Imperator (imperator_357)	279	60.44	70.78	46	16.49
1665.	Heufy (heufy)	279	83.94	105.54	90	32.26
1666.	god (god_is_here)	279	93.36	117.04	93	33.33
1667.	ghaws (ghaws)	279	74.99	97.04	79	28.32
1668.	🧀 Chez (super_not_pro)	279	139.94	174.14	213	76.34
1669.	Val (sgtvaltzu)	279	92.31	109.15	83	29.75
1670.	sukhoi su-57 (shezy)	278	41.77	63.73	29	10.43
1671.	Onni (alchem)	278	82.62	121.20	65	23.38
1672.	henry (luckyhenry)	278	83.48	99.64	71	25.54
1673.	Liam (lime_da_bestest_colemak)	278	63.40	83.34	56	20.14
1674.	ionut (ionut_red)	277	90.70	124.66	106	38.27
1675.	Wave (waveclipping)	277	110.51	147.56	140	50.54
1676.	Yusuke (tokyoprogramming)	277	78.67	102.68	79	28.52
1677.	antobot (antobot)	277	55.14	73.96	52	18.77
1678.	Edwin (biggchinoxxl)	276	64.15	95.43	49	17.75
1679.	aditya (yusifer_zendric)	276	105.19	130.38	130	47.10
1680.	Jamal (xflash)	276	87.52	116.42	92	33.33
1681.	Will (williamwang)	275	109.16	140.26	120	43.64
1682.	Robbie (symba369)	275	80.67	104.63	84	30.55
1683.	Lark (sirhaxbard)	275	112.99	146.15	127	46.18
1684.	Luke (luthedog)	275	77.47	103.12	66	24.00
1685.	Hau (jackie1997)	275	64.96	94.14	69	25.09
1686.	Aheartz (idul_aheartz06)	275	50.46	67.02	28	10.18
1687.	Radek (raddzio)	275	65.68	87.49	62	22.55
1688.	Chilly (racerrrrrrr)	275	59.80	76.35	44	16.00
1689.	Alex (delvern)	275	71.16	87.59	71	25.82
1690.	askeladd (askeladd_619)	274	44.67	58.97	24	8.76
1691.	Cultist (kishore0305)	274	98.00	125.95	89	32.48
1692.	kd (kdrai007)	274	50.33	71.53	31	11.31
1693.	Jpjt (jyrah)	274	72.85	90.92	48	17.52
1694.	Grover (grover8323)	274	51.46	64.06	18	6.57
1695.	Ahmad (ahmad7salah)	274	54.68	71.87	30	10.95
1696.	jerry (sheep0109)	274	52.82	75.40	41	14.96
1697.	jinay (noisy_88)	274	73.30	95.67	79	28.83
1698.	Murad (murad90)	274	52.37	68.14	29	10.58
1699.	razwan (razwan)	273	37.59	61.16	20	7.33
1700.	Yanni (moronicmetalman)	273	106.90	127.47	118	43.22
1701.	gabi (g_i_g)	273	51.43	73.44	32	11.72
1702.	Stefan (fendorian)	273	92.84	116.99	107	39.19
1703.	Dayna (daynarrr)	273	87.63	122.42	93	34.07
1704.	Lawrence (buffoony)	273	79.30	105.10	91	33.33
1705.	Andres (atv2307)	273	64.67	86.53	65	23.81
1706.	Leo (asdbooh)	273	90.79	116.85	87	31.87
1707.	Krg (username_example125259)	273	117.07	142.63	155	56.78
1708.	RAMs3c (xander360)	272	76.18	101.76	59	21.69
1709.	guest (n1lotpal)	272	73.54	91.42	77	28.31
1710.	Manuel (manuelsandoya)	272	52.65	70.76	21	7.72
1711.	humberto torres (humbertoto...	272	88.60	108.76	86	31.62
1712.	TheyGotAlex (harshbarger.a@...	272	118.28	164.34	142	52.21
1713.	Ambi (dank_ambi)	272	93.41	127.75	114	41.91
1714.	Francisco (cdt1)	272	87.38	112.78	80	29.41
1715.	Gio (banzy)	272	59.32	73.91	45	16.54
1716.	Peaches (devastated)	271	122.95	154.23	141	52.03
1717.	Mark (datboi1771)	271	94.16	140.44	93	34.32
1718.	Dang Hai (dang_hai_ema)	271	36.97	51.90	15	5.54
1719.	camden (camdcn)	271	126.49	176.47	183	67.53
1720.	sadsaturdays (sadsaturdays)	271	49.53	64.10	33	12.18
1721.	Perceval-_- (perceval)	271	68.71	86.71	62	22.88
1722.	mcga (mcga)	271	90.31	114.29	101	37.27
1723.	Aman (amanengineer)	271	72.70	106.28	65	23.99
1724.	Jonas (supektibol)	271	88.85	106.32	64	23.62
1725.	accongero (geononquit)	271	145.64	196.28	183	67.53
1726.	Lil guy (littlewalken27)	270	52.06	67.30	33	12.22
1727.	Hunter (hunter_da_man11)	270	88.01	112.47	81	30.00
1728.	Alfabetica (alfabetica)	270	85.95	105.95	77	28.52
1729.	Okiiiieee (acharyas)	270	84.76	111.42	72	26.67
1730.	fishfingers (fastfinger5669)	270	69.48	88.18	66	24.44
1731.	logan (logannnc)	270	53.20	71.55	20	7.41
1732.	frustratedtyper (frustrated...	270	94.89	119.88	95	35.19
1733.	Kirin (emptomatoketchup)	270	86.36	129.62	82	30.37
1734.	nishant (nishp19)	270	76.72	93.47	81	30.00
1735.	Bill (destroyer_2)	269	82.14	117.00	79	29.37
1736.	Le (lenam12345)	269	46.74	69.89	20	7.43
1737.	imscreecher (imscreecher)	269	66.45	91.74	51	18.96
1738.	Trent (tsteele07)	269	68.53	84.78	63	23.42
1739.	Ben (thisisben)	268	85.91	105.82	62	23.13
1740.	SURFΛCΞ (surface)	268	103.58	138.80	129	48.13
1741.	Justin (dunklioscious)	268	146.23	185.85	196	73.13
1742.	akzhol (atomixa)	268	86.24	111.93	89	33.21
1743.	Sandy (sandeshgowda0094)	268	30.12	42.20	34	12.69
1744.	Peter (ptnguyen)	268	108.00	143.19	135	50.37
1745.	Pradeep (pradeep80)	268	70.81	117.68	62	23.13
1746.	Fearless Jutt (lozer098)	268	71.34	92.65	53	19.78
1747.	Bình (juliecorstarr)	267	50.46	97.36	25	9.36
1748.	Jordi (jordi0lle)	267	53.83	72.75	24	8.99
1749.	Matt (inedibility)	267	97.89	122.48	100	37.45
1750.	Glass (glass_crys)	267	94.75	130.10	97	36.33
1751.	Ali (french_baguette)	267	55.73	80.03	47	17.60
1752.	Rory Gower (rxryag)	267	42.97	62.61	22	8.24
1753.	Nagai (nagaimatsuge)	267	89.33	111.87	94	35.21
1754.	Robert (karayicki)	266	102.47	124.31	117	43.98
1755.	Kelby (haulzy)	266	94.40	110.91	100	37.59
1756.	Hossein (dustylamia)	266	85.77	126.90	108	40.60
1757.	JP (freshlumpia)	265	81.68	112.19	79	29.81
1758.	Spotify: Denori (barry011)	265	117.27	148.10	140	52.83
1759.	Jo (jococonutty)	265	87.19	110.79	90	33.96
1760.	zeeee (zeeebra)	265	107.71	146.21	142	53.58
1761.	Typing🤯🤯🤯 (sirsoup)	265	95.23	118.96	75	28.30
1762.	tudorica1 (tudorel1234)	264	98.90	115.94	91	34.47
1763.	Demon (thedemon54)	264	43.87	70.33	21	7.95
1764.	severed (severedhand)	264	83.56	115.71	66	25.00
1765.	gangreenie (gangreenie)	264	97.49	130.44	105	39.77
1766.	Enjoi (enjoisxd)	264	68.27	87.51	58	21.97
1767.	Pavan (sai_pavan)	264	71.17	93.84	60	22.73
1768.	Sahariar (noob_sahariar)	264	70.62	98.98	67	25.38
1769.	munkeontop (revvitt)	263	141.39	169.47	180	68.44
1770.	Byron (chicken_little1)	263	59.57	72.01	40	15.21
1771.	Typer Shark (teodorrd27)	263	122.58	144.05	154	58.56
1772.	Abdulelah (hansan)	263	55.16	73.03	36	13.69
1773.	Hyrum (anom4001)	263	90.03	115.87	91	34.60
1774.	Nigel (nigelhaha)	262	34.20	51.09	11	4.20
1775.	Shu (shuuouma)	262	60.49	76.10	43	16.41
1776.	Poops (poops_magee)	262	116.04	140.37	153	58.40
1777.	Hans (phantomreel)	262	49.62	64.27	30	11.45
1778.	Lightning (just_lightning_)	262	67.14	94.27	42	16.03
1779.	lukman (kopimaniz)	261	87.72	104.81	87	33.33
1780.	Kenway (kenway316)	261	74.00	102.42	59	22.61
1781.	Timmy (timexwatch)	261	71.90	99.49	61	23.37
1782.	(sputype)	261	102.70	144.79	102	39.08
1783.	salem (salem_coder)	261	60.62	91.78	59	22.61
1784.	Ndrew138 (ndrewewqe)	261	69.54	89.16	59	22.61
1785.	Prem (merpx)	261	77.16	94.66	64	24.52
1786.	Nairwick (nairwick)	260	78.30	117.19	52	20.00
1787.	Nagaku (nagaku)	260	99.46	127.84	90	34.62
1788.	Mers (mers_0412)	260	99.87	122.50	108	41.54
1789.	Meet (meet_patel1588)	260	68.99	94.32	57	21.92
1790.	pizza (jsoccerdude@msn.com)	260	87.45	118.20	79	30.38
1791.	yixuan (ixuan)	260	80.75	104.97	87	33.46
1792.	Adrian (adriangat)	260	90.84	113.69	99	38.08
1793.	Adam (adamsyaq)	260	97.81	123.46	108	41.54
1794.	Cythrix (boment)	260	110.09	135.59	125	48.08
1795.	Hatandriya (tiko270303)	260	110.82	142.51	126	48.46
1796.	H (vigilantvillian_colemak)	259	109.67	130.65	135	52.12
1797.	scuba (scuba2x)	259	72.56	111.17	61	23.55
1798.	Violet (ackerman_l1)	259	79.33	96.04	65	25.10
1799.	RoosterDunker (roosterdunker)	259	94.18	114.32	73	28.19
1800.	Richard (richard_king)	259	72.81	95.59	51	19.69
1801.	matiullah (qais_007)	259	39.51	49.78	14	5.41
1802.	Joe (neimad7)	259	110.31	144.78	106	40.93
1803.	joe (mcmillybear)	259	74.55	98.01	70	27.03
1804.	hero (iknowhtml)	259	41.63	56.15	18	6.95
1805.	Kade (buph_kade)	259	78.15	113.29	53	20.46
1806.	CornPacs (cornpacs)	258	87.58	107.48	79	30.62
1807.	CHeezs (cheezs)	258	101.43	135.09	174	67.44
1808.	Mhark (mharkmharkmhark)	258	83.94	105.77	64	24.81
1809.	hitham osama (hitham16)	258	27.91	45.48	29	11.24
1810.	jonny (jlun23)	258	125.09	155.88	173	67.05
1811.	prplx (prplx)	257	99.51	133.39	113	43.97
1812.	Vi Kiet (vikiet1456)	257	60.79	77.48	60	23.35
1813.	Will (slamdado)	257	72.49	95.56	50	19.46
1814.	veirt (exlog)	257	128.69	165.61	158	61.48
1815.	E (evan_30)	257	82.93	103.25	81	31.52
1816.	원숭이 (dweaji)	257	106.15	131.30	116	45.14
1817.	cignx (clamchowderco)	257	79.84	105.41	80	31.13
1818.	Art (artkhl)	257	77.85	99.68	70	27.24
1819.	Andrew (andrewsim)	257	61.05	75.38	59	22.96
1820.	Mooyodauh (mooyodauh)	257	91.57	127.04	76	29.57
1821.	Qi (whathaha)	256	123.49	165.41	157	61.33
1822.	Meow (vic12116)	256	68.08	91.86	65	25.39
1823.	hackthemoon (hackthemoon)	256	81.15	104.71	63	24.61
1824.	Mark (requiem__)	256	85.98	109.78	67	26.17
1825.	mike (oxfordcomma)	256	94.55	116.19	105	41.02
1826.	Nobody is perfect. (odareal...	256	98.21	133.95	88	34.38
1827.	Severin (elmo96)	256	101.84	120.95	109	42.58
1828.	Tony (complex)	256	96.11	131.84	93	36.33
1829.	Ishaant (ishaant)	255	57.88	75.88	50	19.61
1830.	wpmhog (wpmhog)	255	75.77	99.93	55	21.57
1831.	Triklino (triklino)	255	137.66	183.78	183	71.76
1832.	Yash (thanosyash)	255	70.45	102.01	56	21.96
1833.	shashank (shashaank)	255	38.33	47.50	22	8.63
1834.	trash 22424242424 (y6_chris)	254	111.12	137.91	125	49.21
1835.	Shuccer (shuccer)	254	69.52	97.88	62	24.41
1836.	hafidbuilds (hafidium)	254	55.64	68.63	35	13.78
1837.	(amithps66)	254	58.64	72.68	36	14.17
1838.	PR@NIT (anonymous8)	254	34.27	53.80	19	7.48
1839.	Shaikh Nayeem Uddin (snayeemu)	254	41.92	52.07	20	7.87
1840.	abhiraj (abhirajzzz)	254	24.79	36.64	42	16.54
1841.	Atif (atifzaheer2028)	254	93.05	116.16	103	40.55
1842.	Saied (saied_en)	254	54.94	75.03	47	18.50
1843.	Ankan (nc3rtainity)	253	71.12	90.25	63	24.90
1844.	myshmeh (myshmeh)	253	69.01	84.91	57	22.53
1845.	Anmol (anmolsaraswat)	253	82.04	121.64	87	34.39
1846.	AL (alhasandude)	253	54.68	69.13	32	12.65
1847.	Apu (a1p16u21)	253	37.65	53.15	13	5.14
1848.	braeden (braeden312)	253	71.75	101.17	76	30.04
1849.	Xebion (xebion)	253	78.70	98.81	72	28.46
1850.	Lydia (shiruzu)	253	104.32	123.05	96	37.94
1851.	heh (itno)	253	65.44	85.02	66	26.09
1852.	Math (faster_babe)	253	87.70	103.38	69	27.27
1853.	Zeltraa (zeltraa)	252	77.10	101.67	68	26.98
1854.	Casper (venomizedcasper)	252	78.64	101.53	66	26.19
1855.	Alexander (torphon)	252	94.84	115.80	86	34.13
1856.	Imagine losing (naaskee)	252	63.28	83.14	44	17.46
1857.	Daniel (incognitus)	252	90.71	105.98	103	40.87
1858.	tstats[gad2443] (gad2443)	251	112.66	140.67	120	47.81
1859.	Shadow (shadowkitten)	251	104.49	146.52	111	44.22
1860.	Savantik (savantik)	251	111.36	146.26	123	49.00
1861.	Peter (petepp)	251	45.97	62.30	25	9.96
1862.	Mohammad (qwertland123)	251	58.22	82.68	48	19.12
1863.	Zoe (zhanchi)	250	56.21	69.42	31	12.40
1864.	a (vanazkan)	250	68.87	87.57	53	21.20
1865.	Tianchang (tcliao)	250	86.64	109.02	73	29.20
1866.	Eric (sivade)	250	113.45	168.75	129	51.60
1867.	Illya (maldron)	250	75.59	94.95	54	21.60
1868.	JT (jasonthai)	250	36.81	57.17	17	6.80
1869.	Jorn (dealermedic)	250	92.96	121.12	77	30.80
1870.	Bilbo (bilboballins)	250	99.86	132.19	93	37.20
1871.	bendo (bendh)	250	59.59	78.89	40	16.00
1872.	RAAM (raam_d_prince)	250	75.74	112.07	57	22.80
1873.	Free-Palestine (mohammed_id...	250	71.97	99.72	70	28.00
1874.	Edmilson (milson602)	250	61.41	81.46	51	20.40
1875.	McKenna (mcassady13)	250	94.89	122.24	96	38.40
1876.	Ngoc (maxq42)	250	100.19	121.94	78	31.20
1877.	Pintu (pintukanjia)	249	59.02	79.17	52	20.88
1878.	Michael (mchu519)	249	111.05	131.80	133	53.41
1879.	Eldergod of the Universe (l...	249	117.72	157.37	118	47.39
1880.	JusticeEX (justiceex)	249	101.43	149.19	97	38.96
1881.	Piss Boyy (ineedanickname)	249	94.71	138.47	75	30.12
1882.	ignacio (ifarias25)	249	96.54	123.78	72	28.92
1883.	joster150 (joster150)	249	66.74	84.40	50	20.08
1884.	Jammie (typos_z)	249	203.76	273.89	245	98.39
1885.	DMack (dmack98)	249	89.47	114.53	88	35.34
1886.	czus (czus)	249	71.94	98.74	66	26.51
1887.	sam (samtheguy10)	248	66.48	88.11	50	20.16
1888.	Mamdouh (mamdouh_75)	248	63.65	80.10	54	21.77
1889.	zhata1234 (zhata)	248	83.62	111.42	57	22.98
1890.	Heide (vnit)	247	70.73	96.53	52	21.05
1891.	Kopa_Samsu (aaourav0)	247	57.88	75.43	69	27.94
1892.	ajrv (aamodvarma)	247	109.86	146.08	118	47.77
1893.	Karthik (karthikkumar)	247	68.34	96.09	52	21.05
1894.	GWTNess (gwtness)	247	82.86	109.27	79	31.98
1895.	Matthew (poobcum)	247	64.55	85.36	56	22.67
1896.	Einno (einno)	246	85.68	107.64	81	32.93
1897.	Chowda (chowda)	246	103.45	131.08	100	40.65
1898.	https://youtu.be/dQw4w9WgXc...	246	122.33	152.12	136	55.28
1899.	🦉Tenor🦉 (strigibae)	246	127.91	160.99	154	62.60
1900.	Serial (serial_typer)	246	77.24	101.55	65	26.42
1901.	Luda (ludavis)	246	80.68	103.51	68	27.64
1902.	King (kingcrumple)	246	119.75	153.64	157	63.82
1903.	K (ksil_surface)	245	101.72	127.98	106	43.27
1904.	Coder100 (coder_onehundred)	245	123.08	150.37	134	54.69
1905.	ayushwan (ayush6203)	245	24.31	36.13	53	21.63
1906.	H (macca619)	245	69.80	86.36	61	24.90
1907.	tstats[spyro1411] (spyro1411)	245	57.69	69.17	35	14.29
1908.	Walson (wals)	244	68.49	98.93	64	26.23
1909.	AM (freae)	244	85.46	108.13	87	35.66
1910.	Sajib (dipto)	244	51.72	73.31	39	15.98
1911.	unseasoned lawyer (dindondoe)	244	150.76	221.67	172	70.49
1912.	CrashRAcer1 (crashracer1)	244	52.36	77.70	26	10.66
1913.	Ayden (aydensonline)	244	86.53	120.83	67	27.46
1914.	𓇋𓋴𓆑𓏏𓅪 (infer...	244	85.22	122.49	78	31.97
1915.	Richard (redjoe)	244	104.77	134.29	112	45.90
1916.	norush (norush)	244	84.90	102.24	66	27.05
1917.	Rahaf (rahafalahdab)	243	44.88	57.00	25	10.29
1918.	Eric (pawnnub)	243	89.35	131.88	86	35.39
1919.	mrbean (mrbean1)	243	87.20	104.54	95	39.09
1920.	sk (kasem132)	243	62.87	81.56	49	20.16
1921.	mv0 (the_oko)	243	87.45	104.09	75	30.86
1922.	Crasedes (crasedes)	243	80.60	104.07	60	24.69
1923.	himansh.u7 (mou5etrap)	243	55.91	80.74	27	11.11
1924.	Sweats Money (digital_dankie_)	243	49.86	66.00	30	12.35
1925.	Damian (kztryu)	242	55.40	77.34	26	10.74
1926.	Lirei (lirei)	242	96.79	120.03	68	28.10
1927.	jean (jhyppoli)	242	49.57	68.52	16	6.61
1928.	Iqbal Ahmad (iqbal2021)	242	47.34	66.06	27	11.16
1929.	Rabi (rabiulislam9)	242	61.47	86.22	57	23.55
1930.	. (cuzto)	242	76.31	107.97	53	21.90
1931.	Shayne (shayneacasio)	242	87.85	124.52	81	33.47
1932.	Stijn (stijnmeijssen)	241	77.03	105.23	48	19.92
1933.	Hour (soslow_)	241	59.29	76.81	34	14.11
1934.	Bijay (shresthabijay)	241	64.17	86.84	48	19.92
1935.	Anisur (anis_017)	241	77.14	99.18	43	17.84
1936.	Amogh (amogh_14)	241	80.35	103.45	75	31.12
1937.	Aditya (aditya2712)	241	75.28	97.27	62	25.73
1938.	Jay (eradekator)	241	94.28	116.24	72	29.88
1939.	Benji (benbind1)	241	85.75	109.55	69	28.63
1940.	Arschwurst (arschwurst)	241	48.67	62.81	26	10.79
1941.	DeeDee (deedee09)	240	68.04	81.17	49	20.42
1942.	Joaquin (wakincloset)	240	91.00	110.57	92	38.33
1943.	Andrea (tinola)	240	77.11	96.22	51	21.25
1944.	Jonathan (insanegamerwow)	240	132.85	167.10	173	72.08
1945.	Alex (aleksandr797)	240	73.67	94.57	67	27.92
1946.	Allen (xs_ageart)	239	106.14	131.82	109	45.61
1947.	Konstantinos (sotos01)	239	43.87	61.41	160	66.95
1948.	Prajwal (prajwalr)	239	56.67	75.22	38	15.90
1949.	page (phrynesc)	239	73.28	86.76	66	27.62
1950.	William (bobodahobo54)	239	88.39	105.80	65	27.20
1951.	SaeedUllah (asadjani)	239	59.28	76.84	39	16.32
1952.	Ritesh (ritesh_98)	238	63.29	86.74	52	21.85
1953.	Pedro (peter50latam)	238	53.00	80.22	22	9.24
1954.	Krispy (krispytypes)	238	119.56	144.01	129	54.20
1955.	Missy (lovelydy)	237	84.73	104.69	62	26.16
1956.	LoneRusher (lonerusher)	237	78.70	99.87	61	25.74
1957.	gabe (gabeeeeee)	237	96.06	140.01	87	36.71
1958.	mostafa (eng_mustafa)	237	68.65	91.63	59	24.89
1959.	Dhaval (dhaval06)	237	73.67	96.31	71	29.96
1960.	Chaos (chaoszed)	237	87.29	112.28	80	33.76
1961.	Caffebar kb lmao! (baccupacc)	237	142.80	172.17	182	76.79
1962.	Absect (absect)	237	44.37	59.62	22	9.28
1963.	Noobtyper (noobtyper96)	237	54.71	70.63	30	12.66
1964.	Juan (juanmachuca95)	237	58.93	71.47	34	14.35
1965.	Snail (type_of_a_typer)	237	57.40	70.43	27	11.39
1966.	Doan (zzzhzzz)	236	60.91	83.62	47	19.92
1967.	Zen (zenchan123)	236	101.60	147.96	94	39.83
1968.	Matrix (ss005)	236	83.74	104.55	68	28.81
1969.	ThorNMR (thor_nmr)	236	33.42	47.05	13	5.51
1970.	be nice slunt (jokii)	236	128.12	162.13	152	64.41
1971.	Jejo (jejo03)	236	60.89	83.78	45	19.07
1972.	Natchanon (irmia223)	236	86.72	109.02	69	29.24
1973.	Anatoli (errormaker)	236	73.65	90.04	42	17.80
1974.	Pawel (el3ctron)	236	36.42	49.38	11	4.66
1975.	Chronic (cheng01)	236	44.01	59.37	12	5.08
1976.	Casper (bighero86)	236	67.32	88.10	59	25.00
1977.	beatrace (beatrace21)	236	55.80	76.63	23	9.75
1978.	Austin (_8(|) (atrain742)	236	118.35	156.30	115	48.73
1979.	Inferno (mohmadrid0)	236	113.37	144.09	191	80.93
1980.	Roshan (roshan_satare)	235	77.79	97.82	73	31.06
1981.	Joe (__joe___mama__)	235	87.84	119.29	62	26.38
1982.	djagof (zuccandsucc)	235	105.29	134.07	149	63.40
1983.	Akira (s_akira)	235	55.47	72.59	34	14.47
1984.	Stelister (stelister)	235	74.84	96.01	71	30.21
1985.	SMoon (smoon343)	235	60.29	75.76	39	16.60
1986.	Khadea (charter)	235	121.56	154.55	131	55.74
1987.	Brandon (baddoodle)	235	68.30	93.63	48	20.43
1988.	Daito (blucantrell)	234	87.29	112.94	65	27.78
1989.	Julius (reallyoldfart)	234	33.15	48.11	19	8.12
1990.	Kusmir (kusmir)	234	94.80	120.97	78	33.33
1991.	jeremyWINZ (jeremiah_munguia)	234	117.12	156.06	110	47.01
1992.	Jan (acpehalus)	234	71.02	101.91	57	24.36
1993.	Shubham (shubham_p)	234	39.79	60.59	16	6.84
1994.	Jamo (thewindy)	233	97.00	123.03	93	39.91
1995.	Syed Sheraz (syedsherazarshad)	233	32.53	50.38	24	10.30
1996.	strgn (strgn)	233	30.40	42.42	24	10.30
1997.	Stanislav (stanmkh)	233	90.32	124.68	64	27.47
1998.	Saptarshi (lamda_cdm_10)	233	59.88	77.26	50	21.46
1999.	Jagadeeswar (jd_300)	233	76.86	103.43	66	28.33
2000.	Buchock (buchok)	233	51.97	76.01	23	9.87
2001.	Abby (aeheffington)	233	111.10	135.39	116	49.79
2002.	Sushant (sushant09)	233	72.82	88.35	58	24.89
2003.	Chumchum (aldzia)	232	97.61	127.89	148	63.79
2004.	acg (acg26)	232	86.86	118.16	63	27.16
2005.	fassasin (fassasin)	232	67.55	91.95	63	27.16
2006.	aryan (_ar__yan_)	232	50.31	68.12	57	24.57
2007.	Kotai (kotai)	232	74.16	100.37	56	24.14
2008.	Tootels (joenasha10)	232	113.12	151.52	92	39.66
2009.	Harry (hai1912001)	232	56.80	72.32	18	7.76
2010.	Gojou (gojou_)	232	28.02	43.03	32	13.79
2011.	Vishwajeet Prasad (vishwaje...	232	62.95	82.22	69	29.74
2012.	Ralph Angelo (slow_penguin)	232	85.27	111.21	53	22.84
2013.	Nistha Nakarmi (simply_nisu)	232	57.88	77.49	39	16.81
2014.	Jerzy (mr_avocado)	232	60.20	76.74	42	18.10
2015.	但行好事，莫問前程...	232	86.29	110.21	64	27.59
2016.	Doniyorbek (doniyorbek7376)	231	60.16	76.52	39	16.88
2017.	David (dave_em)	231	97.84	120.33	45	19.48
2018.	Jaime Gabriel (_jetdoza)	231	88.38	123.70	76	32.90
2019.	Boba (tapiocaman)	231	84.85	110.28	71	30.74
2020.	nice'nslow (annoyingkid)	231	129.49	159.10	141	61.04
2021.	Quinn (magicsoap444)	231	42.62	64.07	34	14.72
2022.	Dhayanandh (ken_adams)	231	104.41	121.91	91	39.39
2023.	Jane (sarf)	231	85.35	113.61	81	35.06
2024.	RainbowDude (rainbowdudenon...	231	114.69	159.45	93	40.26
2025.	projectfupagain (projectfup...	231	91.62	110.20	78	33.77
2026.	Ahmed (nesbmido)	231	129.65	168.18	142	61.47
2027.	Temple (mason_carlson)	231	89.44	127.78	90	38.96
2028.	Eric (qwarts)	230	105.53	138.65	83	36.09
2029.	Jude (philivey)	230	76.48	96.88	47	20.43
2030.	Murat (nocs782)	230	65.56	85.93	49	21.30
2031.	HATE LAG! (11fingerstypist)	230	115.23	144.48	192	83.48
2032.	epic (epicrako123)	230	93.50	117.12	118	51.30
2033.	throw (bomnom)	230	113.31	147.38	129	56.09
2034.	William (willmart16)	230	112.05	134.19	120	52.17
2035.	jamal (jamalkhan651432)	230	46.78	61.93	21	9.13
2036.	galei (galei)	230	100.75	139.88	92	40.00
2037.	H7ti guy (eternality)	229	113.46	155.26	98	42.79
2038.	Emilio (emilioc)	229	84.92	118.58	54	23.58
2039.	⚡DVORAK (dvorak_mg)	229	105.31	139.59	107	46.72
2040.	prashant (prashant1847)	229	59.10	77.91	41	17.90
2041.	Reverend Poo Poo Bum (poopy...	229	86.31	114.32	66	28.82
2042.	obada (obada_yahya)	229	98.60	127.83	83	36.24
2043.	Niels (nielsjensen)	229	111.52	153.85	106	46.29
2044.	Angela (mee_123)	229	39.15	51.08	9	3.93
2045.	Brandon (aceryeung)	229	76.05	109.67	53	23.14
2046.	Niket (daspacebar)	229	70.69	94.67	61	26.64
2047.	Yasser (yass_mg)	229	59.49	71.83	40	17.47
2048.	Matthew (yossarian_milo_22)	229	93.97	110.54	71	31.00
2049.	Martin (watchieboy)	229	96.77	128.67	87	37.99
2050.	Tutuko (tutuko)	229	50.58	60.75	20	8.73
2051.	thotbox (thotb0x)	229	72.10	95.36	58	25.33
2052.	M (springfield12)	229	112.36	134.83	135	58.95
2053.	Tuukka (sblankg)	228	89.77	110.74	83	36.40
2054.	Minnie (minniemouselondon)	228	87.86	111.45	75	32.89
2055.	John (kingpigeon)	228	70.92	96.62	56	24.56
2056.	Killyan (killyan)	228	94.72	127.28	89	39.04
2057.	Pradhumn (darkinferno)	228	52.72	72.05	34	14.91
2058.	bambang (breakingkeyboards)	228	86.06	106.73	77	33.77
2059.	INDIAN (armaan25)	228	69.89	89.69	53	23.25
2060.	FreePalastine (1omar1)	228	42.41	62.17	23	10.09
2061.	AdamS (adamswabel)	228	68.72	88.50	47	20.61
2062.	ARW🔴 (appleredwarrior)	227	117.71	152.17	132	58.15
2063.	QDDFR (qddfr)	227	54.05	77.03	44	19.38
2064.	Joy (joypark21)	227	77.26	118.02	55	24.23
2065.	Ian (iantu)	227	75.26	92.57	51	22.47
2066.	zaoad (zaoad)	227	56.33	71.43	26	11.45
2067.	Drovor (wwinder)	227	108.66	143.11	110	48.46
2068.	JAFFAR (thetypingfreak)	227	54.78	82.22	47	20.70
2069.	Shahryar (srashid3)	227	65.03	90.08	51	22.47
2070.	Girl (piemaniac)	227	84.78	113.74	63	27.75
2071.	Royce (panda_7)	227	47.79	60.49	24	10.57
2072.	Jacob (nutsak)	227	81.94	110.00	60	26.43
2073.	Mike (mirkzzz)	227	67.88	83.80	27	11.89
2074.	Jazz (melotea)	227	77.74	108.78	52	22.91
2075.	Aaron (a_aron)	227	57.01	74.64	32	14.10
2076.	Rafael (fegelein1234)	226	132.02	169.54	167	73.89
2077.	fares (faressonar)	226	46.39	63.08	24	10.62
2078.	Christian (amici117)	226	108.45	141.44	113	50.00
2079.	kemp (imnotflamez)	226	92.48	143.48	74	32.74
2080.	Someone (gluroy)	226	57.40	72.77	40	17.70
2081.	Hussain (sanpilot)	226	96.46	126.39	86	38.05
2082.	omid (omidhopeful)	226	69.52	87.03	48	21.24
2083.	Neil Franco (neilprangko)	226	116.63	158.38	130	57.52
2084.	Axel (scorchill)	225	63.76	79.16	42	18.67
2085.	Night (anemonighteye)	225	70.98	104.02	55	24.44
2086.	Jared (jaredintyper)	225	88.46	111.62	75	33.33
2087.	bruh_momentum (travis358)	225	104.24	126.13	112	49.78
2088.	Flying fingers (tg_gamer)	225	41.64	58.08	15	6.67
2089.	ak1ra (liamprogamerz)	225	77.70	95.76	56	24.89
2090.	Janis (janisl1993)	224	71.45	92.82	56	25.00
2091.	Ankh (ankhaann)	224	39.73	52.09	14	6.25
2092.	Ghazi (lynnackerman)	224	65.58	82.47	46	20.54
2093.	sanny (scd92318)	224	81.05	115.54	66	29.46
2094.	Pontus (ponhav)	224	113.45	142.15	114	50.89
2095.	mohamed (mohamed_1800)	224	48.19	61.16	16	7.14
2096.	sinc02 (sinc02)	224	82.05	104.25	71	31.70
2097.	Antonio (xxaposxx)	223	52.08	73.08	27	12.11
2098.	BeltBoy (singbearcar)	223	56.91	71.34	29	13.00
2099.	aditya (aditya1003)	223	47.19	56.89	20	8.97
2100.	* (000100020003)	223	73.34	95.03	56	25.11
2101.	soenke (stinkfuhl)	223	51.91	68.11	24	10.76
2102.	Khai (khaikhai2)	223	114.23	149.44	120	53.81
2103.	jia-da-kong (jiadakong)	223	61.38	74.63	57	25.56
2104.	phantom (hrithikhack007)	223	59.05	82.47	33	14.80
2105.	Malaikev (fonsdal)	223	74.79	97.38	56	25.11
2106.	Nick (checksind)	223	109.93	133.91	106	47.53
2107.	BR (brdiesel)	223	109.73	131.32	93	41.70
2108.	Bùi (blackfl_12)	223	79.87	98.80	72	32.29
2109.	mostafa (mostafa_tantawy)	223	61.56	75.65	43	19.28
2110.	mbi (mbi_)	223	36.89	49.22	22	9.87
2111.	Rony (ravneet_b)	222	92.25	120.73	81	36.49
2112.	kyle (poyser)	222	76.46	94.26	54	24.32
2113.	Rohit (kharkongor)	222	80.09	102.96	63	28.38
2114.	Zain (zainabb)	222	63.79	84.08	56	25.23
2115.	Adm1n (vilius8)	222	110.69	136.11	109	49.10
2116.	tris (trisywc)	222	89.23	116.94	57	25.68
2117.	Hendo (slimshadylfc)	222	94.67	124.97	95	42.79
2118.	arindam (ari2007b)	222	54.45	71.91	27	12.16
2119.	Andie (andieeee)	222	74.78	123.19	72	32.43
2120.	tstats[alexander98] (alexan...	222	64.26	83.02	35	15.77
2121.	Abubakar (abubakaravg)	222	47.32	65.58	18	8.11
2122.	tstats[cartax] (cartax)	222	51.76	66.93	24	10.81
2123.	Darth (darthverde)	222	77.07	106.82	56	25.23
2124.	August (august148)	222	46.60	59.21	29	13.06
2125.	Philipp (dasdrache)	221	45.29	57.92	22	9.95
2126.	xiaobao (xiaobaomontgomery)	221	43.98	59.12	16	7.24
2127.	quantum (sexhaver25)	221	93.23	136.94	56	25.34
2128.	Rinmawia (rinmawia)	221	69.87	90.27	53	23.98
2129.	Junkie (qwert_noob)	221	69.02	98.48	46	20.81
2130.	nirmit (nirmit0)	221	64.83	80.08	40	18.10
2131.	ktp (ktp2222)	221	56.87	78.72	27	12.22
2132.	(altrocality)	221	121.19	154.58	117	52.94
2133.	Jocho Muaguadabo (alezander...	221	108.33	136.99	98	44.34
2134.	Cheyenne (cheyennebuchanan)	221	36.16	53.07	9	4.07
2135.	Taiwan is a country (17lingh1)	220	85.07	109.13	65	29.55
2136.	jnk (joelnanakwaku)	220	81.90	104.93	64	29.09
2137.	Yash (mitrapandit)	220	55.92	75.26	43	19.55
2138.	school (modernmarauder)	220	93.24	132.42	81	36.82
2139.	Božidar Grgur (marcipanko)	220	68.60	87.13	56	25.45
2140.	Dean (dino22)	220	59.74	71.91	94	42.73
2141.	Deepesh (codingdeepesh)	220	38.88	55.79	18	8.18
2142.	clgq (clgq)	220	76.79	99.89	44	20.00
2143.	Bloxxer (bloxxerboi_rblx)	220	59.88	88.77	46	20.91
2144.	Harmonic (blitzzzz)	220	88.42	116.35	65	29.55
2145.	Bekboalt (bekbo_0)	220	38.00	47.50	11	5.00
2146.	bryan (bczw)	220	135.33	162.62	173	78.64
2147.	Zeeshan (zeeshan13)	220	94.47	131.94	74	33.64
2148.	Richard (tbone001)	220	84.15	105.43	57	25.91
2149.	Wilson (starkeyqiu)	220	78.79	106.02	56	25.45
2150.	Sky man (koolienavy)	220	99.75	135.87	91	41.36
2151.	lan (lenioniali)	219	48.72	63.14	22	10.05
2152.	sunny (kamal787)	219	31.67	44.09	14	6.39
2153.	John (blazian11111)	219	103.05	143.47	81	36.99
2154.	Aryan (arcuh)	219	85.05	112.37	76	34.70
2155.	Andy (andyrox)	219	72.15	94.51	74	33.79
2156.	Sahaj (sahaj01)	219	62.15	80.34	44	20.09
2157.	Robbe (robbelbobel)	219	83.25	106.91	72	32.88
2158.	Guest (nherbe_3)	219	62.78	91.45	40	18.26
2159.	Mohamad (mohamadasghari)	219	75.67	107.10	50	22.83
2160.	(timjeffery44)	219	143.55	268.06	183	83.56
2161.	Jeffrey (xxpreheattheoven)	218	89.35	110.06	82	37.61
2162.	diva (vampirediva)	218	90.29	123.27	55	25.23
2163.	amanmishra (amanmishra)	218	51.42	74.25	23	10.55
2164.	Wan Iskandar (wanis02)	218	50.79	68.37	28	12.84
2165.	ASHISH (ashish_typer)	218	53.23	74.14	23	10.55
2166.	Marcus (flowerskullbeige)	217	86.68	115.24	61	28.11
2167.	chang (chang1)	217	126.46	155.13	121	55.76
2168.	Jonathan (jonapedia)	217	90.85	121.23	62	28.57
2169.	tayoshu (tayoshu)	217	76.14	93.51	57	26.27
2170.	not (not_vidhu)	217	71.65	95.81	67	30.88
2171.	MiamMiam (miammiam100)	216	60.97	76.28	43	19.91
2172.	iTay (mengleten)	216	92.62	122.22	78	36.11
2173.	Danny (lifeupsidedown)	216	70.29	87.19	47	21.76
2174.	J (leathface23)	216	62.06	76.95	37	17.13
2175.	Jude (jfendo)	216	81.09	109.76	63	29.17
2176.	Minä (arabwinner)	216	110.06	128.48	96	44.44
2177.	Jarred (reed_19)	216	40.34	55.05	15	6.94
2178.	Tomáš (eyzi25)	216	85.72	108.09	52	24.07
2179.	EnkaOsaru (enkaosaru)	216	97.89	124.45	104	48.15
2180.	rocket (dk0063)	216	51.71	67.99	12	5.56
2181.	Wasif (waxif_dad)	216	45.56	63.11	26	12.04
2182.	Shibasis (ship9x)	216	82.16	104.50	73	33.80
2183.	Dima (zormik)	215	74.68	97.22	67	31.16
2184.	youssef (youssefuser)	215	31.43	40.98	24	11.16
2185.	UNSALEK #7379 discord (unsa...	215	90.41	123.61	55	25.58
2186.	saerith (arabianghosthaunting)	215	220.94	281.09	147	68.37
2187.	Aaron (aaron5457)	215	61.86	78.02	38	17.67
2188.	Rohit (rawheattt)	215	50.69	67.23	18	8.37
2189.	Gulam Mustafa (mr_x003_)	215	30.10	44.92	19	8.84
2190.	Spencer (noctis0923)	215	78.84	106.33	67	31.16
2191.	Sanket (newbie24082002)	215	72.85	99.53	59	27.44
2192.	King (kingmaverick07)	215	62.10	80.35	46	21.40
2193.	joann (joannyo)	215	60.38	91.45	51	23.72
2194.	J (jj024)	215	54.64	74.63	20	9.30
2195.	JV (jibs12)	215	83.31	98.14	61	28.37
2196.	Kuro (horikta)	215	60.93	85.46	48	22.33
2197.	Gautam kumar pandey (gautam...	215	42.45	54.03	16	7.44
2198.	Beth (creepmother)	215	92.29	114.01	71	33.02
2199.	Anh (billybean__)	215	103.32	131.33	83	38.60
2200.	Edmund (emmit3)	214	65.53	90.91	46	21.50
2201.	Dyer_Colemak (dyer500)	214	86.07	124.41	63	29.44
2202.	Lian (paullian)	214	83.63	104.78	55	25.70
2203.	Nootch (nootch)	214	112.05	146.02	122	57.01
2204.	Vinayak (vinrana)	214	70.16	89.58	65	30.37
2205.	Alex (arint)	214	87.60	113.16	71	33.18
2206.	Ariffin (ariffin)	214	99.67	127.89	86	40.19
2207.	aerospike (aerospike)	214	59.61	83.07	43	20.09
2208.	Ems (emman123)	214	52.92	70.79	22	10.28
2209.	Lin (ltf0501)	214	77.51	96.15	44	20.56
2210.	Abudlla.Marofi04 (jonsnow21)	214	44.71	58.46	25	11.68
2211.	Isra (israabosada)	214	32.23	44.05	21	9.81
2212.	Viktoras (haeven)	214	84.35	113.10	69	32.24
2213.	Stuipedd (stuipedd)	213	82.36	106.68	62	29.11
2214.	Byunghyun (stringbottle)	213	74.13	97.47	52	24.41
2215.	Cue (cuewitiwat)	213	72.69	97.79	50	23.47
2216.	Chimney (chimneywastaken)	213	66.45	82.42	52	24.41
2217.	Shannon (caseius)	213	86.11	110.22	78	36.62
2218.	Ryan (relaxin)	213	143.23	181.36	131	61.50
2219.	Brian (pocket_ace)	213	78.15	94.60	56	26.29
2220.	ryan (anonymousboy321)	213	128.60	154.10	149	69.95
2221.	Andrew (andumpling)	213	95.82	118.37	91	42.72
2222.	victor (hungry_panda)	213	43.36	59.58	12	5.63
2223.	Alutic (alutic)	212	91.84	114.13	90	42.45
2224.	FrozenCroissant (frozencroi...	212	100.47	126.98	100	47.17
2225.	exodia (exodiaa)	212	109.24	129.60	106	50.00
2226.	:^) (kyeavnign)	212	130.60	176.13	148	69.81
2227.	Hazem (zomaaa23)	212	61.33	79.01	41	19.34
2228.	Dog acc (vick02)	212	129.05	154.08	130	61.32
2229.	noah (randylehey)	212	92.69	119.81	74	34.91
2230.	Monroe (monroeshindelar)	211	87.57	111.47	53	25.12
2231.	Ghulam (malikgd65)	211	47.62	70.61	20	9.48
2232.	Aarni (aarnib)	211	91.01	119.36	81	38.39
2233.	Arun (arunbastola)	211	58.25	71.88	52	24.64
2234.	LA LUNA, LA BELLA LUNA (fee...	211	120.60	161.68	125	59.24
2235.	👻 (damoru)	211	115.39	158.97	102	48.34
2236.	ROOZBEH (verybadboy)	211	63.02	89.59	37	17.54
2237.	Scott (typist2021)	211	64.55	79.52	56	26.54
2238.	Mr.Typist (typer456new)	211	60.26	78.29	27	12.80
2239.	ExtraSauce (thundertyping)	211	68.78	99.72	47	22.27
2240.	kbd warior (spykids3)	211	101.96	139.93	101	47.87
2241.	Yuhang (yuhang0722)	210	105.51	137.06	96	45.71
2242.	Grzegorz (ulxori)	210	63.74	81.66	51	24.29
2243.	Benny (typervain)	210	82.60	106.18	44	20.95
2244.	Tahir (tahir_iqbal)	210	100.63	129.73	88	41.90
2245.	Richard (allacrity)	210	71.47	86.02	40	19.05
2246.	Ayman (akwah)	210	77.09	100.36	58	27.62
2247.	Samvel (samveland)	210	89.91	125.32	62	29.52
2248.	Ryan (rinselmann)	210	87.99	103.57	70	33.33
2249.	duglass (rahafduglass)	210	62.43	84.02	46	21.90
2250.	Myil (pink_coder0518)	210	51.31	91.51	28	13.33
2251.	Morin (lordgroovy)	210	83.07	106.02	67	31.90
2252.	Mr. A (itsabhi01)	210	82.74	106.91	90	42.86
2253.	Juanpa (gokias_1234)	210	70.11	91.70	50	23.81
2254.	Dras (dras227)	210	59.06	77.90	39	18.57
2255.	Kratagya (chutiyatyper)	210	77.48	98.83	40	19.05
2256.	elite (beatagent)	210	54.39	69.35	19	9.05
2257.	Doiv (doiv23)	209	85.99	112.45	62	29.67
2258.	Dmitriy (dj1vs)	209	69.67	89.07	54	25.84
2259.	Bennett (bnnttnwhk)	209	75.83	95.27	50	23.92
2260.	i am (ashou)	209	100.51	141.45	82	39.23
2261.	odannnnnnn (quietkid)	209	82.17	111.19	53	25.36
2262.	oddblob3000 (oddblob3000)	209	106.90	134.00	98	46.89
2263.	Saken (hareket)	209	36.76	53.20	14	6.70
2264.	zetrorectar (zetrorectar)	209	48.11	62.24	25	11.96
2265.	Liampbjray (liampbjray)	209	72.48	97.45	50	23.92
2266.	kaloyan (kalci)	209	71.58	96.61	46	22.01
2267.	kyubkubkubkubyub (kyubkubku...	208	97.89	136.78	88	42.31
2268.	jw (jw_c)	208	59.97	81.28	35	16.83
2269.	Esman (hedwyn_the_nomad)	208	74.42	97.71	60	28.85
2270.	rt (rtizzle)	208	69.35	92.94	62	29.81
2271.	rahul (rku05)	208	46.38	63.97	22	10.58
2272.	𝐱𝐨𝐦𝐞𝐧𝐢�...	208	78.88	104.17	53	25.48
2273.	Rui Alexandre (tapadinhas)	208	50.13	64.52	16	7.69
2274.	shaun (shaunbot_123)	208	68.40	91.34	55	26.44
2275.	GaN (ganthegreat)	208	50.88	75.09	36	17.31
2276.	Dalia (snoppy366)	208	49.07	64.11	27	12.98
2277.	ss (aaassssss)	207	29.21	40.15	25	12.08
2278.	Joe (f1rest0rm)	207	64.47	83.59	39	18.84
2279.	glenn (bukseng)	207	98.85	122.09	96	46.38
2280.	Bean (beansbeansbeans)	207	84.71	106.33	41	19.81
2281.	zaid (xoxygenkillerx)	207	68.98	95.24	50	24.15
2282.	Soyuzbek (soyuzbek)	207	67.65	91.86	47	22.71
2283.	SirAlig (siralig)	207	85.37	107.31	57	27.54
2284.	Omid (zerodarkshadow)	206	66.25	89.98	52	25.24
2285.	Nils (snils)	206	75.12	103.87	49	23.79
2286.	God (godalmighty_)	206	26.37	41.74	38	18.45
2287.	Conspiracy (realkingofgames)	206	91.98	112.54	65	31.55
2288.	Afsal (npafsal)	206	59.75	75.39	55	26.70
2289.	Uncle John Jr. the 5th (che...	206	81.49	108.86	51	24.76
2290.	| (canvaslol)	206	77.33	99.52	57	27.67
2291.	Ivandro (bigivel)	206	90.15	107.99	75	36.41
2292.	Reiner Rekado Bisara (reine...	205	48.72	65.58	33	16.10
2293.	raj bardhan singh rathore (...	205	42.87	55.74	24	11.71
2294.	Maheriniaina tstats[kevinrs...	205	84.69	111.69	54	26.34
2295.	Grant (grantly)	205	97.61	131.90	90	43.90
2296.	Gnarly (gnarlydawg)	205	87.28	110.08	53	25.85
2297.	Nope (_sav)	205	83.13	98.60	61	29.76
2298.	Noob (_anto_200)	205	35.83	52.33	22	10.73
2299.	Khai (superoiishi)	205	88.12	106.31	78	38.05
2300.	Shaishav (shaishav)	205	55.06	73.35	41	20.00
2301.	Zor-Pieu (peter00151)	205	84.58	103.20	48	23.41
2302.	mr (mrantik1)	205	53.46	69.72	28	13.66
2303.	Neo (meoo)	205	55.41	83.19	29	14.15
2304.	Mathias (mattsric)	205	72.49	89.88	56	27.32
2305.	Ryan (ronethenorseman)	204	84.57	102.86	47	23.04
2306.	i'm slow (pndspirit)	204	94.97	124.61	78	38.24
2307.	(nnas)	204	137.39	164.68	165	80.88
2308.	Ngor (nagwick)	204	63.27	80.57	55	26.96
2309.	JH (hou32hou)	204	86.85	107.88	59	28.92
2310.	Ali (hardstone)	204	67.26	90.58	38	18.63
2311.	Gert (hansonagarrett)	204	73.45	92.08	47	23.04
2312.	DP (dragonphoenix)	204	57.27	68.25	33	16.18
2313.	Darren (darrensey)	204	90.14	122.16	73	35.78
2314.	Bas (basawasa)	204	75.41	98.24	55	26.96
2315.	Golujs2000 (avinashjs2000)	204	52.48	70.17	20	9.80
2316.	Juan (vlect2)	204	70.45	89.66	56	27.45
2317.	Tyler (superkai65)	204	99.49	127.42	77	37.75
2318.	Sadie (thotchakra)	203	82.29	108.05	70	34.48
2319.	Jayson (thezeful)	203	77.65	100.03	80	39.41
2320.	supermonkey (sup3rm0nk3y)	203	80.10	98.23	44	21.67
2321.	Joshua (shaggymuffin23)	203	88.43	104.39	69	33.99
2322.	Fearo (fearowastaken)	203	82.16	107.84	64	31.53
2323.	runa (dawn_89)	203	57.29	71.67	30	14.78
2324.	lemonade (chqnges)	203	141.14	173.40	150	73.89
2325.	Byron (byrontan)	203	100.19	125.81	99	48.77
2326.	Đỗ (bigcatyoyo)	203	72.13	90.30	47	23.15
2327.	Ranch (ranchie)	203	80.38	107.34	60	29.56
2328.	Ragnar (ragnar000lothbrok)	203	67.13	80.75	46	22.66
2329.	Pavan (pavan1000)	203	54.18	65.46	17	8.37
2330.	Mattias (matejko203)	203	44.67	64.95	18	8.87
2331.	Gordon (gordon_ramsay)	203	87.32	106.13	63	31.03
2332.	Mahjabin (mahjabin08)	202	31.27	40.62	17	8.42
2333.	Khizer (khizlaw)	202	91.79	114.68	58	28.71
2334.	Non-quit (hitman2207)	202	112.21	136.72	106	52.48
2335.	harshit (harshit712)	202	73.73	102.39	54	26.73
2336.	Kim (rsoler)	202	67.80	88.43	35	17.33
2337.	3.14 (rom3_141592)	202	87.98	118.75	47	23.27
2338.	Patrik (pbody)	202	79.22	100.66	52	25.74
2339.	Ta-Wei (waynetu)	202	97.18	111.64	88	43.56
2340.	Trent (tdavis23540)	202	82.96	109.41	55	27.23
2341.	🤫 (semajames)	202	152.85	195.47	162	80.20
2342.	Feariscool (fearisdumb)	202	60.30	79.45	45	22.28
2343.	Donovan (donovanle)	202	92.82	121.21	64	31.68
2344.	bataa (batuchka)	202	60.29	83.32	49	24.26
2345.	ben (benji2k)	202	90.79	114.79	80	39.60
2346.	et (amogus_irl)	201	79.83	104.60	58	28.86
2347.	:( (altrocality_dvorak_acc)	201	121.44	145.99	108	53.73
2348.	Vu (vuquynghia2)	201	61.95	80.41	40	19.90
2349.	Luna (vexara)	201	109.56	141.93	95	47.26
2350.	Nervous (unselfishnervousha...	201	78.98	103.76	60	29.85
2351.	TennisGOAT (tennislegend1234)	201	60.66	79.23	32	15.92
2352.	adel (thenewb)	201	47.48	60.91	17	8.46
2353.	w (shwilliam)	201	80.63	99.98	49	24.38
2354.	Ismail (ismailo)	201	92.59	122.04	85	42.29
2355.	Pokeman (poke_man)	201	86.84	113.97	64	31.84
2356.	Ox (oxtookbronze)	201	83.48	103.85	59	29.35
2357.	chupapi (nerve784126)	201	61.06	82.21	45	22.39
2358.	Sasha (moongue)	201	59.78	78.71	34	16.92
2359.	Bruno (brutal_posso1)	201	42.20	55.63	9	4.48
2360.	Raunak (englishassignment)	200	99.73	130.78	81	40.50
2361.	Dastan (dastangosu)	200	82.77	102.99	71	35.50
2362.	Drew (bigboisausage)	200	100.18	134.57	79	39.50
2363.	m0nsteR (m0nsta321)	200	105.03	128.90	98	49.00
2364.	Noman (khan_noman14)	200	95.13	115.12	65	32.50
2365.	jerome (jonaslabryinth)	200	89.27	113.67	72	36.00
2366.	Sensei (jjxjacpot)	200	88.24	114.16	76	38.00
2367.	Hussein (husseinabbas)	200	47.96	61.49	17	8.50
2368.	Himanshu (himanharsh)	200	53.47	66.82	25	12.50
2369.	hein (heinthant)	200	71.51	92.61	40	20.00
2370.	Hal (hals11)	200	107.09	139.62	90	45.00
2371.	FunkyChunkyMon (funkychunky...	200	90.04	121.03	61	30.50
2372.	Sean Wrona (arenasnow2)	200	183.61	226.45	182	91.00
2373.	javaMiddle (java_coder)	200	37.91	55.95	11	5.50
2374.	igs (x7041)	200	110.28	136.78	101	50.50
2375.	Krimmson (wrk4thjkr)	200	60.00	79.12	24	12.00
2376.	jawn (turtlesrule)	200	133.51	173.00	125	62.50
2377.	steel (steelmax1214)	200	68.56	88.98	63	31.50
2378.	RI (speedraceriyer)	200	85.52	119.92	50	25.00
2379.	Luka (soleesoki)	200	75.20	102.31	58	29.00
2380.	Deathnote (sanjay_kumar)	200	57.58	83.36	38	19.00
2381.	Robert (rrobertt3137)	200	92.99	122.84	75	37.50
2382.	RacerTracer (racertracer)	200	44.69	63.25	14	7.00
2383.	oni (onifire)	200	79.33	100.32	47	23.50
2384.	Murcury (murcury_)	200	60.33	76.85	40	20.00
2385.	Ivan (sakhman)	199	59.63	80.39	32	16.08
2386.	Mirjalol (mirjaloltv)	199	44.71	58.51	21	10.55
2387.	Mariam (mariamgharraph)	199	54.51	80.79	28	14.07
2388.	guest (okokok1234)	199	68.58	90.07	36	18.09
2389.	stream census designated by...	199	82.18	113.82	56	28.14
2390.	Manami (manami_kun)	199	61.69	85.75	28	14.07
2391.	TribalAxe (darkulas)	199	76.08	96.52	50	25.13
2392.	Cameron (cameronicheese)	199	101.22	137.52	81	40.70
2393.	Phung (longphung151198)	199	94.99	117.37	89	44.72
2394.	Liu (liusbl)	198	107.11	125.47	90	45.45
2395.	Elias (eddyede)	198	73.55	97.68	38	19.19
2396.	🌸Peaches & Cream (easy_g...	198	117.75	143.53	90	45.45
2397.	Dhruv (dhruvarora)	198	66.18	85.87	45	22.73
2398.	kirito (boscomk3)	198	61.14	78.68	38	19.19
2399.	ᕙ( ͡◉ ͜ ʖ ͡◉)ᕗ ...	198	78.94	106.93	55	27.78
2400.	rohan (rohanktksu)	198	51.54	81.98	17	8.59
2401.	helga (pataki29)	198	43.68	61.30	18	9.09
2402.	cody (ocdy1001)	198	87.34	109.40	65	32.83
2403.	medD (mistermask___)	198	92.28	132.69	74	37.37
2404.	Keo (mightkeo)	198	69.85	91.39	39	19.70
2405.	Amorphous (tawseef)	198	56.31	69.72	20	10.10
2406.	McMac2 (sjm46)	198	108.91	134.41	97	48.99
2407.	Shivanju (shivanju)	198	75.21	91.37	47	23.74
2408.	yassine (yassie)	197	52.29	74.36	26	13.20
2409.	toomuchads (toomuchads)	197	78.98	103.47	50	25.38
2410.	Danny (dannyzzzzz)	197	101.38	128.31	76	38.58
2411.	chigala (chigalakingsley)	197	47.48	74.86	19	9.64
2412.	logan (lacton44)	197	84.27	110.76	70	35.53
2413.	Kakini007 (kakini)	197	65.70	96.34	34	17.26
2414.	Jynx (jynx__)	197	73.51	93.48	47	23.86
2415.	J (jellyfiszh)	197	81.87	114.28	60	30.46
2416.	haniel monki (ivious)	197	75.08	100.08	45	22.84
2417.	Cain (gigabite)	197	69.07	90.49	53	26.90
2418.	Gibus (ghastless_gibus)	197	74.05	101.30	54	27.41
2419.	Arasu (arasu)	197	106.63	137.73	94	47.72
2420.	Cornelius (salibzz)	197	97.09	120.56	68	34.52
2421.	rohan (rohan_verma__)	197	74.73	92.87	36	18.27
2422.	yuuth.com (roadto5wpm)	197	112.78	149.72	86	43.65
2423.	incendiary (returnoftheince...	197	162.81	196.84	177	89.85
2424.	Pogfrog (pogfrog1)	197	112.62	137.89	92	46.70
2425.	Jo (noone21)	197	90.38	134.96	84	42.64
2426.	Michael (michaelchristian024)	197	96.19	131.46	76	38.58
2427.	Pheresint (pheresint)	196	95.89	117.26	68	34.69
2428.	Peter (petejim)	196	78.39	100.60	42	21.43
2429.	Leo (leo8786)	196	156.46	178.66	167	85.20
2430.	tstats[kayeii] (kayeii)	196	85.87	105.89	56	28.57
2431.	Juan (juanma09)	196	38.31	53.45	9	4.59
2432.	Nitin (xintacious)	196	73.26	95.09	34	17.35
2433.	wonder wave (wonderwave2)	196	107.55	130.46	90	45.92
2434.	Sparsh (sparsh123)	196	91.58	126.74	59	30.10
2435.	Mr. (serallfreedbear)	196	101.70	128.68	91	46.43
2436.	Emperor (aranjani)	196	63.00	83.71	41	20.92
2437.	Sotonation (akatrell)	196	95.17	113.40	67	34.18
2438.	vishy (drdrunkstain)	196	53.94	75.89	27	13.78
2439.	Jairdan (twin_turbo_two)	196	61.28	84.89	64	32.65
2440.	keyvan (fayazsoleymani)	195	61.53	79.11	33	16.92
2441.	Patrick (ricccccckkkkkk)	195	75.08	103.73	56	28.72
2442.	ErrorOp (error_op)	195	44.48	63.07	19	9.74
2443.	cold (coldmind)	195	74.74	95.91	51	26.15
2444.	Aleph (catblahfishblah)	195	73.40	103.21	58	29.74
2445.	Bartłomiej (bodidogg)	195	40.74	56.56	19	9.74
2446.	Technician (tech23)	195	72.67	96.23	60	30.77
2447.	Shashank (shashank204)	195	86.34	102.23	43	22.05
2448.	Zuhair (zishraq)	194	83.31	97.62	43	22.16
2449.	Jackson (united9jackson)	194	91.91	129.44	75	38.66
2450.	west (supernova_00)	194	63.43	87.52	32	16.49
2451.	RIP Byron (sir_rebral_palsy)	194	140.36	180.69	139	71.65
2452.	not rage (sadge47)	194	86.35	105.72	50	25.77
2453.	qbaracerr (qbajanowski)	194	50.82	67.80	13	6.70
2454.	Naha's (naha_26)	194	43.00	59.57	22	11.34
2455.	Mehedi Islam (mehediislamri...	194	68.34	96.00	40	20.62
2456.	marsistX (marsistx)	194	74.09	88.95	45	23.20
2457.	Jujee (jujee_poo)	194	55.33	78.03	47	24.23
2458.	jkdixit (jkdixit)	194	42.62	56.77	14	7.22
2459.	Fuzusu (fuzusu)	194	94.42	122.97	79	40.72
2460.	Ren (landonren)	194	31.48	45.43	11	5.67
2461.	frank (frankpc)	194	78.74	99.97	55	28.35
2462.	Anubhav (etra_567)	194	70.70	103.25	47	24.23
2463.	code_brains (coderider)	194	104.25	138.57	92	47.42
2464.	Hai (haitathoc)	193	75.00	97.12	37	19.17
2465.	Stefan (_tensor)	193	99.24	122.11	94	48.70
2466.	FGS (simo666)	193	91.60	121.46	63	32.64
2467.	Brys (seabyzz)	193	56.78	69.19	21	10.88
2468.	Thijs (qazygv)	193	44.54	63.88	18	9.33
2469.	niceu (nice_u)	193	94.58	122.22	62	32.12
2470.	Viktor (milkboofer)	193	62.00	78.12	37	19.17
2471.	stt (soulert)	193	63.81	85.00	42	21.76
2472.	Bo (combobombo)	193	40.68	58.80	10	5.18
2473.	Stefan (stefanbm)	192	77.24	91.80	50	26.04
2474.	Anthony (smashingted)	192	69.56	92.74	51	26.56
2475.	Finally (finallyyes)	192	63.64	84.59	66	34.38
2476.	erbol (erbolxac)	192	37.60	51.06	11	5.73
2477.	chachasoba (chachasoba)	192	104.99	126.14	101	52.60
2478.	Chetan (ch374n)	192	106.22	136.03	85	44.27
2479.	A (b04501012)	192	61.48	75.43	36	18.75
2480.	TTVronness_ (ronneclee)	192	96.62	119.91	63	32.81
2481.	JanBa (pythonbyte)	192	96.66	127.46	68	35.42
2482.	Himal (panthimal)	192	55.84	71.33	22	11.46
2483.	Matt (mattymarsh)	192	103.38	126.53	89	46.35
2484.	Punit (punitsubudhi)	191	50.80	69.90	35	18.32
2485.	Andreas (mangabro)	191	68.81	87.01	39	20.42
2486.	Pasin (_hello_world)	191	68.53	86.91	39	20.42
2487.	Weed (weeddinosaur)	191	89.41	112.39	87	45.55
2488.	Troy (troy517545)	191	67.70	89.16	40	20.94
2489.	new keyb who dis(k3 max) (s...	191	104.98	133.70	82	42.93
2490.	Ahnaf (ahnaf75)	191	84.24	101.52	53	27.75
2491.	Abdul (asalam)	191	30.80	39.84	11	5.76
2492.	Polar (polar_6275)	191	67.56	90.58	49	25.65
2493.	Mustafa (leo_messi_)	191	60.88	80.00	38	19.90
2494.	👻 (james7890)	191	86.80	118.32	53	27.75
2495.	Farameer (farameer1)	191	99.41	123.72	69	36.13
2496.	Earlvin (earlvin14)	191	124.62	146.79	111	58.12
2497.	Death_Dragon (dead_beast)	191	50.47	63.61	15	7.85
2498.	Chiaki (chickhiaki)	191	47.47	68.55	18	9.42
2499.	$$$$ (for_fun)	190	83.34	107.18	49	25.79
2500.	R (fjasifjaficaom)	190	55.04	70.78	27	14.21
2501.	Abdul Hannan (detective_ahg)	190	65.24	85.22	36	18.95
2502.	Aurel (big_boss1)	190	128.64	170.37	114	60.00
2503.	Бақытжан (baqytjan)	190	51.67	65.90	21	11.05
2504.	avocadoLover (avocado_lover)	190	45.48	74.11	22	11.58
2505.	AKSHAT (akshat1234)	190	57.09	74.28	89	46.84
2506.	Adrianix (adrianixx)	190	92.61	120.48	68	35.79
2507.	alaw (its_alaw)	190	67.36	92.27	59	31.05
2508.	Octo (octophobia)	190	109.29	151.94	87	45.79
2509.	Peter (metalhead2021)	190	49.04	63.15	12	6.32
2510.	zen (zen181)	190	88.90	114.87	70	36.84
2511.	Маершон (timeandsoul2)	190	149.41	196.34	158	83.16
2512.	Kenn (kenn_double_n)	190	103.36	127.01	76	40.00
2513.	Iris (irxs)	190	29.12	46.53	27	14.21
2514.	J (irocamora)	190	72.98	92.41	50	26.32
2515.	isekai (krimsonly)	189	78.67	101.72	54	28.57
2516.	Kristoffer (koffer96)	189	68.66	94.10	41	21.69
2517.	Jimmy (jimmy_voe)	189	77.35	102.55	42	22.22
2518.	Gmorcad (gmorcad)	189	105.20	134.39	85	44.97
2519.	Danny (beegd)	189	137.62	184.50	154	81.48
2520.	Bataa (bataa_cdj)	189	74.67	95.66	46	24.34
2521.	Auveed (auveed)	189	92.83	110.82	65	34.39
2522.	epicface (adowoable)	189	92.17	120.86	67	35.45
2523.	Eli (elisped1)	189	116.35	149.36	113	59.79
2524.	Sam (sam12436)	189	48.65	61.56	28	14.81
2525.	Spourgon (mattt_hias)	189	35.77	50.77	9	4.76
2526.	yomum (ahmet_ergun)	188	57.13	72.24	23	12.23
2527.	ReTiRedz (retiredz)	188	78.82	103.88	83	44.15
2528.	Julian (jgbuka12)	188	87.13	119.15	55	29.26
2529.	Ethan (etstein)	188	81.58	103.47	49	26.06
2530.	ngoc huy nam (destroy_the_w...	188	102.65	133.57	79	42.02
2531.	David Abdelnour (davidabdel...	188	62.02	81.16	44	23.40
2532.	neverm0r (datamagi)	188	76.17	107.05	51	27.13
2533.	Brrrdman (birdmanmcinnes)	188	59.13	77.24	22	11.70
2534.	Banda (bandamaker)	188	70.07	90.92	51	27.13
2535.	Prithvi (psprithvi)	188	78.97	96.93	59	31.38
2536.	shawty (pogchampion1969)	188	85.00	101.06	47	25.00
2537.	Okh (okh10001)	188	63.29	79.24	40	21.28
2538.	Roshan (noob_master9901)	188	86.66	124.71	55	29.26
2539.	Himanshu (himanshu_sahni)	188	68.08	86.14	38	20.21
2540.	Gjd (gwvj)	188	58.64	77.19	33	17.55
2541.	Jaxon (fusion13)	188	80.96	104.87	54	28.72
2542.	Vijay (vijays4404)	188	66.03	94.65	45	23.94
2543.	Ayush (typer_ayush)	188	67.63	87.28	74	39.36
2544.	StevieWonder (steviewonder69)	188	92.04	119.81	62	32.98
2545.	bub (_bubble)	187	100.08	125.38	82	43.85
2546.	Sassy (taingdavy)	187	60.84	83.06	35	18.72
2547.	Merrick (skmq)	187	97.61	115.79	64	34.22
2548.	oogy (owogy)	187	72.02	97.89	56	29.95
2549.	Othman (othmanaldefer)	187	49.32	63.23	18	9.63
2550.	Aleks (aleks8)	187	71.63	87.09	52	27.81
2551.	Colemak (colemaknub)	187	67.38	98.86	34	18.18
2552.	Timothy (chuzzz)	187	85.96	116.62	48	25.67
2553.	Chirp (chirpflewgone)	187	56.19	75.05	34	18.18
2554.	Buri (buri_was_taken)	187	68.32	90.47	40	21.39
2555.	Ron (gambling_addict_69)	187	94.11	113.82	54	28.88
2556.	lunalululu (lunalululu)	186	95.67	115.28	74	39.78
2557.	Jia (jia_desai)	186	69.76	92.05	38	20.43
2558.	return NULL; (honor12)	186	82.49	100.00	47	25.27
2559.	Gabe (gablikestacos)	186	94.34	120.22	69	37.10
2560.	Yet (yet1208)	186	67.23	92.88	35	18.82
2561.	Turtle Speed (turtle_speed31)	186	43.06	66.14	20	10.75
2562.	Seth (syarb)	186	100.41	125.31	92	49.46
2563.	Samer (samiralbayati)	186	47.19	60.20	21	11.29
2564.	Richit (richit690)	186	62.80	87.34	37	19.89
2565.	pavan kumar (pavan2406)	186	53.12	64.60	24	12.90
2566.	Gene (mckuletzz)	186	136.17	164.93	141	75.81
2567.	Erik (erickano)	186	71.05	92.13	52	27.96
2568.	EquityDeadlock (equitydeadl...	186	96.32	128.76	76	40.86
2569.	Goyna (demon__rage__)	186	54.39	67.86	29	15.59
2570.	Julie (codex13)	186	74.43	104.40	37	19.89
2571.	Rajat (buttocks121)	186	50.65	67.17	24	12.90
2572.	Beket (bayemirov)	186	103.12	126.40	66	35.48
2573.	Sameer (firefoxqb)	185	75.31	106.14	48	25.95
2574.	cole (coldmak)	185	92.78	129.16	64	34.59
2575.	Social Credit (usa_baby)	185	94.75	121.60	75	40.54
2576.	Alex (skoda888)	185	63.47	81.13	40	21.62
2577.	Aestuosi (aestuosi)	185	92.46	113.22	56	30.27
2578.	jan (toxicwasabi)	185	71.19	94.15	76	41.08
2579.	Chris (letring)	185	98.42	124.01	84	45.41
2580.	Italo (italo_x)	185	37.33	50.70	11	5.95
2581.	Abhideep (imabhideep)	185	53.31	74.40	20	10.81
2582.	NQ (nq_neilprangko)	185	109.16	139.86	92	49.73
2583.	MrSaand (mrsaand)	185	100.32	115.98	64	34.59
2584.	Raahil (ravana09)	184	95.51	127.53	63	34.24
2585.	Prashant (pra0337)	184	46.19	59.84	14	7.61
2586.	MIKA (oniichan69)	184	87.18	125.42	63	34.24
2587.	Fat Squirrel (neihs)	184	100.92	129.56	87	47.28
2588.	douzhen (akariin)	184	76.63	97.59	56	30.43
2589.	Alex (kazuma_sama)	184	45.16	56.54	21	11.41
2590.	Rashed (rshod)	184	55.04	71.08	20	10.87
2591.	Adam (deinonysus)	184	61.28	82.81	33	17.93
2592.	daZai (dazzai)	184	53.89	65.20	38	20.65
2593.	punit (thakelatyper)	184	78.62	101.62	35	19.02
2594.	shubham (shubham2468)	184	59.71	81.13	33	17.93
2595.	mai (mai74)	184	46.60	62.15	18	9.78
2596.	Mason (luvmasxn)	184	46.55	64.74	32	17.39
2597.	Koki (kohki)	184	69.20	84.76	29	15.76
2598.	Rishab (kamado_)	184	59.41	76.05	51	27.72
2599.	Jearcan (jearcan)	184	99.19	137.28	69	37.50
2600.	Sentinel (greatsentinel)	184	122.23	151.95	116	63.04
2601.	Learner (learner_dawg)	183	86.76	117.86	48	26.23
2602.	deep (lamborghene)	183	105.40	143.67	88	48.09
2603.	Gagan (ggnbakshi38)	183	64.41	83.49	48	26.23
2604.	saad (saduman)	183	87.89	111.70	67	36.61
2605.	(needforaccuracy)	183	116.62	143.37	96	52.46
2606.	breezy (breezybre)	183	64.89	93.79	37	20.22
2607.	v (vlxu)	183	91.33	115.25	66	36.07
2608.	Tuong (tuong_slow)	183	75.42	104.24	59	32.24
2609.	arnav (trahimam)	183	65.01	87.32	44	24.04
2610.	Sinful Sam (sinfulsam)	183	87.01	108.02	61	33.33
2611.	Thomas (thomas70)	182	72.78	92.60	40	21.98
2612.	sanjeev (sanjeev_2020)	182	21.41	35.25	38	20.88
2613.	Robert (robbstark)	182	80.03	99.10	49	26.92
2614.	Reg (reggg)	182	101.53	126.94	70	38.46
2615.	Paige (pfernandes_)	182	72.77	95.96	40	21.98
2616.	N W (niwore)	182	87.17	109.82	57	31.32
2617.	Danoun (danounidananou255)	182	62.93	81.40	41	22.53
2618.	Calvin (calvinguy)	182	130.25	177.11	127	69.78
2619.	Limey (limeycunt)	182	47.98	65.24	19	10.44
2620.	Jimmy (jimster123)	182	75.50	93.43	52	28.57
2621.	Spartacus (galvarino)	182	70.43	94.14	41	22.53
2622.	ilove cheese142 (ktylol)	181	83.59	129.56	47	25.97
2623.	Karan (iamkaran2)	181	81.32	104.00	40	22.10
2624.	dong (dongdong7)	181	79.89	105.06	51	28.18
2625.	Tuu (cetarin)	181	77.94	102.11	35	19.34
2626.	Benjamin (benjaminsanta)	181	62.65	83.80	44	24.31
2627.	aruj (b0b1000)	181	78.09	110.29	64	35.36
2628.	sergei (youserj)	181	39.02	49.81	15	8.29
2629.	Bikram (wood_cutter)	181	75.38	92.39	53	29.28
2630.	Sarah (swags20)	181	90.33	117.36	66	36.46
2631.	swagatron (swagatron7000)	181	141.61	169.56	123	67.96
2632.	Splonk (splonk)	181	84.90	108.20	70	38.67
2633.	Soul (soulsforsweet)	181	76.54	97.16	38	20.99
2634.	Peter (appapollo)	181	78.36	99.10	45	24.86
2635.	sausage go brrr (hasini_17)	181	56.50	77.31	30	16.57
2636.	Aniket (aniketsanghi)	180	86.45	107.57	51	28.33
2637.	tourist (amey_9)	180	56.99	72.26	26	14.44
2638.	Abdelmohaymn (abdelmohaymn)	180	40.46	56.67	16	8.89
2639.	Arun (pyinjector)	180	58.06	79.71	43	23.89
2640.	eilonshi (eilonshi)	180	47.71	63.97	28	15.56
2641.	Dimo (dimofte)	180	72.18	94.27	49	27.22
2642.	hekima (ashery)	180	58.54	80.96	33	18.33
2643.	Dinja (insanedjoker)	180	70.43	107.33	36	20.00
2644.	Ham (hammah713)	180	53.69	68.86	31	17.22
2645.	Sanket (maskii)	180	120.48	160.69	116	64.44
2646.	Luka (the_lukec)	180	68.95	102.99	42	23.33
2647.	Sufi (sufi7)	180	33.33	67.69	14	7.78
2648.	System.out.println("Nah I'd...	180	91.42	130.58	77	42.78
2649.	Suryakanta (skroy)	180	53.32	67.71	18	10.00
2650.	whough (williamhough)	179	95.15	118.09	62	34.64
2651.	Ksairos (ksairs)	179	61.03	78.26	44	24.58
2652.	Jebediah (jebediah123)	179	117.44	140.40	117	65.36
2653.	NZY (janghanseok)	179	84.72	109.36	49	27.37
2654.	Hong (hong41)	179	52.77	69.79	16	8.94
2655.	Eugene (genedaman94)	179	67.33	98.65	38	21.23
2656.	RB (rbs_)	179	66.23	84.81	36	20.11
2657.	Brussels (brussels11)	179	124.62	146.36	113	63.13
2658.	Basil (basilenthusiast)	179	69.11	116.33	53	29.61
2659.	Sandeep Kumar (sandy14k9)	179	54.20	72.41	19	10.61
2660.	विघ्नेश (no_l...	178	55.15	70.44	23	12.92
2661.	Nabeel (nobleboi10)	178	79.39	104.39	95	53.37
2662.	03496203150 (my_whatsapp_nu...	178	57.22	72.68	28	15.73
2663.	arigrate (mercury80)	178	99.57	124.59	80	44.94
2664.	nightingale (add4line)	178	162.62	213.93	150	84.27
2665.	Mark (10100)	178	73.02	91.49	57	32.02
2666.	gamer gamer (changishfool)	178	70.35	90.89	42	23.60
2667.	Dylan (yorkingharp67)	178	46.73	65.72	28	15.73
2668.	Lourd (edmund04)	178	69.80	92.58	39	21.91
2669.	Chronopolize (chronopolize)	178	100.44	141.64	62	34.83
2670.	b!g (b_i_g_em)	178	83.66	99.71	51	28.65
2671.	Michael (buckley12)	178	91.84	123.61	44	24.72
2672.	Nick (bluepenredpen)	178	84.26	112.33	43	24.16
2673.	BLLA (bellaperez)	178	65.58	85.48	44	24.72
2674.	Azizbek (azizbek00)	178	62.47	79.41	34	19.10
2675.	:) (erincur123)	177	59.94	75.84	32	18.08
2676.	Court (courtmw)	177	48.22	64.02	16	9.04
2677.	awabin (awabin)	177	48.13	81.11	22	12.43
2678.	XD (oma3)	177	73.85	88.79	45	25.42
2679.	StallmanWasRight (misterhotel)	177	121.64	151.77	93	52.54
2680.	Mahay (mahay316)	177	65.11	78.97	40	22.60
2681.	Kimie (lil_pulsar)	177	84.86	118.73	53	29.94
2682.	judo (judowrld)	177	44.02	65.59	41	23.16
2683.	mobin (irmobin)	177	55.00	71.46	36	20.34
2684.	Shubham (ikamthania)	177	58.44	72.12	25	14.12
2685.	Leo (hogsh9862)	177	93.09	121.54	59	33.33
2686.	McKay (heyitsyaboi)	177	71.63	97.28	47	26.55
2687.	Zakk (zakkcp)	177	79.74	99.70	35	19.77
2688.	youm (youm)	177	77.07	98.06	40	22.60
2689.	Trabota (trabota)	177	113.77	138.25	85	48.02
2690.	Jose Manuel (slowmanl0l)	177	85.07	115.70	49	27.68
2691.	Zandro (zandrocraft)	176	68.37	96.44	42	23.86
2692.	Evgeny (x1p234)	176	55.91	70.16	16	9.09
2693.	Scyx (scyx3)	176	59.07	84.67	33	18.75
2694.	moosophy (pepperoni_cat)	176	41.53	51.71	14	7.95
2695.	Duke (needdiscipline)	176	91.41	121.48	65	36.93
2696.	Maksim (morysoff)	176	76.45	97.66	48	27.27
2697.	Peace in world (marcog7)	176	80.25	105.47	45	25.57
2698.	Sadiqa (sadiqa_ansari)	176	38.35	50.52	12	6.82
2699.	Jose Ruel (braveheart143)	176	51.01	66.73	24	13.64
2700.	Nectarios (locomolotov)	176	102.24	138.66	59	33.52
2701.	Akizumi (linaaron)	176	62.18	92.48	39	22.16
2702.	Kinoktia (kinokita)	176	68.77	88.14	46	26.14
2703.	JD (jigglyjd)	176	68.17	86.85	41	23.30
2704.	Jack (jacjack)	176	70.44	90.27	27	15.34
2705.	Hesh (heshg)	176	81.54	107.55	49	27.84
2706.	Mac (mac123456)	175	83.29	104.05	59	33.71
2707.	ALI (legend_haddad)	175	55.58	73.03	27	15.43
2708.	Julian (juliansmile)	175	86.77	105.69	51	29.14
2709.	Ioannis (johndigolis)	175	69.08	83.30	43	24.57
2710.	Jake (jakeowens)	175	81.02	105.93	48	27.43
2711.	JiGsaW (homeboy2603)	175	105.93	134.06	77	44.00
2712.	Mohammed (guitarist999)	175	65.45	89.34	44	25.14
2713.	greed (greedthelazy)	175	81.65	106.85	67	38.29
2714.	Victo (victo_sn)	175	102.99	144.99	81	46.29
2715.	Robby (tddvorak)	175	62.50	92.18	34	19.43
2716.	Ryan (rdeorio)	175	83.23	101.49	47	26.86
2717.	mayr (mayruwu)	175	67.12	89.65	51	29.14
2718.	Eveningthing (evntd)	175	76.85	98.27	43	24.57
2719.	Choong Hyun (chlee)	175	66.11	91.89	44	25.14
2720.	my name (calmthyself)	175	93.67	107.85	55	31.43
2721.	Connor (ct2019)	174	58.70	76.12	32	18.39
2722.	John (beefysalad69)	174	96.17	124.10	84	48.28
2723.	Wob (wobber)	174	64.28	88.08	53	30.46
2724.	tstats[v415hn4v] (v415hn4v)	174	31.81	42.50	12	6.90
2725.	Rahim Abdur (arbijoy1717)	174	45.10	55.32	14	8.05
2726.	Angelo (angelo13c)	174	78.73	93.46	50	28.74
2727.	Ian sparks (sparksian)	174	61.47	79.96	38	21.84
2728.	Itsuki1 (itsuki1)	174	58.52	79.18	42	24.14
2729.	Tarek (o_stady)	174	71.37	84.92	38	21.84
2730.	Naman (namanjain)	174	43.25	52.87	20	11.49
2731.	adrian (rixoner)	173	54.03	72.78	29	16.76
2732.	T (raket124)	173	80.58	95.37	46	26.59
2733.	Noobie (nooobie_typer)	173	63.66	84.90	41	23.70
2734.	Tech (ninja_typer)	173	75.01	94.87	45	26.01
2735.	Chris (mils8545)	173	63.19	77.63	31	17.92
2736.	Abhinav :P (abhi_typist)	173	64.33	84.06	42	24.28
2737.	Kyle (1cheeseisyummy5)	173	95.64	127.68	78	45.09
2738.	RagingChris (ragingchris)	173	89.53	120.41	58	33.53
2739.	Prof (profklapz)	173	76.44	102.48	56	32.37
2740.	Eru (eru2)	173	83.78	110.95	48	27.75
2741.	Dev (devk232)	173	50.71	72.67	16	9.25
2742.	WindSlashKing (bujkata)	173	99.36	156.18	73	42.20
2743.	Kirin (arya_juniko)	173	63.67	89.63	31	17.92
2744.	Coder (the_coder_bro)	173	68.34	85.61	38	21.97
2745.	Warren (slacker_xd)	173	96.19	117.65	71	41.04
2746.	Brandon (kirbyfan107)	173	116.98	151.71	98	56.65
2747.	joshua (jimpdashrimp)	173	95.51	126.13	62	35.84
2748.	An Ackerman (iamvr)	173	53.39	65.81	15	8.67
2749.	Krish (krish108)	172	99.15	128.67	63	36.63
2750.	Ardan (kevinardani)	172	69.75	90.59	45	26.16
2751.	InNeedOfName (inneedofname)	172	96.42	133.56	56	32.56
2752.	General (generalmalorn)	172	107.24	128.61	74	43.02
2753.	fthe (fthe)	172	70.17	94.74	39	22.67
2754.	evil007 (evil007)	172	47.08	66.58	18	10.47
2755.	Anjal (deadashell)	172	66.42	85.75	35	20.35
2756.	Cadmus (cadmus369)	172	65.79	87.14	40	23.26
2757.	AvocadoTM (avocadotm)	172	67.89	87.86	39	22.67
2758.	Neatrianty (neatrianty)	172	110.30	147.24	93	54.07
2759.	Manoj (manjobanjo)	172	104.89	145.51	137	79.65
2760.	moq (moq_)	172	89.79	112.31	65	37.79
2761.	Akash (akashshewale)	172	57.80	72.84	29	16.86
2762.	Matty (mattyman)	172	52.76	63.11	22	12.79
2763.	wenlong (wenlong)	172	51.64	69.27	12	6.98
2764.	wz (taywzzzz)	172	72.59	94.27	50	29.07
2765.	sumit (sumitmgr345)	172	64.57	82.26	37	21.51
2766.	silvik (silvik_)	172	107.60	143.36	86	50.00
2767.	Nyaruko (tatrz)	171	82.12	108.42	63	36.84
2768.	sys (sysuser)	171	46.22	57.02	11	6.43
2769.	Sayat (sayko05)	171	37.71	49.80	14	8.19
2770.	Nagaro (nagaro)	171	76.65	95.66	47	27.49
2771.	Marko (markodob)	171	45.23	58.88	12	7.02
2772.	Jacinth (levesis)	171	73.95	103.89	45	26.32
2773.	Joshua (lckjosh)	171	109.51	130.91	78	45.61
2774.	paddy (kattumanidhan)	171	93.09	140.29	71	41.52
2775.	Kate (kate366)	171	78.45	102.02	45	26.32
2776.	Richard (jorimi)	171	82.76	119.49	47	27.49
2777.	Whatever (hunglatahb1)	171	92.43	113.13	51	29.82
2778.	Heather (heannn)	171	75.02	100.65	44	25.73
2779.	Cho (cho82)	171	69.09	82.44	46	26.90
2780.	Ella (chawahir)	171	152.94	181.26	114	66.67
2781.	Arsalan (arsalan_khan)	171	31.79	47.11	31	18.13
2782.	Abdujalol (abdujalolerkinov)	171	57.42	73.89	39	22.81
2783.	alv (alvdev)	170	60.02	71.50	28	16.47
2784.	Rei (sleepyray)	170	65.22	86.25	45	26.47
2785.	Sheen (mercurial_spod)	170	43.48	62.44	22	12.94
2786.	Derwin (dwu123)	170	82.30	100.36	43	25.29
2787.	4pf (mawienmawien123)	170	63.48	81.35	35	20.59
2788.	Syed Ali (mafailure)	170	69.57	92.55	40	23.53
2789.	Jørgen (jorgen1999)	170	65.43	93.01	33	19.41
2790.	Jordan (invictusj)	170	72.45	93.13	43	25.29
2791.	hello (imfeelingunlucky)	170	82.37	113.68	37	21.76
2792.	VP (illermike)	170	67.27	82.20	40	23.53
2793.	BLU (glitterblonde)	170	88.20	110.31	57	33.53
2794.	Zhijian (zliangal)	170	59.10	75.41	33	19.41
2795.	TheBossOfTheBoss (thebossof...	170	92.42	115.80	57	33.53
2796.	Sumit (sumit0003)	170	42.36	66.81	17	10.00
2797.	Mateusz (mattinato21)	170	119.43	154.89	3	1.76
2798.	Feli (dottedladybug)	170	79.94	98.75	39	22.94
2799.	Harsh Yadav (bestial)	170	59.58	81.16	32	18.82
2800.	AYOUB (ayoub_dkhissi)	170	44.81	59.13	29	17.06
2801.	Ashish (ashk98)	169	55.28	78.17	30	17.75
2802.	MTGAP | Tokimahery (tokimah...	169	79.45	105.28	60	35.50
2803.	Malik (sonatabliss)	169	48.38	70.30	30	17.75
2804.	Lim (ac1ds)	169	72.21	91.88	40	23.67
2805.	Cross (crosscategory)	169	54.87	70.99	19	11.24
2806.	leon (leonzalion)	169	154.03	211.71	28	16.57
2807.	Kiddoz (kiddoz)	169	67.93	83.31	31	18.34
2808.	Toe Typer (ifingeryour)	169	61.75	81.58	34	20.12
2809.	Rdk (olegus)	169	71.14	90.42	47	27.81
2810.	Gourav (mrgaurav2001)	169	49.24	70.68	35	20.71
2811.	Martin (martinmaster)	169	71.23	84.46	44	26.04
2812.	Marco (marcomilo)	169	103.47	129.32	70	41.42
2813.	Nate (natekid11)	168	82.95	100.32	42	25.00
2814.	Yu (mjtunes)	168	58.00	79.34	26	15.48
2815.	ʕ·͡ᴥ·ʔ (memesis)	168	73.40	99.64	48	28.57
2816.	Ghost (ghostdraon)	168	66.87	90.39	42	25.00
2817.	Kabi (kabizzare)	168	41.65	67.23	15	8.93
2818.	Keith (flanneldemigod)	168	80.19	97.28	50	29.76
2819.	Geeth (falsethunder)	168	68.17	99.39	32	19.05
2820.	aida (cloudywithachanceofme...	168	121.82	160.09	95	56.55
2821.	Tushar (tjajodia)	168	73.18	102.66	45	26.79
2822.	SPICY (spicynote)	168	83.53	101.41	56	33.33
2823.	Kaloyan (kokicha120)	168	84.86	110.16	49	29.17
2824.	kai (kainetic)	168	70.14	112.57	35	20.83
2825.	Arjun (k9cruncher)	168	89.70	112.42	55	32.74
2826.	Jacob (jwill420)	168	120.35	151.96	104	61.90
2827.	Lauren (lsmithers619)	167	48.58	64.91	21	12.57
2828.	josh (killer_queen_beats_hi...	167	71.82	84.13	37	22.16
2829.	John (jlavelle)	167	92.46	121.13	53	31.74
2830.	Halley (halxey)	167	68.52	91.47	131	78.44
2831.	dumbosity (dumbosity)	167	126.75	162.99	110	65.87
2832.	Gregory (contrum)	167	112.60	139.83	87	52.10
2833.	CheemCreem (cheemcreem)	167	83.65	100.60	43	25.75
2834.	I am on the rise. (refined_...	167	51.95	69.42	81	48.50
2835.	Pinekkone (pinekkone)	167	76.18	97.78	48	28.74
2836.	Oli (piasekoli)	167	86.99	105.28	44	26.35
2837.	Keagan (ngerks)	167	72.48	91.24	42	25.15
2838.	Abdelrahman (abdelrhaman_sh...	167	66.12	84.12	46	27.54
2839.	Constantinos (488pista)	167	73.00	87.52	37	22.16
2840.	Ayush (improve_type)	167	49.46	63.36	21	12.57
2841.	Abdul Basit (abdul_thetypist)	167	46.26	63.74	16	9.58
2842.	joaoabismado (joaoabismado)	167	60.64	92.81	39	23.35
2843.	Eli (silversweedie)	167	54.99	78.70	14	8.38
2844.	Zakarya (zakarya420)	166	41.80	53.76	10	6.02
2845.	Filemon (the_squad7)	166	42.82	51.87	9	5.42
2846.	Alf (the_destroyer_of_worlds)	166	96.96	123.49	68	40.96
2847.	Janc (psyy1234)	166	88.64	107.09	48	28.92
2848.	Angkana (ployyjen)	166	82.88	102.83	38	22.89
2849.	Onsterm (onsterm)	166	54.76	70.01	18	10.84
2850.	Mike (mikayelb)	166	67.52	83.69	33	19.88
2851.	Matthew (matt_daemond)	166	103.84	134.99	73	43.98
2852.	moofasa (macywood)	166	84.56	116.59	57	34.34
2853.	Lord Of Titans (lord_of_tit...	166	49.35	65.97	26	15.66
2854.	Jacob (jacobascool)	166	60.05	77.46	27	16.27
2855.	Lobster🦞 (itisu127)	166	79.41	105.53	73	43.98
2856.	Voldemort (growthmindset)	166	95.20	114.26	63	37.95
2857.	clover (fat_baby_hippo_312)	166	45.98	73.16	18	10.84
2858.	劉韋論 (evan1liu)	166	66.48	83.25	27	16.27
2859.	DOO (datblakgai)	166	80.83	108.80	48	28.92
2860.	Caegan (caegana)	166	121.39	158.07	87	52.41
2861.	Hello (arnab_9997)	166	74.85	96.25	40	24.10
2862.	Ab (abdir)	166	74.90	106.79	40	24.10
2863.	Free (free_hour)	166	61.98	82.17	32	19.28
2864.	Tomas (elanunciadordedoom)	166	65.82	93.43	38	22.89
2865.	Isabella (bellaa)	165	73.67	100.61	45	27.27
2866.	Shane (shane_666666)	165	51.82	69.40	26	15.76
2867.	Shadi (shzdi)	165	88.03	110.34	149	90.30
2868.	Christos (lexmarkx)	165	60.07	81.49	33	20.00
2869.	Leonardo (leo121)	165	62.82	77.03	33	20.00
2870.	Matt (kirito3141)	165	88.57	126.81	43	26.06
2871.	gujjar (gujjarji)	165	63.23	86.20	35	21.21
2872.	bri (greased_lightning10)	165	85.36	113.05	60	36.36
2873.	tade (tadessetic)	165	32.39	40.53	13	7.88
2874.	Swaraj (swarajpande4)	165	91.99	119.74	52	31.52
2875.	Scott (scottjones25)	165	40.52	52.80	10	6.06
2876.	ryu107 (ryu107)	165	59.36	79.60	28	16.97
2877.	Rishi (qasz)	165	58.37	75.00	27	16.36
2878.	dawid (nuclearmansnothot)	165	81.14	110.78	47	28.48
2879.	Nikolai (nikovertus)	165	89.68	124.50	53	32.12
2880.	Blue Alps, baby! (model_m_k...	165	84.90	111.41	60	36.36
2881.	Mel (mel0214)	165	47.85	59.66	15	9.09
2882.	David (dtnero)	165	83.65	103.73	51	30.91
2883.	Dylan (dtg32148)	165	88.20	111.68	61	36.97
2884.	bhanu (codingbegginer)	165	54.41	73.49	18	10.91
2885.	Nick (cluelessneep)	165	87.96	101.08	46	27.88
2886.	Beret (boina)	165	82.04	106.52	51	30.91
2887.	Enzo (enz0123)	164	97.93	120.64	72	43.90
2888.	Emerald-Rose (emmarose_deleon)	164	42.71	56.25	23	14.02
2889.	Dipankar (dipankarkumar275)	164	58.94	74.22	30	18.29
2890.	damon (damonliv)	164	83.66	106.75	42	25.61
2891.	CopiCat (copicat)	164	57.96	76.60	20	12.20
2892.	Nurlanbek (xtil_06)	164	46.04	58.91	8	4.88
2893.	Kelvin (winlost2)	164	111.60	129.80	86	52.44
2894.	Steve (stevie169)	164	75.35	91.97	33	20.12
2895.	Colemax (sqxleaxes)	164	94.90	120.61	63	38.41
2896.	bach (shuriken)	164	75.77	92.07	41	25.00
2897.	shakthi (shakthi1731u)	164	74.07	98.50	34	20.73
2898.	Guðjón (krotari)	164	86.79	109.75	67	40.85
2899.	Kenyaaa~~~ (kenzaa)	164	92.49	123.11	52	31.71
2900.	kajak_CZ (kajak_cz)	164	64.36	80.99	37	22.56
2901.	Hamidbek (hamidbek)	164	53.34	73.18	18	10.98
2902.	naveen (regretfulsalsa)	164	106.82	134.37	88	53.66
2903.	Daggerpov (read_my_name)	164	111.06	133.77	82	50.00
2904.	Preetish (preetishmajumdar)	164	76.66	96.70	38	23.17
2905.	Manny (mannypack)	164	98.88	139.13	65	39.63
2906.	Manjrnm (manjrnm)	164	97.98	124.87	68	41.46
2907.	Mmonster (mmonsterv11)	163	68.52	97.83	38	23.31
2908.	ybf (ybflewis)	163	86.38	118.67	42	25.77
2909.	Connecting... (toodey)	163	65.61	84.33	36	22.09
2910.	SW1FT808 (sussyboi808)	163	42.73	59.01	16	9.82
2911.	Srdjan (srle1312)	163	49.83	61.52	14	8.59
2912.	SkyerZ (skyerz)	163	92.15	111.22	60	36.81
2913.	AM (amesh8301)	163	67.96	87.20	39	23.93
2914.	Almighty (almightysosaakatu...	163	86.64	115.26	59	36.20
2915.	Andreas (agehring)	163	25.08	33.03	41	25.15
2916.	Sonix (8sonix)	163	70.22	105.90	47	28.83
2917.	TOBIRAMA (sipagan90)	163	47.93	66.83	14	8.59
2918.	Brody (echo3006)	163	75.02	112.02	36	22.09
2919.	Cheyenne (cheycc)	163	79.08	112.92	40	24.54
2920.	Lur3t (lur3t)	163	73.13	96.84	33	20.25
2921.	Ivan (idjuric)	162	111.51	135.94	82	50.62
2922.	Gde (gde1indra)	162	73.44	96.08	45	27.78
2923.	aditya105 (aditya105)	162	47.95	65.08	17	10.49
2924.	Ruel Ryan (ruelryan)	162	71.73	87.17	41	25.31
2925.	Rahul (rsrahul1000)	162	82.20	107.42	51	31.48
2926.	Priyanshi (priyanshi_gupta)	162	62.42	80.17	34	20.99
2927.	nw3x (nw3x)	162	128.05	160.53	110	67.90
2928.	Norm (norm_guy)	162	49.55	64.09	17	10.49
2929.	TheXFalcon (xavier_poh)	162	74.63	96.80	46	28.40
2930.	salsa (spencer_salsa)	162	59.55	83.30	31	19.14
2931.	Callum (specktome26)	162	87.65	111.02	40	24.69
2932.	Elgamal (elgamal)	162	62.17	86.27	31	19.14
2933.	Pisit (compisit)	162	88.17	112.69	48	29.63
2934.	Celeste (celeste_b)	162	62.05	81.69	29	17.90
2935.	Arsh (batman4ever)	162	59.13	76.64	32	19.75
2936.	tstats[depsy] (depsy)	161	81.31	102.27	41	25.47
2937.	RiCyber (curiouscrow)	161	70.80	83.70	52	32.30
2938.	nbv (cumming4u)	161	72.04	93.91	42	26.09
2939.	yong (coaleo)	161	79.31	122.20	37	22.98
2940.	TYPE KITA (carracers)	161	55.10	77.27	23	14.29
2941.	Adam (schimoda)	161	99.10	121.29	53	32.92
2942.	kraken (pronto1)	161	72.00	90.43	38	23.60
2943.	Piplup (piplup_)	161	81.33	105.83	32	19.88
2944.	Nicki (nickisusanalex)	161	85.65	99.13	39	24.22
2945.	xdd (n1kk1)	161	52.47	77.70	22	13.66
2946.	mattfus (mattfus2)	161	94.35	112.55	47	29.19
2947.	Kingdomfight (kingdomfight)	161	73.01	88.19	35	21.74
2948.	April (apesbang)	161	81.20	101.04	48	29.81
2949.	something (xuegalaxy)	161	65.02	95.80	33	20.50
2950.	manish (typo_beginner19)	161	51.92	68.50	15	9.32
2951.	Asma (speedy10123667567)	161	41.48	63.99	13	8.07
2952.	scrubs (scrubs1906)	161	64.43	80.41	41	25.47
2953.	Onion (x__onion__x)	160	111.57	173.99	76	47.50
2954.	Luca (whitebronco)	160	53.90	77.26	16	10.00
2955.	TheCaptainBuster (thecaptai...	160	83.76	136.32	90	56.25
2956.	^o^ (thasial)	160	83.28	111.19	48	30.00
2957.	Shivam (sj_pro)	160	59.24	78.17	38	23.75
2958.	Kurochi (kurochi_cyril)	160	81.05	100.01	54	33.75
2959.	Jackie (jackiechan816)	160	82.32	110.90	47	29.38
2960.	badplayer (idk213)	160	91.19	145.82	72	45.00
2961.	Hafiz (huseynoff)	160	75.17	94.31	44	27.50
2962.	seaweedOrca (h17unicorn)	160	73.74	96.97	34	21.25
2963.	Gaurav (gaurav_38)	160	77.47	96.85	42	26.25
2964.	Leonardo (finex2126)	160	47.74	65.33	18	11.25
2965.	Demian Volkov (demianwolf)	160	124.06	150.14	102	63.75
2966.	Chirag (chirag_2580)	160	68.21	95.05	39	24.38
2967.	Yo (azurewinter)	160	89.53	124.17	59	36.88
2968.	Asura (asura_yt)	160	111.23	141.19	66	41.25
2969.	Arsuta (aryasuta13)	160	79.00	100.36	44	27.50
2970.	SCHMURK (schmurk)	160	98.04	124.69	63	39.38
2971.	Pavan (pavan_06)	160	52.80	71.46	22	13.75
2972.	oukkat2 (oukkat2)	160	89.14	115.67	55	34.38
2973.	oscar (oscarhinxdd)	160	73.32	91.72	39	24.38
2974.	Com (neon1087)	160	84.62	100.07	48	30.00
2975.	Myles (mylessucks)	160	115.32	146.62	79	49.38
2976.	Meliflua (meliflua)	160	56.62	68.03	21	13.13
2977.	Joshua (manch)	160	89.55	112.54	51	31.88
2978.	Shaked (aes222)	160	107.84	141.06	73	45.63
2979.	Nikita (andriievskyi_2)	160	64.70	84.97	30	18.75
2980.	gar (dagmarski)	160	68.69	87.11	37	23.13
2981.	Chourrage (chourrage)	160	73.86	93.44	38	23.75
2982.	Max (eggrollccc)	160	86.38	105.80	77	48.13
2983.	Ankit (ankit_10)	159	32.18	44.28	25	15.72
2984.	ABM (abm150)	159	66.72	80.76	43	27.04
2985.	Erin Lanz (erinxmaligaya_)	159	41.90	60.44	13	8.18
2986.	Aditya (dhruvaditya)	159	48.91	64.25	11	6.92
2987.	Gabriel (dekkoz)	159	63.39	78.50	24	15.09
2988.	daniel (danielphantom)	159	90.28	118.92	57	35.85
2989.	Liam (bonkatronk)	159	85.77	101.76	56	35.22
2990.	Dinkin (blindguy_mcsqueezy)	159	78.11	111.16	36	22.64
2991.	Khanh (aygentp)	159	90.79	119.87	51	32.08
2992.	Garotto (uselessusername)	159	94.47	116.78	60	37.74
2993.	switchedtocolemak (switched...	159	120.63	144.18	75	47.17
2994.	Jakub (serckle)	159	94.92	114.92	67	42.14
2995.	tstats[madkingxxx] (madking...	159	60.00	82.12	34	21.38
2996.	Lloyd (llgraves)	159	77.92	104.62	33	20.75
2997.	liz (lizkebab)	159	106.43	130.83	56	35.22
2998.	KC (hotdogkc)	159	118.17	160.13	39	24.53
2999.	Sam (samsrm)	159	69.68	96.84	30	18.87
3000.	RRKS (rrks43)	159	89.51	112.99	55	34.59
3001.	Oliwier (olix04)	159	84.33	102.75	38	23.90
3002.	Omar (omarbahgat2003)	158	77.66	99.04	36	22.78
3003.	Nader (nader12)	158	53.65	66.29	17	10.76
3004.	Zaynski (zaynium)	158	106.32	128.89	74	46.84
3005.	Aziyat (aziyatali)	158	46.13	65.51	18	11.39
3006.	dilano (dilano55)	158	85.44	112.24	58	36.71
3007.	Alpha (unseenalpha)	158	54.88	75.09	15	9.49
3008.	bsmith4972 (bsmith4972)	158	53.34	72.48	18	11.39
3009.	ben (benwu1)	158	86.99	110.02	42	26.58
3010.	Aytac (aytac_neigel27)	158	82.30	102.21	49	31.01
3011.	Hieu (larhral)	158	89.72	112.48	58	36.71
3012.	Karl (karlpuno)	158	61.87	83.89	29	18.35
3013.	Rohit (john_titor234432)	158	69.96	95.93	35	22.15
3014.	Filip (l4rry99)	157	89.20	120.59	46	29.30
3015.	Firelord (jetray)	157	73.85	90.26	33	21.02
3016.	Sexy Mark (jay_cartwright)	157	110.38	142.76	69	43.95
3017.	Jake (jake_tyler)	157	97.00	117.37	62	39.49
3018.	aya (aya1994)	157	48.92	58.23	17	10.83
3019.	daniel (nitezu)	157	90.38	118.56	53	33.76
3020.	Feris (merelyaferis)	157	141.26	179.23	119	75.80
3021.	Twis (twis23)	157	74.04	100.88	40	25.48
3022.	Sundara Subramanian (sundar...	157	81.23	97.99	37	23.57
3023.	Oskar (dailypants)	157	67.87	82.88	36	22.93
3024.	khalil (credendo)	157	81.19	100.11	48	30.57
3025.	Fidel Alberto Ramos (Perú)...	156	58.91	77.73	21	13.46
3026.	Mike (fastneko)	156	92.05	132.37	55	35.26
3027.	deceptiveVI (dsaldana711)	156	113.75	145.60	82	52.56
3028.	Tianyi (dreamatd)	156	76.69	93.47	31	19.87
3029.	RMS (sarfaraz008)	156	85.32	120.76	63	40.38
3030.	percival (samuelnirina)	156	79.93	98.48	37	23.72
3031.	PJR (petrosyan_jr)	156	87.70	104.82	56	35.90
3032.	Kwikk (mrkwikk)	156	60.43	82.18	31	19.87
3033.	JFL (mialiu0804)	156	61.04	79.19	32	20.51
3034.	Luffy-dono (luffy_dono)	156	71.18	88.70	37	23.72
3035.	deroche make me 220 nq plea...	156	75.13	98.35	37	23.72
3036.	アヒオ (knalb)	156	52.12	68.99	14	8.97
3037.	Karim (karimkarim)	156	48.88	64.66	18	11.54
3038.	Kieran (kahinjin)	156	127.13	164.65	119	76.28
3039.	Abylaikhan (ho1den)	156	78.14	110.78	30	19.23
3040.	w0ng (w0ng_dvorak)	156	58.66	74.69	20	12.82
3041.	Verve81 (verve81)	156	111.96	136.49	89	57.05
3042.	Theroarx (theroarx)	156	88.32	112.14	53	33.97
3043.	Ckh (theckh)	156	88.90	108.38	48	30.77
3044.	Sonwa (sonwa)	156	55.74	66.69	17	10.90
3045.	Zurfer (zurfer)	155	70.50	99.29	40	25.81
3046.	Salted (whyisitsohardto)	155	82.57	111.59	46	29.68
3047.	Uurdmandakh (uurdmandakh)	155	63.97	83.30	35	22.58
3048.	typoMaster (tt_qureshi)	155	46.99	60.36	12	7.74
3049.	Trying (sakurya)	155	132.87	163.14	102	65.81
3050.	John (qui505092)	155	118.55	144.55	86	55.48
3051.	Emily (emj9)	155	66.61	81.25	32	20.65
3052.	Elliot_1980_UK (elliot_notts)	155	102.90	126.92	66	42.58
3053.	calum (calousime)	155	81.77	112.56	61	39.35
3054.	Avi (avitoohband)	155	59.14	86.06	33	21.29
3055.	Alf (jacv_10)	155	61.89	74.57	31	20.00
3056.	Casper (casper_001)	155	70.86	94.94	31	20.00
3057.	Aidan (kubachi)	155	83.36	106.45	48	30.97
3058.	Joseph (joseph_468)	155	118.59	140.23	90	58.06
3059.	John (jhakala)	155	102.97	118.58	53	34.19
3060.	Jordan (jagmasta259)	155	93.97	117.53	61	39.35
3061.	Hovari (hovari)	155	66.55	92.22	33	21.29
3062.	(ghall)	155	153.46	209.53	64	41.29
3063.	Lai (laiyr)	154	109.87	136.95	67	43.51
3064.	Samuel (king_anuus)	154	113.00	139.64	89	57.79
3065.	Keelan (keelanf_28)	154	64.78	88.03	39	25.32
3066.	Julius (juliuscl2004)	154	51.95	73.37	22	14.29
3067.	Andreas Vida (johnbonham)	154	108.27	138.95	75	48.70
3068.	tstats[ilaghardcore] (ilagh...	154	105.13	134.02	70	45.45
3069.	Muhammad (donnyutsman)	154	82.08	98.98	28	18.18
3070.	yo (callmeford)	154	86.15	110.00	47	30.52
3071.	Batteekha (batteekha)	154	68.53	83.98	39	25.32
3072.	Ayyaz Sajjad (ayyazsajjad)	154	43.53	55.35	18	11.69
3073.	alex (ay1259)	154	92.23	123.32	64	41.56
3074.	Zaid (zaidnashihamin)	154	52.55	70.49	25	16.23
3075.	Serenity (turkaturka)	154	83.89	103.53	43	27.92
3076.	Turning 14 in 2 Weeks! (spe...	154	111.57	163.48	55	35.71
3077.	Keyma.sh is better (ryleyx...	154	130.92	155.77	93	60.39
3078.	Mohamd (mohamed_hussein)	154	31.07	42.68	23	14.94
3079.	Mims (mimzi_who)	154	79.08	104.21	44	28.57
3080.	ig=muzi.priva (muzamil69)	154	53.07	87.31	58	37.66
3081.	johnny (jdmalcolm)	154	74.00	93.60	47	30.52
3082.	alpha (alphawoman)	153	89.03	121.05	51	33.33
3083.	ydem2nir9tag (ydem2nir9tag)	153	104.87	132.43	75	49.02
3084.	Tanya (tee_85)	153	44.20	70.27	14	9.15
3085.	Neko (stanoje)	153	88.89	110.81	41	26.80
3086.	Sigmund (sir_renardwil)	153	87.98	109.61	49	32.03
3087.	killer (killerz4564)	153	60.93	78.89	40	26.14
3088.	Jamie (jamietyper90)	153	85.33	110.22	45	29.41
3089.	declan (dekkiefish)	153	94.63	120.52	57	37.25
3090.	Bento (bento420)	153	97.53	121.99	77	50.33
3091.	Looserrrrrrrrrrrr (rahulary...	153	28.34	52.04	70	45.75
3092.	ace (pressctrlandw)	153	85.06	101.23	44	28.76
3093.	pedro (pmedley)	153	46.45	61.03	10	6.54
3094.	Ex (not_a_razer)	153	67.26	85.02	34	22.22
3095.	vroom💤 (noprop)	153	122.12	145.40	78	50.98
3096.	Minaricano (minaricano)	153	87.63	113.61	43	28.10
3097.	Никита (mamaxab)	153	31.14	43.39	20	13.07
3098.	Darth (rakin000)	152	78.60	94.12	28	18.42
3099.	Rahul (rahuls1995)	152	51.35	64.62	15	9.87
3100.	AtmoSci (noctilucent)	152	63.77	86.13	30	19.74
3101.	netram88 (netram88)	152	77.07	96.55	53	34.87
3102.	tstats[marin049] (marin049)	152	112.57	151.03	84	55.26
3103.	Luka (lukoloz)	152	89.46	113.47	46	30.26
3104.	Laco (koomp)	152	86.47	103.84	46	30.26
3105.	Nik (iiirxs)	152	80.60	113.83	37	24.34
3106.	Josh (h3hat3m3)	152	93.44	112.28	41	26.97
3107.	Ali (alijoon)	152	58.77	74.40	18	11.84
3108.	AlexopoulosC (alexopoulosc)	152	92.60	114.78	55	36.18
3109.	saam4 (saam4)	152	70.63	94.34	35	23.03
3110.	type_racist (the_orange)	152	83.85	108.24	44	28.95
3111.	Stephen (s_dog2001)	152	65.06	92.50	44	28.95
3112.	Splixy (splixy)	152	70.60	88.42	37	24.34
3113.	Fatnot (fatnot)	152	84.71	112.01	39	25.66
3114.	Denis (deniii)	152	61.54	78.10	33	21.71
3115.	ashok (ashokkasi)	152	79.66	100.74	42	27.63
3116.	Tom (darkusisdope)	151	47.64	59.25	14	9.27
3117.	Aaron (biogence)	151	72.39	93.03	28	18.54
3118.	MNL48 Frances DieHardSuppor...	151	89.20	109.59	60	39.74
3119.	fingerblaster (linn123321)	151	81.55	105.26	39	25.83
3120.	Szektor (szektor)	151	53.75	72.21	12	7.95
3121.	Mohanad (mohanad3302)	151	29.84	41.28	18	11.92
3122.	Laura (lauraisgreatattypera...	151	61.23	77.20	29	19.21
3123.	Rasmus (rasmus_v)	151	74.55	90.96	27	17.88
3124.	ahmed (puzite)	151	85.52	108.20	37	24.50
3125.	IllMind (lllmind)	151	48.64	65.10	24	15.89
3126.	Jimmy (jimmmy193)	151	106.15	145.66	67	44.37
3127.	jcm (jan500)	151	81.73	104.17	45	29.80
3128.	INCOMPETENT (incompetent_co...	151	79.25	108.16	50	33.11
3129.	Drew (vegan_freedom_fighter)	151	65.62	85.30	30	19.87
3130.	Sidharth (_ceres_)	150	45.53	57.20	12	8.00
3131.	James (wnston)	150	92.16	134.71	54	36.00
3132.	Wilson (wilsonthewinner)	150	93.55	117.14	44	29.33
3133.	Whyn (why8n)	150	80.33	101.06	44	29.33
3134.	ws (wdsyywd)	150	83.75	114.60	35	23.33
3135.	Vishal (vishal_kr_saw)	150	74.43	90.92	61	40.67
3136.	Unidentified (themunchkin3)	150	125.50	146.39	80	53.33
3137.	Daniel (sea_sick)	150	86.65	102.46	53	35.33
3138.	Casey (novacainr)	150	90.22	112.12	61	40.67
3139.	Necdet Ali (necdetaliozdur_...	150	64.14	80.31	31	20.67
3140.	Nadav (nadavb9)	150	62.42	97.22	36	24.00
3141.	Dmitry (dmitry_turcan)	150	68.58	90.87	32	21.33
3142.	David (d4v1dh)	150	103.91	131.43	62	41.33
3143.	Cindy (cwycindy)	150	77.99	106.44	51	34.00
3144.	Kapal Tua :v (cream777)	150	69.43	89.79	37	24.67
3145.	Brian (brianhsu7476)	150	75.03	87.85	46	30.67
3146.	(boy_314)	150	140.89	169.64	101	67.33
3147.	Bismith (bismith)	150	76.63	93.22	33	22.00
3148.	Arvind (arvindlamba454)	150	71.92	104.43	47	31.33
3149.	Lily (andisapple32)	150	67.95	86.36	33	22.00
3150.	Abby (abkwreu)	150	35.96	62.70	7	4.67
3151.	linkai (linkailul)	150	95.94	125.50	56	37.33
3152.	Kreoniz (kreoniz)	150	61.41	74.47	31	20.67
3153.	jimjom (jimysucks)	150	147.98	187.38	122	81.33
3154.	Airbender Aang (lolmode2)	149	94.38	115.62	40	26.85
3155.	Logan (laucian)	149	79.36	101.18	39	26.17
3156.	Hudson (hudson_the_cat)	149	57.00	75.70	24	16.11
3157.	GEMargad (gemrgd_23)	149	53.34	72.14	16	10.74
3158.	Eaglekott (eaglekott)	149	93.54	114.39	48	32.21
3159.	John Le (zingerburgerkfc)	149	73.78	99.74	43	28.86
3160.	Zaid (zaids)	149	84.92	108.42	34	22.82
3161.	♛₴𝕥o͓̽ᖇო·₴�...	149	73.04	91.82	40	26.85
3162.	waseem ahmad bhat (waseemraja)	149	60.40	91.39	29	19.46
3163.	john (sharks445)	149	82.96	107.29	41	27.52
3164.	Sebastian (sebastian070)	149	35.60	50.06	32	21.48
3165.	Rdmm (rdmm)	149	84.60	102.30	46	30.87
3166.	Moyosore (mokarios)	149	77.77	94.02	44	29.53
3167.	JesusWrite (jesus_write)	149	45.42	56.11	13	8.72
3168.	Connor (cellingson)	149	47.21	59.78	8	5.37
3169.	vardhman (vardhman)	149	57.18	83.13	23	15.44
3170.	Arian (arianrz82)	148	62.83	82.06	32	21.62
3171.	Marc (andesandwich)	148	68.47	88.25	41	27.70
3172.	Anchit (anchit)	148	77.04	92.45	37	25.00
3173.	Priyam (priyam_anand)	148	54.33	71.43	9	6.08
3174.	Shally (shallybroken)	148	53.00	67.99	26	17.57
3175.	Trent (uninterested)	148	126.29	166.70	95	64.19
3176.	Adrian (thebossboi1324)	148	65.41	98.95	46	31.08
3177.	☼_☼ (temuramir)	148	106.75	132.19	56	37.84
3178.	Jupiter8000 (jupiter8000)	148	70.41	96.21	47	31.76
3179.	Jony (jonycolemak)	148	76.91	97.93	37	25.00
3180.	denis (j4yz11)	148	47.63	60.64	12	8.11
3181.	Isaac (inied)	148	99.58	133.35	56	37.84
3182.	HiteshM (hiteshm_riptide)	148	76.42	99.36	45	30.41
3183.	Habibullah (habibullahhussa...	148	50.02	71.90	19	12.84
3184.	Musa (greatwarrior235)	148	83.02	103.21	39	26.35
3185.	Jyotirmay (goldenguts)	148	65.32	83.62	36	24.32
3186.	Geux (geux)	148	40.84	58.94	14	9.46
3187.	WSY (elyx_2302)	148	93.69	111.86	64	43.24
3188.	Dennetix (dennetix)	148	57.57	69.45	28	18.92
3189.	Tady (concernednecron)	148	41.67	55.59	15	10.14
3190.	Ping Janat (ppppp5541)	148	43.81	64.95	9	6.08
3191.	Wenjie (pervysama)	148	128.96	147.46	104	70.27
3192.	Leona (onale)	148	125.00	153.06	95	64.19
3193.	Max (max_pinc)	148	83.14	108.27	38	25.68
3194.	RaV (rav_the_writer)	147	101.26	124.74	61	41.50
3195.	Cool (mrcoolguy69)	147	111.12	138.61	72	48.98
3196.	MeHdi (mehdiii8)	147	96.82	120.09	69	46.94
3197.	Eugene (lilgene1)	147	88.84	114.97	45	30.61
3198.	Kaden (lifeshappy)	147	62.86	83.41	37	25.17
3199.	Sanji (kuroashi)	147	67.28	83.38	32	21.77
3200.	Jeden Osiem L (jedenosieml)	147	99.02	117.42	57	38.78
3201.	Bryan (iduhowpeopledo150wpm)	147	104.47	128.20	62	42.18
3202.	Hovok (hovok)	147	108.79	148.39	69	46.94
3203.	H A (hamada_ali)	147	78.71	98.61	33	22.45
3204.	Mehedi (mehedihasan)	147	61.62	76.27	34	23.13
3205.	Woody (woody_wins_)	147	79.55	98.33	25	17.01
3206.	Manas (who_mana)	147	63.53	77.04	35	23.81
3207.	Vbee (vb33)	147	96.25	121.00	63	42.86
3208.	Justin (ustinj)	147	87.49	112.07	44	29.93
3209.	Poly (typingpoly)	147	90.53	118.52	46	31.29
3210.	tomdin0 (tomdin0)	147	32.19	43.87	9	6.12
3211.	tailcatch (tailcatch)	147	122.63	158.31	92	62.59
3212.	vinnii (slowvinni)	147	157.12	193.00	119	80.95
3213.	FA (fa00)	147	47.26	57.78	20	13.61
3214.	BOTbkchod (bot_bakchod)	147	59.48	72.91	27	18.37
3215.	Muruganantham (bossmuruga)	147	40.29	56.74	14	9.52
3216.	Tide (firefly441)	146	63.20	80.67	40	27.40
3217.	David (dave_h12)	146	78.80	95.38	36	24.66
3218.	(clouhhd_)	146	95.44	141.96	4	2.74
3219.	Lam (catposter1)	146	115.19	153.74	129	88.36
3220.	Nafidz (arckngel)	146	68.36	82.47	29	19.86
3221.	AouiGui (andersgrymer)	146	101.12	126.27	64	43.84
3222.	Holo (aisha23__)	146	90.99	110.42	55	37.67
3223.	acc (agglomeration)	146	126.28	155.93	98	67.12
3224.	m1dK$9T (adepa)	146	49.37	65.26	22	15.07
3225.	Lazy (lazy_gamer322)	146	56.17	68.91	17	11.64
3226.	Rocky (rockyparks)	146	72.88	83.84	27	18.49
3227.	ZedHead01 (qdedmon87)	146	98.38	123.92	56	38.36
3228.	Jeon (owokunn)	146	113.88	138.74	74	50.68
3229.	Thomas (loboru)	146	133.92	168.71	109	74.66
3230.	JJ (jjbonta)	146	92.21	116.89	55	37.67
3231.	yoozernaim (yoozernaim)	146	92.73	108.20	49	33.56
3232.	Aditya (typingspree31)	146	80.82	96.02	28	19.18
3233.	pat (trikster)	146	134.05	164.96	100	68.49
3234.	Tracking Time (trackingtime)	146	85.90	111.15	45	30.82
3235.	sura (suraflux)	146	83.43	100.09	47	32.19
3236.	AAARGH (statim)	146	87.44	111.09	54	36.99
3237.	Samuel (ssesena)	146	63.65	85.03	34	23.29
3238.	Wayne (xwang4)	145	83.93	114.96	42	28.97
3239.	WinterCore (wintercore)	145	127.82	161.42	89	61.38
3240.	Umair (umair121)	145	75.76	95.98	34	23.45
3241.	ryleigh (thestonedpotato)	145	79.42	108.00	35	24.14
3242.	De Leo (theleo)	145	58.25	76.01	22	15.17
3243.	Delgerskhn (thege)	145	101.43	121.67	54	37.24
3244.	OULAHBIB (suicv)	145	65.69	82.91	30	20.69
3245.	spiky (spiky228)	145	101.60	119.92	69	47.59
3246.	mikey (snicker861)	145	86.01	107.37	50	34.48
3247.	FootedPear (ryanpear0)	145	75.56	99.15	40	27.59
3248.	Luis (regneva17)	145	74.60	97.73	35	24.14
3249.	parsa (parsa_ktz)	145	57.29	72.28	26	17.93
3250.	(palpha)	145	76.03	102.57	70	48.28
3251.	NessQuik (nessquik)	145	64.44	83.88	34	23.45
3252.	ROCKSTAR008 (mrbest6000)	145	112.81	145.72	77	53.10
3253.	IMSL (moonrabbit)	145	129.58	154.95	95	65.52
3254.	masterassassin3 (masterassa...	145	65.44	79.45	27	18.62
3255.	Ћира (cira12345)	145	84.51	105.40	48	33.10
3256.	Alex (atduffaut)	145	70.95	96.04	37	25.52
3257.	Hououin Kyouma (makise_kuri...	145	85.77	118.00	58	40.00
3258.	Marek (ksydry)	145	105.17	126.62	59	40.69
3259.	Luke (kipkat)	145	57.16	76.83	24	16.55
3260.	गुरु (jokerster)	145	80.85	103.90	37	25.52
3261.	Jiranimo (jiranimo)	145	32.86	52.35	19	13.10
3262.	Tane (husquin)	145	112.80	142.52	74	51.03
3263.	Gunner (gunner8)	145	90.96	115.49	59	40.69
3264.	Gabe (grahamcracker4)	145	69.57	89.96	40	27.59
3265.	kevin (kongdonglong32)	144	85.45	112.20	45	31.25
3266.	Jubax (jubax)	144	90.01	110.57	49	34.03
3267.	Jayanth (jayanththelegit)	144	46.91	64.69	12	8.33
3268.	hossam (hossam_ramadan)	144	53.50	64.40	12	8.33
3269.	saeed (saeedhosam)	144	62.47	83.14	31	21.53
3270.	Rice Chan (rice_chan)	144	108.76	131.97	103	71.53
3271.	Alpine (relambrien)	144	143.20	176.50	106	73.61
3272.	Paul (paul5005)	144	63.28	82.15	26	18.06
3273.	Sanchi (pachi_sanchi)	144	83.74	110.65	47	32.64
3274.	Nooby (noobythenoob)	144	87.32	110.70	51	35.42
3275.	Gina (nannelcam)	144	89.45	113.71	54	37.50
3276.	Leeham (you_smell)	144	78.07	99.65	35	24.31
3277.	Xmoonsheep (xmoonsheep)	144	99.06	125.13	65	45.14
3278.	Zhu (viviora)	144	76.96	92.51	44	30.56
3279.	Sushi (sushixr)	144	70.51	93.38	30	20.83
3280.	Sulthan Cendikia (sulthance...	144	65.85	86.19	39	27.08
3281.	MAXIM (skramt)	144	55.78	74.49	12	8.33
3282.	Andre (andreandreandre)	144	90.87	113.54	50	34.72
3283.	Alex Jane (alex_jane)	144	40.83	54.29	15	10.42
3284.	chepe (albetrash)	144	79.32	101.22	46	31.94
3285.	Francis (francis_7777)	144	60.82	79.70	27	18.75
3286.	fhbjnrng (fhbjnrng)	144	132.83	164.66	115	79.86
3287.	Eddie_NP (eddie023)	144	102.15	123.87	69	47.92
3288.	dylan (crspy)	144	85.30	118.61	29	20.14
3289.	eunhyun (eunhyun)	143	113.79	145.88	73	51.05
3290.	Eric (ericcand)	143	82.36	103.14	35	24.48
3291.	jungkook (elizabethngg)	143	57.97	97.74	19	13.29
3292.	Notaleksandr (cartonito)	143	74.23	98.40	45	31.47
3293.	(bicycleman)	143	101.68	162.95	59	41.26
3294.	aspirar (aspirar)	143	97.56	122.32	92	64.34
3295.	Jo (typermac)	143	108.42	150.36	67	46.85
3296.	joey (joeraps)	143	119.95	139.13	102	71.33
3297.	Jerviz (jerviz)	143	107.24	133.46	80	55.94
3298.	Mycargoboom (hayadabest)	143	95.62	132.81	53	37.06
3299.	G (goutham_k)	143	45.25	59.16	13	9.09
3300.	Bruh? (funkun)	143	63.58	82.77	30	20.98
3301.	Otto (otto_types)	143	77.30	99.20	40	27.97
3302.	HuisbaasJR (ofbasecfin)	143	90.19	116.40	50	34.97
3303.	Mohammad (mostat)	143	50.43	62.14	14	9.79
3304.	salvation (mo7a_1913)	143	78.52	105.70	34	23.78
3305.	Memperor (memeemperor)	143	66.64	89.19	31	21.68
3306.	Arees (arees)	143	77.19	97.64	39	27.27
3307.	Ahmad (aawwad172)	143	62.12	76.86	27	18.88
3308.	Bumble (rowantheboat)	143	52.17	73.53	17	11.89
3309.	ArklightF0x (arklightf0x)	142	56.35	73.74	30	21.13
3310.	antifragile (antifragile)	142	85.15	126.32	42	29.58
3311.	Agnar (agnar)	142	80.94	100.22	46	32.39
3312.	Marco (grinzosi)	142	45.59	56.67	18	12.68
3313.	tanvir (tanvir42)	142	53.75	73.90	24	16.90
3314.	Linfeng (llinfeng)	142	101.97	132.48	59	41.55
3315.	Rav (impaledbison)	142	80.96	105.07	37	26.06
3316.	Arnav (hyp3rn00b10)	142	57.80	77.58	21	14.79
3317.	Huoi (huy_truong_le)	142	86.79	117.60	48	33.80
3318.	111 (grimiv)	142	80.07	95.86	30	21.13
3319.	Chris (gatoroid37)	142	87.64	111.93	39	27.46
3320.	dylan_9802 (dylan_9802)	142	120.90	155.93	73	51.41
3321.	Brandon (dreonic)	142	65.88	81.96	28	19.72
3322.	Appropriate (d0wny)	142	97.30	133.50	57	40.14
3323.	Stanisław (bosastopaa)	142	54.09	75.08	18	12.68
3324.	w (wonton2)	142	130.54	155.90	93	65.49
3325.	TNT92fin (tnt92fin)	142	63.24	76.72	24	16.90
3326.	Shoe (shoebox004)	142	86.60	124.31	47	33.10
3327.	Andy (run_from_andy)	142	63.66	79.97	23	16.20
3328.	ritesh (ritesh123)	142	53.48	71.82	18	12.68
3329.	Neeraj (neeraj1)	142	58.66	77.60	22	15.49
3330.	breddreamer (rasel_hasan)	141	50.19	63.16	9	6.38
3331.	Just a potato (quocbinhgt3007)	141	53.50	82.16	26	18.44
3332.	SirShrek69 (puffers23)	141	108.53	124.51	59	41.84
3333.	Nayeem (obaydul_hasan_nayeem)	141	50.10	61.74	18	12.77
3334.	Andree (ntuanson97)	141	105.81	127.04	71	50.35
3335.	Nim (nim1chimpsky)	141	85.91	111.93	45	31.91
3336.	Ethan (ethant772)	141	116.35	156.80	79	56.03
3337.	bruh (diablodvorak)	141	87.49	106.53	35	24.82
3338.	Dear (dearme)	141	67.03	81.48	33	23.40
3339.	sally (creamdonut)	141	108.02	146.97	69	48.94
3340.	(barfing)	141	134.32	168.93	96	68.09
3341.	ashiq hussain wani (ashiqwani)	141	46.83	58.56	14	9.93
3342.	Ar7N (ar7n)	141	70.60	98.54	31	21.99
3343.	anas (ana_1s)	141	77.38	95.36	31	21.99
3344.	HADI (adilmuhammadi)	141	58.77	73.52	28	19.86
3345.	Abdelrahman (7gab)	141	78.12	109.15	31	21.99
3346.	Abhishek (abhishek_mtb)	141	46.55	59.97	18	12.77
3347.	(lwycsrc)	141	125.92	156.81	86	60.99
3348.	Michael (kame3200)	141	79.39	106.30	31	21.99
3349.	(jlachney)	141	135.20	174.23	96	68.09
3350.	Illumin80 (illumin80)	141	60.60	73.33	25	17.73
3351.	anhar (_anhar)	141	104.45	127.91	51	36.17
3352.	yen (yennn)	141	62.26	82.47	24	17.02
3353.	the (theguy27)	141	80.31	95.69	34	24.11
3354.	Tareq (tareq_2007)	141	52.09	68.23	17	12.06
3355.	Souptacks (souptacks)	140	70.92	96.32	29	20.71
3356.	shota.b (shotiko8)	140	90.66	119.96	51	36.43
3357.	Lulu (shade_senpai)	140	116.89	150.30	77	55.00
3358.	Anis (anis22)	140	59.05	74.17	29	20.71
3359.	65best (65best)	140	106.89	134.49	61	43.57
3360.	Anas (01anas)	140	55.03	72.26	18	12.86
3361.	ayman (aymanzraiga)	140	35.69	51.37	9	6.43
3362.	hhj (baidu123)	140	57.66	70.67	19	13.57
3363.	Indian (typelife2)	140	56.08	70.50	24	17.14
3364.	Negatory (saltedslug)	140	64.70	77.95	29	20.71
3365.	saket (saket1harsh2)	140	58.49	73.53	23	16.43
3366.	Aaron (rondc108)	140	62.52	81.43	39	27.86
3367.	BEing VinCI (ppubalo)	140	87.46	112.12	49	35.00
3368.	Dario (oodarioo)	140	49.93	65.51	17	12.14
3369.	hamza (mizoxes)	140	96.28	118.55	58	41.43
3370.	CVH (cvh_)	140	136.45	163.05	106	75.71
3371.	Badri (bxdri)	140	123.66	167.54	70	50.00
3372.	Joshua (busbud)	140	71.92	94.50	35	25.00
3373.	SKY (avid_learner8)	140	29.64	36.69	20	14.29
3374.	Richrad (laci279)	140	77.46	93.26	32	22.86
3375.	Hai (ky0ka)	140	83.13	107.77	34	24.29
3376.	Viacheslav (krevetko)	140	68.01	85.12	26	18.57
3377.	Yunusali (khakimjanovich)	140	60.96	81.15	21	15.00
3378.	Jonathan (jonathan888)	140	69.67	88.84	32	22.86
3379.	jittery (jittertypes)	140	83.95	105.23	45	32.14
3380.	simon (i_am_simon)	140	97.51	128.09	52	37.14
3381.	asdf (itz_pvp1235)	140	87.89	110.30	50	35.71
3382.	Jan (hokejan_14)	140	37.51	51.11	8	5.71
3383.	Alexander (greenocelot26_dv...	140	106.35	130.44	58	41.43
3384.	Goldie (goldie87)	140	40.06	54.84	12	8.57
3385.	V¹ҡҡʏ (littlevikky_)	139	76.57	96.00	31	22.30
3386.	leo (leokkqqjj)	139	42.74	55.83	14	10.07
3387.	Daniel (kimster773)	139	86.38	108.56	46	33.09
3388.	Jake (jmanq)	139	66.63	97.12	38	27.34
3389.	Ishaan (ishaank10)	139	67.25	86.79	32	23.02
3390.	Harjot (harjot2000)	139	59.83	74.70	25	17.99
3391.	Justin (ggwp_123)	139	60.88	71.69	16	11.51
3392.	Sabrina (getrektttt)	139	66.92	96.43	37	26.62
3393.	Le Hoang (gampingbua)	139	52.11	67.45	14	10.07
3394.	rafi (sandbomber)	139	79.20	105.03	31	22.30
3395.	Rem (remroid66)	139	83.59	104.89	44	31.65
3396.	Randall (rdox10)	139	118.65	156.39	83	59.71
3397.	Mediumsecy (mediumsecy)	139	67.84	84.20	27	19.42
3398.	The Zaffles (zaffles)	139	71.39	94.11	33	23.74
3399.	Cal (wiscahhhhnsin)	139	115.70	151.88	76	54.68
3400.	Vanza (vanzasetia)	139	53.14	67.42	10	7.19
3401.	Ufo23 (ufo23gg)	139	90.17	112.14	55	39.57
3402.	Tar (typer_noob)	139	100.58	126.19	47	33.81
3403.	Welcome to Brazil (thunder02)	139	111.20	146.30	84	60.43
3404.	tayyab (tayyab246)	139	48.02	62.96	18	12.95
3405.	sam (swalden)	139	85.63	104.07	51	36.69
3406.	(ﾉ◕ヮ◕)ﾉ*:･ﾟ�...	139	121.17	159.34	79	56.83
3407.	Riddy (songridv)	139	84.96	120.42	43	30.94
3408.	Ardison (arddison)	139	100.37	116.73	50	35.97
3409.	lakhey (antivenene)	139	94.26	117.50	49	35.25
3410.	longi (alongens)	139	95.00	107.29	40	28.78
3411.	Nick S. (furbyparade226)	139	105.56	127.91	56	40.29
3412.	dlvhdr (dlvhdr)	139	78.71	101.87	32	23.02
3413.	a-s-a (kaustiflat)	139	45.01	59.01	34	24.46
3414.	Soren (cuckslayer)	139	74.01	96.73	40	28.78
3415.	crai (crai27)	139	91.29	110.11	43	30.94
3416.	Will (carbohydra)	139	63.23	76.63	40	28.78
3417.	Yakiniku (bigmeatball)	139	102.17	128.79	44	31.65
3418.	Evan can't pass the validat...	138	95.52	114.81	47	34.06
3419.	Daniel (danvs60)	138	77.77	99.08	36	26.09
3420.	Benjamin Martin (benjamin_m...	138	61.52	78.08	31	22.46
3421.	Benjamin (banjo_)	138	59.00	75.43	25	18.12
3422.	Zulsorai (zulsorai)	138	71.40	92.36	33	23.91
3423.	Gustavo (yoosteen)	138	66.25	76.67	29	21.01
3424.	Alosson (tiger6654)	138	63.87	80.56	32	23.19
3425.	Laggy (thefitfatass)	138	122.59	146.03	97	70.29
3426.	sidharth (sidharth_71)	138	67.25	95.07	41	29.71
3427.	shantal (shantal0924)	138	69.04	98.90	31	22.46
3428.	Mahdi Lotfi (mahdilotfi)	138	58.50	72.18	23	16.67
3429.	jeyy (jeyy11)	138	35.22	46.29	8	5.80
3430.	Liam (je1q)	138	47.77	64.13	17	12.32
3431.	Lushtifer (inanutshell)	138	71.41	89.45	41	29.71
3432.	hhg (hhg2)	138	60.34	73.66	34	24.64
3433.	Rodney (rodneyslafuente)	138	92.20	113.50	35	25.36
3434.	NOJ8 (noj8)	138	82.24	109.33	44	31.88
3435.	Gemeine (nemememky)	138	76.20	99.22	37	26.81
3436.	life (armaansoni)	138	76.89	96.81	40	28.99
3437.	Aparesh (aparex)	137	69.92	87.35	34	24.82
3438.	aculeasis (aculeasis)	137	81.96	117.87	37	27.01
3439.	abdallah (abdallahmontaser)	137	41.83	52.70	10	7.30
3440.	Lorenzo (lolohardy)	137	71.87	92.95	32	23.36
3441.	horyzen1 nq (lucknumber8)	137	87.62	119.49	44	32.12
3442.	Casado con Ale (lrip)	137	118.35	145.35	59	43.07
3443.	Little (littlepump1)	137	77.34	95.64	38	27.74
3444.	kingsley (kings350)	137	68.78	92.82	44	32.12
3445.	kacper szybki (kacper1)	137	47.55	60.56	12	8.76
3446.	Harish (harish_roxx)	137	57.84	79.51	25	18.25
3447.	gcc42 (gcc42)	137	91.93	112.87	51	37.23
3448.	Shivanshu (cvanshu)	137	67.96	85.78	28	20.44
3449.	Dylan (chrunchy)	137	91.13	117.66	44	32.12
3450.	jen (chennyjen)	137	109.65	136.50	69	50.36
3451.	Jacy (bohdan_danyltsiv)	137	78.37	97.40	31	22.63
3452.	Arun (thenooboflegend)	137	80.99	95.93	36	26.28
3453.	Cuong (qt1003)	137	62.40	83.16	24	17.52
3454.	Abror (owl2023)	137	49.43	62.19	15	10.95
3455.	ObiWanKeyboardobi (obiwanke...	137	84.97	119.84	36	26.28
3456.	myaonfya (myaonfya)	137	72.83	107.41	29	21.17
3457.	Mithun (mithu16_2001)	137	57.62	73.14	51	37.23
3458.	J (mindjar)	137	27.70	37.13	23	16.79
3459.	Umer (programmer_1)	136	83.92	101.79	48	35.29
3460.	Ibrahim (platon)	136	95.16	124.36	52	38.24
3461.	weirdo (master_guy17)	136	81.59	113.48	35	25.74
3462.	f2realw (f2realw)	136	67.94	85.12	48	35.29
3463.	Bálint (diabolokiller)	136	82.82	102.88	30	22.06
3464.	Justin (basicjc)	136	58.05	70.56	25	18.38
3465.	asdsfdg (asdfgdsf)	136	76.36	101.33	34	25.00
3466.	tstats[vintage_maavirup] (v...	136	57.14	69.22	25	18.38
3467.	Midorinn1222 (midorin1222)	136	65.91	89.64	41	30.15
3468.	Tayler (tay_bae11)	136	58.05	84.98	35	25.74
3469.	Yurii (yura198)	136	66.78	89.34	32	23.53
3470.	medkit phighting (gayliquid...	136	95.25	138.80	44	32.35
3471.	Eran (umm_eran)	136	103.49	131.26	54	39.71
3472.	sleepo (sleepotimer)	136	93.96	113.09	56	41.18
3473.	Serv (servgd)	136	79.86	99.30	42	30.88
3474.	Zuhaib (zuhaibdam)	135	104.61	135.29	63	46.67
3475.	👺Wainie san (wxia)	135	94.30	124.37	49	36.30
3476.	Hyena (wildhyena)	135	84.16	114.03	31	22.96
3477.	Guest (whoyoung99)	135	85.75	113.78	37	27.41
3478.	Will (w1llmcl)	135	91.95	138.79	49	36.30
3479.	Uladzislau (vlad_13_borisov)	135	76.28	90.16	28	20.74
3480.	Tor (tortle4444)	135	49.61	66.13	12	8.89
3481.	Max (thisismydrive1997)	135	100.99	117.51	43	31.85
3482.	Th3BossC (th3bossc)	135	82.41	112.55	34	25.19
3483.	Taso (tas123)	135	83.85	108.49	62	45.93
3484.	sliptok (sliptok)	135	87.39	115.91	38	28.15
3485.	Seb (sebb7y)	135	103.73	120.46	73	54.07
3486.	Crystal (arcee143)	135	85.34	113.45	97	71.85
3487.	AnasigN (anblk)	135	36.39	56.10	7	5.19
3488.	ali (ali79taba)	135	71.16	84.93	46	34.07
3489.	Ezad (ezad99)	135	55.62	72.76	21	15.56
3490.	Reenreen (reenreen)	135	70.24	91.67	41	30.37
3491.	PogChamp (raziqphantomz)	135	114.80	134.82	77	57.04
3492.	Allen (onelonelyguy101)	135	64.58	89.69	30	22.22
3493.	Nour (nourxcx)	135	105.50	135.10	66	48.89
3494.	Mohammad (moreda1999)	135	74.31	95.54	36	26.67
3495.	Michael (mihcael)	135	95.51	125.68	53	39.26
3496.	Nour (micasa_ackarmen11)	135	36.86	46.70	10	7.41
3497.	Manne (epicblueberry)	135	85.46	106.74	37	27.41
3498.	J (jihoomoon)	135	75.21	94.54	36	26.67
3499.	ヴィエット (hsdpa365)	135	86.69	112.36	38	28.15
3500.	chabe (halfu)	135	95.02	123.59	86	63.70
3501.	Guggles (guggles)	135	103.60	130.08	71	52.59
3502.	loveleen (loveleenasalia)	134	60.04	71.25	19	14.18
3503.	Ralston (ralstonnub)	134	63.11	80.68	35	26.12
3504.	Avery (purplat)	134	105.43	141.72	49	36.57
3505.	Vincent (not_a_robot)	134	103.44	130.90	59	44.03
3506.	muchinchai (muchinchai)	134	88.82	103.57	43	32.09
3507.	Matiss (mazainwastaken)	134	37.18	47.12	5	3.73
3508.	Bram (yogurt55)	134	72.70	95.52	36	26.87
3509.	🚀 (wildreamz)	134	104.71	114.06	46	34.33
3510.	thinkingds (sohandeshar)	134	74.86	90.29	30	22.39
3511.	morsetyper (typing_with_morse)	134	13.52	21.40	27	20.15
3512.	Josh (expiredvenom)	134	98.31	116.77	52	38.81
3513.	Anik (eternatus)	134	62.70	74.70	36	26.87
3514.	Enrico (enricoaf)	134	93.53	133.42	58	43.28
3515.	DunDun (dundunbread)	134	56.97	70.21	22	16.42
3516.	cadde (cadde)	134	59.00	75.03	18	13.43
3517.	Cube (cubedefender)	133	84.20	111.91	37	27.82
3518.	Em (cookie666)	133	88.03	111.19	93	69.92
3519.	Petrus (clavigerpc)	133	62.58	83.59	32	24.06
3520.	nub (buildernub)	133	66.87	87.70	33	24.81
3521.	Andrei (belearau)	133	81.93	101.65	34	25.56
3522.	Bauyrzhan (baurtokenov)	133	107.45	130.06	66	49.62
3523.	Benjamin (xlr8or)	133	94.01	112.85	38	28.57
3524.	9aswara (victorious1)	133	39.38	59.84	9	6.77
3525.	Eugene (sushiwaumai)	133	77.86	97.92	37	27.82
3526.	Sean Paolo (seanpaolo_22)	133	80.60	99.23	42	31.58
3527.	. (lun_rix)	133	85.63	103.70	29	21.80
3528.	Mamazait (kozhoev1)	133	39.92	69.99	6	4.51
3529.	jakub (jakub177)	133	84.44	106.17	37	27.82
3530.	JJ (jajo_00)	133	49.98	64.19	15	11.28
3531.	Jacob (jacobjuras)	133	115.01	141.86	77	57.89
3532.	tstats[rajveer_100] (rajvee...	133	53.27	68.16	18	13.53
3533.	Stas (onixflip)	133	72.57	92.06	25	18.80
3534.	Omar (omar_ziada)	133	81.54	113.59	42	31.58
3535.	J (nothisisjeff)	133	81.40	102.58	30	22.56
3536.	An (anhanpro2k)	133	82.52	102.76	40	30.08
3537.	albert (albertos13)	133	89.74	114.61	43	32.33
3538.	Admaster (admaster)	133	59.67	80.33	29	21.80
3539.	mohamed (spear_dfjdklf)	133	64.94	84.80	32	24.06
3540.	Eryk (erykeryk1998)	133	40.91	59.30	16	12.03
3541.	PinkyPonky (pinky_ponky)	132	61.32	86.71	31	23.48
3542.	Shreya (shreya02)	132	36.21	45.05	6	4.55
3543.	Dat (dat_amazon)	132	23.42	72.97	21	15.91
3544.	Abhijeet (free_wanderer)	132	59.91	79.97	30	22.73
3545.	Fire (fire_rice)	132	77.19	98.72	32	24.24
3546.	Dishant (dishant_10)	132	46.52	62.50	11	8.33
3547.	Aron (aronbk)	132	91.62	112.41	44	33.33
3548.	John (whalenj)	132	55.39	69.39	16	12.12
3549.	Mau (walfare_12)	132	93.52	122.64	50	37.88
3550.	Gary (vision_123)	132	52.25	63.59	25	18.94
3551.	Jack (user85793)	132	92.79	123.43	47	35.61
3552.	Keith (touchpoint)	132	69.72	86.91	37	28.03
3553.	afafaf (tkuo42)	132	113.38	139.23	79	59.85
3554.	gfy (tiga6)	132	42.29	59.89	14	10.61
3555.	Bùi (thundergod1311)	132	63.57	81.48	30	22.73
3556.	gabriel (super_racer1)	132	68.42	88.37	25	18.94
3557.	wiredShark (slamerpunch)	132	91.47	123.13	45	34.09
3558.	Sam (samsmoke)	132	65.66	80.27	28	21.21
3559.	Erik (rocketdog_23)	132	67.73	82.27	17	12.88
3560.	Soham (okaysoham)	132	53.32	69.41	21	15.91
3561.	neyo (neyoka)	132	83.64	104.49	43	32.58
3562.	M (musketeertypist)	132	108.41	130.35	68	51.52
3563.	John (meep_beep)	132	76.19	98.47	39	29.55
3564.	2Centuries (marwankhaled)	132	96.06	118.42	49	37.12
3565.	Roman (romanzm19)	131	35.09	44.62	7	5.34
3566.	RHYTHM MOTWANI (rhythm_123)	131	28.09	38.89	26	19.85
3567.	Myles (pord)	131	49.94	62.45	8	6.11
3568.	Aaditya Pal (ninjaadi7903)	131	86.09	114.24	31	23.66
3569.	nivedh (n43527)	131	84.66	103.44	38	29.01
3570.	mik (miiik)	131	76.29	93.31	39	29.77
3571.	Martin (megdal02)	131	101.75	123.95	58	44.27
3572.	Lucy (masterlu789)	131	77.80	97.50	24	18.32
3573.	Frara (frara)	131	43.81	61.93	10	7.63
3574.	Cuthbert (cuthybert)	131	123.51	163.01	86	65.65
3575.	braden (cablebox)	131	63.81	100.35	33	25.19
3576.	Luis (lmorales)	131	90.97	113.07	49	37.40
3577.	Karan (kk11007)	131	34.02	47.04	6	4.58
3578.	chuanHui (juchh)	131	37.79	46.43	10	7.63
3579.	hello :) (heyimalexsmileyface)	131	105.71	134.81	51	38.93
3580.	Usman (grim_09)	131	75.56	98.51	49	37.40
3581.	Jayden (gancube)	131	91.99	123.60	37	28.24
3582.	Alistair (futuresenator)	131	79.34	109.35	36	27.48
3583.	Abdy (a7xsg)	131	50.58	63.28	11	8.40
3584.	Ryan (rtyocum)	131	69.01	83.40	24	18.32
3585.	Fabio (fl1410)	131	60.30	77.72	25	19.08
3586.	Shnyll (shnyll10)	131	56.31	85.22	21	16.03
3587.	bozo (erengunaydin_)	131	78.70	98.61	37	28.24
3588.	Stefan (x2stefan)	131	57.22	78.77	23	17.56
3589.	Guest (weruio)	131	72.66	98.31	36	27.48
3590.	vrz (vrztaa)	131	64.17	77.04	30	22.90
3591.	Dante (therealdante13)	131	58.04	71.86	19	14.50
3592.	Lincoln (soupyy34)	131	81.15	110.05	35	26.72
3593.	Syie (shinze)	131	110.37	139.79	59	45.04
3594.	Zeyad (zeyad_mohamed)	130	45.17	58.82	12	9.23
3595.	GOBLIN (xgoblin)	130	106.50	146.84	60	46.15
3596.	Hunter (wizardhunter11)	130	85.26	108.99	35	26.92
3597.	Daehan (vitamaxdh)	130	93.45	116.83	44	33.85
3598.	Md. Tarek Hasan (tarek_racer)	130	60.80	78.86	19	14.62
3599.	Timofey (t1m0n)	130	81.38	95.69	39	30.00
3600.	sherry (sherry4)	130	75.61	93.31	37	28.46
3601.	heythisistej (lucknumber8_alt)	130	88.81	115.03	43	33.08
3602.	Olexiy (lexk)	130	77.29	98.63	38	29.23
3603.	Mohammed (ledger67)	130	76.95	94.65	23	17.69
3604.	nakkooo (kuudere)	130	137.10	183.15	90	69.23
3605.	mike (jazz_hands)	130	107.40	130.48	60	46.15
3606.	laezza (inimitabile)	130	95.00	130.55	51	39.23
3607.	SMdG (hyperlord)	130	67.93	80.91	34	26.15
3608.	Remi (remi_11)	130	56.64	72.04	24	18.46
3609.	Red (redchristian16)	130	81.57	100.60	42	32.31
3610.	Pheontern (pheontern)	130	68.11	83.11	29	22.31
3611.	Sriram (nvsriram)	130	83.63	99.69	40	30.77
3612.	Mikey (miket349)	130	109.71	147.61	55	42.31
3613.	endless (dm475)	130	76.65	105.94	40	30.77
3614.	Corné (corneduring)	130	73.41	88.98	34	26.15
3615.	Tenzin (cleggmcmuffin)	130	90.15	120.53	45	34.62
3616.	Billy (battlefieldragon)	130	101.62	119.08	50	38.46
3617.	Basketbla (basketbla)	130	72.87	92.74	40	30.77
3618.	Miguel (anckael)	130	101.43	122.90	61	46.92
3619.	Akshay (akshay_c123)	130	42.15	57.12	13	10.00
3620.	akash_mzp (akash04mzp)	130	34.69	47.40	9	6.92
3621.	Steve (addictedtoendorphins)	130	107.32	124.01	68	52.31
3622.	Abbey (abbey240901)	130	85.64	101.67	30	23.08
3623.	Ni (013ni)	130	94.04	119.56	50	38.46
3624.	Lucyfer666 (lucyfer666)	130	71.53	90.06	38	29.23
3625.	bg (bbbggg)	130	33.41	44.12	7	5.38
3626.	David (nesor)	130	61.88	88.43	32	24.62
3627.	radish (onlyradish)	129	94.09	115.88	58	44.96
3628.	Nikhil (momo7636)	129	49.06	59.85	11	8.53
3629.	CHUGGITYPES (chuggitypes)	129	74.98	97.12	21	16.28
3630.	Decent (coolgamerplayer124)	129	73.99	94.61	30	23.26
3631.	Person (person753)	129	72.37	96.25	42	32.56
3632.	Alexander (need4speed402)	129	91.80	132.07	40	31.01
3633.	Naeem (naeemsalarzai)	129	39.45	56.18	15	11.63
3634.	Niue (miloszz)	129	74.24	91.13	26	20.16
3635.	winner (winner11)	129	106.50	132.17	72	55.81
3636.	Tom (tom09876)	129	53.41	65.75	11	8.53
3637.	TJ (timothyjan)	129	86.95	105.65	43	33.33
3638.	Pedro (timboly3)	129	98.39	131.60	61	47.29
3639.	Rouven (therealr5)	129	44.49	58.46	14	10.85
3640.	Kreingkrai (kengkreingkrai)	129	67.06	81.93	33	25.58
3641.	Muhammad (junaidqazi)	129	57.53	73.06	19	14.73
3642.	Jacob (jacobogbeide)	129	73.71	97.76	28	21.71
3643.	David (hanid3)	129	76.81	98.32	37	28.68
3644.	Hamza π (hamzza_)	129	104.07	125.08	55	42.64
3645.	augustus (guslee)	129	106.61	130.85	57	44.19
3646.	Falitac (falitac)	129	78.34	103.16	46	35.66
3647.	TypingSince2017 (expeditive)	129	147.70	184.96	98	75.97
3648.	alloine0220 (d1rtyd33d_5)	128	51.16	70.41	11	8.59
3649.	BOOGIE (bobarex)	128	47.02	60.34	10	7.81
3650.	blaze (blaze_012)	128	54.57	65.92	10	7.81
3651.	tstats[beedi] (beedi)	128	72.41	96.51	38	29.69
3652.	Wouter (wouter_kuijk)	128	87.93	106.98	40	31.25
3653.	venki (venki15)	128	66.16	82.92	60	46.88
3654.	Haris (undead_slayer)	128	67.96	83.43	58	45.31
3655.	tje (tje04)	128	88.65	119.56	40	31.25
3656.	Raymond (szlesh)	128	93.08	121.77	53	41.41
3657.	saniya (supersaniya)	128	54.98	68.48	18	14.06
3658.	bubbleTEA (stefsbored)	128	77.86	102.63	34	26.56
3659.	10 🆆🅿🅼 (sostdeo)	128	57.95	67.55	20	15.63
3660.	Roy (sisalt)	128	99.40	123.30	47	36.72
3661.	Shukhrat (shux121995)	128	70.79	87.26	28	21.88
3662.	Andrew (andrewfischr)	128	66.61	81.81	21	16.41
3663.	Abstraxions (abstraxions)	128	115.66	141.64	65	50.78
3664.	Gabe (zonazebra)	128	67.65	88.16	34	26.56
3665.	shishir_karanth (shishira1203)	128	90.50	112.60	46	35.94
3666.	Raghav (redsondude)	128	99.24	119.91	48	37.50
3667.	Ravindra (ravindrats)	128	62.42	75.49	19	14.84
3668.	Phillip (phillip_kim)	128	84.00	124.64	45	35.16
3669.	Caleb (miniso0987)	128	132.14	164.26	53	41.41
3670.	johnny :P (johnny234)	128	87.49	108.27	39	30.47
3671.	Ivan (ivanv1997)	128	62.88	72.06	21	16.41
3672.	gab (ggzl1998)	128	106.15	128.38	72	56.25
3673.	AMM (gamesplaytest)	128	61.33	82.90	25	19.53
3674.	KTH (kthmanish)	127	86.25	115.89	42	33.07
3675.	ghoudiy (ghoudiy)	127	66.75	92.12	20	15.75
3676.	Krittiphum (100508274)	127	101.36	122.35	54	42.52
3677.	Ryan (barnes12)	127	64.10	83.71	30	23.62
3678.	Kalervo (dilbodeadhorseflog...	127	66.94	81.70	23	18.11
3679.	desarly (desarlymarshall)	127	64.01	87.04	32	25.20
3680.	Wendy (crystalblue123)	127	56.64	70.84	21	16.54
3681.	Chumba1ba (chumba1ba)	127	94.62	118.73	43	33.86
3682.	Jimmy Le🇻🇳🇺🇸 (c...	127	70.91	88.72	30	23.62
3683.	Peter (upsala_koy)	127	75.82	92.01	33	25.98
3684.	Aren (tl8xv)	127	89.96	121.55	39	30.71
3685.	sheep (theonesheep)	127	100.72	129.58	53	41.73
3686.	SR (ssdel)	127	85.13	116.43	48	37.80
3687.	HEMEL (sm_hemel)	127	74.20	89.27	23	18.11
3688.	Cris (schmidtolini)	127	98.29	123.88	52	40.94
3689.	Basti (schinken38)	127	71.79	98.09	35	27.56
3690.	Mohamad (mhsyazani)	127	66.43	88.47	30	23.62
3691.	mazen (mazen25287)	127	55.84	73.12	13	10.24
3692.	Bat-Amgalan (mambatukaa)	127	80.67	97.79	36	28.35
3693.	felix (sanfelix)	126	64.72	87.31	26	20.63
3694.	Sam (samb11)	126	102.09	126.16	53	42.06
3695.	PUO (puomaster)	126	67.43	83.55	40	31.75
3696.	Daniel Mulligan (parubujotuce)	126	41.06	58.84	12	9.52
3697.	Panic (panicswitch07)	126	85.86	131.07	44	34.92
3698.	idell (notidell)	126	89.58	110.24	42	33.33
3699.	Mauro (mauronaval)	126	52.42	68.40	15	11.90
3700.	stained (fartunderwear)	126	170.19	200.25	0	0.00
3701.	m&m (egyz)	126	84.13	101.55	43	34.13
3702.	Pei Bin (cheongpeibin)	126	93.64	132.28	45	35.71
3703.	Bymbadulam (boa_7515)	126	50.49	67.68	12	9.52
3704.	mackysmach (mackysmach)	126	60.64	82.05	35	27.78
3705.	John (johnykenny)	126	73.32	98.23	29	23.02
3706.	Miles (jetblxckwalls)	126	101.21	126.02	57	45.24
3707.	Snowy (it_was_lag)	126	90.74	127.61	40	31.75
3708.	Jacob (hydrogenation)	126	87.76	116.76	40	31.75
3709.	Anadi vyas (anadivyas)	126	73.67	88.67	19	15.08
3710.	Adam (adammomen)	126	61.44	76.63	19	15.08
3711.	Nuub (1brasil)	126	102.42	131.43	51	40.48
3712.	Typemasterluka (fica030)	126	56.94	73.17	16	12.70
3713.	Andrei (_son_)	126	169.89	194.72	118	93.65
3714.	Pratul NHK (zer_fus)	126	56.45	71.39	20	15.87
3715.	Aaron (the_bus)	126	76.67	89.91	35	27.78
3716.	no (theovive)	126	101.92	128.87	60	47.62
3717.	Sean (seandominic14)	126	78.45	93.72	38	30.16
3718.	Bob (wmwmwmwm)	125	81.26	115.25	31	24.80
3719.	Tanver (tanverrupos)	125	80.54	107.40	34	27.20
3720.	Stafford (staffordv)	125	84.21	111.88	29	23.20
3721.	Sphynx (sphynxy)	125	80.83	103.32	32	25.60
3722.	Soph (soap28)	125	43.92	57.08	6	4.80
3723.	Jessica (jeguar)	125	89.30	127.51	36	28.80
3724.	Grant (gboi881)	125	65.53	80.93	28	22.40
3725.	ridicolos (ridicolos)	125	79.93	96.80	37	29.60
3726.	Rendi (rendi_touchtype)	125	91.60	120.60	46	36.80
3727.	Perry ᗜˬᗜ (perryok)	125	125.45	151.72	77	61.60
3728.	Aisha (needforspeed_)	125	52.96	76.27	14	11.20
3729.	Shonade (mr_overclocked)	125	87.40	128.17	32	25.60
3730.	Ujjwal (megamindx)	125	65.13	96.09	24	19.20
3731.	Mayank (mayank1508)	125	71.75	85.59	24	19.20
3732.	Murk (marchell0)	125	66.39	91.85	33	26.40
3733.	Maninder (mani_ms1)	125	76.42	101.69	32	25.60
3734.	daniel (dpainter)	125	99.51	118.59	57	45.60
3735.	Cuong (cuongdao)	125	78.55	99.60	32	25.60
3736.	Jeff (chiefjeef)	125	109.83	136.78	75	60.00
3737.	CB (cb_cabral)	125	37.36	47.44	11	8.80
3738.	Wen Ree (cataclysm234)	125	79.51	103.72	37	29.60
3739.	Brandon (brandon_b)	125	80.53	102.73	28	22.40
3740.	Manu (basuramanu)	125	111.15	159.27	65	52.00
3741.	ATRAN (atranhehe)	125	76.91	98.36	25	20.00
3742.	ارمغان (armaghan_ahmed)	125	56.87	71.22	17	13.60
3743.	Slowpoke (amisanthropist)	125	95.14	125.73	41	32.80
3744.	aman729272 (aman729272)	124	55.50	64.91	19	15.32
3745.	Tony (adbaldini)	124	45.57	59.79	9	7.26
3746.	Vu (3nim3)	124	85.17	108.17	31	25.00
3747.	Scalmole (scalmole)	124	89.09	112.16	47	37.90
3748.	Per (perlydersen)	124	67.31	81.15	29	23.39
3749.	NickBwalley (nickbiiy)	124	97.16	122.02	52	41.94
3750.	mayimbe (mayimbe194)	124	76.99	98.10	28	22.58
3751.	araceli nicole (xrxcxlx)	124	73.28	104.45	74	59.68
3752.	dude (udead1)	124	108.62	124.60	58	46.77
3753.	Quan (tmquan98)	124	77.36	117.83	25	20.16
3754.	Stitch (lostowo)	124	65.58	91.29	48	38.71
3755.	Jay (jay_soh)	124	93.89	109.92	41	33.06
3756.	Jason (jasonw1121)	124	106.33	134.77	80	64.52
3757.	Gabriel (itsgiorno)	124	56.22	68.35	27	21.77
3758.	g (georgecolin1221)	124	44.30	62.98	11	8.87
3759.	Roman (freasy)	124	59.97	77.91	21	16.94
3760.	Anye (farmerfred)	124	81.93	100.57	44	35.48
3761.	Edu (edlofe)	124	63.19	84.05	29	23.39
3762.	Sir (dsfee)	124	66.21	82.33	33	26.61
3763.	hu (crediblez)	124	143.90	190.09	89	71.77
3764.	bhavesh (bhanucsgo)	124	55.60	75.51	23	18.55
3765.	bangka (bangkabelitung)	124	81.42	102.82	26	20.97
3766.	Desert (desert_eagle)	123	38.80	50.05	9	7.32
3767.	isaac (darealjoemama)	123	73.68	95.49	38	30.89
3768.	ousssama (cybereagle2001)	123	51.60	65.74	14	11.38
3769.	Code_slayer_25 (code_slayer...	123	39.40	49.86	10	8.13
3770.	bombplay1 (bombplay1)	123	78.65	102.78	35	28.46
3771.	Zx (zxloh)	123	72.11	89.44	25	20.33
3772.	Zodi (zodi_dutoit)	123	70.63	84.61	28	22.76
3773.	Yash (yash1402_)	123	85.14	108.74	28	22.76
3774.	k2K (worthwhile)	123	64.48	85.47	22	17.89
3775.	Julia (thejulia)	123	66.91	81.06	21	17.07
3776.	nonaem (apansi)	123	90.16	119.95	39	31.71
3777.	Ankit (ankp)	123	47.61	59.30	13	10.57
3778.	aero (aeroagg15)	123	84.14	110.91	38	30.89
3779.	sketchy (sketchysquirrel)	123	79.02	100.30	36	29.27
3780.	jclb (jclb)	123	67.15	88.43	30	24.39
3781.	donald_dump. (lookin_xss)	123	58.20	74.23	24	19.51
3782.	Alan (alanzim)	123	67.03	90.42	31	25.20
3783.	sathwik_0777 (sathwik_7770)	123	58.16	73.70	18	14.63
3784.	RoSchnitzel (sab_lyptical42)	123	63.53	84.00	15	12.20
3785.	Logan (ronaldo_02)	123	78.45	106.21	38	30.89
3786.	Novandru (novandru98)	123	68.27	87.85	23	18.70
3787.	Lawrence Leones (leonnids)	123	114.52	150.73	64	52.03
3788.	Juan (juanmartinez111)	123	73.25	92.70	30	24.39
3789.	AKIS (harkar)	123	62.75	79.12	29	23.58
3790.	Thank you, (maintrack)	122	135.72	176.94	78	63.93
3791.	MAHIR (mahirlabib)	122	56.01	69.25	22	18.03
3792.	Muhammad (littlememon)	122	69.19	91.91	33	27.05
3793.	Laura (laurga)	122	102.35	125.82	45	36.89
3794.	Homer (aerowang)	122	58.86	72.20	16	13.11
3795.	adarshdhital007 (adarshdhit...	122	47.11	73.85	17	13.93
3796.	Adamelvis (adamelvis)	122	73.56	92.18	27	22.13
3797.	Daniel (maddan2016)	122	83.06	106.50	27	22.13
3798.	dulux23 (dulux23)	122	99.52	121.63	47	38.52
3799.	Ana (druze_tito)	122	53.58	70.42	19	15.57
3800.	yah-yeet (dingdong768)	122	105.40	125.98	58	47.54
3801.	Andrew (dijkstra)	122	92.33	113.13	46	37.70
3802.	CHEESE (chromatickhaled)	122	103.85	121.28	50	40.98
3803.	twitch_NotDefense (bravedev...	122	92.21	114.26	31	25.41
3804.	Blake (blake4605)	122	75.87	93.24	35	28.69
3805.	Binay (binayginodia)	122	68.15	86.16	24	19.67
3806.	yash (userthree)	122	52.87	67.12	16	13.11
3807.	Golf GTI (typeracer_user_)	122	82.96	102.56	35	28.69
3808.	vinh (tienvinh)	122	54.25	68.51	13	10.66
3809.	Alireza (thealireza)	122	116.11	154.94	76	62.30
3810.	snackmancer (snackmancer)	122	141.77	165.38	93	76.23
3811.	Mikke (skrammelkonto)	122	59.54	70.20	41	33.61
3812.	Sherniiaz (shero2002)	122	64.85	81.09	32	26.23
3813.	pablo (pablo_rm1197)	122	82.06	109.61	31	25.41
3814.	otto (ottocorrect)	122	91.98	114.45	39	31.97
3815.	Phil (miss_you_reck)	122	131.79	153.07	91	74.59
3816.	matin (mdmatin4)	122	43.93	58.57	6	4.92
3817.	Ryan (riceisgoodman)	121	91.80	115.72	40	33.06
3818.	Putus (putusbb)	121	24.50	35.84	18	14.88
3819.	Lesibana (profles)	121	64.70	87.16	25	20.66
3820.	DDIR (pn10401006)	121	59.06	72.98	23	19.01
3821.	PAT (pat0216)	121	75.39	93.33	31	25.62
3822.	Egg (organicegg)	121	90.75	115.48	43	35.54
3823.	Nungkha (nungkha)	121	58.43	81.79	22	18.18
3824.	no (nomaybeyes)	121	94.22	121.67	40	33.06
3825.	Andrei (elpelaodank)	121	169.24	204.35	101	83.47
3826.	Aloysius (dude101no)	121	95.91	114.58	42	34.71
3827.	Arnab (arnab_api)	121	67.69	82.62	22	18.18
3828.	David (jabadahub25)	121	64.57	82.98	28	23.14
3829.	a (im_typing_with_my_d)	121	72.19	89.85	27	22.31
3830.	Andrew (honeyman)	121	129.37	159.68	79	65.29
3831.	Blake (hanlentt)	121	65.27	95.25	26	21.49
3832.	Gabriel (gbvicente)	121	80.91	100.96	26	21.49
3833.	Abed (abed42)	121	65.46	98.65	30	24.79
3834.	Sandeep (5keleton)	121	28.89	37.89	18	14.88
3835.	chi (naviqq)	121	71.27	84.46	35	28.93
3836.	Benjie (xbenjie)	121	125.82	170.31	84	69.42
3837.	Eric (wernerosorio)	121	91.94	117.93	36	29.75
3838.	vitvlkv (vitvlkv)	121	59.56	73.08	18	14.88
3839.	Stank (stankyard)	121	60.30	78.38	33	27.27
3840.	Seraphear (_seraphear)	120	73.79	85.75	31	25.83
3841.	Vinni (vinnico)	120	60.01	75.13	17	14.17
3842.	skyeblu7 (skyeblu7)	120	94.07	115.51	46	38.33
3843.	sika (sikathenub)	120	81.85	109.22	52	43.33
3844.	Shelpeck (shelpeck)	120	55.18	75.44	17	14.17
3845.	serien (serien_)	120	86.00	113.62	28	23.33
3846.	M (magmag00)	120	53.03	64.51	7	5.83
3847.	Lord Kuro (lordkuro)	120	91.92	117.59	39	32.50
3848.	chromebook user (kuxir97)	120	69.63	92.41	57	47.50
3849.	KM9 (kunal2795)	120	88.32	127.09	65	54.17
3850.	光次郎 (koujiro)	120	81.61	109.93	33	27.50
3851.	Alfred (junior162007)	120	63.62	87.24	26	21.67
3852.	tstats[itchyhuman] (itchyhu...	120	113.72	148.03	62	51.67
3853.	Invis (invis_lurker)	120	80.63	119.82	28	23.33
3854.	pavle (hello_kittyy)	120	84.68	101.04	34	28.33
3855.	Gamer (gamer_equine)	120	53.30	67.48	19	15.83
3856.	Gajendra (gajendra_0180)	120	70.68	87.64	113	94.17
3857.	Sahil (sahil_sa)	120	57.16	68.32	14	11.67
3858.	Rafar (rafar504)	120	62.01	79.30	16	13.33
3859.	Mykhailo (pushkarov)	120	52.01	64.43	20	16.67
3860.	Prosper (prosperhuang)	120	85.35	105.89	30	25.00
3861.	oley (oley11)	120	50.08	65.33	10	8.33
3862.	Road (oldayanisnoob)	120	55.06	71.90	25	20.83
3863.	Noob (noob_racer1)	120	78.33	100.83	61	50.83
3864.	Sreshta Kamya (nikitha)	120	83.55	104.52	37	30.83
3865.	Narmichid (narmichid_2003)	120	59.08	76.12	25	20.83
3866.	Colin (modernbonsai)	120	79.43	96.21	28	23.33
3867.	Mohammad Hossein (mh1998)	120	81.45	99.89	38	31.67
3868.	Andre (dreson03)	120	85.36	114.59	36	30.00
3869.	Mario (dmfz)	120	72.91	91.79	32	26.67
3870.	Deltaology (deltaology)	120	48.58	66.64	9	7.50
3871.	DeadpoolFromAliBaba (bruhgo...	120	60.58	79.13	22	18.33
3872.	Aleks (alexmandev_3)	120	77.21	95.02	36	30.00
3873.	click clack (albert471)	120	130.40	160.14	74	61.67
3874.	Akkmaharaj (akkmaharaj)	120	67.37	87.37	24	20.00
3875.	Ae (aezharhu)	120	77.48	99.77	28	23.33
3876.	suhuyini (smaimoro)	120	32.70	46.08	18	15.00
3877.	Bed Rock (bedhat7)	120	58.32	84.02	20	16.67
3878.	aedan (aedanbinoy)	120	27.65	36.26	27	22.50
3879.	jitin (jitinharyana)	120	98.72	119.71	35	29.17
3880.	Chad (chad_nuckolls)	120	62.04	74.33	21	17.50
3881.	Leo (leoroy7x7)	120	68.19	86.11	31	25.83
3882.	Rochtark (rochtark)	120	48.25	61.77	8	6.67
3883.	Amer (amer202)	119	51.08	70.58	14	11.76
3884.	albit (albit)	119	35.38	48.68	3	2.52
3885.	ponyo (ponyyo2323)	119	33.73	47.94	2	1.68
3886.	polongas (polongas)	119	50.30	67.81	10	8.40
3887.	Ben (mrjamminkearl)	119	91.69	120.85	41	34.45
3888.	Tralalero Tralala (mita57)	119	101.90	122.26	51	42.86
3889.	CelerySticks (whatan0b)	119	101.15	123.16	47	39.50
3890.	Speed (ututu222)	119	97.89	129.84	43	36.13
3891.	pugman (thepugpro)	119	105.91	142.64	56	47.06
3892.	Anurag (mak42)	119	79.41	100.27	34	28.57
3893.	Mark (loggsu)	119	97.94	135.32	47	39.50
3894.	mkk (litt1e_ave1)	119	42.44	54.15	31	26.05
3895.	bruh (lambertwp)	119	70.96	90.71	30	25.21
3896.	Blaze (klblaz)	119	83.64	106.50	29	24.37
3897.	buynaa (kamikaze0612)	119	85.94	109.04	26	21.85
3898.	Jin Yi (jinyisim)	119	94.36	113.96	43	36.13
3899.	VY (india_vikas_yadav)	119	133.58	160.68	88	73.95
3900.	Speed is relative (hvan1998)	119	72.15	87.01	20	16.81
3901.	Chen (chen_)	119	80.47	96.44	30	25.21
3902.	Bharath (bharath0915)	119	50.76	65.87	9	7.56
3903.	Exzede (exzede)	118	66.28	88.97	32	27.12
3904.	😳 (expertgeneralist)	118	87.89	111.31	35	29.66
3905.	Ethan (ethan_5)	118	100.10	129.70	47	39.83
3906.	cod1r (cod1r)	118	89.89	120.20	41	34.75
3907.	james (chilty14)	118	76.82	105.39	33	27.97
3908.	Ihor (_ihor)	118	47.52	60.02	15	12.71
3909.	Shubham (_anonymous)	118	50.80	66.89	10	8.47
3910.	Zaid (zaid1012)	118	58.59	78.01	30	25.42
3911.	TBo (tbo_)	118	84.69	110.32	30	25.42
3912.	Steve (srd93)	118	89.96	106.99	42	35.59
3913.	Satyam (sprayinglight0)	118	71.55	89.92	27	22.88
3914.	someonewhoisntlikeyou (some...	118	99.54	119.89	57	48.31
3915.	Argo (argonautika)	118	84.95	108.49	30	25.42
3916.	Ankush (ankush_12)	118	57.44	73.02	20	16.95
3917.	Aamill (aamill)	118	91.88	117.59	34	28.81
3918.	Ryan (8baller)	118	68.17	87.21	29	24.58
3919.	(4lsi3w544lwi4lk)	118	129.99	155.49	78	66.10
3920.	:( (notabot69)	118	64.59	80.42	23	19.49
3921.	SSJ 5 :) (rak99)	118	48.49	62.83	9	7.63
3922.	n1tro (n1tro)	118	70.38	90.80	38	32.20
3923.	Sam (sambibiriz)	118	51.59	91.55	20	16.95
3924.	Safi (_safi_)	118	70.68	87.29	26	22.03
3925.	Scotf (scottgraham)	118	40.50	53.40	8	6.78
3926.	Hussam (samwa7sh800)	118	65.50	80.64	29	24.58
3927.	Elliot (privateplague)	118	80.64	100.26	29	24.58
3928.	Shinji (nagkagrabe7)	118	96.95	118.73	42	35.59
3929.	Michael (mwalter32123)	118	69.77	84.97	29	24.58
3930.	matcha (matchamacchiato)	118	111.26	137.29	67	56.78
3931.	🍉 (masqueworld)	118	119.51	141.86	66	55.93
3932.	Gaurab (logan_pi)	118	60.01	79.22	25	21.19
3933.	Liam (lime_da_bestest)	118	80.81	100.72	29	24.58
3934.	VH (jaywild)	118	60.13	77.47	23	19.49
3935.	lav (illblowurmind)	118	102.09	131.91	43	36.44
3936.	how? (haotingz)	118	105.06	129.65	57	48.31
3937.	Garrett (gdiegnan147)	118	119.43	144.32	65	55.08
3938.	Yevhen (m1rev)	117	38.90	57.69	9	7.69
3939.	max (low_wpm)	117	49.40	60.43	11	9.40
3940.	kikiki (kiki02613)	117	99.98	117.11	48	41.03
3941.	laptopwinterpro (justanothe...	117	146.69	168.37	84	71.79
3942.	josh (joshtypes1)	117	107.91	145.30	51	43.59
3943.	Jonas (jonasj2001)	117	85.63	105.41	37	31.62
3944.	jeff (jeffersongtg)	117	72.85	92.29	31	26.50
3945.	6typeR (hacker888)	117	60.51	74.92	26	22.22
3946.	Micro (apm14)	117	91.61	116.19	28	23.93
3947.	Abdulwahab (wahabi56)	117	25.19	34.35	22	18.80
3948.	new account fenno4 (fennomak)	117	123.90	157.15	71	60.68
3949.	Rahul (endeavour_the_one)	117	58.85	79.26	18	15.38
3950.	dvorak (dvorak0211)	117	44.41	68.11	16	13.68
3951.	Bea (chilichanga)	117	90.34	119.24	37	31.62
3952.	Asif (asif04)	117	75.89	90.87	33	28.21
3953.	Tom (twatters)	117	75.11	102.40	31	26.50
3954.	timgan (timgan)	117	104.24	126.95	51	43.59
3955.	testsubject (shamushasha)	117	76.67	101.28	30	25.64
3956.	Shai (shaichon)	117	84.42	102.94	37	31.62
3957.	Zamami (shadaokami)	117	46.98	62.74	11	9.40
3958.	magnus (robertavmagic)	117	74.41	91.66	22	18.80
3959.	Chen (nyarlathoteppppp)	117	70.31	85.10	31	26.50
3960.	BEECEE (nukecee)	117	107.85	131.53	63	53.85
3961.	Nate (ngb125)	117	66.97	86.42	27	23.08
3962.	Jester (murvayne)	117	120.32	149.46	61	52.14
3963.	MithterMagma (mithtermagma)	117	92.95	112.79	43	36.75
3964.	Marc (mghale_215)	117	100.52	126.40	45	38.46
3965.	sanchayay (sanchayay)	116	57.58	72.87	22	18.97
3966.	Vincent (rubixon)	116	50.04	59.86	9	7.76
3967.	Rohit (rohit_1706)	116	40.48	61.61	10	8.62
3968.	Lia (reyi)	116	94.64	124.30	35	30.17
3969.	Miłosz (refjel)	116	69.59	82.80	31	26.72
3970.	Lord (planta)	116	97.08	121.94	39	33.62
3971.	Nitesh (niteshtiwari)	116	64.11	92.22	28	24.14
3972.	Andreas (drivknuten)	116	38.92	44.93	9	7.76
3973.	Divyesh (divyeshm)	116	59.86	78.23	22	18.97
3974.	Bob (bob_loblawrl)	116	69.51	82.87	32	27.59
3975.	Miguel (bellcros)	116	61.81	84.62	32	27.59
3976.	Asad (asad104khan)	116	82.94	100.38	31	26.72
3977.	Judas Escargot (looneyjuice)	116	113.23	148.90	61	52.59
3978.	laZorbeamZ (lazorbeamz)	116	101.93	125.27	46	39.66
3979.	Kaplana (kaplana)	116	47.77	69.91	26	22.41
3980.	Jordan (jordan2380)	116	161.91	196.32	0	0.00
3981.	Tru (jhake_1)	116	82.12	110.49	26	22.41
3982.	Amal (amal_jyothis)	116	57.84	81.96	15	12.93
3983.	Vishagh (vishagh)	116	41.55	54.68	16	13.79
3984.	Ronan (ronocoolo)	116	78.72	96.45	32	27.59
3985.	pilioko (pilioko)	116	77.23	107.28	38	32.76
3986.	Charles (chan_cellor)	116	48.93	60.77	12	10.34
3987.	Alden (alden_s)	116	59.33	71.14	16	13.79
3988.	G (zger)	116	90.05	119.68	40	34.48
3989.	tobias (thandschin)	116	85.38	102.31	31	26.72
3990.	mm (smsa5000)	116	78.26	96.20	20	17.24
3991.	Daniel (scumset)	116	102.35	126.87	52	44.83
3992.	Pranav (_vanarp)	115	42.10	58.37	9	7.83
3993.	snake_case (_snake_case)	115	45.22	54.77	5	4.35
3994.	iosif (y_o_s)	115	44.47	62.54	8	6.96
3995.	Areeb (your_avg_aaa)	115	82.37	104.92	36	31.30
3996.	s3yf (unclemeat)	115	74.93	95.88	33	28.70
3997.	Free Palestine (tidy400)	115	82.62	103.71	28	24.35
3998.	TheTIger107 (thetiger107yt)	115	97.89	144.70	51	44.35
3999.	Sultan (sultanreal)	115	53.31	71.90	15	13.04
4000.	Shil (shilegend)	115	54.43	68.00	12	10.43
4001.	bruh (lmnhat2002vn)	115	57.34	74.51	19	16.52
4002.	tstats[learning_dvorac] (le...	115	67.38	96.32	32	27.83
4003.	Florian (jordanbelfort)	115	89.89	108.87	35	30.43
4004.	Jem (jemanema)	115	80.49	101.20	28	24.35
4005.	jay (jaymorant)	115	60.74	77.11	21	18.26
4006.	race typing (jangyeeunnie616)	115	94.11	131.49	97	84.35
4007.	hypeiron (hypeiron)	115	69.62	84.78	29	25.22
4008.	heyitsalec (heyitsalec)	115	115.44	140.53	75	65.22
4009.	Hans (hansboi)	115	86.51	121.19	42	36.52
4010.	labaalli (hajjaba)	115	28.37	39.31	15	13.04
4011.	PotatoLyfe (potato_lyfe)	115	69.15	92.74	25	21.74
4012.	Radwin (nosmirk)	115	90.19	122.23	51	44.35
4013.	nazmul (nhasan0290)	115	69.89	87.49	30	26.09
4014.	Ken (netski1400)	115	75.87	93.05	28	24.35
4015.	Ḿ (m_10)	115	56.19	72.39	18	15.65
4016.	Matthew (mstracy)	115	86.54	104.90	35	30.43
4017.	Fadosa (fadosa)	115	86.71	104.40	33	28.70
4018.	erk (estalow)	115	121.40	139.61	71	61.74
4019.	Ramiei (elli_y)	115	84.38	112.88	38	33.04
4020.	vrum vrum (elex_)	115	41.42	55.54	9	7.83
4021.	el (elanamax)	115	98.06	116.42	42	36.52
4022.	Ethan (eg083)	115	66.75	86.35	30	26.09
4023.	Edward (edwardw21)	115	136.32	167.24	74	64.35
4024.	Donald (dhonuill)	115	111.47	134.80	53	46.09
4025.	dat (datkitteh)	115	35.37	60.03	11	9.57
4026.	Sonatry (danyannang)	115	100.67	116.91	43	37.39
4027.	Niamh (crystalniamh)	115	105.55	135.83	41	35.65
4028.	J (average_typer95)	115	98.67	124.41	42	36.52
4029.	Arunreas (arunreas)	115	48.26	65.49	19	16.52
4030.	Vielle (arc_sec)	115	178.39	220.10	9	7.83
4031.	angie :) (angwie)	115	88.69	117.79	33	28.70
4032.	Al (al_gha23)	115	70.11	85.91	35	30.43
4033.	Adam (adamhawkins)	115	122.29	151.49	73	63.48
4034.	Obi-Wan (6x_ebitda)	115	80.23	94.63	32	27.83
4035.	sss (1whiteblack1)	115	58.04	72.81	11	9.57
4036.	Jules (layinpip_)	115	67.52	88.20	24	20.87
4037.	Isaiah (zayhoncho)	115	44.25	62.20	10	8.70
4038.	Jeremy (jeremyperdok)	115	69.13	91.69	24	20.87
4039.	tstats[abdul_hakeem123] (ab...	114	52.97	69.36	19	16.67
4040.	5000600 (5000600)	114	108.69	171.39	87	76.32
4041.	rajnish (rajnishkumar31)	114	69.83	94.96	37	32.46
4042.	RacerABM (racerabm)	114	70.79	96.05	32	28.07
4043.	badgyalting (pl200834)	114	51.81	67.65	26	22.81
4044.	Phil (philwinnem)	114	102.51	127.62	46	40.35
4045.	Pacham (pachamcham)	114	75.86	91.54	41	35.96
4046.	ogkatumus (ogkatumus)	114	90.73	121.82	46	40.35
4047.	Don (odonjeque)	114	64.54	78.76	15	13.16
4048.	Moye (moyoka)	114	90.91	119.21	32	28.07
4049.	Michael (mercury28)	114	102.79	131.22	49	42.98
4050.	Maxwell (mc2006)	114	81.64	98.64	33	28.95
4051.	William (william_david)	114	89.68	122.02	49	42.98
4052.	Tai (weakmee)	114	83.54	109.52	38	33.33
4053.	anonym (thefencr)	114	39.71	53.58	5	4.39
4054.	Thiago (terjan)	114	77.03	105.66	38	33.33
4055.	Tanvir (tanvir_025)	114	74.72	94.24	35	30.70
4056.	StewieGriffin (stewiegriffi...	114	101.76	141.45	49	42.98
4057.	Salah-eddine (sharrach)	114	42.64	60.14	22	19.30
4058.	樊 (krinzkolo)	114	65.99	82.97	24	21.05
4059.	kum (kinararidwan)	114	79.96	102.02	37	32.46
4060.	Ken (kenkenken_)	114	113.93	131.35	74	64.91
4061.	Jonathan (jonyaa)	114	84.19	105.72	33	28.95
4062.	Jesus (johangodinho123)	114	85.98	123.80	37	32.46
4063.	Doniyor (doni_dev)	114	67.61	89.35	38	33.33
4064.	Parik (communistcomradepv)	114	61.45	81.94	18	15.79
4065.	david (chu0724)	114	43.70	59.72	19	16.67
4066.	Caitlin (caitlin3)	114	98.36	117.55	53	46.49
4067.	Samuel (budbeats)	114	53.01	79.01	16	14.04
4068.	Joe (bubustrick)	114	60.43	75.14	24	21.05
4069.	BooceJooce (boocejooce)	114	58.47	75.19	21	18.42
4070.	BMO (balot2020)	114	76.82	100.44	24	21.05
4071.	badtyper (badtyper_)	114	72.89	95.98	25	21.93
4072.	fares (fares_esam_22)	113	36.38	44.97	4	3.54
4073.	on earth, as it is in heave...	113	114.35	145.07	58	51.33
4074.	Essi (essi4678)	113	52.96	68.44	24	21.24
4075.	Terry (eleftheriosonic)	113	66.03	86.58	29	25.66
4076.	Big Pop (broguyman)	113	87.93	110.12	26	23.01
4077.	kay (bbsaltlord)	113	89.39	114.12	45	39.82
4078.	ashish (ashishroka)	113	52.07	69.18	17	15.04
4079.	Zia (zia1)	113	45.28	66.04	6	5.31
4080.	Xristos (xristos_gav)	113	72.32	94.03	22	19.47
4081.	Andre (smallchicken)	113	84.68	113.03	40	35.40
4082.	ghoul (abigail_w)	113	133.72	151.26	71	62.83
4083.	I ♥ Gym (2slow_2exist)	113	97.42	115.53	42	37.17
4084.	Samar Singla (samluci666)	113	68.86	91.24	29	25.66
4085.	Arthur (sagman)	113	85.64	134.41	20	17.70
4086.	Rachel (rffree)	113	80.25	103.17	31	27.43
4087.	PreciousStats (precious_stats)	113	124.52	166.49	75	66.37
4088.	Jayden (nephewjayden)	113	84.41	104.24	31	27.43
4089.	Mike (miym)	113	70.96	83.42	19	16.81
4090.	winter (kitzy)	113	76.56	105.23	24	21.24
4091.	Dyslexic_J (jamjar_)	113	79.92	98.77	23	20.35
4092.	Hussein (hussein987)	113	71.46	102.45	33	29.20
4093.	TheProdigyHenry (henryv70)	113	125.20	164.70	63	55.75
4094.	fish and chips (heavenseer)	113	185.62	220.51	96	84.96
4095.	HawksCardinals (hawkscardin...	113	102.66	129.36	52	46.02
4096.	Harshit (harshitjindal)	113	68.05	96.18	23	20.35
4097.	Tim (littlesprinklesjersey)	112	111.73	141.62	59	52.68
4098.	Viktor (knifenoob)	112	89.78	115.46	44	39.29
4099.	walid (kasemwalid)	112	52.84	67.71	13	11.61
4100.	Isaac (isaacchen_cool)	112	112.81	141.64	57	50.89
4101.	Hue (hue_man)	112	75.43	88.83	27	24.11
4102.	gdonke (gdonke)	112	57.26	69.55	20	17.86
4103.	FMURTADHO (fmurtadho)	112	122.26	151.11	64	57.14
4104.	Nikola (flomaster_)	112	82.73	106.83	34	30.36
4105.	Exyiaevox (exyia)	112	96.30	132.03	46	41.07
4106.	cvxz (cvxz)	112	58.96	80.48	22	19.64
4107.	chris (chrisp03)	112	61.13	78.93	28	25.00
4108.	jieun (bunnypenguin)	112	111.66	143.38	53	47.32
4109.	Vincent (bhangjiwon)	112	122.56	153.53	76	67.86
4110.	Balgow (balgow)	112	73.83	93.69	25	22.32
4111.	Rakibul Alam (badboirakib)	112	22.83	33.34	15	13.39
4112.	Ashutosh (ashutosh6997)	112	73.84	96.29	21	18.75
4113.	Vibhav (vibhav_1262)	112	63.31	84.29	25	22.32
4114.	ican tpye fwtf (sup_chief)	112	93.27	139.40	41	36.61
4115.	Steven (stevencd)	112	83.45	102.17	34	30.36
4116.	Robert (selbor)	112	74.31	99.87	31	27.68
4117.	:D (scottmorrisonmp)	112	90.55	112.47	30	26.79
4118.	Yu (sadochist)	112	101.16	119.90	50	44.64
4119.	Jiong Liang (odliang_15)	112	60.25	76.37	21	18.75
4120.	Sam (sammusubi27)	111	71.05	87.34	30	27.03
4121.	William (normalizejoey)	111	74.52	96.34	45	40.54
4122.	MooMoo (moo_24)	111	54.35	69.62	13	11.71
4123.	Master (master_2010)	111	45.20	60.91	10	9.01
4124.	Aditya (fire_smasher1)	111	55.98	72.06	18	16.22
4125.	Felix (felixsantoso)	111	69.12	90.72	23	20.72
4126.	Mordo (elmordo)	111	77.13	91.23	21	18.92
4127.	Sean (drherpdederp)	111	84.38	106.59	36	32.43
4128.	Demancer (demancer)	111	107.25	140.13	46	41.44
4129.	Ahmad Fatih (afaf_tech19)	111	64.51	86.62	27	24.32
4130.	Baramee (6666666666666666)	111	49.58	67.82	7	6.31
4131.	Thomas (447tomtom)	111	47.18	60.62	11	9.91
4132.	Radoslav (padoto07)	111	71.06	89.56	27	24.32
4133.	Leonardo (zadig1789)	111	55.62	72.12	18	16.22
4134.	Ester (torreset321)	111	63.39	78.73	19	17.12
4135.	Ɓritishyobro (britishyobro)	111	80.25	100.90	24	21.62
4136.	Kevki (kevki_)	111	84.14	104.61	34	30.63
4137.	Jonathan (jah_n_i)	111	85.90	113.25	45	40.54
4138.	iCry (icry)	111	90.40	120.90	33	29.73
4139.	@smile.hnts on twitter (hyp...	111	85.82	108.35	33	29.73
4140.	Syed (hello_guest)	111	47.13	62.11	12	10.81
4141.	Lun Mang (halberd237)	111	59.87	75.82	12	10.81
4142.	Ricky (galvanize)	111	96.50	126.99	40	36.04
4143.	ziad (ziadbensaada)	111	46.47	65.15	6	5.41
4144.	DaVinky (xxlarrylegendxx)	111	70.93	89.07	38	34.23
4145.	Teodoras (teoyessir)	111	113.39	141.84	57	51.35
4146.	Ammar (s_ammar)	111	46.01	58.12	12	10.81
4147.	Sheraz (sherazahmad720)	111	48.95	60.17	20	18.02
4148.	aEr0 (_aero)	110	62.80	76.35	22	20.00
4149.	Olivia (xlivsteer07x)	110	54.78	72.62	34	30.91
4150.	Taradiddle (taradiddle)	110	77.60	92.71	24	21.82
4151.	elongated (supreme10001)	110	135.84	161.43	67	60.91
4152.	SRI (sr71)	110	86.89	99.82	34	30.91
4153.	SpeedTrain (speedtraintyper)	110	82.09	114.90	26	23.64
4154.	this quote is sh*t (slowass...	110	81.15	106.27	24	21.82
4155.	skycandy (skycandy1)	110	64.40	79.11	24	21.82
4156.	#$# (ah_ha)	110	74.27	95.44	30	27.27
4157.	Amorphic (_amorphic)	110	58.92	89.76	27	24.55
4158.	Farid (faridkhan)	110	29.39	41.52	17	15.45
4159.	Joseph (schmo_)	110	101.57	129.70	48	43.64
4160.	sat (sattypants)	110	77.66	104.01	31	28.18
4161.	sab (sabpap)	110	65.45	83.24	25	22.73
4162.	robloxyboy1212 (robloxyboy2...	110	100.78	136.54	43	39.09
4163.	Ring2020 (ring2020)	110	76.46	96.84	24	21.82
4164.	Raymando (raymando)	110	95.82	120.08	52	47.27
4165.	Rawest_Dawg (raw_dawg)	110	65.67	84.57	24	21.82
4166.	Procrastiracer (racerrob)	110	115.16	147.26	55	50.00
4167.	Atif (pakistan_786)	110	81.61	109.17	22	20.00
4168.	Ngita (ngita)	110	57.94	72.79	16	14.55
4169.	Marek (mxrkz)	110	66.50	80.86	27	24.55
4170.	Mircox (mircozen)	110	89.40	108.32	32	29.09
4171.	Somto (megamined)	110	62.93	79.33	15	13.64
4172.	nikhil (forceablebean6)	110	108.28	126.19	61	55.45
4173.	Daniel (dreilly2231)	110	77.16	91.77	32	29.09
4174.	David (dmed519)	110	69.58	82.05	26	23.64
4175.	Dwiko (diorite90)	110	59.50	76.33	27	24.55
4176.	Daniel (beefichor)	110	75.51	90.58	22	20.00
4177.	Maximus (asso2002)	110	97.62	125.83	46	41.82
4178.	Irham (irhamdinataa)	110	86.79	110.28	39	35.45
4179.	Gayathri (gayathri_prabhu)	110	65.99	83.77	27	24.55
4180.	Banoboo (lasttry)	109	33.62	48.14	9	8.26
4181.	David (king_cao1)	109	110.79	133.79	51	46.79
4182.	kenneth (kennethnhan)	109	71.57	86.96	23	21.10
4183.	jveee (jv223)	109	75.16	94.50	30	27.52
4184.	Michael (henderslender11)	109	49.02	62.28	12	11.01
4185.	Hassaan (hassaan0180)	109	70.00	92.29	40	36.70
4186.	Gareton (gareton)	109	58.80	69.82	14	12.84
4187.	Samuel (samharr)	109	66.96	84.35	19	17.43
4188.	Nguyen Truong (racing_typer...	109	102.72	136.72	55	50.46
4189.	q4say (q4say)	109	61.55	75.48	27	24.77
4190.	boat (narwhalinz)	109	129.12	161.38	72	66.06
4191.	Rizwan (mrpassionate)	109	68.24	83.82	20	18.35
4192.	Max (maxcampman)	109	79.13	101.57	29	26.61
4193.	Sandwich (marlonbrandoseyes)	109	56.59	72.15	18	16.51
4194.	Marcos (marcosjlr)	109	75.01	88.71	19	17.43
4195.	Eric (yellowblankets)	109	83.71	111.98	23	21.10
4196.	I'm bad at typing (uzumakid...	109	92.53	120.77	39	35.78
4197.	Kian (uls_sanch)	109	95.95	111.05	30	27.52
4198.	alipboy (tragicbronson)	109	106.73	131.85	55	50.46
4199.	horney (titansmakemehorney)	109	82.17	104.33	27	24.77
4200.	Lily (tiptaptyping)	109	112.79	139.23	47	43.12
4201.	Roberto (soniic99)	109	45.43	61.69	10	9.17
4202.	shrnayvi (shrnayvi)	109	89.13	100.30	33	30.28
4203.	Lakshay (shaybas)	109	97.23	123.43	36	33.03
4204.	www (aaahrgrhh)	109	105.12	135.22	44	40.37
4205.	Jacob (peanutboy)	109	64.25	85.17	27	24.77
4206.	Veteran1728 (frenzy1728)	109	97.34	116.55	35	32.11
4207.	Desmond (desmond27)	109	84.37	102.03	28	25.69
4208.	DeafChef (deafchefsteph)	109	58.30	72.80	16	14.68
4209.	Karan (commando_typer)	109	48.26	59.18	12	11.01
4210.	crip (cipti)	109	44.18	56.16	13	11.93
4211.	Chubby (chubbykidseating)	109	102.38	133.89	41	37.61
4212.	Nikita (chervovn04)	109	59.07	74.29	20	18.35
4213.	jdyn (ayskiri)	109	78.16	128.28	29	26.61
4214.	Aymscird (aymscird)	109	100.81	121.18	45	41.28
4215.	rip reckful (fictorian)	108	116.23	145.75	56	51.85
4216.	balls (faygodreams)	108	114.92	140.98	48	44.44
4217.	Osh (elvor)	108	92.36	106.17	47	43.52
4218.	Joe (edwardstewart69)	108	105.73	153.37	43	39.81
4219.	Davi (davi_v)	108	118.83	141.52	52	48.15
4220.	Sean (crowded_keyboard)	108	93.35	119.68	52	48.15
4221.	Albert (certikbertik)	108	84.89	109.43	33	30.56
4222.	Bekzat (blkssmv)	108	64.80	78.97	29	26.85
4223.	azu (azux)	108	83.42	111.49	47	43.52
4224.	tstats[ayyaz7] (ayyaz7)	108	78.63	96.91	26	24.07
4225.	🌹Ayra (ayraa)	108	78.72	110.50	26	24.07
4226.	Emil (awsomeemil25)	108	115.71	151.35	70	64.81
4227.	bloomy (atsu)	108	89.16	114.60	38	35.19
4228.	xelfeR (armez)	108	122.53	199.14	60	55.56
4229.	clarence (zerogly)	108	87.60	104.87	39	36.11
4230.	jason (yacine77)	108	74.82	95.29	24	22.22
4231.	Elijah (too_ez_)	108	97.74	126.90	49	45.37
4232.	THATCHILD (thatchild)	108	103.08	125.76	98	90.74
4233.	Sunny (sunny6464n)	108	50.94	61.70	11	10.19
4234.	Shubham (srp3003)	108	91.07	115.55	35	32.41
4235.	Json (jskfreerunner)	108	74.47	92.35	27	25.00
4236.	bruh (jakubd)	108	82.37	106.92	37	34.26
4237.	Itay (itzir)	108	56.14	67.00	15	13.89
4238.	Jia (icecoldpillow)	108	115.74	139.23	43	39.81
4239.	Rosy (rosyport)	108	121.93	159.76	55	50.93
4240.	Parag (parag_gn)	108	49.08	62.97	11	10.19
4241.	(onah)	108	120.27	150.72	60	55.56
4242.	Markus (ark_sum)	108	65.22	80.27	22	20.37
4243.	Amirey (st_amirey)	108	72.84	94.18	24	22.22
4244.	Allan (allan_g)	107	68.73	88.95	27	25.23
4245.	Arnold (10wpmtyper)	107	128.21	162.27	69	64.49
4246.	sarampium (saripu)	107	78.62	97.66	28	26.17
4247.	Nabibro007 (nabibro_007)	107	60.83	79.45	17	15.89
4248.	zach (rz23222)	107	81.78	112.74	22	20.56
4249.	RixZorro (rixzorro)	107	70.69	83.97	28	26.17
4250.	kartheek (kartheek542)	107	54.55	71.96	29	27.10
4251.	Maciey (maciey_ff)	107	71.70	87.66	33	30.84
4252.	Leonid (leosmrdljak)	107	75.15	95.88	55	51.40
4253.	Izzy (izzythompson)	107	81.47	107.91	25	23.36
4254.	Emon (emonn)	107	67.88	85.64	22	20.56
4255.	Dingus Fish (dingusfish)	107	84.11	101.97	35	32.71
4256.	cocoju (cocoju)	107	65.74	82.06	18	16.82
4257.	Yoel (chessmaster55)	107	55.40	74.37	13	12.15
4258.	Harry (bonogo123)	107	90.99	114.05	28	26.17
4259.	Nacho (awooo)	107	90.75	109.37	44	41.12
4260.	Zev (zevaverbach)	107	104.58	146.82	51	47.66
4261.	Ty (yomommafav)	107	89.11	113.40	31	28.97
4262.	Surya (surya_p)	107	53.57	72.21	17	15.89
4263.	Sn1kt (sn1kt)	107	55.38	74.57	17	15.89
4264.	Newton (nklflips)	107	94.67	123.18	45	42.06
4265.	🏅🏅🏅 (naod_1225)	107	114.48	146.10	50	46.73
4266.	Vishal (mr_sharma01)	107	53.26	65.53	17	15.89
4267.	Moghit (moghit44)	107	74.54	117.63	29	27.10
4268.	Sean (metrognome12)	107	84.25	105.10	40	37.38
4269.	Quan (martinrockon)	107	71.01	96.20	27	25.23
4270.	Samuel (samuelga)	106	91.95	115.58	44	41.51
4271.	sami (sami66)	106	89.40	109.23	27	25.47
4272.	Ravid (ravid37)	106	18.76	25.56	13	12.26
4273.	yashwi (potato0o0)	106	74.85	103.60	30	28.30
4274.	peter (peterfan)	106	70.26	93.43	33	31.13
4275.	mahmoud (mzridi)	106	46.10	56.89	9	8.49
4276.	Mena (mony40)	106	44.95	58.70	13	12.26
4277.	Sam (monkeh_type_fast)	106	84.41	113.81	37	34.91
4278.	M (mileung)	106	75.42	95.23	30	28.30
4279.	Max (max_akyl)	106	52.06	67.35	11	10.38
4280.	md (duom_1432)	106	71.93	102.87	24	22.64
4281.	Dan (danezu)	106	68.21	91.13	15	14.15
4282.	Bruce (brucecccccc)	106	105.86	127.84	48	45.28
4283.	Elden (bloab)	106	121.10	150.45	86	81.13
4284.	Biza (biza)	106	74.22	86.67	24	22.64
4285.	Christian (allen2021)	106	56.52	69.24	10	9.43
4286.	pnguin (pnguin_)	106	98.06	119.65	55	51.89
4287.	Ahjashi (jnguyen21)	106	64.19	78.02	19	17.92
4288.	Hayley (hayleylafontaine)	106	71.58	93.99	24	22.64
4289.	Caleb (powelcb)	106	52.24	67.91	7	6.60
4290.	Luan (luanxpg9)	106	68.95	79.18	35	33.02
4291.	khanh (lenguyenkhanh)	106	89.48	104.05	28	26.42
4292.	JD_FPS (jd_fps)	106	69.20	96.46	22	20.75
4293.	J (itsjustj)	106	93.72	123.15	31	29.25
4294.	Eric (insecureforsure)	106	81.36	101.87	31	29.25
4295.	ihba (ihba)	106	79.14	106.61	35	33.02
4296.	Deni (zingaraaa)	106	62.81	75.46	23	21.70
4297.	Vishnu (vishnu6174)	106	76.45	94.22	22	20.75
4298.	Viktor Helgi (viktorhelgi)	106	61.96	77.14	26	24.53
4299.	Valeria (valeriale)	106	52.30	64.35	8	7.55
4300.	Calculus (uchihalol)	106	162.20	196.11	8	7.55
4301.	They Don't Know That (theyd...	106	102.81	131.71	39	36.79
4302.	Subir (subir_b)	106	34.27	42.26	2	1.89
4303.	feelsclapman (sprenkelz)	106	111.70	137.67	47	44.34
4304.	SMhd (smhd)	106	89.44	105.64	26	24.53
4305.	skitter315 (skitter315)	106	115.95	134.67	63	59.43
4306.	Benga (skebengat)	106	71.29	90.26	28	26.42
4307.	Simon (siarnt)	106	93.70	111.16	38	35.85
4308.	shane (shanel0l)	106	68.93	84.81	29	27.36
4309.	Sebastian (sebz1)	106	80.04	109.14	22	20.75
4310.	Cameron (sebajun)	106	95.77	119.28	36	33.96
4311.	(zealindaus)	105	132.64	164.72	87	82.86
4312.	Willll (yongzew)	105	50.39	59.96	3	2.86
4313.	Yanni (yannishams)	105	63.13	80.82	32	30.48
4314.	Phoeniix (xiineo)	105	86.71	115.02	37	35.24
4315.	Typo (wlofails)	105	112.86	148.63	72	68.57
4316.	withan46 (withan46)	105	72.99	85.45	27	25.71
4317.	ugga (ugga_ugga)	105	87.09	108.20	42	40.00
4318.	Lucas (slappy_rgs)	105	68.26	89.22	20	19.05
4319.	April (apping)	105	65.16	80.75	27	25.71
4320.	ehe (aeronsic)	105	87.83	100.26	30	28.57
4321.	Mahedi (12362)	105	71.21	92.76	29	27.62
4322.	Parameshwaran (knparamesh26)	105	54.50	70.42	14	13.33
4323.	Gold (goldberger)	105	80.47	107.24	40	38.10
4324.	Bitcoin (sreeharshag)	105	46.16	57.84	7	6.67
4325.	enes (mr_moonz)	105	51.40	62.98	10	9.52
4326.	Sabari (sabari314)	105	80.81	104.15	35	33.33
4327.	slow-af (rohilverma)	105	130.45	152.08	73	69.52
4328.	Radmilo (radmilo)	105	96.01	114.88	40	38.10
4329.	:| (peanutbutter_665)	105	72.74	111.66	22	20.95
4330.	lio (osybius)	105	96.27	118.76	46	43.81
4331.	OrangeKomodo (orangekomodo)	105	63.91	82.86	24	22.86
4332.	💾 PROGRESS IS NOT LINEAR...	105	86.37	104.14	29	27.62
4333.	Nino (ninospvp)	105	129.65	156.97	66	62.86
4334.	ninfueng (ninfueng)	105	61.16	79.26	19	18.10
4335.	Eva (niejingtan)	105	77.98	98.85	32	30.48
4336.	Nick (nick1236)	105	58.74	78.21	16	15.24
4337.	Natsu (n4tsu_dragneel)	105	51.76	66.60	12	11.43
4338.	Tien (mr_tien)	105	77.01	110.31	24	22.86
4339.	apoodle_ (molltenlol)	105	69.58	91.33	24	22.86
4340.	DiroDoku (dirodoku)	105	91.84	112.34	38	36.19
4341.	bleh (dan1ce)	105	59.71	74.99	38	36.19
4342.	Gascoigne (correctionhaha)	105	121.47	158.77	59	56.19
4343.	CJ (cj2305)	105	74.09	91.63	26	24.76
4344.	[FRLA] Frank Admirer (ciaer...	105	110.17	134.30	81	77.14
4345.	Bbbbbbbbb (boohaw)	105	146.80	185.10	80	76.19
4346.	Boo (boo42069)	105	62.35	83.38	31	29.52
4347.	aymen (aymenalwh)	105	59.18	73.96	22	20.95
4348.	Madara (madara_uchihaking)	105	60.32	77.13	64	60.95
4349.	Loopy (loopy_oopy)	105	65.62	81.35	24	22.86
4350.	Jatin (jatin_sharma_2005)	105	77.36	92.75	21	20.00
4351.	take care of ur wrists bae!...	105	122.33	154.11	63	60.00
4352.	Valentina (genericwhitemale)	105	88.53	118.84	33	31.43
4353.	Ahmed (gemy_amin)	105	47.74	62.50	10	9.52
4354.	2002hondaaccord (gamingboss...	105	101.83	131.47	45	42.86
4355.	Kuidurgu (kuidurgu01)	104	40.91	50.60	22	21.15
4356.	Karan (karansinghgi18)	104	53.78	67.03	11	10.58
4357.	IanL (jeedaiian)	104	52.04	63.63	14	13.46
4358.	Honza (honza2535)	104	85.57	101.78	26	25.00
4359.	howdoitellherilovehersomuch...	104	71.57	94.02	26	25.00
4360.	Drake (gangket)	104	58.97	75.94	13	12.50
4361.	Bing (gamerbilplays)	104	96.38	133.28	45	43.27
4362.	Calvin (fullrespect)	104	99.71	119.58	59	56.73
4363.	PedroS235 (pedro_s235)	104	59.89	74.66	17	16.35
4364.	knoppix (ninopereira)	104	53.89	66.91	10	9.62
4365.	Emma (missbennett)	104	86.41	108.71	25	24.04
4366.	Apollyon (mik_apollyon)	104	96.84	122.30	46	44.23
4367.	Matthew (mattyhassett)	104	102.56	141.91	44	42.31
4368.	Kevin (zuperfire1)	104	94.65	111.91	27	25.96
4369.	zhizin (zhixin0220)	104	38.11	45.77	10	9.62
4370.	Rezaul (vuzinga)	104	63.99	74.44	13	12.50
4371.	JL (tsg03)	104	67.22	86.92	24	23.08
4372.	Tómas Ingi (tomasingi)	104	66.41	80.69	25	24.04
4373.	Andrew (silverdotters)	104	95.51	115.24	42	40.38
4374.	Dutch (shawnseb)	104	91.20	112.61	34	32.69
4375.	Nick (headhunter_jr)	104	67.99	80.77	17	16.35
4376.	Shyam (gamr7564)	104	85.18	108.30	32	30.77
4377.	Pawan (fake_name)	104	58.83	76.94	15	14.42
4378.	heker the kichuz (kichuz)	104	47.10	62.11	12	11.54
4379.	femonemonemo (femonemo)	104	73.59	84.40	19	18.27
4380.	Nathan (craizar)	104	82.52	99.42	29	27.88
4381.	Petr (chytris)	104	54.22	65.73	12	11.54
4382.	shiba inu (bamboozledshibe)	104	87.70	124.01	32	30.77
4383.	Hello Layth :) (ayoubantita...	104	75.94	102.31	32	30.77
4384.	durehuu (durehuu_123)	103	34.60	61.50	5	4.85
4385.	Nikola (dudeimwhite)	103	69.64	91.65	30	29.13
4386.	DINKL3B3RGG (cosmovt)	103	62.64	79.64	20	19.42
4387.	clock145 (clock145)	103	74.42	93.09	29	28.16
4388.	Chinmoy (chinmoy709)	103	38.56	49.37	13	12.62
4389.	Caleb (calebbueckert)	103	79.33	100.90	24	23.30
4390.	Tobias (bolleeer)	103	80.57	100.99	18	17.48
4391.	bella (bella4088888888)	103	45.23	57.43	53	51.46
4392.	Ashwani (ashwani45)	103	72.52	92.69	26	25.24
4393.	vminh (tvmint)	103	63.62	80.44	25	24.27
4394.	Swarmy (swarmy)	103	76.26	94.01	20	19.42
4395.	themommajeans (spammaam)	103	105.31	139.84	50	48.54
4396.	Galih (sobig_f)	103	80.62	117.66	35	33.98
4397.	love (skaldssss)	103	94.24	126.70	48	46.60
4398.	Lynn (lynnhanananer1)	103	84.07	103.86	24	23.30
4399.	tstats[legendarybbk] (legen...	103	87.11	109.36	38	36.89
4400.	Stone (kimpors)	103	65.92	82.07	25	24.27
4401.	G_4G3 (g4g3)	103	58.04	71.30	16	15.53
4402.	Sanchit (sanchitsharma21)	103	85.98	101.95	35	33.98
4403.	Mark (redblacktiger)	103	93.53	124.30	45	43.69
4404.	pro (pro_napro)	103	37.54	47.99	7	6.80
4405.	arun (noobtyperarun)	103	87.25	119.05	53	51.46
4406.	Tom (mikeoxverylong)	103	92.42	112.47	46	44.66
4407.	Midnight (midnightshadows)	103	79.60	116.27	33	32.04
4408.	Midhun (midhunvmurali)	103	55.04	66.05	7	6.80
4409.	Cheese (arandomasiankid)	103	73.03	102.32	34	33.01
4410.	Release from the pain (abod...	103	80.71	99.86	26	25.24
4411.	Abhi (abhinavsanthosh_162008)	103	64.08	83.67	23	22.33
4412.	HCKB (hckb21)	103	43.63	59.00	10	9.71
4413.	colemak54 (coder054)	103	32.83	41.29	9	8.74
4414.	abdullah (aslan19)	103	35.27	42.43	3	2.91
4415.	𝕲𝖍𝖔𝖘𝖙♠️ ...	102	78.68	104.10	21	20.59
4416.	Budhai (budhai_)	102	51.91	68.48	12	11.76
4417.	David Lia (terraform)	102	60.06	81.47	17	16.67
4418.	lin (mattlin)	102	51.11	63.40	11	10.78
4419.	Varun (purplevarun)	102	55.94	71.44	23	22.55
4420.	Anxiietyx (anxiietyx)	102	61.14	74.34	16	15.69
4421.	big (bigdesch)	102	63.19	76.26	25	24.51
4422.	Dario (darioacg)	102	25.78	52.40	21	20.59
4423.	kamothy (kamothy)	102	73.62	94.58	24	23.53
4424.	Lemone (lemonylemone)	102	71.40	93.48	24	23.53
4425.	Just a man in a hotdog van ...	102	121.94	164.51	56	54.90
4426.	799 (khs4126428)	102	87.28	111.52	31	30.39
4427.	Rest Easy Byron (keatonsmith)	102	146.73	178.11	83	81.37
4428.	Jonjon (jonjonlilbas)	102	80.67	107.30	24	23.53
4429.	jihoon007 (jihoon007)	102	55.44	69.05	19	18.63
4430.	sg my beloved (imperfect_qu...	102	98.86	123.84	44	43.14
4431.	mrrizkin (ifixlss)	102	83.83	99.42	28	27.45
4432.	Mitchell (godekm)	102	111.76	147.90	44	43.14
4433.	billie (eillib)	102	75.20	94.93	19	18.63
4434.	Andrius (ciornas)	102	60.14	70.34	23	22.55
4435.	MaBec (_mabecma_)	102	61.46	82.75	16	15.69
4436.	Bugs (_bunny)	102	66.76	79.04	30	29.41
4437.	Jason (_bagel_)	102	78.73	97.77	31	30.39
4438.	zooommm23 (zooommm23)	102	69.70	95.74	16	15.69
4439.	Hamza (yamac_kocovali)	102	39.80	52.43	9	8.82
4440.	Viran (viranp)	102	99.82	126.07	43	42.16
4441.	V3ness (venessang)	102	72.65	104.46	21	20.59
4442.	me again (urdogwateruwu)	102	111.04	145.55	49	48.04
4443.	Coco (ummena)	102	72.54	88.10	34	33.33
4444.	and we light up the sky (th...	102	136.97	169.28	77	75.49
4445.	Theodore (theo52)	102	76.24	96.07	30	29.41
4446.	XIN (tem_per)	102	84.54	109.25	18	17.65
4447.	suhayb (suhayb)	102	42.76	63.37	36	35.29
4448.	Madison (speedbltch)	102	70.73	93.44	24	23.53
4449.	Sarah (sarahmae123)	102	85.46	116.53	31	30.39
4450.	Prasoon (prkharel)	102	94.01	125.70	36	35.29
4451.	AP (priyanthushara)	102	39.05	54.29	7	6.86
4452.	Priyanshu (priyanshu88064)	102	67.31	80.68	20	19.61
4453.	Parker (parkerfd9dy)	102	70.17	89.82	32	31.37
4454.	Opmrph (opmrph)	102	91.86	124.98	48	47.06
4455.	Navid Sadeghi (navid_sadeghi)	102	46.77	62.15	40	39.22
4456.	Nathan (nathan_cant_type)	102	90.52	108.51	30	29.41
4457.	TechHolmes (mohmmde)	102	55.27	74.15	17	16.67
4458.	Sameer (sameercarpenter)	101	62.16	77.14	21	20.79
4459.	Mac (redsmac)	101	73.01	91.46	26	25.74
4460.	Aditya (prakashaditya)	101	63.35	72.65	20	19.80
4461.	Chaos (numerodos)	101	131.30	161.81	70	69.31
4462.	Frank (fizero)	101	58.35	71.93	10	9.90
4463.	Endstyle (endstylegg)	101	102.47	123.30	34	33.66
4464.	come (comecurry)	101	98.76	125.09	41	40.59
4465.	Mikita (byxmend)	101	55.02	68.44	13	12.87
4466.	Bonu (bonu21)	101	55.35	65.06	14	13.86
4467.	bean boy (binhthetyper)	101	56.20	74.30	17	16.83
4468.	Bdoo (bdo0)	101	35.07	48.53	2	1.98
4469.	Andy (andygeo)	101	44.02	56.23	14	13.86
4470.	Anavo (anavailable)	101	59.94	75.16	1	0.99
4471.	Benny (helmet123)	101	60.56	71.75	14	13.86
4472.	James (james123wu)	101	75.70	101.56	24	23.76
4473.	Leviathan (furyx)	101	106.49	157.52	26	25.74
4474.	Ryan (_rhou_)	101	108.93	144.95	60	59.41
4475.	Zils (zils_)	101	87.87	101.96	29	28.71
4476.	uann (uann1)	101	64.53	78.68	27	26.73
4477.	hetang (typr_1)	101	62.88	76.47	33	32.67
4478.	Ross (trickydick6)	101	105.42	135.11	37	36.63
4479.	Welcometomycrucifixion (tim...	101	100.24	118.66	35	34.65
4480.	Steve (stevegocoding)	101	60.86	77.89	18	17.82
4481.	JD (snag1)	101	72.08	93.45	23	22.77
4482.	Nick (slotharms)	101	73.59	89.85	16	15.84
4483.	Shanti Swaroop (shanti_swar...	101	79.69	94.45	26	25.74
4484.	ScreaM (scream2002)	101	58.04	81.96	12	11.88
4485.	smq (_smq)	100	97.18	124.93	44	44.00
4486.	Brockton (ztgstover)	100	109.28	138.83	48	48.00
4487.	zoo (zoo868e)	100	65.19	77.56	25	25.00
4488.	Bob (xminer99)	100	61.44	88.97	22	22.00
4489.	Victor (victorzasz)	100	53.26	65.77	8	8.00
4490.	FREE PALESTINE (then1g)	100	96.10	118.62	34	34.00
4491.	Zoomer (somerandomkid76)	100	80.04	100.18	27	27.00
4492.	Tyler (slashrage)	100	64.40	80.95	19	19.00
4493.	Aidan (sirrahnadia)	100	109.73	137.79	44	44.00
4494.	Anton (antonjr04)	100	78.44	104.05	27	27.00
4495.	animalpsyche (animalpsyche)	100	72.52	89.83	24	24.00
4496.	Ahmed (ahmeed_a)	100	29.35	37.04	10	10.00
4497.	Koma5 (xultronix)	100	91.76	109.54	32	32.00
4498.	K a a y (none_available)	100	65.03	84.57	32	32.00
4499.	SpeedRacer (the_transporter)	100	53.12	73.43	8	8.00
4500.	THE MAK (realbenjaminmak)	100	82.44	99.04	35	35.00
4501.	JianClash (jianclash)	100	29.25	40.35	12	12.00
4502.	Jimmy (ratjesus)	100	82.53	110.51	27	27.00
4503.	pipelined (polarilacari)	100	77.80	97.33	28	28.00
4504.	chad (pokeman34)	100	123.58	144.18	49	49.00
4505.	plantfan330 (plantfan330)	100	57.23	75.26	15	15.00
4506.	Arnau (pestopasta)	100	66.24	85.77	24	24.00
4507.	Perich (perich)	100	84.96	108.33	33	33.00
4508.	Sven (paindevil07)	100	69.52	80.95	24	24.00
4509.	Azar (nxp_azar)	100	60.43	76.57	51	51.00
4510.	Marx (marxjp)	100	78.06	99.36	25	25.00
4511.	Manish (manish_89)	100	53.47	66.48	18	18.00
4512.	Filip (flameouken)	100	60.28	77.14	25	25.00
4513.	ACC [99 - 100] (dinoh_sandys)	100	84.70	105.20	44	44.00
4514.	Crystal (crystal_angelo)	100	88.88	116.41	33	33.00
4515.	Crash (crash_complete)	100	81.39	105.41	34	34.00
4516.	Ethan (conanethan)	100	91.71	114.48	30	30.00
4517.	César (c3sar36)	100	79.18	113.30	28	28.00
4518.	Big (boosted_ape)	100	67.88	81.52	30	30.00
4519.	Marcus (boopbeepboopboop)	100	86.79	108.85	30	30.00
4520.	Rashid (beats_exe)	100	73.62	101.36	28	28.00
4521.	Lukas (lukaslechner)	100	67.37	81.90	21	21.00
4522.	Kinfi4 (kinfi4)	100	79.35	100.07	21	21.00
4523.	khoinhalam (khoinhalam)	100	67.27	88.86	19	19.00
4524.	John (johnhemrom)	100	56.44	68.01	8	8.00
4525.	rasmus (jemjoyous)	100	77.70	106.50	45	45.00
4526.	idk man (ithatme)	100	51.71	71.99	8	8.00
4527.	idk_hii (idk_hii)	100	87.05	108.17	28	28.00
4528.	hellooooo (hk_in_london)	100	77.56	97.51	23	23.00
4529.	Harry (harrycomp16)	100	77.08	98.27	29	29.00
4530.	grigoar (grigoar)	100	76.87	98.92	25	25.00
4531.	goombamario (goombamario)	100	39.49	53.33	12	12.00
4532.	浩丁 (kusogedane)	99	102.32	125.13	43	43.43
4533.	Joy (joy_1)	99	70.25	82.13	22	22.22
4534.	my fingers are slow (jay12310)	99	92.78	111.56	30	30.30
4535.	Able (interstellarnova)	99	69.49	81.28	19	19.19
4536.	ibrahim (ibrahiem)	99	60.48	77.42	17	17.17
4537.	waifu (helpme_pls)	99	72.67	90.51	28	28.28
4538.	HelioSpook (heliospook)	99	34.85	47.95	1	1.01
4539.	samy (samy_mohsen)	99	56.15	73.77	14	14.14
4540.	Benjamin (saltysnit)	99	95.66	113.62	39	39.39
4541.	Jerm (professional_keyboard...	99	87.70	123.50	36	36.36
4542.	Howard (papertofu)	99	137.01	164.59	75	75.76
4543.	Nick (nirosmit)	99	58.28	74.31	14	14.14
4544.	Yam (metrictensor)	99	110.51	133.98	46	46.46
4545.	Meet (meet27)	99	83.09	100.61	27	27.27
4546.	warya (warya)	99	64.64	89.28	77	77.78
4547.	Gus (uberro)	99	96.47	121.70	40	40.40
4548.	Toodles (toodles678)	99	104.77	151.44	43	43.43
4549.	Smokey (smokeytheoni)	99	79.21	97.50	24	24.24
4550.	Siddharth (sid_1310)	99	68.84	89.22	18	18.18
4551.	ArkoSammy12 (arkosammy_1208)	99	75.64	105.60	27	27.27
4552.	tadej pogačar (acadiantaco)	99	119.98	162.91	53	53.54
4553.	lyrxcal (4l3y)	99	116.23	148.85	58	58.59
4554.	oscar (skarro)	99	61.42	78.12	24	24.24
4555.	Silent (silent_c1c4d4)	99	71.76	101.24	31	31.31
4556.	Suman (kissey)	99	60.46	76.02	23	23.23
4557.	Madeleine (maddiebeck)	99	73.71	92.47	29	29.29
4558.	wi.p (rendyrond)	99	61.83	90.03	19	19.19
4559.	Ducky (duckyz1)	99	73.13	93.61	23	23.23
4560.	Dreamside (dreamside0010)	99	63.88	88.51	18	18.18
4561.	isaac (cowwee90)	99	99.01	124.95	32	32.32
4562.	David (circuitnerd)	99	64.17	79.48	24	24.24
4563.	Montu (axom_shochwave)	99	85.61	104.05	22	22.22
4564.	Indian hacker man (asain_du...	99	62.89	80.45	17	17.17
4565.	Freundschaft Bus (freundsch...	98	86.04	105.66	34	34.69
4566.	deepak (fireyfingers)	98	46.09	60.31	6	6.12
4567.	Erik (erik4)	98	83.55	102.73	31	31.63
4568.	Chhavi (chhavijain1111)	98	70.49	88.20	19	19.39
4569.	macura (bobbygreg)	98	85.25	122.65	36	36.73
4570.	BASIL (basilps123)	98	76.37	88.86	26	26.53
4571.	Brayan (veraniego)	98	55.29	68.54	16	16.33
4572.	Mark (veltzer)	98	92.05	117.94	40	40.82
4573.	Vimim (tovtype)	98	81.24	96.95	20	20.41
4574.	Mausam (the_witcher)	98	78.22	93.13	33	33.67
4575.	JS (thenotorious619)	98	67.79	85.59	23	23.47
4576.	Tharun (tharun66)	98	67.15	90.07	11	11.22
4577.	Erick (smittywerben)	98	81.44	101.20	31	31.63
4578.	Singh (singh_ram)	98	54.23	74.05	10	10.20
4579.	Cody (kingbear2)	98	78.97	100.59	21	21.43
4580.	grandsheber (justbagdat)	98	61.23	72.56	37	37.76
4581.	jonica (jonicailagan)	98	99.54	123.00	32	32.65
4582.	Jack (jackshadow)	98	81.48	101.71	25	25.51
4583.	Ice (icedime)	98	88.71	107.21	34	34.69
4584.	Hannah (hpelay)	98	96.62	117.72	37	37.76
4585.	myself (sakib9)	98	80.72	104.36	36	36.73
4586.	robdude22 (robodude22)	98	101.81	126.07	52	53.06
4587.	Pixel269 (pixeltwosixnine)	98	98.83	144.22	35	35.71
4588.	Oli (oli94)	98	103.56	138.37	42	42.86
4589.	elongatedsquirrel (nba_youn...	98	64.16	90.95	29	29.59
4590.	Rest in peace (michaeltrayv...	98	179.97	215.41	95	96.94
4591.	uhhhhhhh (membrane_ripper)	98	70.85	92.82	23	23.47
4592.	Mark (mamochiro)	98	65.96	81.44	21	21.43
4593.	Aditya (aditya9219)	98	76.70	96.26	24	24.49
4594.	Dahmer's (hybridtattu)	98	33.03	49.97	10	10.20
4595.	Dominik (b14ucky)	98	64.47	81.83	26	26.53
4596.	Vroom (woem)	98	61.99	75.20	30	30.61
4597.	anjal (anjal23)	97	84.90	107.48	32	32.99
4598.	Raunak (aabbccdd4444)	97	81.58	97.53	25	25.77
4599.	Syed Faysel (syedfaysel)	97	52.04	66.83	15	15.46
4600.	Derrick (quiet_alien)	97	49.54	72.33	10	10.31
4601.	Muhd Khalid (lid313)	97	75.37	95.70	25	25.77
4602.	jeremiah (jeremiah12345)	97	87.72	106.98	32	32.99
4603.	M (iamake)	97	75.69	93.02	24	24.74
4604.	Grim (grimtorcher)	97	68.46	91.23	24	24.74
4605.	Kasidit (ganadosa)	97	46.05	58.89	6	6.19
4606.	Rask (frederik0147)	97	66.92	77.36	16	16.49
4607.	n0 (doo1222)	97	69.81	87.51	16	16.49
4608.	Eri (bobtentencarracer)	97	92.51	115.87	34	35.05
4609.	Benjamin (bnje1)	97	105.67	139.94	41	42.27
4610.	Valentin (bg4uk)	97	57.45	73.73	16	16.49
4611.	Nathan (vanderha)	97	80.66	102.72	18	18.56
4612.	ton (tonton31)	97	87.47	110.43	32	32.99
4613.	Ceres (the445guy)	97	87.56	115.48	38	39.18
4614.	Stam (stam_01)	97	79.43	106.06	32	32.99
4615.	jojo (spacelion121319)	97	75.50	99.53	23	23.71
4616.	Marm (slayerxy)	97	144.59	172.00	69	71.13
4617.	Fork (sir_fork)	97	61.70	86.32	12	12.37
4618.	Sal-Kal (sal_kal)	97	80.44	101.38	36	37.11
4619.	Matt (rosettastoned)	97	93.77	113.84	39	40.21
4620.	Roper (ropergames)	97	47.44	75.03	8	8.25
4621.	Rany (ranystephan)	97	60.51	87.69	16	16.49
4622.	Principle (principle105)	97	120.53	149.70	51	52.58
4623.	typer (practise_to_type)	97	59.66	74.46	38	39.18
4624.	Om (omsharma612)	97	61.39	80.97	14	14.43
4625.	qwerab (qwerab)	96	67.54	79.30	19	19.79
4626.	olliedudd (olliedudd)	96	67.44	88.02	15	15.63
4627.	Ankur (naresh12)	96	65.26	77.79	24	25.00
4628.	FOO (mintaly_unstable)	96	73.94	91.14	25	26.04
4629.	ouchies (evilemmelina)	96	113.04	147.57	47	48.96
4630.	Eric (ebiman9726)	96	58.68	86.59	14	14.58
4631.	Dr (drchhun)	96	58.82	76.93	15	15.63
4632.	develsixteen (develsixteen)	96	94.03	112.32	26	27.08
4633.	jb (deamon_214)	96	41.04	60.86	11	11.46
4634.	Em (chuchu)	96	77.93	94.83	27	28.13
4635.	Catman (catman847)	96	71.18	86.41	24	25.00
4636.	Nathan (buddyurslow)	96	89.14	106.35	37	38.54
4637.	Bryan.. XD (bryan_xd)	96	76.54	106.42	24	25.00
4638.	Thomas (banone)	96	46.80	57.35	10	10.42
4639.	Areeb (areebur)	96	68.98	85.24	29	30.21
4640.	Shohan (ansshohan)	96	75.41	95.52	23	23.96
4641.	alaa (alaa_eddin)	96	44.75	53.13	16	16.67
4642.	carina (carina05)	96	107.63	132.67	87	90.63
4643.	Lukares (dulacz)	96	80.30	93.21	30	31.25
4644.	Andy (graydragon12)	96	78.24	102.85	36	37.50
4645.	average rice enjoyer (kireg...	96	141.68	190.60	33	34.38
4646.	Wallapa (kefatypist)	96	47.33	56.42	11	11.46
4647.	Jinf931 (jinf931)	96	86.52	108.58	31	32.29
4648.	Gergő (gergo225)	96	81.20	100.46	29	30.21
4649.	geras (gerastv)	96	98.57	146.89	29	30.21
4650.	Steven (gamma_knife17)	96	102.14	123.55	40	41.67
4651.	Ikeai0515 (uanea0516)	96	88.99	111.87	33	34.38
4652.	thunderbeast (thunderbeast_)	96	77.25	101.59	32	33.33
4653.	Trevor (thetrevormonreal)	96	85.84	115.48	25	26.04
4654.	Vu (taptyping)	96	63.89	85.16	18	18.75
4655.	fingerSkate (skhmt)	96	70.52	89.55	18	18.75
4656.	se me pudrieron los dedos c...	96	128.01	148.87	75	78.13
4657.	Scryp (scryp)	96	102.24	125.66	41	42.71
4658.	Ethan (zshooter0077)	95	57.02	74.36	18	18.95
4659.	Zito (zrelova)	95	113.61	138.39	52	54.74
4660.	YSSH (yosshi)	95	79.83	97.27	20	21.05
4661.	Samir (wickedl4ndo)	95	63.18	83.99	24	25.26
4662.	WinG9G (vving020515)	95	68.87	85.81	16	16.84
4663.	🎈 (typing_badly)	95	133.99	162.56	55	57.89
4664.	Dan (typheratrix)	95	78.74	106.76	21	22.11
4665.	turbocell48 (turbocell48)	95	119.43	145.23	57	60.00
4666.	Toowe (toowe)	95	73.07	96.91	20	21.05
4667.	raj (the_karna)	95	60.25	77.72	21	22.11
4668.	Oscar (oarr)	95	57.70	73.33	15	15.79
4669.	Sriram (sriramrox)	95	56.83	78.78	30	31.58
4670.	Shivam (shivy08)	95	68.13	84.06	38	40.00
4671.	Aniruddh (arl17)	95	48.24	57.24	7	7.37
4672.	trakovsik (beyazzenci)	95	69.68	86.49	27	28.42
4673.	rexjo7 (rexjo7)	95	72.86	118.05	30	31.58
4674.	Tomas (tigfiend)	95	62.30	76.48	12	12.63
4675.	Bryce (satlight)	95	82.62	107.18	30	31.58
4676.	clackity (phys1cs)	95	63.37	80.85	19	20.00
4677.	morty (morty_lh)	95	49.76	66.69	11	11.58
4678.	George (mega_type_racer)	95	95.82	114.07	44	46.32
4679.	Marsal (marsalsz)	95	77.27	100.24	30	31.58
4680.	Marvin (malvolio)	95	83.69	99.39	27	28.42
4681.	Amirzhan (dungeon_beast13)	95	44.70	55.07	13	13.68
4682.	darthinfinix (darthinfinix)	95	77.23	106.85	26	27.37
4683.	Ashley (darlavsue12)	95	93.33	114.02	28	29.47
4684.	cole (cole_makker)	95	40.98	54.30	9	9.47
4685.	Code (codeiii)	95	60.07	74.80	17	17.89
4686.	Capivara (capivaradafarialima)	95	79.19	98.76	27	28.42
4687.	Vladislav (atmsphrx)	95	94.10	121.16	35	36.84
4688.	Alexa (lexalexa100)	95	120.94	141.71	67	70.53
4689.	Leon (leon22)	95	96.68	118.06	33	34.74
4690.	Samuel (knightsight)	95	118.33	154.88	68	71.58
4691.	krisr17 (kk017)	95	81.71	101.16	35	36.84
4692.	sam (justlikethat)	95	54.93	69.83	8	8.42
4693.	John (johnrupesh)	95	80.78	101.45	25	26.32
4694.	Joosh (jewsh)	95	82.40	103.13	28	29.47
4695.	Jelly belly (jellybabysexys...	95	67.73	85.59	20	21.05
4696.	Zephyr (introstealer)	95	76.01	96.54	25	26.32
4697.	husq (husq)	95	106.70	132.36	46	48.42
4698.	huddled (haraldgb)	95	89.32	106.25	27	28.42
4699.	AHomieNucleus (galaxxyn1)	95	97.01	116.50	36	37.89
4700.	Madiyor (madiyor)	94	72.81	96.09	30	31.91
4701.	Christian (loggityloglog)	94	90.68	116.23	29	30.85
4702.	Rohan B. (linuxman_linux)	94	139.79	174.64	78	82.98
4703.	Lakshay (lakshay882)	94	51.10	65.68	19	20.21
4704.	Koolis (koolisz)	94	92.55	110.01	38	40.43
4705.	Jeffy (jeffyl)	94	119.71	150.35	57	60.64
4706.	Grzegorz (jag1)	94	70.28	87.93	25	26.60
4707.	rebecca (ionn)	94	94.59	114.24	33	35.11
4708.	imtiaz (imtiaz12)	94	68.98	97.17	28	29.79
4709.	jacob (iljain)	94	89.23	112.89	29	30.85
4710.	(records)	94	115.97	147.13	50	53.19
4711.	Souvik (rascalam)	94	71.14	95.50	22	23.40
4712.	pwxown (pwxown123)	94	64.66	79.70	21	22.34
4713.	Goodwmyfingers (polterg3ist)	94	108.73	132.01	37	39.36
4714.	pituf0 (pituf0)	94	95.36	123.92	34	36.17
4715.	aaaaaaaaaaa (mintlyowo)	94	140.93	185.41	71	75.53
4716.	Mark (mastopuppets)	94	61.38	84.63	21	22.34
4717.	Tze Ning (zzzzzningd)	94	80.94	100.84	27	28.72
4718.	Joe (zeppyg)	94	90.72	111.10	31	32.98
4719.	z0rp (z0rp)	94	103.87	131.46	47	50.00
4720.	Vivek (vivek62)	94	62.46	79.70	18	19.15
4721.	lilvic (vickty)	94	102.99	125.62	45	47.87
4722.	Hassan (urboyhassan)	94	77.75	96.01	19	20.21
4723.	Tamás (tamas)	94	98.79	136.90	44	46.81
4724.	Me (something_s)	94	110.92	144.29	42	44.68
4725.	Jason (serenity47)	94	94.56	113.21	34	36.17
4726.	Anvesh (anveshreddy18)	94	74.72	92.00	24	25.53
4727.	goku (dragonballsuper)	94	60.77	73.51	18	19.15
4728.	kuutti (pela10)	94	72.59	96.73	49	52.13
4729.	husky (hungryhusky)	94	54.60	69.87	17	18.09
4730.	Will (squilii)	94	63.95	80.82	20	21.28
4731.	TASHI (erehh19)	94	40.90	56.90	41	43.62
4732.	Divyanshu (dev064)	94	30.25	43.24	14	14.89
4733.	Casper (casperliuliuliu)	94	53.34	71.76	12	12.77
4734.	Jimmy (carb0n13)	94	92.68	116.35	29	30.85
4735.	caesar (caesar03)	94	54.57	68.15	12	12.77
4736.	Avi (avi222)	94	29.40	42.46	9	9.57
4737.	Felix (felizocker)	93	75.70	99.48	20	21.51
4738.	honk (fallguys)	93	70.80	94.61	26	27.96
4739.	Declan (deccazz)	93	93.71	112.19	40	43.01
4740.	Siddhant (code_talker)	93	112.74	134.56	42	45.16
4741.	Filip (churllix)	93	58.80	73.19	10	10.75
4742.	Burak (burakkor434)	93	71.17	87.02	19	20.43
4743.	Zak (zajawe)	93	80.08	97.50	27	29.03
4744.	Yessimkhan (yess_0)	93	26.51	38.62	23	24.73
4745.	Yash (yash23)	93	76.20	107.73	26	27.96
4746.	gusher (wizardlordbob)	93	62.40	77.98	16	17.20
4747.	venky (venkywonka)	93	73.15	97.61	20	21.51
4748.	Lord (valharius)	93	94.05	112.48	37	39.78
4749.	Vincent (v1ncent)	93	147.32	174.95	74	79.57
4750.	tito (titoreo)	93	69.48	94.62	22	23.66
4751.	memers (thememers)	93	51.39	63.72	12	12.90
4752.	sagar (sgr5)	93	46.52	59.06	12	12.90
4753.	Luis (luismec90)	93	62.67	89.49	26	27.96
4754.	017 (k_chun)	93	69.03	87.83	23	24.73
4755.	house (jrsp5)	93	91.46	107.59	28	30.11
4756.	JoaoPauluu (joaopauluu)	93	104.05	137.39	50	53.76
4757.	Miguel (jalb)	93	92.27	112.77	25	26.88
4758.	Hxwk (hxwkoncrack)	93	76.04	97.73	20	21.51
4759.	Herbie (hjrand1005)	93	96.85	116.52	37	39.78
4760.	Teodor (maniacth)	93	57.08	72.10	16	17.20
4761.	md abdullah (mamun220)	93	39.66	51.76	9	9.68
4762.	Neo (aonixn)	93	80.80	100.94	24	25.81
4763.	Alberto (angry_grandad)	93	64.84	78.67	20	21.51
4764.	Elk (elkx)	93	50.96	68.17	12	12.90
4765.	Johnty (boardsupremacy)	93	85.76	120.10	36	38.71
4766.	Utkarsh (utkarshsarkar)	93	36.99	44.32	5	5.38
4767.	tstats[jimmyneuson] (jimmyn...	93	87.70	103.82	18	19.35
4768.	Ray (thickdoink)	93	29.21	68.15	13	13.98
4769.	Jike (procrastinatingking)	93	79.73	103.80	47	50.54
4770.	i am (anwar24)	93	53.46	68.92	13	13.98
4771.	t0oms (t0oms)	93	57.80	71.00	15	16.13
4772.	alam (alamjael)	92	78.25	102.63	18	19.57
4773.	Agamemnon (agamemnon_)	92	56.76	74.35	9	9.78
4774.	Khulugjin (aceno)	92	89.26	115.39	37	40.22
4775.	Direwolf (abdelmoezhj)	92	81.59	100.89	20	21.74
4776.	Joe (2513134)	92	109.83	131.26	39	42.39
4777.	Henry (taipeik9)	92	66.10	85.23	26	28.26
4778.	paul (slowsim)	92	28.75	37.82	13	14.13
4779.	Kevin (kevinparkit)	92	101.82	121.72	35	38.04
4780.	Jack (jx34tech)	92	62.69	87.97	18	19.57
4781.	Jun Kang (junkang098)	92	95.55	128.22	33	35.87
4782.	Josh (josgo888)	92	60.79	78.38	19	20.65
4783.	Jonathan (jontheprinter)	92	79.87	100.22	24	26.09
4784.	Jason Hean (jackson95)	92	51.67	63.76	7	7.61
4785.	Hawky (itshawky)	92	130.54	158.53	62	67.39
4786.	Mark (inthe)	92	79.12	97.23	18	19.57
4787.	Kevin (ibekevinn)	92	100.44	124.72	51	55.43
4788.	HGud (hgudtk)	92	85.77	116.81	23	25.00
4789.	Gerry (gl701)	92	112.15	137.96	46	50.00
4790.	Farhan (ft10)	92	73.25	88.82	20	21.74
4791.	🥬 (freshkale_workman)	92	74.83	91.91	24	26.09
4792.	Emmanuel (emmanuelmoon)	92	57.55	72.89	18	19.57
4793.	Dyllan (dyllanbui)	92	92.08	118.40	38	41.30
4794.	Breeze (driftbreeze)	92	108.76	126.84	44	47.83
4795.	Sam (disasterlooms)	92	110.69	133.50	38	41.30
4796.	demberel (demberel94)	92	73.00	89.49	31	33.70
4797.	Vishnu (crazy_typeracer)	92	70.67	92.71	24	26.09
4798.	choco (chocolateblocks)	92	105.94	146.75	45	48.91
4799.	Pumpkin Raj (chillreksai)	92	96.63	115.98	44	47.83
4800.	Bekkhan (bkun)	92	84.24	107.57	22	23.91
4801.	mani (bigmeat_)	92	104.82	140.49	48	52.17
4802.	Begatim Bytyqi (begatim)	92	54.54	67.76	18	19.57
4803.	Jonas (zamurai88)	92	67.53	85.70	23	25.00
4804.	x1300252 (x1300252)	92	40.92	49.60	9	9.78
4805.	vita_melk (vita_melk)	92	73.76	93.93	28	30.43
4806.	Josh (unkret)	92	60.11	77.86	23	25.00
4807.	Subhajit (tumpasona)	92	51.43	64.83	11	11.96
4808.	timas (timastimas)	92	82.39	98.06	30	32.61
4809.	Thickspinach (thickspinach)	92	82.79	102.18	25	27.17
4810.	Anna (slewa)	92	46.10	57.98	5	5.43
4811.	Derry (siribackwards)	92	80.72	100.69	28	30.43
4812.	Vinh (shadeomen)	92	97.95	120.17	39	42.39
4813.	Rajish (rajish)	92	90.82	108.17	30	32.61
4814.	Typer (pjottur)	92	62.19	76.73	17	18.48
4815.	The don (photondestroyer)	92	74.52	91.86	18	19.57
4816.	Nahla (na_hla)	92	25.77	37.03	19	20.65
4817.	Nuno (n4n0x01)	92	78.38	96.25	30	32.61
4818.	msm (mousamlimbu)	92	62.91	81.16	34	36.96
4819.	Mohchih (mohchih)	92	78.25	107.79	24	26.09
4820.	Melissa (mel8402)	92	70.02	94.88	14	15.22
4821.	Md Saim (saimahmad)	91	68.92	85.36	25	27.47
4822.	Rabbi (rhdevil)	91	36.35	49.11	6	6.59
4823.	Rex (rexcaliber_115)	91	83.37	111.23	28	30.77
4824.	mashrafi (qweer)	91	44.48	58.57	9	9.89
4825.	Parvez (parvez31)	91	46.60	57.86	14	15.38
4826.	Andy (parkourmaster302)	91	108.85	137.31	57	62.64
4827.	Mmm coffee (orchdork7926)	91	103.73	123.15	36	39.56
4828.	Tyler (omni_aspect)	91	81.28	124.76	28	30.77
4829.	Jannyx (nyxal)	91	88.15	111.97	31	34.07
4830.	Mobinul (mobinhmmh1)	91	46.32	53.13	7	7.69
4831.	nomad_valhalla (me_manas17)	91	54.76	70.61	18	19.78
4832.	MasonColemak (masoncolemak)	91	92.76	114.15	26	28.57
4833.	Hnnnnngh (frostequinox)	91	134.89	157.74	66	72.53
4834.	Ritardo (ett5252)	91	120.68	152.90	48	52.75
4835.	白貓 (cutewhitecat)	91	52.64	64.64	22	24.18
4836.	chom (chom2474)	91	109.06	164.41	51	56.04
4837.	Clay (cduck621)	91	78.17	97.06	27	29.67
4838.	Areppa (areppa)	91	75.73	92.87	12	13.19
4839.	anth (ant_h)	91	71.30	86.76	23	25.27
4840.	Krikium (krikium)	91	68.31	77.15	22	24.18
4841.	Jack (hammer_jack)	91	52.45	68.20	13	14.29
4842.	Dev (dev_1729)	91	71.02	83.21	21	23.08
4843.	Yurii (kruason)	91	60.08	71.26	19	20.88
4844.	Only Dvorak (kkqu)	91	96.49	114.55	35	38.46
4845.	Ken (kenzymazy)	91	82.13	99.39	28	30.77
4846.	kripp (hotdoghunter)	91	85.68	120.03	29	31.87
4847.	ahmad (h0gan_2020)	91	51.20	74.25	17	18.68
4848.	dinker (gumbolaya)	91	145.49	170.49	14	15.38
4849.	Slava (gilescope)	91	44.17	53.96	23	25.27
4850.	░ (_warrior_)	91	103.71	120.83	41	45.05
4851.	Sven (zeverit)	91	97.65	118.18	35	38.46
4852.	AlphaQ (zbooya)	91	60.25	72.02	16	17.58
4853.	Yhannis (yhannis)	91	82.73	101.70	25	27.47
4854.	Bartłomiej (y3v4d)	91	104.54	119.31	41	45.05
4855.	Kevin (windn6)	91	96.33	123.33	33	36.26
4856.	vm (vm_gojiya)	91	60.63	79.07	17	18.68
4857.	Aleksandar (usernamegold)	91	99.66	119.74	38	41.76
4858.	Martin (typeracist_)	91	82.27	104.54	47	51.65
4859.	tsapi (tsapi)	91	102.78	129.25	31	34.07
4860.	Alex (tra_pz)	91	86.83	114.38	24	26.37
4861.	Harsh (todorokishotoua15)	91	49.60	70.59	71	78.02
4862.	The (the_typing_train)	91	90.21	113.02	34	37.36
4863.	bronze (thebronzesword)	91	105.21	130.79	52	57.14
4864.	Sydney (sydneykimbell)	91	116.52	134.15	47	51.65
4865.	Spam (ssspeed)	91	74.52	94.23	29	31.87
4866.	MAMUN (wmamunhossain)	90	55.95	70.80	15	16.67
4867.	wasim (wasim7198)	90	51.84	60.60	8	8.89
4868.	Ranger (turbo_99)	90	74.72	88.50	31	34.44
4869.	Tuan (tuan_nguyen)	90	115.28	140.83	49	54.44
4870.	fischld (tokiwa)	90	88.47	109.82	25	27.78
4871.	storm (stooormmm)	90	98.97	124.15	39	43.33
4872.	zyuken (spaceee)	90	100.43	143.40	35	38.89
4873.	Vienna (sexystan69)	90	68.85	92.40	23	25.56
4874.	Alejandro (akakmx)	90	78.33	98.39	23	25.56
4875.	A (ag2718)	90	113.61	145.09	40	44.44
4876.	Adrian (aeroplaneking)	90	98.32	120.70	32	35.56
4877.	Sasang (aerialstunt)	90	84.17	102.22	29	32.22
4878.	Lien❤️Neu(2025-04-21) (...	90	102.11	134.06	34	37.78
4879.	abi19911 (abi19911)	90	63.44	87.02	15	16.67
4880.	Nguyen (nguyenpa3963)	90	38.11	51.81	3	3.33
4881.	lizzie-beth (lizzie_beth)	90	69.66	87.82	40	44.44
4882.	Sunil Nishad (senpaaiii)	90	32.97	44.05	6	6.67
4883.	Danylo Dolhopolov (danylos)	90	21.13	31.51	21	23.33
4884.	rpx (caspertrxsh)	90	57.39	73.07	12	13.33
4885.	WELLINGTON (luissluis202)	90	90.71	119.84	30	33.33
4886.	Sayu_ (sayu_)	90	53.00	63.14	7	7.78
4887.	Brandon (retrogamer56)	90	115.72	138.81	54	60.00
4888.	poqe8819 (poqe8819)	90	95.18	121.45	21	23.33
4889.	Martin (palchone)	90	74.03	92.01	26	28.89
4890.	car (nostalgiatest)	90	100.67	130.51	40	44.44
4891.	Kono Dio Da (nankan6111)	90	106.75	130.09	39	43.33
4892.	Nak (nakulo)	90	67.49	93.41	19	21.11
4893.	Moellie (moelong1)	90	66.02	87.05	20	22.22
4894.	maoam (maoamwins)	90	92.04	112.59	32	35.56
4895.	DataCrusader (faruzzy)	90	64.55	74.22	28	31.11
4896.	Omega (enmendurana)	90	50.55	65.74	6	6.67
4897.	Shane (enahs_py)	90	97.97	119.82	39	43.33
4898.	Emmy (emilyelaine)	90	93.02	112.10	31	34.44
4899.	oreo (e00d)	90	105.49	135.41	47	52.22
4900.	Kebab (durum_kebab)	90	91.33	116.51	33	36.67
4901.	Daniel (danielsabox)	90	89.92	111.64	32	35.56
4902.	dumbdwei (cringe69)	90	73.99	93.49	17	18.89
4903.	Evan (crcd)	90	76.80	92.91	20	22.22
4904.	. (cope_and_seethe)	90	115.19	147.17	49	54.44
4905.	Venus (ching_ching)	90	69.80	86.26	29	32.22
4906.	Celiakos (celiakos)	90	48.93	57.91	8	8.89
4907.	Josh (belewcookies)	90	66.36	82.95	22	24.44
4908.	Naimul (bangladeshi)	90	31.28	44.23	6	6.67
4909.	Hi (aspenink)	90	110.87	142.96	58	64.44
4910.	Lack (lackhammer)	90	98.31	118.20	34	37.78
4911.	Ksizzzzz (ksiz)	90	85.63	107.03	32	35.56
4912.	Norik (kingjulian1)	90	60.66	74.38	14	15.56
4913.	kj (kellydebow)	90	63.59	87.37	19	21.11
4914.	Johnofan (johnofan)	90	91.57	123.15	24	26.67
4915.	JBrocksfellas (jbrocksfellas)	90	56.92	70.32	30	33.33
4916.	immikeylee (immikeylee)	90	108.76	126.99	49	54.44
4917.	Zachary (hejukaza)	90	58.76	95.38	22	24.44
4918.	gloria (glorialostthegame)	90	101.62	126.49	32	35.56
4919.	G L O O M Y (gloomy24)	90	46.02	57.15	6	6.67
4920.	mingi (gatangae)	90	78.89	95.67	26	28.89
4921.	lone (lone17)	89	59.62	86.34	21	23.60
4922.	lolitsgow (lolitsgow)	89	86.23	100.23	26	29.21
4923.	Tom (krarc)	89	84.31	110.46	20	22.47
4924.	iwillcomboyou (iwillcomboyou)	89	49.59	67.62	6	6.74
4925.	Hamza (hamza_type)	89	58.14	74.37	16	17.98
4926.	Chef Giuliano (gd27)	89	90.56	113.32	19	21.35
4927.	SalahDin (salastro)	89	69.88	86.63	21	23.60
4928.	Safi (safeehalim)	89	70.42	89.21	27	30.34
4929.	tofu (reversytofu)	89	119.04	150.16	54	60.67
4930.	Pendejo (pendejo13)	89	53.87	64.62	7	7.87
4931.	Kevin (pekkanator1)	89	100.91	124.15	39	43.82
4932.	Paul (pasham999)	89	62.12	72.83	20	22.47
4933.	apostolos (orou)	89	39.31	55.93	12	13.48
4934.	tstats[orbitaltowel] (orbit...	89	93.15	126.41	38	42.70
4935.	Mirtininkas (mirtininkas)	89	63.66	90.64	18	20.22
4936.	Leo (me10250)	89	60.04	89.03	19	21.35
4937.	Angeline (mangosteen18)	89	59.33	75.46	11	12.36
4938.	Yelxuh (yelxuh)	89	121.86	162.95	51	57.30
4939.	Steve (stevestupidface)	89	104.73	124.59	44	49.44
4940.	Stefan (stefanknez03)	89	36.67	51.52	6	6.74
4941.	q (scullyy)	89	81.03	108.18	51	57.30
4942.	Nick (adyingwalrus)	89	118.64	141.06	38	42.70
4943.	6226 (6226)	89	88.07	104.02	26	29.21
4944.	KGHZY (kghzy)	89	44.93	65.97	7	7.87
4945.	marmar (marmarmarmar)	89	93.87	121.94	31	34.83
4946.	bigdoongg (bighotdogg)	89	56.52	74.28	17	19.10
4947.	Kristel (speedygonzales1997)	89	45.94	58.02	6	6.74
4948.	Michał (michalll)	89	74.63	90.28	20	22.47
4949.	FiB0 (fiboss)	89	95.15	119.63	68	76.40
4950.	Affan (fantzy)	89	38.10	55.67	5	5.62
4951.	Daedalus (dufficinetic)	89	70.68	87.90	17	19.10
4952.	Tim (dreamaz)	89	83.46	99.54	26	29.21
4953.	Draco (draco_the_toad)	89	67.75	92.70	29	32.58
4954.	Dhruv (dhruv8601)	89	61.91	84.57	12	13.48
4955.	Jason (d4tb0i)	89	77.26	93.93	17	19.10
4956.	Chagil (chagil)	89	116.39	152.38	41	46.07
4957.	mahdi (carpenterbrother)	89	68.63	83.12	20	22.47
4958.	billypeppin (billypeppin)	89	112.48	139.43	36	40.45
4959.	Long (bachthime)	89	70.89	92.99	19	21.35
4960.	fixing my (fixing_bad_habits)	88	106.98	124.44	37	42.05
4961.	JK (ettanin)	88	60.96	73.11	11	12.50
4962.	Erza (erza_loves_coffee)	88	59.85	73.42	9	10.23
4963.	sdf (delta23)	88	105.14	132.70	42	47.73
4964.	🐸bingus🐸 (dearmr)	88	114.93	136.42	49	55.68
4965.	Cat (catcatcatcatcatcatcatcat)	88	107.48	129.09	61	69.32
4966.	Cammy (cammy04)	88	70.85	82.82	15	17.05
4967.	Gabe (yokingszn)	88	72.36	87.43	30	34.09
4968.	Tarun (tpunhani)	88	70.95	94.01	23	26.14
4969.	Spritly (spritly)	88	87.65	106.65	30	34.09
4970.	Marc (maarcabiaad)	88	94.25	126.47	22	25.00
4971.	Krish (krish7)	88	50.93	64.61	6	6.82
4972.	Shakil Kabir (kopbdshakil)	88	66.07	81.52	23	26.14
4973.	heavy (heavyshaker)	88	52.61	64.34	17	19.32
4974.	Will (ghostal)	88	100.01	125.83	40	45.45
4975.	Tamir (recoon44)	88	49.55	67.66	8	9.09
4976.	Prabh (prabh1601)	88	85.27	103.95	31	35.23
4977.	Pach (pachslayer)	88	112.18	137.70	39	44.32
4978.	Neo (neosteps)	88	67.25	90.16	26	29.55
4979.	Jonathan (mrschubidu)	88	65.13	87.20	24	27.27
4980.	Pranay (ant1sipater)	88	70.13	87.97	21	23.86
4981.	Daniel (altold)	88	91.92	107.52	29	32.95
4982.	Alex (alexey0)	88	67.50	81.50	25	28.41
4983.	Abdullatif (ak_type_master)	88	62.87	73.73	10	11.36
4984.	Adepttyper123 (adepttyper123)	88	92.13	118.09	37	42.05
4985.	kumar (kumar_adity_a)	88	54.22	65.22	11	12.50
4986.	asfastasurrelation (darryl11)	88	55.37	76.62	6	6.82
4987.	Tyler (tylerbeep)	88	39.88	53.86	7	7.95
4988.	LAVISH (lavvish)	88	44.75	63.20	18	20.45
4989.	Andrej (andy144)	87	72.71	86.08	19	21.84
4990.	Ali (amizan8653)	87	84.54	104.56	27	31.03
4991.	Abode (abulrahman_kallas)	87	24.67	37.29	19	21.84
4992.	faxer (faxer123)	87	33.74	46.96	11	12.64
4993.	Tamer (tls_15)	87	56.32	75.29	11	12.64
4994.	Jau (maievvvv)	87	62.44	86.72	76	87.36
4995.	ikkumaru (ikkumaru)	87	43.18	53.66	7	8.05
4996.	David (dragon25321)	87	77.58	96.52	21	24.14
4997.	Malcolm (malcolm_)	87	89.17	109.54	38	43.68
4998.	Rin (komorebi2)	87	136.26	191.51	48	55.17
4999.	Kirubel (kirubelt)	87	58.21	71.02	14	16.09
5000.	josca (josca)	87	75.23	92.86	32	36.78
5001.	BlueOctupus 🦑 (jim_my)	87	57.29	73.85	18	20.69
5002.	Snail's Pace (hardtack)	87	86.71	108.35	32	36.78
5003.	Hoang (feelsdankman_1)	87	83.25	105.65	13	14.94
5004.	Eric (erichamers)	87	85.90	106.76	34	39.08
5005.	GOTTAGOFAST (b_200910028)	87	59.59	77.09	18	20.69
5006.	Patrick (burntriceboi)	87	49.38	76.15	15	17.24
5007.	Batbold (burabatbolf)	87	65.77	85.29	26	29.89
5008.	Jordan (brownbox)	87	70.75	84.85	29	33.33
5009.	Igor (zig84)	87	78.92	97.26	25	28.74
5010.	random (waltersgo)	87	95.43	113.19	32	36.78
5011.	Tastic (t_tastic)	87	71.30	99.59	49	56.32
5012.	tomthegamer150 (tomthegamer)	87	78.26	101.82	23	26.44
5013.	Marc (thehobbit6937)	87	69.15	90.73	25	28.74
5014.	Jole (sliceoflife)	87	87.74	103.19	33	37.93
5015.	Simon (simon_f1)	87	92.21	107.33	28	32.18
5016.	Matthew (rush_a)	87	84.77	109.02	25	28.74
5017.	Romi (romi14)	87	96.95	127.84	26	29.89
5018.	Risheet (risheet_7)	87	64.30	81.23	25	28.74
5019.	Prex (prex)	87	54.27	72.12	26	29.89
5020.	Sean (polosauris)	87	79.93	102.48	22	25.29
5021.	S M (plaban13)	87	42.56	54.11	7	8.05
5022.	otomen (nurul_liayana)	87	82.20	104.63	29	33.33
5023.	fastkid (notfastkid)	87	89.99	118.38	28	32.18
5024.	Nonstoplink (nonstoplink2)	87	94.30	136.60	42	48.28
5025.	omar (nightkappa73)	87	71.01	91.41	17	19.54
5026.	Nigel Yul (nigelyul)	87	110.38	131.05	49	56.32
5027.	Tony (naka__)	87	100.23	129.84	32	36.78
5028.	NadAlaba (nadalaba)	87	54.91	79.56	16	18.39
5029.	Kumar Charan (mr_kc)	87	48.71	62.51	5	5.75
5030.	MH (mh_parag)	87	70.73	88.82	22	25.29
5031.	SB (sbjeans)	86	66.09	78.51	24	27.91
5032.	Rain (rain_19)	86	68.27	87.65	32	37.21
5033.	Jim (pokemontcg2)	86	124.68	152.34	51	59.30
5034.	Palish (palish)	86	70.78	87.40	22	25.58
5035.	Owen (owenxc1234)	86	119.00	160.43	49	56.98
5036.	TooTired (oturan11)	86	94.18	130.42	24	27.91
5037.	Nelson (nelson_typer)	86	51.21	62.08	6	6.98
5038.	August (myracule)	86	54.96	68.28	8	9.30
5039.	Mohaka (mohaka)	86	55.91	72.49	8	9.30
5040.	Junior (mkunaji)	86	60.73	73.93	23	26.74
5041.	maxwelljones14 (maxwelljones)	86	99.35	122.31	32	37.21
5042.	Dvorak on (freddysg)	86	74.72	99.52	85	98.84
5043.	Fishy_Types (fishy_types)	86	96.56	126.46	33	38.37
5044.	Eli (e_lightning)	86	64.94	81.41	20	23.26
5045.	Dong (dongggg)	86	86.54	108.41	29	33.72
5046.	dalia (daliafraga)	86	78.09	92.72	21	24.42
5047.	Jalen (dabesttypr)	86	90.82	111.40	25	29.07
5048.	caleb (caleb123456)	86	125.48	151.84	48	55.81
5049.	Adrian (bobsgotepicskills)	86	72.53	90.96	17	19.77
5050.	GreatWhiteShark (black_b6969)	86	92.07	114.02	25	29.07
5051.	তৌসিফুল ফ�...	86	83.40	99.30	25	29.07
5052.	Ayy (ayush_parihar)	86	60.27	76.90	12	13.95
5053.	Asaan (asaan)	86	48.31	63.74	5	5.81
5054.	Anunnaki (anunnaki77)	86	52.17	65.05	17	19.77
5055.	Tursunali (ali_khan)	86	60.85	86.76	18	20.93
5056.	ahnfnsr (ahnfnsr)	86	78.51	96.99	17	19.77
5057.	Green Tea (2001186)	86	99.93	131.76	24	27.91
5058.	Peter (cruzp_63_mobile)	86	37.15	52.46	2	2.33
5059.	mdawg101 (mdawg10101)	86	65.07	84.29	18	20.93
5060.	Layth (a_layth_z)	86	34.88	48.78	6	6.98
5061.	hoji (hoging)	86	44.97	53.20	11	12.79
5062.	abc (abcijkkkk)	86	47.40	63.56	18	20.93
5063.	Nate (n8thenb)	86	66.89	84.90	16	18.60
5064.	Ted (lucky_strike)	86	91.05	111.58	22	25.58
5065.	Krystall (krystaller)	86	43.30	55.06	6	6.98
5066.	Eugene (kpopgay)	86	79.70	104.00	20	23.26
5067.	Kevin (kevin_zhang)	86	79.61	99.68	21	24.42
5068.	Jayden (jripic137)	86	105.38	123.23	57	66.28
5069.	Ashish (grimjaw7)	86	68.13	79.06	14	16.28
5070.	Hehe (gagokarin)	86	114.55	158.63	46	53.49
5071.	Joaquin (zevolish)	86	106.27	129.98	45	52.33
5072.	yeet (yeetanut)	86	114.52	159.17	37	43.02
5073.	lokesh (vidhvanshak)	86	56.64	67.64	16	18.60
5074.	uzu (uzuiiske)	86	106.77	135.37	47	54.65
5075.	Qing En (twea)	86	53.02	69.37	14	16.28
5076.	bobby (trowlazer)	86	130.14	149.72	63	73.26
5077.	Bruno (tresco)	86	105.21	143.04	33	38.37
5078.	treespirit (treespirit)	86	89.97	111.03	25	29.07
5079.	Mony The G (skull_slayer)	86	122.45	161.09	52	60.47
5080.	Shamseer (shamsu)	86	45.89	62.67	11	12.79
5081.	Chris (___chris)	85	85.05	106.74	24	28.24
5082.	zyrch (zyrch)	85	71.30	89.12	26	30.59
5083.	Jesse (yojesse__)	85	70.82	101.01	19	22.35
5084.	wlof (wlof)	85	64.68	77.55	19	22.35
5085.	Luca (tracked)	85	67.08	89.32	16	18.82
5086.	TehTrooper (tehtrooper)	85	68.76	83.76	18	21.18
5087.	fast_as_f*ck (techniqueee1337)	85	28.99	39.45	8	9.41
5088.	Syrup (syrupsandwich)	85	118.48	155.73	41	48.24
5089.	Sven (sven0101)	85	57.39	72.30	16	18.82
5090.	superkhau (superkhau)	85	104.49	142.57	34	40.00
5091.	StevesterH (stevesterh)	85	94.83	117.24	24	28.24
5092.	Jake (starbless)	85	98.30	123.66	33	38.82
5093.	Saurav (srvsaha)	85	63.65	86.02	20	23.53
5094.	Akash (speedy_acj)	85	86.93	104.73	32	37.65
5095.	Sicoz (skyarc12)	85	98.32	120.03	30	35.29
5096.	HngryChef (siam33162)	85	53.97	73.49	9	10.59
5097.	Jacob (shrimploin)	85	126.54	159.24	46	54.12
5098.	Person (ali_666_)	85	98.30	118.07	36	42.35
5099.	A (akane49)	85	62.21	76.63	22	25.88
5100.	B00P (aaron_sy1)	85	91.65	112.73	30	35.29
5101.	Ayman (7times)	85	67.60	93.12	24	28.24
5102.	Rui (raiyik)	85	69.36	83.16	23	27.06
5103.	Silat (1guts_is_berserk)	85	37.41	49.07	14	16.47
5104.	Yem (yemm)	85	53.76	65.97	19	22.35
5105.	Jilly (thors_right_nut)	85	75.77	89.07	17	20.00
5106.	Gene (dorites)	85	65.65	81.77	21	24.71
5107.	Brett (savagesapien)	85	72.91	94.56	18	21.18
5108.	Sean (qpalzm123)	85	90.12	112.82	24	28.24
5109.	Harvey (precisiongoat)	85	66.75	78.73	16	18.82
5110.	Matthew (noobdestroyer69)	85	98.49	120.57	48	56.47
5111.	raven (mr_raven)	85	70.70	87.57	28	32.94
5112.	Miky (mikymoose)	85	52.66	61.80	9	10.59
5113.	Mason (mgbaird)	85	53.46	72.25	11	12.94
5114.	Gobind (meri_marzi)	85	73.38	112.74	14	16.47
5115.	ZanderL (mcmickeylyc)	85	79.66	95.90	27	31.76
5116.	Mars (mars212163)	85	89.54	110.42	29	34.12
5117.	Moritz (mango_1212)	85	49.37	66.17	13	15.29
5118.	Artur (ester_versuch)	85	57.49	67.43	11	12.94
5119.	rawrrr (darrrrrrr)	85	97.74	114.77	33	38.82
5120.	conquodS (cobraa)	85	99.51	123.47	39	45.88
5121.	Kusahgra (kushagra813)	85	79.93	94.23	23	27.06
5122.	king (kingkuzo)	85	91.01	111.53	30	35.29
5123.	---| (karthivi95)	85	80.04	97.90	22	25.88
5124.	Jeremy (jerbear27)	85	83.03	102.97	31	36.47
5125.	Bart (itwashishat)	85	49.91	73.32	11	12.94
5126.	IMcRoni (imcroni)	85	91.47	123.37	26	30.59
5127.	iglo31 (iglo31)	85	74.18	95.01	20	23.53
5128.	iAmKaviar (iamkaviar)	85	58.74	76.60	15	17.65
5129.	Gabriel (hong_kong_)	85	73.99	93.90	27	31.76
5130.	(g_fruit)	85	133.21	157.55	60	70.59
5131.	joey (legend_joey)	84	48.51	65.32	14	16.67
5132.	Kitty (kxkixi)	84	116.91	135.95	46	54.76
5133.	Paul Kenneth (kennetoy2302)	84	58.67	78.21	20	23.81
5134.	Jump (jump420)	84	54.27	71.43	13	15.48
5135.	JEWels (juewls)	84	58.63	76.87	16	19.05
5136.	Jon (jonlivestrong)	84	83.47	106.21	32	38.10
5137.	Jay (jayser6)	84	90.68	116.99	30	35.71
5138.	Jason (jachian)	84	107.79	133.84	51	60.71
5139.	Harshit (harshu19)	84	51.51	62.38	6	7.14
5140.	Ahmed (goushaa)	84	56.74	73.59	11	13.10
5141.	SilentHill (gosha666)	84	98.21	117.87	33	39.29
5142.	Vikram (galvarino_)	84	49.52	58.85	5	5.95
5143.	Saugat (saugat_regmi)	84	53.57	66.73	7	8.33
5144.	Ed (recht)	84	93.34	110.33	40	47.62
5145.	Nice (pranavkum123)	84	111.22	136.61	35	41.67
5146.	Nasser (nass_1000)	84	53.32	67.50	5	5.95
5147.	MoonSpoon (moonspoon1337)	84	47.90	63.15	5	5.95
5148.	Mohammad (mohammadmc)	84	70.70	91.08	20	23.81
5149.	McBurger (mcburger)	84	67.62	88.62	15	17.86
5150.	Zubair Ali (zubairali)	84	58.79	76.34	11	13.10
5151.	Carlton (wizardhero)	84	82.17	96.74	18	21.43
5152.	VoiceOfTheWorld (voiceofthe...	84	62.64	77.93	17	20.24
5153.	​​yosefxlr8 (vaniix_)	84	89.01	111.07	22	26.19
5154.	Anu (typeradha)	84	109.36	128.27	36	42.86
5155.	tourist (tourist18)	84	71.21	80.80	22	26.19
5156.	sussyplayer (sussyplayer696...	84	66.95	81.79	13	15.48
5157.	Shokhrukh (shokhrukh18)	84	65.59	76.66	32	38.10
5158.	Arijit (arijitgupta42)	84	71.91	91.82	28	33.33
5159.	Anirudh (anirudh06)	84	74.52	88.13	37	44.05
5160.	dj_sevdah (dj_sevdah)	84	63.54	83.45	27	32.14
5161.	fnkl (fnkl)	84	77.43	105.66	23	27.38
5162.	shinygia (shinygia)	84	65.00	82.21	20	23.81
5163.	Shiba (pianolover123)	84	107.44	140.61	50	59.52
5164.	Elias (mojolake)	84	72.34	100.28	22	26.19
5165.	nick (ismenick)	84	62.84	81.60	16	19.05
5166.	tdawg (tdawg11)	84	70.99	102.63	29	34.52
5167.	ant (fourmi)	84	40.01	47.87	3	3.57
5168.	MoralCharity (ethicalgivings)	84	115.54	158.96	47	55.95
5169.	Jesper (dwingx)	84	104.79	136.37	28	33.33
5170.	Chetan (chetankawarkhe)	84	58.80	81.44	16	19.05
5171.	carlos (carlit0)	84	96.81	121.90	25	29.76
5172.	Jimbo (bugprostate)	84	81.53	101.40	26	30.95
5173.	deez (biggy2)	84	104.66	121.02	30	35.71
5174.	AYJayeh (ayjayeh)	84	59.91	73.78	20	23.81
5175.	Erick (ep1ore)	83	65.59	80.51	20	24.10
5176.	Emeer (emeer_macapili)	83	60.35	74.60	16	19.28
5177.	Dan (dnor1313)	83	93.03	120.85	31	37.35
5178.	D (darueru241)	83	54.85	66.05	13	15.66
5179.	Daivat (daivatvaishnani)	83	75.39	89.09	19	22.89
5180.	Donked (cyrany)	83	85.67	105.71	26	31.33
5181.	chesco (chesco97)	83	73.66	91.37	27	32.53
5182.	simon (chainsawteeth)	83	70.91	83.14	21	25.30
5183.	Carmondai (carmondai)	83	44.78	53.04	5	6.02
5184.	Sherlock (caramel1995)	83	118.25	143.37	45	54.22
5185.	buhaN (buhan1337)	83	80.64	95.53	28	33.73
5186.	Blade0307 (blade0307)	83	65.21	78.14	14	16.87
5187.	ya BOI (beasted6969)	83	110.71	139.32	32	38.55
5188.	Bartek (batek_kierownik)	83	105.79	143.15	47	56.63
5189.	kes (barubelajarhehe)	83	64.63	77.86	18	21.69
5190.	Kid (zenfire9001)	83	85.23	107.71	20	24.10
5191.	Toko (xisderr)	83	55.58	75.68	10	12.05
5192.	Pp (typerace2002)	83	57.65	70.89	14	16.87
5193.	Baby Shark (toinfinity1)	83	97.67	120.18	32	38.55
5194.	doctor (timelordvader)	83	48.19	60.36	7	8.43
5195.	Storm (st0rm7)	83	50.31	62.57	8	9.64
5196.	spider (spidergod)	83	51.09	68.94	10	12.05
5197.	thanatoph (speedyant)	83	113.17	141.69	37	44.58
5198.	Sky (lanprodn41)	83	91.87	110.35	28	33.73
5199.	Kunal (kunaldutta)	83	40.67	55.60	10	12.05
5200.	Kitchen (kitchen_operator)	83	72.38	88.51	17	20.48
5201.	MAYANK (kartosbrotherinlaw)	83	57.92	71.85	14	16.87
5202.	Harrison (harryblueberry)	83	118.40	158.91	51	61.45
5203.	Andrews (godspeeedd)	83	70.24	96.82	20	24.10
5204.	Amo (santan_amzy)	83	89.07	101.49	26	31.33
5205.	Elliott (s1ldafort)	83	75.83	95.84	23	27.71
5206.	Rudolf (rutzzz)	83	94.32	119.98	33	39.76
5207.	rideler (rideler)	83	66.28	79.87	19	22.89
5208.	darren (raisinnbrann)	83	66.53	91.99	17	20.48
5209.	Zach (qwerty1221)	83	90.55	110.30	21	25.30
5210.	Jim (problemset)	83	85.40	106.37	27	32.53
5211.	JJ (peppermints)	83	78.76	90.57	16	19.28
5212.	Zachary (peanutbutter146)	83	69.44	84.54	21	25.30
5213.	Omunyokol (omunyokol)	83	64.44	84.09	14	16.87
5214.	Obatop (obatop)	83	92.49	122.31	26	31.33
5215.	noah (noahruether)	83	57.09	77.52	16	19.28
5216.	Noah (noah187)	83	88.97	102.61	27	32.53
5217.	Ali (medtype)	83	134.87	164.68	55	66.27
5218.	help (mango_mango_mango)	83	103.73	124.72	44	53.01
5219.	Alex (alexwpm)	83	62.26	81.84	15	18.07
5220.	Felix (sp4cebar)	83	70.42	88.30	19	22.89
5221.	Bryce (pennydog13)	83	56.09	70.47	12	14.46
5222.	Abraiz (abraiz)	83	57.03	68.65	11	13.25
5223.	Alpamys (a1pamys)	83	74.26	96.77	16	19.28
5224.	GZ (dysonspheres)	83	97.49	112.87	22	26.51
5225.	Space (spacecarrot)	83	79.07	95.63	21	25.30
5226.	oscar (ansgar92314)	82	88.32	106.83	27	32.93
5227.	Abhishek (abhishekxix)	82	66.58	86.62	21	25.61
5228.	Abdelrahman (abdo_mano)	82	42.00	52.63	3	3.66
5229.	Govind (404fixer)	82	56.51	69.93	11	13.41
5230.	Leo (powerleo101)	82	81.09	114.75	25	30.49
5231.	self (fzires)	82	99.82	123.29	32	39.02
5232.	Blake (topo666)	82	64.72	91.85	19	23.17
5233.	Vedaant (vedu_baba)	82	57.78	73.12	4	4.88
5234.	Bbblaire (bbbblaire)	82	78.12	93.43	23	28.05
5235.	. (lv23)	82	82.01	106.78	20	24.39
5236.	Lucas (lucasbush3)	82	74.36	94.67	34	41.46
5237.	L (lpuczynski)	82	71.52	88.48	21	25.61
5238.	Romit (junior12345)	82	60.62	77.28	19	23.17
5239.	qwerty (jowk)	82	84.03	107.27	22	26.83
5240.	FT_Zeref (iamzeref)	82	29.49	40.59	15	18.29
5241.	Gaurav (gaurav2607)	82	48.88	63.59	12	14.63
5242.	Majdi (freuud)	82	84.10	97.35	27	32.93
5243.	Aldir (faway)	82	83.26	100.62	19	23.17
5244.	M (faster_than_your_father_...	82	54.75	65.14	13	15.85
5245.	Ezz Abuzaid (ezzabuzaid)	82	59.83	72.53	20	24.39
5246.	Michael (dodus)	82	90.48	106.40	17	20.73
5247.	Dipesh (dipeshm77)	82	76.78	91.55	18	21.95
5248.	Aranyo (chimichenghiskhan)	82	96.35	114.45	36	43.90
5249.	chekic (chekic)	82	88.79	114.60	27	32.93
5250.	Ivan (bbqhehe)	82	129.14	152.00	50	60.98
5251.	Amit (a_myth)	82	66.50	75.29	15	18.29
5252.	Wake (awriter)	82	72.19	98.43	20	24.39
5253.	Asis (asis1998)	82	47.80	66.18	11	13.41
5254.	ari (aryanonye)	82	67.98	75.77	19	23.17
5255.	Lauris (toxic_bowl)	82	72.93	85.55	23	28.05
5256.	Ron (rounakc18)	82	101.90	117.16	24	29.27
5257.	rita (rita_mahato)	82	46.65	62.06	7	8.54
5258.	Ravel (raveltan)	82	62.95	73.82	20	24.39
5259.	Mayank (person_mayank)	82	77.20	94.78	19	23.17
5260.	Nazarii (nazarii_z)	82	72.05	91.99	18	21.95
5261.	Mike Adrian (mikeadrian)	82	74.33	86.09	15	18.29
5262.	Skipper (samskipper)	81	29.27	39.07	17	20.99
5263.	RAJIV RANJAN (rajiv_ranjan_1)	81	42.30	59.29	6	7.41
5264.	Blake (raccoonswoon)	81	75.95	96.01	22	27.16
5265.	Raaed (raaed_23)	81	96.05	127.39	33	40.74
5266.	Jan (q1xter)	81	69.98	84.94	16	19.75
5267.	Presiyan (presiyan15)	81	65.53	81.78	13	16.05
5268.	Ovidiu (ovidiu0720)	81	61.25	72.17	15	18.52
5269.	Omar (omarr84)	81	64.67	77.21	15	18.52
5270.	Omer (om3rrr)	81	101.52	128.03	32	39.51
5271.	Odo (odo_bean)	81	64.20	80.14	21	25.93
5272.	Thao (ncthao)	81	75.00	98.37	31	38.27
5273.	mubara (mubara)	81	37.09	49.18	8	9.88
5274.	The (mrperfectionista)	81	49.66	59.15	8	9.88
5275.	Declan (doctordirl)	81	99.71	116.91	27	33.33
5276.	Dew2118 (dew_2118)	81	68.03	79.07	15	18.52
5277.	David (davidstakic)	81	58.36	77.56	13	16.05
5278.	Danzcotic (danzcotic)	81	85.55	106.54	20	24.69
5279.	Ranit (colemakgang)	81	99.95	132.39	32	39.51
5280.	Brzzz (brzzz)	81	77.49	94.81	19	23.46
5281.	Missile Input (breadlump)	81	83.67	104.08	21	25.93
5282.	Ayham (ayhamgh)	81	59.30	74.04	19	23.46
5283.	Salamander (20_minutes_per_...	81	90.50	108.41	47	58.02
5284.	mcg (_mcg)	81	74.10	87.57	19	23.46
5285.	Bingo Bongo (bingo_bongo_)	81	79.07	97.60	25	30.86
5286.	seb (xsebzero)	81	76.74	98.73	23	28.40
5287.	Bastien_race28 (bastien_rac...	81	72.88	88.50	20	24.69
5288.	Pavel (pavelmirror)	81	37.90	44.35	5	6.17
5289.	jyjy (jyking99)	81	75.44	101.46	19	23.46
5290.	Kayden (kaydengiang2512)	81	72.09	92.44	62	76.54
5291.	The Green (hemanth37)	81	51.70	67.97	9	11.11
5292.	Lakshya (lakshyasharma)	81	69.76	88.47	21	25.93
5293.	Tommy (kamuimaru)	81	113.75	145.12	41	50.62
5294.	kajuna (kajuna)	81	90.41	123.14	30	37.04
5295.	Joshua (justdatotherguy)	81	73.39	90.18	23	28.40
5296.	No (jopear)	81	75.39	89.26	17	20.99
5297.	Joey (joeyp123)	81	76.43	93.49	14	17.28
5298.	Jason (jbb817)	81	128.39	154.54	54	66.67
5299.	Baxtiyor (iotype)	81	90.35	104.71	32	39.51
5300.	holsoma (holsoma)	81	82.91	97.42	26	32.10
5301.	hamada (hamada377)	81	22.44	34.08	14	17.28
5302.	akhil (hailk11)	81	77.55	95.64	21	25.93
5303.	Håvard (haavga)	81	64.98	83.48	13	16.05
5304.	ghxstly-_-kid (ghxstlykid)	81	54.57	69.56	6	7.41
5305.	zach (zacc2285)	81	103.18	124.04	35	43.21
5306.	Vishal Singh Adhikari (vizz...	81	68.28	88.22	21	25.93
5307.	v (vinay747)	81	48.54	64.34	9	11.11
5308.	Ben@ (uniconsole)	81	56.12	74.39	11	13.58
5309.	Typer4e (unbreakse)	81	90.71	106.26	21	25.93
5310.	vulture (typinguntilcompute...	81	111.52	133.09	45	55.56
5311.	Jimothy (typeman_69_420)	81	43.87	64.60	3	3.70
5312.	user_012 (tsitohaina)	81	46.73	57.43	19	23.46
5313.	Tmr (tmr_sa)	81	35.61	45.90	6	7.41
5314.	Jaxon Tatton (superjax101st)	81	50.66	74.88	47	58.02
5315.	snipa146 (streamsniper146)	81	36.85	50.15	5	6.17
5316.	Cathy (strawberrylatte)	81	78.94	101.11	15	18.52
5317.	Sourav (sourav008)	81	48.30	58.60	8	9.88
5318.	Nick (soltymong)	81	65.33	87.18	21	25.93
5319.	sky (skymario)	81	71.85	98.21	15	18.52
5320.	Shreyas (shreyastalathi)	81	72.01	88.25	14	17.28
5321.	Zoltatorrez (zoltatorrez)	80	72.41	88.50	15	18.75
5322.	Brandon (zombieapocalypse)	80	67.83	82.53	20	25.00
5323.	Zachary (zacharide)	80	61.61	83.03	21	26.25
5324.	Viet (viettp)	80	50.16	64.18	6	7.50
5325.	Marcel (thiccer_marc)	80	106.42	137.36	42	52.50
5326.	Logan (thewhiteowl69)	80	80.22	105.64	21	26.25
5327.	Alex (snowbdd9f1)	80	80.55	97.30	26	32.50
5328.	Slowman (slowman101)	80	96.67	111.04	30	37.50
5329.	sharavsambuu (sharavsambuu)	80	70.95	86.67	22	27.50
5330.	Shane (shane_woosh)	80	100.95	123.02	38	47.50
5331.	shahan (shahanj)	80	66.66	95.57	25	31.25
5332.	ambi (ambiidextrous)	80	92.79	120.58	38	47.50
5333.	k (ahhhjk)	80	81.85	107.21	22	27.50
5334.	AbdElazeem (abd_alazeem)	80	39.81	52.41	6	7.50
5335.	Abderrahim (aaissa)	80	65.23	88.06	16	20.00
5336.	Jakeyboi (00hike)	80	83.59	102.87	25	31.25
5337.	Cannelle (cannelle)	80	47.17	59.09	10	12.50
5338.	Dirk (treetoucher)	80	56.01	68.38	11	13.75
5339.	Rice (riceinbob)	80	70.47	89.12	28	35.00
5340.	x (roadtoonehundwpm)	80	76.07	93.62	22	27.50
5341.	skiie (huypig11)	80	60.93	73.88	15	18.75
5342.	Mo (mo7azeem)	80	94.17	107.28	25	31.25
5343.	ahmad (ahmad3r)	80	23.36	32.04	24	30.00
5344.	turbo (turbo_fister)	80	82.81	99.48	28	35.00
5345.	Vipul (vipulsings)	80	60.08	72.94	15	18.75
5346.	Schpuunk (schpuunk)	80	68.84	86.62	25	31.25
5347.	Reimar (reimarpb)	80	97.15	115.44	40	50.00
5348.	pprav (potato69420)	80	95.74	120.51	23	28.75
5349.	Quinn (peea)	80	86.55	107.10	23	28.75
5350.	MsPianomama (mspianomama)	80	93.70	121.18	28	35.00
5351.	Fadil (mr_fadil48)	80	59.26	79.27	15	18.75
5352.	Harry (moto1310)	80	53.72	77.87	22	27.50
5353.	Bakhodir (marko_w)	80	59.73	77.02	26	32.50
5354.	Nicolas (fruscianterules)	80	81.71	112.68	27	33.75
5355.	Fernando (ferthekiller6_)	80	82.20	107.16	27	33.75
5356.	fantdm4@gmail.com (evolnizark)	80	60.24	80.99	25	31.25
5357.	Helena (evanalfred0817)	80	86.40	111.77	42	52.50
5358.	Eli (elithesped)	80	127.72	167.40	54	67.50
5359.	m_j (dontlistentome)	80	87.12	115.94	25	31.25
5360.	David (davidjohnston20)	80	107.15	134.68	32	40.00
5361.	Don Quixote (crunchjunkie)	80	49.55	62.57	12	15.00
5362.	EJ (clarencedc)	80	83.89	114.34	30	37.50
5363.	Chetan (chetanhaobijam)	80	77.46	101.48	14	17.50
5364.	Bingsong (bingsongbingsong)	80	64.45	79.07	11	13.75
5365.	Stepan (a_s_v)	80	82.08	94.77	25	31.25
5366.	pen (lock3r)	80	97.15	125.46	25	31.25
5367.	TRLT - YouTube (krux_254)	80	51.02	64.22	16	20.00
5368.	Kenzen (kenzen18)	80	70.72	87.53	23	28.75
5369.	kamal (kemokingdod)	80	22.02	33.09	15	18.75
5370.	KMN (kanatbekov_24)	80	54.03	65.83	6	7.50
5371.	JoePuttatoe (joeputtatoe626_)	80	63.06	86.93	20	25.00
5372.	Dat (jgatz)	80	91.74	107.81	29	36.25
5373.	Benjamin (izno)	80	58.12	84.79	19	23.75
5374.	tstats[ioannisvrynios] (ioa...	80	110.75	148.15	36	45.00
5375.	Hi (hime_)	80	74.07	89.29	19	23.75
5376.	Harry (harpreetsingh005)	80	74.70	97.01	16	20.00
5377.	Agnes-Joker (guitarbed)	80	104.77	130.99	44	55.00
5378.	Gio (gio_etche)	80	96.46	125.10	27	33.75
5379.	L0G0S (logos_)	79	94.67	114.69	40	50.63
5380.	Light (light655)	79	58.30	72.48	19	24.05
5381.	Kasper (kaspertypes)	79	132.91	168.48	58	73.42
5382.	종지 (jonge1124)	79	98.81	120.85	31	39.24
5383.	Richard (jjjxxx)	79	65.59	80.38	16	20.25
5384.	Jayden (jdawwgg)	79	67.29	96.29	20	25.32
5385.	Frank (jaxfrank)	79	60.08	73.33	15	18.99
5386.	eugene paul (itdrmts)	79	78.60	91.60	26	32.91
5387.	Aufan (icepondx)	79	88.61	106.50	22	27.85
5388.	Garrett (grgarrett)	79	92.89	112.73	24	30.38
5389.	sawamura (sawamura)	79	52.20	65.36	12	15.19
5390.	ASHIK (samael99)	79	40.58	52.49	5	6.33
5391.	Roelof (roeloflucka)	79	78.03	93.32	20	25.32
5392.	plip (plip)	79	57.74	69.34	15	18.99
5393.	sayba (nusaiba4)	79	49.43	60.51	6	7.59
5394.	Nicholson (nic8ag)	79	61.29	79.46	18	22.78
5395.	neneko soldat meltfire (nerif)	79	122.69	158.35	43	54.43
5396.	Nathan (natekruger)	79	89.09	116.01	28	35.44
5397.	Naomi (naomielianora)	79	70.21	87.18	20	25.32
5398.	⁦⁧Mukundan (mukundan314)	79	85.35	106.49	23	29.11
5399.	md mahadie (mdmahadiehasanh...	79	71.01	88.44	21	26.58
5400.	wunyan (wunyannie)	79	105.59	128.12	31	39.24
5401.	Robert (wobert_)	79	130.41	165.59	52	65.82
5402.	Adam (waba_waba)	79	57.52	70.61	11	13.92
5403.	trqvcr (trqvcr)	79	66.99	96.27	17	21.52
5404.	ThatLastWaffle (thatlastwaf...	79	89.59	117.02	31	39.24
5405.	Mikołaj (sweed4life)	79	36.68	54.86	10	12.66
5406.	ST (subsonic86)	79	41.41	52.36	2	2.53
5407.	Noodle (stayed)	79	95.26	153.12	38	48.10
5408.	sssssssssssssss (sssssnake)	79	102.56	131.47	38	48.10
5409.	toudouche (seni42)	79	89.06	105.11	27	34.18
5410.	Akeisara (ake_e_e)	79	46.24	56.67	9	11.39
5411.	Aespar (aespar)	79	93.72	114.27	28	35.44
5412.	Aang_Guns (aang_guns)	79	59.63	73.52	13	16.46
5413.	fast-typist101 (vuylsteke)	79	90.89	115.41	30	37.97
5414.	Hassan (7zn5alid)	79	61.10	75.21	21	26.58
5415.	SouL (s4ul)	79	58.40	72.55	16	20.25
5416.	Pink (pinkunikorn)	79	60.48	79.72	18	22.78
5417.	ineed (buttado_g)	79	61.99	93.39	20	25.32
5418.	Mikey (mikey2020)	79	58.34	80.53	12	15.19
5419.	Ink (slidxt)	79	62.32	77.24	16	20.25
5420.	muhammad (akbacha)	79	44.47	61.37	6	7.59
5421.	abdelrahman (basyouni74)	79	35.38	44.98	4	5.06
5422.	babao (babao)	79	85.06	114.66	23	29.11
5423.	Me (emailgmailcom)	78	56.34	78.24	6	7.69
5424.	Jan (elapid)	78	99.42	116.52	37	47.44
5425.	Steven (eeekom)	78	79.65	108.10	22	28.21
5426.	Nyora (dvorak_mode)	78	108.65	130.69	41	52.56
5427.	dexterj (dexterj)	78	86.52	109.44	20	25.64
5428.	Danny (danny_whal)	78	68.09	91.79	22	28.21
5429.	Cres (crespear)	78	84.89	105.63	19	24.36
5430.	jeff (cqyimo42)	78	114.39	133.67	34	43.59
5431.	Brian (bv_altxps)	78	116.73	146.24	40	51.28
5432.	toki_crush (boom_51)	78	105.99	128.68	46	58.97
5433.	Axel (axeltb)	78	70.84	86.82	23	29.49
5434.	z (zivry)	78	70.15	84.52	20	25.64
5435.	yuh (yuhyeetyaw)	78	103.92	130.74	33	42.31
5436.	Youssof (youssof10)	78	62.03	79.18	61	78.21
5437.	Gurshaant Singh (waffleflau...	78	60.94	76.30	29	37.18
5438.	Vala (valarn)	78	48.53	59.43	4	5.13
5439.	Toni (topityper)	78	89.49	110.77	26	33.33
5440.	Diego (thebeastboi__)	78	77.74	99.57	31	39.74
5441.	Tendinits (tendinits)	78	65.94	93.38	27	34.62
5442.	Thomas (tammis)	78	105.67	121.13	39	50.00
5443.	Pizdonja (sule57)	78	97.36	115.38	22	28.21
5444.	Shubham (shubham_)	78	70.90	87.93	16	20.51
5445.	Glade (shogekiha)	78	111.18	134.25	58	74.36
5446.	Shen301 (shen301)	78	57.58	69.38	9	11.54
5447.	Shaun (shaun_c)	78	88.82	107.67	22	28.21
5448.	Shai (shai15)	78	63.32	73.43	14	17.95
5449.	may (maciem14)	78	66.96	93.54	20	25.64
5450.	Arthur (lelface)	78	102.19	131.80	36	46.15
5451.	Saba (junior6)	78	91.75	113.42	29	37.18
5452.	Yuri (json223)	78	102.75	129.88	39	50.00
5453.	Josh (joshjacks)	78	96.67	112.93	36	46.15
5454.	PinapL (joshiedean63)	78	50.32	67.80	12	15.38
5455.	Eliud (inggoodface)	78	96.77	133.10	19	24.36
5456.	Hassan (hassansajjad)	78	94.80	136.72	25	32.05
5457.	Gurra (halogurra)	78	81.03	111.92	19	24.36
5458.	fool (geekdud)	78	94.29	114.14	21	26.92
5459.	Alexeï (g4520u10)	78	37.79	51.06	3	3.85
5460.	Scer_1 (scer)	78	66.92	86.01	18	23.08
5461.	Rajesh (rcham)	78	39.63	50.50	3	3.85
5462.	Pranto (pranto2722)	78	86.04	103.59	23	29.49
5463.	Saul (paulsaredes)	78	93.15	115.34	29	37.18
5464.	Yusuf (northernbay4)	78	51.50	68.37	12	15.38
5465.	Jay (noj0ke)	78	90.83	122.71	22	28.21
5466.	Orion (nettle)	78	41.62	49.86	10	12.82
5467.	Natalie (natcard)	78	104.62	130.00	36	46.15
5468.	Marc (mwahab_)	78	104.96	137.18	39	50.00
5469.	chunchunmaru (mr_mystery4896)	78	87.62	116.87	30	38.46
5470.	Tangent (mrtangent)	78	69.23	92.24	16	20.51
5471.	Mohamed (mohamedsameh)	78	59.79	70.64	13	16.67
5472.	Adley (milf_slayer)	78	46.74	56.68	6	7.69
5473.	Abizer (abizern)	78	80.33	98.83	24	30.77
5474.	79 Camaro (79camaro737)	78	100.18	124.31	30	38.46
5475.	Shar (sharkg16)	78	119.13	138.14	32	41.03
5476.	Dinah (kirbytyper)	78	90.48	114.50	25	32.05
5477.	Matin (pmflash666)	78	28.42	38.25	14	17.95
5478.	Casper Tyson (caspertyson)	78	53.54	67.50	11	14.10
5479.	Ahmed (ahmed20)	77	44.26	55.28	6	7.79
5480.	zoidburger (adamczh1)	77	127.52	149.36	49	63.64
5481.	Huevonette (heavenslurp)	77	42.67	52.24	5	6.49
5482.	lost (lost2037)	77	36.03	50.09	10	12.99
5483.	sigit (licardi)	77	75.77	96.00	23	29.87
5484.	Kyle (kuronkuu)	77	85.57	121.30	23	29.87
5485.	Ng (kinkhai)	77	70.25	89.61	17	22.08
5486.	Khit (khitnay)	77	96.14	117.89	35	45.45
5487.	Hi (jxjx)	77	83.73	97.99	28	36.36
5488.	Vincent (jvgcalites)	77	84.11	102.02	18	23.38
5489.	que (jhavul)	77	119.85	153.20	48	62.34
5490.	Arber (hitit)	77	50.51	71.80	3	3.90
5491.	Andrew (greatfighter10)	77	97.02	110.56	27	35.06
5492.	john (funkefeet)	77	43.86	57.07	8	10.39
5493.	Fabian (fabii1309)	77	90.54	108.23	27	35.06
5494.	Tim (eternalwind)	77	67.61	81.57	15	19.48
5495.	BBIBBI (eddie110)	77	98.95	116.77	35	45.45
5496.	DULAL (dulal744574)	77	39.85	52.82	7	9.09
5497.	updog (danielseow)	77	99.62	118.42	25	32.47
5498.	Chicken (chickenpowerftw)	77	87.49	115.77	19	24.68
5499.	Yogesh (bestyogesh)	77	71.34	88.11	13	16.88
5500.	YNCBearz (bear19930414)	77	71.24	85.35	16	20.78
5501.	Basel (baselhatata)	77	85.09	108.70	30	38.96
5502.	Nikk (white13)	77	101.45	123.63	34	44.16
5503.	Michael (v3spula)	77	100.86	131.40	19	24.68
5504.	nullchilly (tuwuna)	77	122.76	274.05	39	50.65
5505.	YT (tim72)	77	57.01	73.11	8	10.39
5506.	... (the_sesquipedalienist)	77	102.27	137.30	36	46.75
5507.	KirILL (spl4yce)	77	75.91	98.77	18	23.38
5508.	Sparshong (sparshong)	77	78.53	98.59	24	31.17
5509.	S (sima0502)	77	84.76	103.66	22	28.57
5510.	ritwik (ritwik3856)	77	73.63	97.00	18	23.38
5511.	Prem (premkumar12)	77	31.47	40.00	6	7.79
5512.	Tiffany (potatosmeller)	77	72.88	90.90	13	16.88
5513.	no (noob1720)	77	84.74	98.03	21	27.27
5514.	Navdeep (navk007)	77	48.64	64.54	10	12.99
5515.	Marwan (marwans)	77	49.61	61.62	6	7.79
5516.	Rahul (rocketiscracked)	76	59.21	82.91	22	28.95
5517.	Fresca (reifresca)	76	100.53	115.84	19	25.00
5518.	Isaac (psachy)	76	98.41	128.40	31	40.79
5519.	Bam (phoenixthestral)	76	95.94	118.45	26	34.21
5520.	Sergio (perezsergioace)	76	70.15	82.21	22	28.95
5521.	Pavan (pa163361)	76	75.67	90.46	43	56.58
5522.	Nitro (nitrocrate)	76	95.92	114.08	34	44.74
5523.	Nave (naveleon)	76	61.31	81.54	15	19.74
5524.	Mr.chops (mr_chops)	76	90.67	104.21	26	34.21
5525.	Mohamed Emara (mohamed_emara)	76	47.12	59.99	7	9.21
5526.	alex (mimzy1995ns)	76	78.22	95.37	20	26.32
5527.	Anthony (mike916)	76	93.32	112.55	37	48.68
5528.	BobDaAsianBuilda (fortnitef...	76	115.62	134.70	32	42.11
5529.	Fitive (fitive_gaming)	76	63.96	82.64	20	26.32
5530.	Farhan (farhan_op)	76	94.44	113.70	40	52.63
5531.	fakedpoet (fakedpoet)	76	62.34	72.34	10	13.16
5532.	Emma (emmalischka)	76	56.84	65.02	13	17.11
5533.	Oneness (dreamtime)	76	89.97	103.59	22	28.95
5534.	Dragos (dragos_valak12)	76	55.03	79.22	8	10.53
5535.	arnab (dark_morty)	76	68.86	87.26	24	31.58
5536.	Andrew (completespud)	76	86.30	107.72	25	32.89
5537.	Tsunami (bmo12)	76	65.53	80.85	23	30.26
5538.	Matt (beano15)	76	76.34	96.46	17	22.37
5539.	Braden (barbuthnot)	76	92.94	108.45	30	39.47
5540.	Buyandelger (b200970010)	76	43.06	56.30	11	14.47
5541.	Adam (azonite)	76	107.47	139.99	45	59.21
5542.	Atomic (atomicf)	76	44.50	70.81	18	23.68
5543.	Nathan (alteriffic)	76	90.95	113.46	29	38.16
5544.	Jimbo (doa_jimbo)	76	66.55	85.51	19	25.00
5545.	Chad (douchebagasshole)	76	71.80	84.73	19	25.00
5546.	Đạt (thanhdat9503)	76	34.13	42.66	8	10.53
5547.	Ahmed (ahmedosama14)	76	84.40	105.04	19	25.00
5548.	xtr (xtr_)	76	74.35	94.65	16	21.05
5549.	Will (lynxwill_bov)	76	75.04	103.88	14	18.42
5550.	lol (luv_you)	76	124.96	150.16	50	65.79
5551.	♦☺♦ (lookdownnotjustup)	76	67.63	80.45	19	25.00
5552.	Ryan (lilchicken)	76	83.89	99.38	17	22.37
5553.	Lego (lamborgotii)	76	113.57	147.64	65	85.53
5554.	Shahan Sanjid Khan (korosen...	76	70.59	82.86	17	22.37
5555.	David (klassmagicer17)	76	89.87	111.23	24	31.58
5556.	Khadiza (khadiza)	76	30.49	37.54	6	7.89
5557.	kandarp (kandarp_5)	76	59.55	79.34	17	22.37
5558.	Oikawa (kakashihatake1205)	76	74.14	92.12	22	28.95
5559.	Jimmy (jiminator)	76	67.20	79.55	17	22.37
5560.	JahJi (jahji)	76	91.85	115.21	27	35.53
5561.	Dawid (ilordawid)	76	65.85	83.70	13	17.11
5562.	Hoasm (hoasm_gnaba)	76	43.67	54.88	11	14.47
5563.	Kevin Rendell (hankami37)	76	74.96	92.66	19	25.00
5564.	Morris (h0nny)	76	107.28	144.14	26	34.21
5565.	Sourav (_sourav_sarkar_)	76	59.72	81.10	13	17.11
5566.	Beybaris (zstorm_rd)	76	83.52	101.77	21	27.63
5567.	Zitti (zittti)	76	67.10	82.79	18	23.68
5568.	William (williamy34)	76	75.88	91.46	23	30.26
5569.	Lucian (the_eighth_wonder)	76	73.05	92.05	13	17.11
5570.	Alex (theflyestlai)	76	69.11	91.56	16	21.05
5571.	william (thefastest69)	76	100.76	134.25	23	30.26
5572.	KING (thecalamitousduck)	76	61.24	81.33	9	11.84
5573.	swoLee (swolee)	76	94.26	116.46	27	35.53
5574.	Sven (swen999)	76	80.27	94.06	25	32.89
5575.	Sumit (smromuec)	76	92.85	110.12	24	31.58
5576.	Slow (slow_typer111)	76	39.16	49.82	2	2.63
5577.	Shingo (shingoshoji)	76	110.63	134.63	36	47.37
5578.	shavalli (shavalli)	76	44.75	59.47	7	9.21
5579.	Gada go FAAASST (seesawsi)	76	83.80	97.31	17	22.37
5580.	8N (_8n_)	75	57.11	75.12	14	18.67
5581.	Yanterko (yanterko)	75	93.68	112.05	32	42.67
5582.	Tyler (xtios)	75	111.04	130.89	36	48.00
5583.	Fábio (vallkorion)	75	63.06	74.29	17	22.67
5584.	Kris (tymptra)	75	60.80	73.49	14	18.67
5585.	Test Project 3 (turkishtyper)	75	77.49	101.79	5	6.67
5586.	Motch (treemes)	75	73.67	89.76	16	21.33
5587.	Tomaz (tomaz1502)	75	92.23	108.57	25	33.33
5588.	Tawalisi (tawalisi_1500)	75	76.81	92.68	18	24.00
5589.	Korey (serveo21)	75	61.06	75.04	15	20.00
5590.	andy (andytixn)	75	146.44	194.75	55	73.33
5591.	A.B.G (ahmed_burham_pro)	75	67.42	79.63	12	16.00
5592.	3ymsdet (3ymsdet)	75	121.82	160.85	54	72.00
5593.	iuhyuh (iuhyuh)	75	80.62	108.91	29	38.67
5594.	Saurav (sauravdeore)	75	88.01	103.92	22	29.33
5595.	2fast4u (russell12345)	75	108.62	134.93	36	48.00
5596.	Lloyd (rketch)	75	78.55	93.07	18	24.00
5597.	Pranav (pranavsetpal)	75	60.68	82.66	11	14.67
5598.	potato (potato42069)	75	101.81	132.72	46	61.33
5599.	platno (platno)	75	101.90	116.72	33	44.00
5600.	Plague (plaguey)	75	81.03	95.88	10	13.33
5601.	nizam (nizamovicxi)	75	84.78	103.27	19	25.33
5602.	nart (nartyaltchin)	75	65.06	81.93	17	22.67
5603.	Nada (nadazz9)	75	31.75	39.33	6	8.00
5604.	Michael (mscott3)	75	112.82	137.34	30	40.00
5605.	Mostafa (moghorab)	75	41.44	54.20	10	13.33
5606.	Miles (miles223)	75	153.98	185.62	62	82.67
5607.	flaneur (flaneurnq)	75	171.49	203.98	71	94.67
5608.	Henry (flamekata24)	75	90.78	109.08	33	44.00
5609.	Seilacara (eunaosei)	75	65.38	80.23	19	25.33
5610.	Rohan (dragami)	75	75.39	110.37	20	26.67
5611.	Igor (disstream2)	75	63.29	72.84	16	21.33
5612.	Chris (chrisjordan23)	75	82.01	102.30	22	29.33
5613.	Chizi (chiziivictor)	75	51.48	61.42	10	13.33
5614.	Mort (captain_fredrickson)	75	72.84	88.77	12	16.00
5615.	not your dad (buthee)	75	115.38	139.38	44	58.67
5616.	GabWasTaken (bored_dude)	75	66.81	89.49	10	13.33
5617.	beta (betameta123)	75	89.69	106.47	19	25.33
5618.	Edward (batskater1234)	75	87.84	135.94	20	26.67
5619.	Kei (aznkei)	75	75.34	90.66	17	22.67
5620.	Kiryu (kiryugozi)	75	75.11	105.19	18	24.00
5621.	Khoa (khoadeptrai111)	75	78.49	113.93	21	28.00
5622.	JRT (jrt829)	75	75.49	87.67	15	20.00
5623.	poemich (jerkyice)	75	73.69	87.59	28	37.33
5624.	Lasse (imlasse)	75	82.26	100.42	20	26.67
5625.	Mohsin Ali (gillbest)	75	42.23	51.00	8	10.67
5626.	Lukas (lukasprestonchow)	74	79.98	108.37	32	43.24
5627.	amanogawa (lhykv)	74	151.47	186.27	60	81.08
5628.	ok (laggyfeetshake123)	74	133.01	161.00	49	66.22
5629.	blair:) (labercrombie36)	74	110.55	132.20	38	51.35
5630.	kyoppiy (kyoppiy)	74	42.58	56.90	3	4.05
5631.	mohamed (karray)	74	45.64	57.65	4	5.41
5632.	silver_soul (jooeeee)	74	80.85	105.61	18	24.32
5633.	Binly (inahee)	74	53.72	66.76	11	14.86
5634.	Bhavya (iconic_typer)	74	57.67	69.49	7	9.46
5635.	HHpotatoes (hhpotatoes)	74	80.79	101.88	17	22.97
5636.	Miika (hakkerijehu)	74	69.93	85.10	15	20.27
5637.	sAnideos (sanideos)	74	81.51	97.78	15	20.27
5638.	Saket (saketraj)	74	62.68	74.42	10	13.51
5639.	Lettuce (rolesg)	74	88.56	133.31	25	33.78
5640.	reall (reall)	74	81.88	97.36	21	28.38
5641.	Quinten (qspuijman)	74	86.92	102.82	27	36.49
5642.	Prathamesh (prathamesh0927)	74	60.78	78.34	10	13.51
5643.	payn (paynnn_)	74	102.70	123.30	32	43.24
5644.	Oscar (oscrrmrz)	74	66.64	105.52	18	24.32
5645.	Mr. Fancy (mr_fancy77)	74	70.48	90.22	18	24.32
5646.	PR (mrprx)	74	93.98	114.03	25	33.78
5647.	Johny (mijq)	74	42.29	51.10	7	9.46
5648.	Ywq06 (ywq06)	74	93.88	122.54	26	35.14
5649.	mateo (yaboimateo)	74	86.86	115.01	23	31.08
5650.	Arnav (variable_seal)	74	51.00	71.05	7	9.46
5651.	Nonthapat (uniq0rn)	74	48.65	60.52	6	8.11
5652.	Totally Not A Cat (totallyn...	74	56.55	71.88	15	20.27
5653.	Tormod (tormodfh)	74	44.98	57.24	5	6.76
5654.	Toonafisch (toonafisch)	74	75.04	94.90	19	25.68
5655.	van (toofasthoot)	74	86.83	103.87	13	17.57
5656.	Rishabh (thomasshellby)	74	76.88	96.49	19	25.68
5657.	samongcs (thesamuelong10)	74	61.88	74.72	16	21.62
5658.	Tenzin (tenzinfrost)	74	40.17	54.77	6	8.11
5659.	Stonebreaker (stonebreaker)	74	36.78	48.77	6	8.11
5660.	u (stirlo21)	74	77.95	90.01	8	10.81
5661.	Nate (somemoresmors)	74	82.96	106.63	20	27.03
5662.	Sebastian (shrekbastian)	74	80.90	100.80	33	44.59
5663.	Ahead (ahadwhat)	74	74.03	100.10	41	55.41
5664.	Adrian (adrian_himself)	74	53.45	67.49	9	12.16
5665.	aditya (adityaraj322)	74	54.15	69.19	13	17.57
5666.	Abhishek (abhichauhan)	74	41.95	57.20	4	5.41
5667.	aawan (aawan_viator)	74	56.05	66.59	11	14.86
5668.	asdasdf (211bazooka)	74	99.78	122.23	27	36.49
5669.	Mario (mariobeh)	74	52.39	71.39	6	8.11
5670.	Benjamin (benjikrafter)	74	62.00	73.43	11	14.86
5671.	Farrux (farruxprogg)	74	25.84	34.61	19	25.68
5672.	Musa (jaydeep712)	74	74.84	85.62	20	27.03
5673.	abc (thedumpster)	74	63.53	92.30	20	27.03
5674.	Foren (foren)	74	50.32	67.71	14	18.92
5675.	Experiment 626 (eee01)	74	93.31	115.46	32	43.24
5676.	Jack (ditabyte)	74	66.23	87.38	17	22.97
5677.	🥺👉👈 (daddy_mememas...	74	73.61	93.12	18	24.32
5678.	Aidan (coconutwaffle)	74	74.69	93.12	21	28.38
5679.	Maddie (ciderto)	74	89.39	121.19	23	31.08
5680.	CurryAbalone (careycai)	74	86.64	124.36	27	36.49
5681.	Bleu (bleublix)	74	73.19	88.78	20	27.03
5682.	Bachiri (bachiri)	74	83.03	95.29	15	20.27
5683.	Aaron (ayeayeron)	74	59.28	72.33	20	27.03
5684.	Ashton (ashtonnothsa)	74	31.29	43.04	7	9.46
5685.	Aryan (aryan7_king)	74	48.89	66.04	5	6.76
5686.	Aryaman (aryaman04)	74	86.96	111.64	25	33.78
5687.	Duffy (duffylam)	73	40.95	55.51	5	6.85
5688.	Booba (drakonsio)	73	94.69	115.66	22	30.14
5689.	noise (dp123)	73	134.48	177.15	52	71.23
5690.	davidpasion (davidpasion)	73	93.27	107.88	27	36.99
5691.	Darrin (darrinj)	73	68.89	84.45	24	32.88
5692.	Daniel (dark0nee)	73	84.09	96.25	20	27.40
5693.	veenu (comp_typist)	73	69.86	88.61	17	23.29
5694.	Anuj (coder05)	73	92.36	112.89	32	43.84
5695.	Chester (chesterization)	73	71.26	82.53	12	16.44
5696.	Erica (canadianhuman)	73	69.29	85.44	16	21.92
5697.	tehfu (brownmilk)	73	92.28	115.78	28	38.36
5698.	Anthlone (blakley)	73	93.12	115.71	24	32.88
5699.	Aidan (b8its)	73	93.70	107.94	22	30.14
5700.	austirol (austirol)	73	20.17	33.25	11	15.07
5701.	Austin (austinmarton)	73	101.29	123.85	27	36.99
5702.	veer pratap singh (_veerpra...	73	45.82	56.22	28	38.36
5703.	Richard (zzzcha10)	73	107.46	128.12	38	52.05
5704.	Sour (yung246)	73	59.07	70.00	12	16.44
5705.	yes (yesmaybeno)	73	99.02	123.37	42	57.53
5706.	Yeraly (yeraly_)	73	66.74	86.94	15	20.55
5707.	Winter (winter_dawn)	73	95.94	116.60	27	36.99
5708.	Malcolm (weatherman7921)	73	66.92	81.16	12	16.44
5709.	Steven (vivihuang)	73	89.41	118.28	22	30.14
5710.	tstats[typingsid02] (typing...	73	67.46	80.59	14	19.18
5711.	Oliver (typer2947)	73	50.23	64.61	6	8.22
5712.	Alex (truxior)	73	91.04	108.33	23	31.51
5713.	snow leopard (truechaos)	73	120.15	157.43	39	53.42
5714.	Kyozō (thegiantchip)	73	96.65	118.76	36	49.32
5715.	terrace (terrace2fast)	73	121.56	169.58	35	47.95
5716.	Taeyang (taeta3)	73	84.37	107.41	16	21.92
5717.	Madhvendra (madhvendra)	73	21.27	37.14	23	31.51
5718.	Loege (loege)	73	97.35	120.44	28	38.36
5719.	Lime (lizzardwizzard)	73	37.75	46.17	3	4.11
5720.	leodelfo (leodelfo)	73	95.65	114.47	27	36.99
5721.	Torrey (lavamob64)	73	100.17	123.80	35	47.95
5722.	KilinWei (kilinwei)	73	62.39	74.09	19	26.03
5723.	Kelly (kellyqin)	73	34.79	44.29	2	2.74
5724.	Kapi (kapi_boi)	73	58.57	79.33	13	17.81
5725.	Jerome (jerome_ctq)	73	86.63	106.52	11	15.07
5726.	Jerome (jeromesiu1210)	73	90.30	105.30	26	35.62
5727.	Arr (htunkyaw)	73	84.77	107.43	17	23.29
5728.	Grenek (grenek)	73	102.40	122.27	30	41.10
5729.	Sam (samtsullivan)	73	121.17	149.61	31	42.47
5730.	ROWLAND (rownet)	73	62.33	76.25	14	19.18
5731.	Wayne (retroweezy)	73	87.83	105.91	29	39.73
5732.	Rigno (redbubba)	73	118.44	144.70	37	50.68
5733.	anntz (reaction__)	73	86.89	108.05	26	35.62
5734.	skull issues (psychic7195)	73	102.66	133.30	62	84.93
5735.	peaNUTS (prabeshdai)	73	64.18	80.00	15	20.55
5736.	Paul (pkanas)	73	113.76	150.25	40	54.79
5737.	Peshraw-Kurdi (peshraw)	73	59.24	76.67	12	16.44
5738.	paveN (paven_)	73	59.13	73.67	15	20.55
5739.	pasha (pasha8800)	73	61.55	74.60	25	34.25
5740.	Ryan (nuigit)	73	99.11	134.57	31	42.47
5741.	Nadarsha (nadarsha)	73	21.24	29.83	23	31.51
5742.	musratte (musratte)	73	81.89	100.11	21	28.77
5743.	Never :q! (mista_t)	73	58.06	77.11	12	16.44
5744.	ang (angelah)	73	94.42	112.37	37	50.68
5745.	Adam (adamsawahgamer)	73	76.97	95.48	23	31.51
5746.	abh1sh3k (abh1sh3k)	73	81.43	96.30	41	56.16
5747.	don (psyfer_69)	73	72.14	92.25	14	19.18
5748.	Wallace (timmaddog)	73	94.23	112.96	18	24.66
5749.	Ulrich (ulrichji)	73	82.57	98.87	24	32.88
5750.	joygerry (joygerry)	73	76.95	96.31	18	24.66
5751.	Lorenz (yaramaisus)	73	30.28	42.24	5	6.85
5752.	Sam_2021 (sams_69420)	73	56.19	69.05	15	20.55
5753.	Annwesha (annwesha)	72	56.09	66.98	8	11.11
5754.	Aidan (amess92304)	72	63.23	77.48	18	25.00
5755.	JD (ahiajd)	72	75.91	90.58	12	16.67
5756.	Advith (advithshetty02)	72	78.33	98.03	19	26.39
5757.	AsiaSeries (adeepra)	72	65.81	75.63	19	26.39
5758.	Abhijeet (abhibaj007)	72	41.88	48.83	7	9.72
5759.	jojojo (astrot)	72	30.69	38.79	5	6.94
5760.	brooke (brookeech)	72	51.77	71.92	13	18.06
5761.	Matthew (matty_foo_foo)	72	54.52	67.48	6	8.33
5762.	Logan (iceisnice)	72	64.84	89.35	19	26.39
5763.	Ru (impurelight)	72	51.17	68.39	11	15.28
5764.	CoolBongoBoy (nerdrepellent)	72	79.26	96.85	23	31.94
5765.	Matt (shayosu)	72	83.46	103.25	19	26.39
5766.	Chris (lumms)	72	86.46	116.02	28	38.89
5767.	derrick (lewi0332)	72	49.66	64.55	4	5.56
5768.	LEANG (leangsy22)	72	34.43	42.22	5	6.94
5769.	Marcellus (krouthen)	72	103.15	135.31	24	33.33
5770.	k1suxu (k1suxu)	72	69.56	82.14	14	19.44
5771.	josh (jshg)	72	102.06	127.78	24	33.33
5772.	GreatKing (greatking)	72	104.54	120.48	31	43.06
5773.	Goldenpigg (goldenpigg123)	72	90.55	120.13	25	34.72
5774.	gegs921 (gegs921)	72	106.65	129.69	30	41.67
5775.	dayman (gangbeast_21)	72	73.47	99.43	19	26.39
5776.	FROST (frostxdemons)	72	77.56	95.16	26	36.11
5777.	Faiq (faiq57)	72	83.40	101.80	28	38.89
5778.	Noah (excell)	72	85.16	107.70	21	29.17
5779.	Emily (ellajournal13)	72	86.60	104.45	16	22.22
5780.	Ekezuke (ekezuke)	72	59.71	77.24	19	26.39
5781.	Hernan (edry12)	72	53.36	72.58	15	20.83
5782.	Selyaka (ddamyanov)	72	72.09	93.35	29	40.28
5783.	Dario (dariovondrasek)	72	46.61	57.65	9	12.50
5784.	cvs (cvs_pharmacy)	72	110.51	143.33	32	44.44
5785.	Chris (cascade_)	72	75.03	95.11	14	19.44
5786.	Bouba (breadbake)	72	107.82	124.47	39	54.17
5787.	JC (bid4peace)	72	58.37	72.69	12	16.67
5788.	barmijo (barmijo)	72	69.68	92.64	17	23.61
5789.	Cameron (ballsinyourface)	72	82.37	109.35	19	26.39
5790.	Alex (ask496)	72	111.56	126.42	30	41.67
5791.	Asier (asierart)	72	69.38	93.17	24	33.33
5792.	Reynol (arsen714)	72	78.45	103.03	13	18.06
5793.	Darren (zincj)	72	43.14	76.38	7	9.72
5794.	The Hunter (the_hunter_)	72	86.25	104.30	28	38.89
5795.	Kenneth (thedas)	72	88.23	109.79	25	34.72
5796.	Daniel (swietlikkielce)	72	62.18	84.78	15	20.83
5797.	travman (sunshinemamba)	72	71.85	91.04	16	22.22
5798.	Saurav (saurav555)	72	61.95	86.03	16	22.22
5799.	Sanjeevwa (sanjeevwa)	72	79.74	96.38	20	27.78
5800.	Sheldon (rooksword3393)	72	88.01	106.47	15	20.83
5801.	Raakulan (raakulan_94)	72	46.15	55.56	6	8.33
5802.	Pineapple (pineapple_pie1)	72	77.12	95.82	20	27.78
5803.	Alvaro (patomalo)	72	49.99	64.65	8	11.11
5804.	Nils (nosta_06)	72	82.21	101.43	25	34.72
5805.	nishi (nishi_san)	72	67.07	80.80	16	22.22
5806.	Toan (nguoichuadangki)	72	68.66	90.40	32	44.44
5807.	nexro (nexro44)	72	99.13	114.57	32	44.44
5808.	Melwan (melwan)	72	43.98	55.31	3	4.17
5809.	Ravenwolf (rvenwolf)	71	84.21	101.37	22	30.99
5810.	Empio (ppdodoqqq)	71	39.68	50.24	12	16.90
5811.	Ponymouse (ponymous)	71	96.50	129.56	33	46.48
5812.	Nail (nailail)	71	34.27	42.62	3	4.23
5813.	Noah Ignacio (nachos_7575)	71	71.31	83.47	14	19.72
5814.	Lutfullokh (mirzaqosimov)	71	50.58	65.36	9	12.68
5815.	Danny (flowburst)	71	121.61	153.26	42	59.15
5816.	Jacob (emptypaintbrush)	71	80.91	105.37	27	38.03
5817.	Alcolopa (emilioelmurr)	71	69.27	92.64	13	18.31
5818.	㋡㋛☹ (chzeeshan)	71	88.99	104.67	29	40.85
5819.	Xuanming (caoxuanming)	71	49.19	58.45	8	11.27
5820.	Fabijan (bifazg)	71	109.33	132.81	38	53.52
5821.	Brandon (bgrospe)	71	102.70	128.55	35	49.30
5822.	Garett (assaulted)	71	117.46	140.33	39	54.93
5823.	Med Amine (med_amine)	71	42.87	55.92	9	12.68
5824.	Kyle (kyle_w27129)	71	42.19	51.50	6	8.45
5825.	Sfang (johnblund)	71	80.29	100.32	22	30.99
5826.	Mr (luke44661)	71	52.33	64.36	5	7.04
5827.	Locomotion22 (locomotion22)	71	62.16	85.55	16	22.54
5828.	Maserati (latitude_5a)	71	63.18	77.28	13	18.31
5829.	Ashish (landxcape)	71	53.39	63.98	5	7.04
5830.	Kolock (kolock)	71	100.19	123.92	28	39.44
5831.	Homie (kingtrammy)	71	90.48	119.57	25	35.21
5832.	Juan (juan_mo)	71	67.85	88.99	12	16.90
5833.	Jessica (jesshe183)	71	86.09	102.41	12	16.90
5834.	Jacob (jacobr2d3)	71	75.19	98.05	24	33.80
5835.	imbad (imbad789)	71	97.49	129.84	19	26.76
5836.	Helmi Abdul (helmiabdul)	71	71.47	80.29	15	21.13
5837.	Ujjwal (half_blooded)	71	57.60	69.28	6	8.45
5838.	BlueCar (greencar)	71	59.09	72.07	10	14.08
5839.	ghostspirit (ghostspirit)	71	94.28	115.85	28	39.44
5840.	G (gc3shadow)	71	101.39	126.70	38	53.52
5841.	Hossen (galacticcheese1)	71	96.88	119.16	25	35.21
5842.	Vedica (gairolavedica)	71	34.44	45.21	9	12.68
5843.	F (_ft__)	71	66.60	88.11	19	26.76
5844.	har (zsbzsb)	71	86.44	106.76	26	36.62
5845.	Bartek (undg)	71	55.00	69.51	17	23.94
5846.	Tunmsie (tunmi_dev)	71	87.84	104.96	26	36.62
5847.	Sebastian (tulanir)	71	99.83	122.67	30	42.25
5848.	Johan (treeff)	71	92.77	119.30	21	29.58
5849.	Sudipta Sarkar (sudipta276)	71	42.38	49.73	7	9.86
5850.	Arthur (squekk)	71	39.70	50.47	28	39.44
5851.	sonny (sonnysixteen)	71	89.17	111.28	27	38.03
5852.	Md. Shafiul Islam (sohan110...	71	42.47	53.53	6	8.45
5853.	Slice Dice (slicedice)	71	56.20	71.87	10	14.08
5854.	Shahana (shahanas)	71	83.42	102.21	21	29.58
5855.	R (sevenexpert)	71	86.35	99.99	26	36.62
5856.	sedate (sedatekitten)	71	96.05	135.10	27	38.03
5857.	Zosia Nicholson (zosianicho...	70	76.85	104.60	11	15.71
5858.	Yehezkiel Raymundo (yehezki...	70	106.50	129.36	25	35.71
5859.	Kasper (yckf2)	70	124.15	155.13	50	71.43
5860.	Salman (xinvoker)	70	82.55	109.90	23	32.86
5861.	Wildebeest (wildebeest1)	70	60.56	75.04	7	10.00
5862.	Toyota (websitejunkie)	70	116.46	158.88	43	61.43
5863.	wade (waderf)	70	39.16	53.37	5	7.14
5864.	Abhishek (vbunny)	70	57.64	72.57	11	15.71
5865.	Valoix (valoixgaming)	70	68.42	81.02	63	90.00
5866.	tserse (tserse)	70	89.60	104.09	14	20.00
5867.	tony (tony_starc303)	70	55.99	66.73	9	12.86
5868.	TC Stinkey Mouse (thst4483)	70	94.05	119.24	19	27.14
5869.	teraah (teraah)	70	99.56	133.44	33	47.14
5870.	Md. Tarikul (tarikul_01)	70	60.71	80.32	13	18.57
5871.	Bob (sydre2)	70	96.42	113.73	35	50.00
5872.	victor (swegboi)	70	128.05	162.64	47	67.14
5873.	Stefan (stefradjen)	70	102.22	125.99	37	52.86
5874.	Stay (stayscaffolded)	70	98.04	125.17	20	28.57
5875.	adil (silawatadil)	70	56.47	72.29	15	21.43
5876.	Shuxuan (shuxuan)	70	58.48	75.22	13	18.57
5877.	nizika (shouronpou)	70	92.52	118.80	22	31.43
5878.	Shaina (shainaziza)	70	73.14	99.61	24	34.29
5879.	null (sectest)	70	103.39	115.33	30	42.86
5880.	Aniket (aniket_pithadia)	70	58.35	78.86	12	17.14
5881.	megatron (ahnomi)	70	68.18	83.66	18	25.71
5882.	Adil (adika_r)	70	71.03	83.63	22	31.43
5883.	Sanic (192378)	70	97.11	116.77	27	38.57
5884.	Jakub (jakubuwu)	70	49.94	63.30	9	12.86
5885.	Möhsün (pogodemon)	70	61.62	79.96	19	27.14
5886.	Mohammed (mohammed_almadani)	70	57.57	64.68	7	10.00
5887.	Marwan (the_typo_typist)	70	60.85	82.74	16	22.86
5888.	Sean (fairx)	70	42.92	53.33	1	1.43
5889.	Md. (ranoy)	70	25.45	38.87	14	20.00
5890.	Paolo (powlu)	70	76.00	95.56	23	32.86
5891.	Nik (nik_farhan)	70	77.75	109.32	21	30.00
5892.	Nikolino (nikolinolive)	70	65.62	84.29	40	57.14
5893.	lolow (neworange999)	70	101.69	129.58	32	45.71
5894.	Myka (mosin_warrior)	70	60.65	73.74	9	12.86
5895.	Kevin (moffitt)	70	151.74	173.14	61	87.14
5896.	mike (mikehawk12345)	70	96.50	129.78	29	41.43
5897.	5k m1chael (mihai03)	70	94.36	110.00	21	30.00
5898.	mitchell (miceol)	70	76.47	105.71	9	12.86
5899.	FAITH (fjoel)	70	30.05	45.41	10	14.29
5900.	Farid (faridmusayev)	70	87.75	118.17	24	34.29
5901.	Evangelos (es305)	70	85.66	110.82	26	37.14
5902.	erakai (erakai)	70	140.34	171.34	48	68.57
5903.	EG (eg_immortal)	70	43.21	59.90	18	25.71
5904.	Eli (eberger03)	70	87.53	110.01	23	32.86
5905.	Charles (doubleqin)	70	122.60	145.35	40	57.14
5906.	poop (dompozo)	70	66.84	88.05	23	32.86
5907.	Charles (charles_good)	70	79.81	92.43	21	30.00
5908.	Hadi (charaka)	70	95.95	117.81	25	35.71
5909.	napkin (call_me_napkin)	70	133.51	169.54	41	58.57
5910.	Kyle (break_fast)	70	53.21	73.14	9	12.86
5911.	duncan (bobby29831)	70	97.78	112.17	26	37.14
5912.	AD (blastoise13524)	70	74.13	116.72	26	37.14
5913.	Salman (blackstrobe)	70	93.58	112.97	26	37.14
5914.	Aryan (aryan_16)	70	63.09	74.93	11	15.71
5915.	Arsennn (arsenn)	70	88.72	115.39	19	27.14
5916.	Louis (loucru1)	70	87.47	106.02	21	30.00
5917.	tstats[log1xmeister] (log1x...	70	88.80	113.85	26	37.14
5918.	Leong (leong_ckai)	70	61.71	76.80	12	17.14
5919.	Kimberly (kimboslice16)	70	95.86	120.63	36	51.43
5920.	Logi K380 (kedr0n)	70	122.84	144.65	37	52.86
5921.	kalisto (kalisto)	70	63.11	76.21	10	14.29
5922.	Greatman (jimmy_x)	70	87.06	102.30	16	22.86
5923.	kjr (jianrong2004)	70	44.15	53.45	3	4.29
5924.	Jav (jav77)	70	71.71	83.14	13	18.57
5925.	Jared (jaredblack)	70	98.18	117.10	56	80.00
5926.	James (itsbamble)	70	95.60	113.96	25	35.71
5927.	ironmk11 (ironmk11)	70	88.36	107.27	21	30.00
5928.	Imad (imad_uo)	70	42.83	52.47	6	8.57
5929.	Abhas (imabhas)	70	62.09	83.76	11	15.71
5930.	hoangnam75 (hoagnnam75)	70	96.03	112.53	26	37.14
5931.	. (hanthedude)	70	112.36	129.95	40	57.14
5932.	hamza (hamza_8)	70	52.52	63.63	5	7.14
5933.	mr.purpose24 (hacker51)	70	72.18	88.66	20	28.57
5934.	hrsh (h3rs8)	70	91.03	117.22	20	28.57
5935.	John Paulo (guehnwyvar)	70	78.35	97.79	25	35.71
5936.	Jerrynick (goldenxbulletz)	70	74.28	98.94	16	22.86
5937.	Isaac (ksspook)	69	43.52	62.22	4	5.80
5938.	Khenh (khnhnguyen)	69	60.07	93.28	19	27.54
5939.	A-Train (k4sh1zy)	69	71.41	88.39	16	23.19
5940.	Jimmy (jimmy890302)	69	60.95	74.41	9	13.04
5941.	Anon (jeff10)	69	141.02	173.22	63	91.30
5942.	Zhamshid (Jam1lbek) (jam1lbek)	69	44.94	61.14	12	17.39
5943.	Mio (i_drive_car_lol)	69	69.24	90.62	17	24.64
5944.	i'm a band kid (imabandkid)	69	85.55	107.60	41	59.42
5945.	Ernst (hopeofmercy)	69	90.24	117.23	27	39.13
5946.	Henry (henrybutschool)	69	81.81	97.75	20	28.99
5947.	Gidean (gidean)	69	81.97	98.01	15	21.74
5948.	johan (sagapam)	69	52.22	63.49	9	13.04
5949.	Tadej (reyalpdab2)	69	116.12	138.26	41	59.42
5950.	Renato Emeric (renatoemeric11)	69	63.58	77.77	10	14.49
5951.	Ramez (ramezraymond)	69	88.51	104.72	29	42.03
5952.	Prince (prince7589)	69	95.80	116.67	34	49.28
5953.	Harry (pandasboob)	69	118.28	143.54	34	49.28
5954.	T (omega5002)	69	83.84	98.25	19	27.54
5955.	Raiden Shogun (ntd_dll)	69	92.14	111.59	23	33.33
5956.	Norman (noromoon)	69	68.17	87.48	15	21.74
5957.	Naomi (nmb813)	69	49.90	61.75	5	7.25
5958.	naganandana (naganandana)	69	71.17	84.93	17	24.64
5959.	Yiming (mymreview)	69	69.99	95.75	24	34.78
5960.	moon (moon_anna)	69	67.49	84.12	23	33.33
5961.	Alazar (mealazar)	69	58.68	74.71	9	13.04
5962.	Aditya (zwelgop)	69	76.45	101.48	18	26.09
5963.	Zecro (zecro_48)	69	39.76	53.61	2	2.90
5964.	yurii (yurcifer)	69	52.64	67.57	8	11.59
5965.	Voak (voak)	69	51.31	65.07	11	15.94
5966.	Arief (valliante)	69	88.24	105.53	31	44.93
5967.	Mike (tonz30)	69	80.52	96.27	18	26.09
5968.	Daniel (throwmycage)	69	54.05	67.60	5	7.25
5969.	spetterpoep (spetterpoep)	69	94.36	119.78	26	37.68
5970.	Jesse (soval)	69	65.43	87.63	8	11.59
5971.	Shynali Otep (shynali)	69	27.58	34.85	10	14.49
5972.	Scribbled (scribbled_trashhh)	69	61.15	78.07	9	13.04
5973.	Arka (arkacsedu)	69	73.23	90.46	13	18.84
5974.	Riley (amlockedinfridge)	69	93.61	116.41	26	37.68
5975.	Akshay (akshaymkupnoor)	69	52.23	63.48	4	5.80
5976.	Af (aepaef17)	69	71.18	90.75	18	26.09
5977.	0verhaul (0verhaul)	69	66.99	104.17	17	24.64
5978.	Smitesh (smiteshp)	69	70.51	81.67	16	23.19
5979.	Jeferson Beliber (jbyungz)	69	81.17	116.12	26	37.68
5980.	Victor (dczxao)	69	74.23	91.31	15	21.74
5981.	grim (gri16m)	69	89.20	116.34	25	36.23
5982.	DKTang (killnoevil)	69	86.53	108.06	20	28.99
5983.	Francisco (frantark)	69	45.70	69.46	5	7.25
5984.	vakupen (vakupen)	69	42.13	77.56	16	23.19
5985.	Beri (beri_)	69	61.71	75.01	23	33.33
5986.	Ghufran Ahmed (gahse)	69	34.17	46.35	1	1.45
5987.	Jack (s_7ven)	69	67.62	86.83	28	40.58
5988.	Alejandro (foreversick)	69	89.61	110.91	23	33.33
5989.	Femke (fffemke)	69	64.68	80.73	19	27.54
5990.	dude_BrahMan (dudebrahman)	69	104.05	131.45	36	52.17
5991.	Dustin (dsthegold23)	69	95.06	117.12	23	33.33
5992.	Nyxious (demonicious)	69	80.35	96.37	22	31.88
5993.	Nimble fingers (deadjarus)	69	57.85	71.03	6	8.70
5994.	Danny (danny1901)	69	96.26	116.94	29	42.03
5995.	D A M A G E D (dama_ged)	69	107.47	129.73	28	40.58
5996.	Abdi (bravenoob)	69	60.94	77.62	13	18.84
5997.	Astoshan (astoshan)	69	64.17	83.24	17	24.64
5998.	Avalanche (arnobel)	69	62.00	70.75	17	24.64
5999.	mitchell (fool1shdemxn)	68	88.45	109.59	26	38.24
6000.	Tobi (fastestflash)	68	108.93	137.98	39	57.35
6001.	Eboy (e_nonymous)	68	66.01	84.79	15	22.06
6002.	Ethan (ethanchansk)	68	94.74	119.50	28	41.18
6003.	Bray (erasleeps)	68	103.98	136.28	34	50.00
6004.	elnaz (elnaznsi)	68	54.40	71.98	45	66.18
6005.	Naing Htoo Aung (devii92)	68	86.49	103.50	23	33.82
6006.	Dark (darkelevent)	68	74.25	91.95	13	19.12
6007.	Iemand (darckshy)	68	73.47	89.53	24	35.29
6008.	hanno (busterity)	68	77.88	96.33	16	23.53
6009.	bouse7th (bouse7th)	68	52.76	62.77	6	8.82
6010.	Bonifacijus (bonifacijus)	68	53.37	74.15	6	8.82
6011.	hehe (blazeclash)	68	106.08	130.40	29	42.65
6012.	Papa (big_papa69)	68	43.54	54.77	7	10.29
6013.	Beata (beata111)	68	76.02	96.11	22	32.35
6014.	Lane (asdfedffd)	68	93.20	107.08	15	22.06
6015.	Zyad (zyad0magdy)	68	65.20	84.21	15	22.06
6016.	F. (yrebainahs)	68	100.42	120.45	28	41.18
6017.	Wesley (wesleylong)	68	80.37	101.53	13	19.12
6018.	Wael(▀̿Ĺ̯▀̿ ̿) (wa...	68	62.87	83.46	45	66.18
6019.	De9mond (uniwite)	68	72.86	87.43	13	19.12
6020.	Parminder (trion129)	68	44.66	56.87	5	7.35
6021.	stegmarb (stegmarb)	68	68.14	95.63	16	23.53
6022.	SlowBoy (slow_boy_neen)	68	86.85	109.35	17	25.00
6023.	Sizzled (sizzledbeans)	68	94.92	117.09	25	36.76
6024.	A (kmos)	68	94.88	115.53	29	42.65
6025.	shaan (khem92)	68	99.45	110.39	26	38.24
6026.	Jerome (jerome251998)	68	75.45	93.36	14	20.59
6027.	Johnathan (jellyowar308)	68	101.39	122.61	27	39.71
6028.	Diego (isqube)	68	73.98	92.41	15	22.06
6029.	Ion (incode4it)	68	95.96	133.97	28	41.18
6030.	Hunter (hunterwho43)	68	112.33	131.19	31	45.59
6031.	Hamada (hamadasalhab)	68	74.31	93.99	17	25.00
6032.	SenAlice (gokamiso)	68	73.98	90.14	14	20.59
6033.	v (gamegodv)	68	61.31	75.63	18	26.47
6034.	Russellazy (russellazy)	68	84.24	111.76	20	29.41
6035.	AG (rollingpanda0)	68	68.17	81.99	15	22.06
6036.	🗿 (rjh7)	68	61.86	82.25	11	16.18
6037.	Daryoush (rango__nice)	68	18.08	25.70	14	20.59
6038.	pri (prinni)	68	93.16	109.50	23	33.82
6039.	H J (ojinjin)	68	80.74	99.95	17	25.00
6040.	touko.ursin (oikipoiki)	68	62.55	72.85	17	25.00
6041.	nwieuv (nwieuv)	68	135.68	162.53	51	75.00
6042.	Nischal (nischal165)	68	64.43	76.15	18	26.47
6043.	Nahush (nahush28)	68	63.73	79.12	17	25.00
6044.	Bob (mrgeeses)	68	90.57	114.59	25	36.76
6045.	tstats[mozra3] (mozra3)	68	61.31	79.26	19	27.94
6046.	Nic (matcaps)	68	66.93	81.78	16	23.53
6047.	Andreas (andi_0324)	68	55.94	69.73	8	11.76
6048.	༄༊࿆Faith࿐ (adaling369)	68	85.44	106.26	16	23.53
6049.	Oblivyxia (oblivyxia)	68	84.80	108.77	29	42.65
6050.	Faraaz (_faraaz_)	68	45.48	65.06	8	11.76
6051.	Akilah (akilah1)	68	56.66	73.59	12	17.65
6052.	Caden (csjones1358)	68	33.18	43.51	8	11.76
6053.	Jackson (bigstix006)	68	55.20	68.29	13	19.12
6054.	rachie (grrachie)	68	97.04	114.25	35	51.47
6055.	Ariscottle (ariscottle3106)	67	77.29	103.00	19	28.36
6056.	Amr (amr98)	67	53.18	61.40	6	8.96
6057.	Nathan (tposetime)	67	61.30	76.64	13	19.40
6058.	Chino (stylish1323)	67	65.13	86.43	13	19.40
6059.	Aly (aly_hussien)	67	16.13	22.04	9	13.43
6060.	kenzar (kenzar)	67	43.27	52.69	3	4.48
6061.	saif (saif07ahmed)	67	52.93	75.19	10	14.93
6062.	Joseph (scomosypes)	67	85.50	119.28	20	29.85
6063.	Rafiq Ahmed (tanjil2009)	67	38.92	50.41	8	11.94
6064.	Shreesh (shreesh)	67	57.35	76.38	11	16.42
6065.	Viz (viz_124)	67	59.15	76.84	9	13.43
6066.	hope (hopekhembo)	67	39.15	50.62	3	4.48
6067.	Magz (magzse7en)	67	85.49	106.77	25	37.31
6068.	I lost (lxtxmx1)	67	80.09	112.37	10	14.93
6069.	Ludvig (lochecho)	67	121.93	146.19	45	67.16
6070.	Lộc (loccb90)	67	72.62	92.56	15	22.39
6071.	Justin (liontan)	67	87.20	104.74	28	41.79
6072.	Kicker (kickermasu)	67	73.39	89.17	16	23.88
6073.	karimulla (karimulla12)	67	71.05	96.75	18	26.87
6074.	jjjjjj (jitu8149)	67	64.64	79.78	20	29.85
6075.	Jennie (jeniibearr)	67	112.93	144.88	39	58.21
6076.	zxc (idcidcidcidc)	67	68.25	86.89	15	22.39
6077.	SCUT-黄光积 (hy_1314)	67	59.53	76.94	5	7.46
6078.	hamzah (hamzahzzs)	67	67.55	88.27	17	25.37
6079.	Greg (grrg)	67	81.72	97.72	17	25.37
6080.	Nawazish (ghostlead420)	67	49.12	65.26	5	7.46
6081.	Fedor (fshabashev)	67	90.14	103.07	17	25.37
6082.	Flash (flashyflashy)	67	127.18	146.45	45	67.16
6083.	filip (filko)	67	38.99	49.03	9	13.43
6084.	Machmori (explainingkamui)	67	65.78	80.63	16	23.88
6085.	Evelyn (evelynji)	67	77.09	92.55	20	29.85
6086.	Jen (ethima)	67	110.79	132.29	33	49.25
6087.	duckyful (duckydatyper)	67	74.24	103.99	9	13.43
6088.	Drakka (drakkathedark)	67	68.15	85.17	18	26.87
6089.	Diya (dmatulizo13)	67	56.89	75.19	15	22.39
6090.	Anurag (debroglie)	67	55.53	70.62	15	22.39
6091.	coolzacboy (coolzacboy)	67	97.47	116.83	23	34.33
6092.	Chris (bunkieme)	67	127.90	155.44	47	70.15
6093.	Brian (briansu)	67	87.03	112.70	14	20.90
6094.	Brendan (brenakin)	67	83.71	104.98	23	34.33
6095.	Brandon (bqn0309)	67	98.95	131.40	23	34.33
6096.	Hans (b3n1s)	67	78.65	99.20	13	19.40
6097.	tstats[azhy_01] (azhy_01)	67	82.38	98.71	25	37.31
6098.	Bettina (awkventurer)	67	123.78	194.62	45	67.16
6099.	Ren (yirenwang)	67	61.03	80.26	13	19.40
6100.	Loading.... (xbooza)	67	78.48	92.17	14	20.90
6101.	wobba (wobba)	67	84.00	99.25	21	31.34
6102.	Noah (typer_noah)	67	65.90	81.61	13	19.40
6103.	suraj giri (surajgirioffl)	67	69.10	79.77	18	26.87
6104.	Steven (stuvun)	67	101.55	118.23	35	52.24
6105.	Spy (spy71)	67	39.20	90.45	4	5.97
6106.	man (speedweeweeman)	67	112.92	139.02	40	59.70
6107.	NeverRage (solid_raiden)	67	108.41	129.75	37	55.22
6108.	Master (smartax)	67	98.38	123.59	17	25.37
6109.	Tom (rubik1908)	67	79.27	103.94	18	26.87
6110.	Reto (reddo)	67	85.68	104.21	21	31.34
6111.	purple (purplejust)	67	56.37	72.09	17	25.37
6112.	Prashant Kumar (prasha3nt)	67	30.95	38.04	5	7.46
6113.	Wiphoothorn (poomws)	67	40.64	54.05	5	7.46
6114.	Phong (phong1902)	67	71.59	95.44	15	22.39
6115.	Dillon (peak3433)	67	83.16	108.36	12	17.91
6116.	Paige (patrickwest)	67	67.59	75.71	15	22.39
6117.	noob (noahc207)	67	70.18	99.66	15	22.39
6118.	Jeff (navigation07)	67	67.89	84.05	14	20.90
6119.	mahmoud (modokatr)	67	51.00	66.27	3	4.48
6120.	Mateusz (matswiatek)	67	42.99	54.32	1	1.49
6121.	Marni (marniparnie)	67	44.41	60.24	5	7.46
6122.	Lucas (rlnb)	66	40.90	51.73	4	6.06
6123.	Pema (rimuru_tempest2004)	66	29.73	39.25	10	15.15
6124.	ricko (ricklo7)	66	96.44	123.48	22	33.33
6125.	dead account (ribombee)	66	125.53	163.64	25	37.88
6126.	Renardo (renarded)	66	145.50	188.54	34	51.52
6127.	9fingerstyle (readjust)	66	105.43	126.68	31	46.97
6128.	pylori (pylori)	66	88.10	108.75	24	36.36
6129.	Pouf (pouf_1)	66	53.62	67.14	18	27.27
6130.	flis (philip29)	66	97.16	124.86	28	42.42
6131.	Kajtebolikitica (patrik131)	66	89.25	108.16	21	31.82
6132.	Jeremy (orcane)	66	80.80	106.75	15	22.73
6133.	Oken (okenthelfocken)	66	63.81	85.41	14	21.21
6134.	kostis (oh_yeah_go)	66	49.21	58.90	5	7.58
6135.	femboy (nekokawaiiuwu)	66	127.74	152.18	49	74.24
6136.	Carlos (nearbywaffle)	66	93.70	120.99	22	33.33
6137.	Mythrick (mythrick)	66	100.69	122.52	27	40.91
6138.	Tortle (megahentai)	66	107.57	126.61	27	40.91
6139.	Frosty_Speed (frosty_s_speed)	66	51.92	79.48	9	13.64
6140.	jon (fishy159)	66	66.50	79.64	16	24.24
6141.	FatherWood (fatherwood)	66	69.71	84.23	16	24.24
6142.	Ethan (ethfer_77)	66	83.66	100.03	21	31.82
6143.	Emanuel (emanuelchristo)	66	67.53	80.57	19	28.79
6144.	Mr Plow (el_putino_1917)	66	65.87	84.86	16	24.24
6145.	Ellie (ellieoo)	66	89.98	110.30	16	24.24
6146.	Azamat (div2der)	66	75.07	98.16	18	27.27
6147.	Del (dellieran)	66	81.98	99.02	19	28.79
6148.	uko (darjaw)	66	79.79	97.46	29	43.94
6149.	(dafler)	66	117.44	135.05	36	54.55
6150.	swfan (curleyx)	66	76.31	96.83	20	30.30
6151.	soda, pop, tonic ( which on...	66	80.81	99.27	16	24.24
6152.	Bob (bobsvegana)	66	54.44	69.12	6	9.09
6153.	Ben (benpoopy)	66	71.97	95.15	22	33.33
6154.	Satwik Kashyap (annhilat0r)	66	63.49	79.64	10	15.15
6155.	Alexei (alexiedad)	66	85.37	109.09	13	19.70
6156.	Aidar (aidar13)	66	55.43	69.99	10	15.15
6157.	tamara (tyche1997)	66	39.16	52.32	4	6.06
6158.	Kvothe (relarkvothe)	66	83.94	98.04	18	27.27
6159.	Napasin (triplesic)	66	67.03	81.16	12	18.18
6160.	speedster11 (tygamer)	66	50.61	62.25	5	7.58
6161.	Ellis (sneakee)	66	77.54	93.43	15	22.73
6162.	Cadmiium (cadmiium)	66	92.96	118.04	31	46.97
6163.	Derto12 (derto12)	66	58.99	78.73	11	16.67
6164.	Youri (youriwatson)	66	61.95	74.28	8	12.12
6165.	Sanidhya (sanidhyas3s)	66	46.11	55.75	8	12.12
6166.	Gantulga (tsgantulga)	66	57.69	67.16	19	28.79
6167.	gilbo (ch0wner)	66	90.26	115.96	21	31.82
6168.	Roman (boycanoy)	66	69.35	84.52	14	21.21
6169.	Joe (lanolin211)	66	90.92	120.45	28	42.42
6170.	Michael (kimbo1414)	66	79.77	105.45	14	21.21
6171.	KetanaBlade (ketanablade)	66	104.57	125.71	9	13.64
6172.	Ketan (ketan1314)	66	65.22	82.35	26	39.39
6173.	Kenneth (kennethraphael)	66	75.91	94.69	21	31.82
6174.	✨MTH Insane Typer✨ (jos...	66	162.40	201.84	57	86.36
6175.	Jordan (jordanlreynolds99)	66	79.24	99.33	23	34.85
6176.	Craig (jitterjuicegaming)	66	88.11	104.12	18	27.27
6177.	JanTheMan (jan_the_man)	66	56.87	68.25	6	9.09
6178.	Marzuq (itsmarzuq)	66	47.82	55.89	3	4.55
6179.	Hari (harisund)	66	120.47	164.12	44	66.67
6180.	Imnatoshi (hanmayujiro)	66	65.00	78.94	9	13.64
6181.	Ahmad (gmg12)	66	86.95	113.26	12	18.18
6182.	Ko (__lo)	66	88.21	119.28	23	34.85
6183.	Trai (yezurey)	66	38.89	60.11	4	6.06
6184.	RyanNXD0120 (xuanduy1269)	66	87.49	109.80	27	40.91
6185.	Xassie (xassie)	66	83.82	102.02	24	36.36
6186.	Róbert (worder01)	66	78.47	94.60	13	19.70
6187.	sam (wongy03)	66	97.33	122.83	40	60.61
6188.	Williawar (williawar)	66	86.29	105.63	20	30.30
6189.	Wieds (wieds)	66	65.17	80.83	16	24.24
6190.	Vinayak (vinayak_7989)	66	65.61	87.99	21	31.82
6191.	. (vectorale)	66	108.10	136.54	26	39.39
6192.	None (v8_eatr)	66	67.51	81.96	22	33.33
6193.	rahul (typer_typer)	66	37.56	45.85	9	13.64
6194.	Rod (twors_colemak)	66	109.81	133.80	31	46.97
6195.	Nathanael (tunahead)	66	102.94	121.45	37	56.06
6196.	Wilson (tigermatos)	66	60.90	74.58	12	18.18
6197.	Lewis (the_mysterium)	66	55.98	69.81	12	18.18
6198.	Slamsal (slamsal)	66	74.14	92.06	27	40.91
6199.	Amanda (simplesecretsauce)	66	88.07	107.94	18	27.27
6200.	Luka (sercasm)	66	117.68	136.84	43	65.15
6201.	Nic (scylla1)	66	104.88	129.69	30	45.45
6202.	Mrinal (_tt_)	65	82.86	99.48	15	23.08
6203.	Anda (_anda_)	65	83.08	104.52	21	32.31
6204.	zain (zain_nawaz)	65	57.76	82.48	14	21.54
6205.	yashar (yashar1)	65	55.63	67.03	8	12.31
6206.	George (wiliu)	65	110.98	161.04	36	55.38
6207.	Donee (volts5)	65	82.67	115.86	16	24.62
6208.	Chris (tschy)	65	45.52	58.67	5	7.69
6209.	Thunderstorm (thunderst0rm27)	65	115.72	137.66	51	78.46
6210.	Charlie (swordmole)	65	102.22	116.90	29	44.62
6211.	suddernpy (suddernpy)	65	62.43	77.90	20	30.77
6212.	Edisa (snoopy34)	65	109.62	129.08	37	56.92
6213.	SnakeTwix (snaketwix)	65	90.99	126.35	25	38.46
6214.	Shashank (sky08)	65	31.29	46.01	5	7.69
6215.	Skiddy (skiddybadoosh)	65	61.42	79.59	10	15.38
6216.	Axel (sector7)	65	87.00	108.14	19	29.23
6217.	Alo (alooo)	65	48.04	59.26	3	4.62
6218.	Akbar (akbarovi)	65	59.08	73.25	8	12.31
6219.	Inesh (69420nice)	65	92.70	110.06	21	32.31
6220.	Tanya (verko)	65	41.37	51.91	7	10.77
6221.	Subhro (subhro_121)	65	54.40	67.73	2	3.08
6222.	Ursa (ursagaming)	65	79.29	98.91	23	35.38
6223.	Kyle (bloodfall90)	65	75.24	96.59	15	23.08
6224.	Alpha (alpha464)	65	77.56	101.84	23	35.38
6225.	John (venuntraxo)	65	86.08	120.17	25	38.46
6226.	tahmid (tahmid73)	65	52.70	60.97	4	6.15
6227.	Rodolfo (rojunman)	65	74.89	90.30	20	30.77
6228.	RMC (rmcproductions)	65	78.86	92.79	16	24.62
6229.	Marc (ratshepard)	65	97.42	119.10	32	49.23
6230.	Rahul (rahulburrito)	65	75.46	105.93	13	20.00
6231.	Puan (puanpro)	65	63.91	75.39	14	21.54
6232.	tommy bhau (pseudonetwork)	65	58.48	74.19	17	26.15
6233.	ProRick2358Y (prysp)	65	48.44	61.07	5	7.69
6234.	Pauli (pauli___)	65	72.88	92.75	19	29.23
6235.	pastarishi (pastarishi)	65	63.59	87.94	21	32.31
6236.	nil.rajmane@gmail.com (nila...	65	81.18	106.73	23	35.38
6237.	Mai (napping_koala)	65	72.64	87.88	18	27.69
6238.	mt005 (mt005)	65	76.65	98.86	15	23.08
6239.	Mounir (mounir_typing)	65	42.88	52.12	6	9.23
6240.	Miguel (migsarm)	65	79.18	88.43	12	18.46
6241.	Michael (meta1)	65	104.94	135.65	28	43.08
6242.	Matthew (mattisdabomb77)	65	74.10	92.88	14	21.54
6243.	Derek (frigorific)	65	73.04	93.62	20	30.77
6244.	thocky caps (floodvalve)	65	112.24	128.89	32	49.23
6245.	Spin (firesquall)	65	90.95	114.81	18	27.69
6246.	Zach (encasedthought)	65	90.20	113.76	23	35.38
6247.	Yosapol (eji4h)	65	90.74	102.86	16	24.62
6248.	John Lizuer (dimasalangchae)	65	59.35	80.66	16	24.62
6249.	Deku (dekachu)	65	51.60	66.17	5	7.69
6250.	Damos (damos22)	65	51.92	61.68	7	10.77
6251.	Colin (cwandell31)	65	81.21	113.46	18	27.69
6252.	Todd (cooldude_69)	65	45.16	57.99	3	4.62
6253.	Colin (colinn02)	65	97.85	125.06	30	46.15
6254.	buruum (buruum)	65	106.34	130.68	36	55.38
6255.	Edvinas (bull3tf)	65	121.84	144.56	36	55.38
6256.	Ben (bennash13)	65	91.60	114.31	19	29.23
6257.	seyyed sina (aseidsina)	65	45.54	55.97	5	7.69
6258.	Jui (laboni)	65	39.94	54.88	41	63.08
6259.	Max (kinginthenorth78)	65	84.61	99.88	22	33.85
6260.	Kiko (kikozz)	65	86.90	109.04	20	30.77
6261.	Khusan (khusan)	65	45.76	59.99	12	18.46
6262.	Karl (karl_marx_1818)	65	63.46	90.14	14	21.54
6263.	Junaid (junaidahmad3)	65	75.54	96.89	9	13.85
6264.	Jacob (jmbogo19)	65	67.00	86.37	17	26.15
6265.	James (jhoffman1204)	65	95.10	119.43	18	27.69
6266.	Daniel (irrrlrvant)	65	114.61	147.10	12	18.46
6267.	HenIsTheMan (henry_lim)	65	76.25	88.43	13	20.00
6268.	ILoveLofi (ginpaku)	65	71.43	94.39	15	23.08
6269.	Gabriel (gabp)	65	85.45	99.62	17	26.15
6270.	Trpimira (m15k0)	64	96.85	113.98	28	43.75
6271.	Jack (jr9810)	64	95.18	113.88	27	42.19
6272.	Steve (jack_of_all_trades)	64	87.70	103.39	23	35.94
6273.	Jack (jackmcg27)	64	68.17	83.79	20	31.25
6274.	Jun (jacketwithpockets)	64	94.26	126.42	21	32.81
6275.	bam (iamsobald)	64	95.75	123.43	24	37.50
6276.	Michael (hit2u)	64	103.78	148.42	25	39.06
6277.	▄︻̷̿┻̿═━一 (h...	64	88.47	110.74	26	40.63
6278.	Nate (haploeco)	64	59.87	80.29	10	15.63
6279.	Cecil (goodie1857)	64	96.79	127.35	46	71.88
6280.	Francisco Amat (saryon)	64	76.40	96.96	22	34.38
6281.	raim (raimmillion)	64	31.31	41.25	5	7.81
6282.	Priyam (priyam_raj)	64	67.94	83.35	14	21.88
6283.	Nooyag (priceisright2)	64	108.10	132.53	31	48.44
6284.	prgobet (prgobet)	64	75.17	97.38	26	40.63
6285.	Persov (persov)	64	93.39	119.57	21	32.81
6286.	Ethan (persom_)	64	77.32	97.04	14	21.88
6287.	PeriodicHAiL (periodichail)	64	67.55	79.08	17	26.56
6288.	Kim (ntk02)	64	73.14	96.18	16	25.00
6289.	altaire (notchrubble)	64	101.11	123.13	23	35.94
6290.	Mihovil (mladabobica)	64	86.08	106.40	27	42.19
6291.	💉 (milan_)	64	128.05	159.47	45	70.31
6292.	Zuhaer (zaszuhaer)	64	100.38	115.91	22	34.38
6293.	Rika (z3us99)	64	83.95	101.85	23	35.94
6294.	Virus (virusinmotion)	64	51.15	67.44	11	17.19
6295.	ukimub (ukimub)	64	142.68	157.77	44	68.75
6296.	Gin (tonic_gin)	64	94.05	113.36	17	26.56
6297.	Tam (tam04101993)	64	73.73	93.39	18	28.13
6298.	Essy (supersonics123)	64	58.80	77.23	10	15.63
6299.	Marshall (stoppednile)	64	94.67	112.85	21	32.81
6300.	Aakash (srinivasan41)	64	132.37	167.18	49	76.56
6301.	Sophia (sophia_8)	64	74.18	89.24	12	18.75
6302.	Shreesh (shreesh_racer)	64	56.22	66.89	9	14.06
6303.	Joe (seph_of_joe)	64	126.47	158.93	39	60.94
6304.	Everly (scribblenerd)	64	77.69	99.34	18	28.13
6305.	Nazar (aimogenius)	64	72.28	91.22	9	14.06
6306.	absor (absor)	64	89.26	113.61	24	37.50
6307.	Abdou (abdoulabani1)	64	50.78	70.52	5	7.81
6308.	Lim (doxel)	64	69.83	92.77	13	20.31
6309.	audran bobo (audran_bobo)	64	30.12	41.41	17	26.56
6310.	Dummy (resshin11)	64	56.11	72.32	43	67.19
6311.	Luna (wrackspurt)	64	66.35	83.24	9	14.06
6312.	Shaw (shaw_7)	64	23.26	28.41	11	17.19
6313.	balint (bailnt)	64	66.17	78.60	17	26.56
6314.	まぬーゆき (dudebtm_yt)	64	57.23	98.41	21	32.81
6315.	Luka (vashakmadze_luka)	64	79.41	98.23	23	35.94
6316.	Jackson (jacksonchen666)	64	77.88	110.98	21	32.81
6317.	This person (woeaifsdka)	64	55.28	73.52	12	18.75
6318.	Tominator (tominator0_0)	64	53.16	67.94	7	10.94
6319.	Uemi (uemichan)	64	86.15	103.33	33	51.56
6320.	Sage (el_anticristo)	64	47.19	61.50	10	15.63
6321.	left testicle (yggvcdghhigt)	64	27.26	35.96	13	20.31
6322.	Gay (fujikage999)	64	91.52	109.18	31	48.44
6323.	Frxntize (frxntize)	64	95.31	131.30	27	42.19
6324.	Anton (foroi)	64	48.07	60.56	10	15.63
6325.	HayfordHumade (flace)	64	59.99	71.74	13	20.31
6326.	eren (erenisdevil)	64	56.38	71.95	9	14.06
6327.	Elwin (elwin05)	64	60.90	69.70	14	21.88
6328.	Xiaorui (dxr1234)	64	69.31	83.39	14	21.88
6329.	Hamza (dribbble)	64	57.48	73.87	18	28.13
6330.	Damn (dammmson)	64	85.88	106.04	15	23.44
6331.	Ian (copywright)	64	88.88	113.34	20	31.25
6332.	Andeh (calluxdapotato)	64	101.63	117.42	27	42.19
6333.	Al Jade (c00k1e)	64	85.55	106.05	21	32.81
6334.	Joshua (buwan)	64	107.99	128.71	31	48.44
6335.	Adril (btsbiot)	64	71.53	99.21	17	26.56
6336.	bryan (bryan1111)	64	87.00	122.09	23	35.94
6337.	fastboi (boyfast)	64	91.72	110.08	35	54.69
6338.	Bob (bobtehguy)	64	118.82	139.20	44	68.75
6339.	Jonathan (bobjoni1233)	64	67.72	77.62	12	18.75
6340.	BobbyWasabi (bobby_wasabi_)	64	85.23	109.33	18	28.13
6341.	tstats[ayush_] (ayush_)	64	81.81	101.69	26	40.63
6342.	Attila (attila1)	64	44.52	54.91	5	7.81
6343.	FlyAtNight (flyonkeyboard)	63	84.95	101.06	22	34.92
6344.	Evan (elin4046)	63	102.48	123.48	22	34.92
6345.	D (davmarksman)	63	47.48	57.48	4	6.35
6346.	Oleksandr (c_u_b_e)	63	50.04	60.06	5	7.94
6347.	Collin (collin_felter)	63	89.40	107.20	19	30.16
6348.	i like to type (chuggaaconr...	63	115.80	141.01	37	58.73
6349.	Chrollo (chrollo283)	63	63.76	77.11	12	19.05
6350.	abhi (cheapcoder)	63	84.36	104.67	21	33.33
6351.	Cel (celerity_)	63	68.64	93.52	22	34.92
6352.	Danielle (bunelle)	63	44.26	64.37	8	12.70
6353.	Joseph (bnnes714)	63	43.16	61.62	7	11.11
6354.	Thien Nam Anh (benvu3005)	63	44.66	56.34	3	4.76
6355.	Awz. (awzcubensis)	63	49.55	65.54	11	17.46
6356.	Arnold (arnoldlek)	63	82.73	103.99	22	34.92
6357.	Wooloo (_extremely_bored)	63	105.92	127.77	20	31.75
6358.	Speed Cola (zdj361)	63	124.04	134.17	30	47.62
6359.	yoyojuice (yoyojuice)	63	103.42	146.22	21	33.33
6360.	suhai (xxrapidfirexx)	63	78.64	97.00	16	25.40
6361.	oldaccforpracticing (xsdream)	63	91.43	123.17	31	49.21
6362.	Matthew (wormshurm)	63	80.13	114.31	17	26.98
6363.	Wilford (wilfordjason)	63	123.95	149.81	32	50.79
6364.	They don't know me son (war...	63	96.55	133.65	30	47.62
6365.	Vahan (vaki)	63	25.42	33.91	14	22.22
6366.	Tommy (tommy_sylver)	63	69.45	90.32	28	44.44
6367.	Thymme (thymme)	63	84.55	108.82	26	41.27
6368.	Mark (tehone4u)	63	62.81	81.39	15	23.81
6369.	Spencer (spenciepoo)	63	120.14	148.39	39	61.90
6370.	👽 (sofreakingslow)	63	76.22	93.76	16	25.40
6371.	Jacob (slashingpuma)	63	97.75	114.51	26	41.27
6372.	Alice (shadowsofwaxwingsslain)	63	71.84	88.86	13	20.63
6373.	Magzhan (mako_siaa)	63	72.34	94.20	20	31.75
6374.	Max (mafab1)	63	118.94	148.45	38	60.32
6375.	Thang (lhg81hc)	63	72.15	86.11	14	22.22
6376.	ktzzzuuuu (ktzzz)	63	53.80	72.69	12	19.05
6377.	コタ (kotasucksatyping)	63	69.56	94.61	13	20.63
6378.	Kostaice (kostaice)	63	61.01	75.67	6	9.52
6379.	john (kingtypemaster)	63	75.21	90.36	31	49.21
6380.	Kit (kesuki)	63	125.16	149.89	42	66.67
6381.	Mate (hhmate)	63	59.90	74.78	10	15.87
6382.	George (gkoubbe)	63	67.65	83.45	19	30.16
6383.	Kawaii (saranghoe)	63	99.90	126.73	28	44.44
6384.	Rakesh Singu (rakeshsingu)	63	68.55	99.02	15	23.81
6385.	Putrid (putridacid)	63	60.94	80.25	11	17.46
6386.	Pierrot (pierrotplays)	63	113.03	132.39	39	61.90
6387.	I'm so trash (peepolove)	63	114.94	129.41	28	44.44
6388.	Corrupt (onlyicorrupt)	63	68.23	83.74	14	22.22
6389.	༼ つ ◕_◕ ༽つ (nyr...	63	54.34	72.31	12	19.05
6390.	No (noman75)	63	89.69	115.98	30	47.62
6391.	Neil (neilt_)	63	87.73	103.71	17	26.98
6392.	Mohab Tharwat (mohab97)	63	59.68	88.49	15	23.81
6393.	max (max2817max)	63	55.76	73.16	6	9.52
6394.	Amar (masteramar)	63	43.76	57.07	4	6.35
6395.	Marius (mariusniveri)	63	73.88	87.67	12	19.05
6396.	Huang.zy (amwzhenyu)	63	104.58	134.70	28	44.44
6397.	Von (vonjorie)	63	66.95	97.32	12	19.05
6398.	Hoàng (hoangloverboy)	63	78.46	93.90	11	17.46
6399.	Litefeather (litefeather)	63	57.67	69.60	10	15.87
6400.	AbsurdlyBlack (absurdlyblack)	63	78.22	108.47	18	28.57
6401.	Jennie (jorab)	63	50.23	62.23	7	11.11
6402.	OTERO81 (shashu_191)	63	45.78	58.99	7	11.11
6403.	Jax (jaxsnjohnson)	63	56.74	68.93	7	11.11
6404.	Seb (sebnivek)	63	56.52	66.80	10	15.87
6405.	Anlun (anlun)	62	77.58	100.03	22	35.48
6406.	ali (alimuhammadi)	62	38.52	56.60	1	1.61
6407.	Ahmed (ahmekal)	62	71.22	84.14	13	20.97
6408.	adugna (adex_22)	62	73.62	99.67	17	27.42
6409.	Adam (abrokke)	62	77.39	98.47	12	19.35
6410.	Abdallah (abdallah1)	62	72.21	83.46	13	20.97
6411.	Kobe (kobeelijah111)	62	86.50	112.54	19	30.65
6412.	Brandon (thewinterdonut)	62	70.86	93.02	25	40.32
6413.	Ali (iliyati)	62	65.44	77.46	12	19.35
6414.	Charles (charleswongnt)	62	82.45	108.18	19	30.65
6415.	A (axenaxii)	62	59.40	70.03	18	29.03
6416.	Newton Gain (newton7)	62	21.73	28.69	17	27.42
6417.	idkwhatoyusay (iuseblackswi...	62	82.39	100.24	19	30.65
6418.	evan (etearl)	62	58.63	76.45	8	12.90
6419.	James (vmisfit)	62	92.99	119.11	23	37.10
6420.	Ivan (realstyle)	62	44.92	54.59	10	16.13
6421.	Mike Kevin (mkcastro24)	62	75.27	86.76	18	29.03
6422.	Ahmad (gharbawy)	62	30.28	39.59	10	16.13
6423.	Lūkass (lukasslv)	62	76.48	100.84	14	22.58
6424.	Robert (lekia)	62	51.02	64.11	8	12.90
6425.	I×Blazar×I (lblazarl)	62	110.71	134.43	38	61.29
6426.	kabbo (kabbo25)	62	70.96	99.11	17	27.42
6427.	Youssef (jo1999)	62	84.65	99.36	15	24.19
6428.	N (jaripozz)	62	81.90	94.87	19	30.65
6429.	James (james702)	62	105.20	129.72	23	37.10
6430.	Cameron (iliveinabox117)	62	63.64	81.42	9	14.52
6431.	Gemma (gemmaaa)	62	70.60	91.83	17	27.42
6432.	3ntr0py (fr3udian)	62	95.86	112.32	20	32.26
6433.	Africa (ethiopian1252)	62	53.09	67.45	6	9.68
6434.	Joel (easynoob)	62	105.29	124.13	22	35.48
6435.	Dusan (dusanmilic95)	62	91.86	113.39	24	38.71
6436.	Luis (duelistone)	62	104.32	122.92	31	50.00
6437.	Biggus (drthunderface)	62	103.34	120.55	35	56.45
6438.	jerk (doofenshmirtzevil_inc)	62	59.69	71.50	16	25.81
6439.	Jay (dj_jay)	62	63.68	79.34	7	11.29
6440.	Brian (desbrigs)	62	77.00	97.29	12	19.35
6441.	dafiyoung (dafiyoung)	62	63.71	78.24	14	22.58
6442.	Penguino (cspenguino)	62	147.26	168.97	50	80.65
6443.	Copernicus (copernicsus)	62	81.09	112.51	22	35.48
6444.	Bryce (brycetifer)	62	86.97	120.45	20	32.26
6445.	BOBBY (bobbyquinn23)	62	51.41	68.45	6	9.68
6446.	Blitz Anschlag (blitzanschlag)	62	62.46	79.08	12	19.35
6447.	Alan (bl4n)	62	72.59	90.70	12	19.35
6448.	Sumit Prasad (beyonderr)	62	86.93	102.81	27	43.55
6449.	Bal (belgianwaffle)	62	115.69	144.43	35	56.45
6450.	(atypicaltypist)	62	117.21	152.11	34	54.84
6451.	ATHARVA (atharva07)	62	55.75	65.99	7	11.29
6452.	Aries Vince (arvj9)	62	68.19	95.23	18	29.03
6453.	Zor (zor365)	62	44.10	52.23	6	9.68
6454.	Daniel (zdaniel02_)	62	97.98	115.77	25	40.32
6455.	Xyexs (xyexs)	62	87.05	105.23	16	25.81
6456.	warm (warmthunder51)	62	68.50	88.67	15	24.19
6457.	turgz (turgz)	62	91.46	112.05	20	32.26
6458.	Wyman (speedy_boi420)	62	96.85	121.49	25	40.32
6459.	Jawad (sixtysicks66)	62	54.33	70.75	16	25.81
6460.	jm (sirpricebeach)	62	89.86	108.54	25	40.32
6461.	Siddhartha (sid_tiw)	62	99.48	120.07	31	50.00
6462.	alaa (salaa)	62	66.16	75.03	9	14.52
6463.	Rokas (rokasa369)	62	87.82	106.82	25	40.32
6464.	Redwan (redwan_360)	62	65.55	82.39	15	24.19
6465.	jungle_cruser (redscorn)	62	62.25	71.72	9	14.52
6466.	Believe in GOD and the PROC...	62	42.16	55.08	6	9.68
6467.	Rabber (polrabber)	62	65.43	85.79	15	24.19
6468.	Brendan (panikooooos)	62	121.50	148.43	33	53.23
6469.	Oleg (oleg27)	62	90.96	109.84	22	35.48
6470.	Nigel (nigeljames)	62	54.32	75.40	9	14.52
6471.	✔️▄◘🚀!new_luca@y...	62	108.16	134.95	32	51.61
6472.	Steven (nerobot)	62	67.30	84.68	9	14.52
6473.	Neeecu (neeecu)	62	72.43	90.15	14	22.58
6474.	Nathan (nat179)	62	81.96	107.05	55	88.71
6475.	(narzzz)	62	79.91	102.99	14	22.58
6476.	typeracist (moron212)	62	124.04	149.22	41	66.13
6477.	Joseph (meshram2001)	62	97.63	118.48	24	38.71
6478.	Faisal (md_faisal)	62	63.68	83.04	20	32.26
6479.	Márton (marcityperacer)	62	63.13	78.57	18	29.03
6480.	Satyam (satyamslow)	61	55.19	70.12	10	16.39
6481.	Samiha (sammoha)	61	35.46	47.58	2	3.28
6482.	Salah (salah135)	61	54.29	68.67	4	6.56
6483.	RoA (romori)	61	56.57	67.65	12	19.67
6484.	Foole (rizzbor)	61	75.17	87.89	15	24.59
6485.	RicoBaby (ricoricoree_)	61	93.53	117.13	38	62.30
6486.	Rafeeq (raf_al)	61	77.21	97.70	17	27.87
6487.	Qaplan (qaplan)	61	55.71	64.73	24	39.34
6488.	Punder (punderland)	61	76.33	92.25	13	21.31
6489.	tstats[pumpkinsoup1] (pumpk...	61	121.94	159.47	36	59.02
6490.	Bill (proepicgamer101)	61	89.18	119.37	30	49.18
6491.	Said (porta_said)	61	37.74	48.48	3	4.92
6492.	Plotinus (plotinusdickens)	61	126.32	154.93	40	65.57
6493.	Alexander (olekpark)	61	105.56	124.46	26	42.62
6494.	Nicholas Dimitrov (nickytyp...	61	84.91	131.20	20	32.79
6495.	Denis (newdenispro)	61	65.54	84.82	14	22.95
6496.	MysticNovaLord (mysticnoval...	61	63.07	89.59	16	26.23
6497.	Mohammed (mshousha29)	61	50.69	65.12	7	11.48
6498.	Mayank (mmayank74)	61	61.20	79.37	10	16.39
6499.	meli (meli0604)	61	88.29	109.28	18	29.51
6500.	matthew (mattchy)	61	73.56	83.49	21	34.43
6501.	Mathias (mathias64)	61	72.56	99.60	13	21.31
6502.	Haiden (manthetypewriter)	61	42.24	56.89	11	18.03
6503.	FlameFrost (flamefrost)	61	90.39	112.56	26	42.62
6504.	emily (em0p6)	61	45.46	57.24	31	50.82
6505.	ekoadipg (ekoadipg)	61	106.51	135.01	23	37.70
6506.	Tomaz (dragart)	61	61.21	70.29	12	19.67
6507.	Tapioca (davidararipe)	61	75.58	93.62	19	31.15
6508.	Darren (darrentheboi)	61	106.21	130.61	24	39.34
6509.	Chloe (c_stvr)	61	89.73	111.60	26	42.62
6510.	Nicholas (creamycarrots)	61	113.55	139.24	35	57.38
6511.	Cowlor (cowlortyper1)	61	98.81	123.46	26	42.62
6512.	Gabs (coolkidswag)	61	96.90	121.66	15	24.59
6513.	Bruh (chesswithmath)	61	94.40	126.73	27	44.26
6514.	UReal (chc39615)	61	83.49	100.80	15	24.59
6515.	Audrey (catholicguilt)	61	80.55	102.84	17	27.87
6516.	Brent (brvnt)	61	84.91	103.09	20	32.79
6517.	arno (boxhill)	61	107.64	138.59	33	54.10
6518.	blood (bloodripper)	61	26.19	33.65	8	13.11
6519.	Nathan (axewtypes)	61	88.42	116.24	25	40.98
6520.	Andrew (andrewwin2003)	61	75.02	94.54	16	26.23
6521.	Ahmed (ahmedhallool)	61	48.24	57.93	5	8.20
6522.	Parsa (5barsa5seconds)	61	91.21	110.73	21	34.43
6523.	Nadiah (naddyhere)	61	75.09	90.01	22	36.07
6524.	Nurs (nurs_sarsenov)	61	65.40	79.90	22	36.07
6525.	zeno (zeno_sama)	61	36.25	47.63	13	21.31
6526.	Destroyer (destroyer101)	61	41.26	69.22	2	3.28
6527.	TH127001 (th127001)	61	48.68	64.34	3	4.92
6528.	Keng Soon (kengsoon11)	61	49.73	66.10	13	21.31
6529.	Simon (simon6609griley)	61	92.06	114.08	28	45.90
6530.	Leukino (leukino)	61	92.91	127.78	20	32.79
6531.	kunal (kunaldongre)	61	78.43	96.99	15	24.59
6532.	Jethro (jethrofort)	61	76.51	101.59	20	32.79
6533.	Jenna (jennafer323)	61	72.83	106.88	16	26.23
6534.	Jainam (jainam123)	61	63.29	71.55	13	21.31
6535.	Hrant (hrant0)	61	78.98	92.64	16	26.23
6536.	SalmanMKC (hellothen)	61	135.57	177.10	9	14.75
6537.	silver (gr0ff)	61	94.83	115.86	31	50.82
6538.	im bored (googooalp)	61	62.22	80.26	16	26.23
6539.	Matthias (_matthias_)	61	65.42	83.54	15	24.59
6540.	Marcus (_flipz)	61	89.89	101.95	13	21.31
6541.	Tamerlan (zhanglet)	61	56.33	71.36	10	16.39
6542.	Jan (zeekat)	61	87.51	118.47	16	26.23
6543.	Mustakim (winterflew)	61	72.44	91.63	20	32.79
6544.	Alex (wakeful_celery)	61	68.91	87.98	10	16.39
6545.	oldweeb (uchiha_obito)	61	89.88	106.16	33	54.10
6546.	E (typemctypeface)	61	100.13	118.95	20	32.79
6547.	Jarrett (typeguy14)	61	75.85	93.35	24	39.34
6548.	tylerthsss (tylerths)	61	112.23	131.21	28	45.90
6549.	Tran (ttphu28)	61	42.37	51.99	5	8.20
6550.	🐵🙈🙉🙊🐒🦍�...	61	117.27	151.95	33	54.10
6551.	Tashrif (tashrif_shahriar)	61	89.68	109.09	24	39.34
6552.	shivam (svmyadav)	61	72.09	85.85	9	14.75
6553.	Chapri 👛👛 (sunilswain)	61	60.79	85.74	13	21.31
6554.	Brayan (sneymo)	61	52.69	71.24	6	9.84
6555.	Krishna (shinigami00)	61	64.40	79.03	18	29.51
6556.	mariah (serialfriend)	61	98.94	124.75	21	34.43
6557.	Yzmael (yzmael156)	60	98.44	122.38	31	51.67
6558.	Regulus ❄ (yo_yo_honey_si...	60	85.58	105.10	16	26.67
6559.	JB (wtfhowareyousofast)	60	117.09	151.56	35	58.33
6560.	Jay (wolfjay757)	60	84.33	105.30	21	35.00
6561.	william (willi30124)	60	68.75	85.89	15	25.00
6562.	gayman (vvvvvccvvvvv)	60	68.57	85.55	18	30.00
6563.	Vil (vil_)	60	92.89	117.03	20	33.33
6564.	Stefan (unknow_stef)	60	56.13	70.78	7	11.67
6565.	uglyjeffrey (uglyjeffrey)	60	69.53	89.36	21	35.00
6566.	Tyler (tyster02)	60	85.91	98.57	20	33.33
6567.	Typer (typertyping)	60	69.32	82.00	11	18.33
6568.	viv (toastexee)	60	91.19	116.60	13	21.67
6569.	Sulov (sul49)	60	67.82	86.22	19	31.67
6570.	spark (sparkkk)	60	81.99	121.23	19	31.67
6571.	Shashank (shashu1509)	60	86.09	107.58	15	25.00
6572.	Ace (semiace)	60	96.08	120.54	28	46.67
6573.	McQueen (aquino_jk)	60	40.31	51.18	4	6.67
6574.	Aibek (aosmonov)	60	80.89	99.42	24	40.00
6575.	Ankit (ankit0)	60	67.43	78.74	16	26.67
6576.	Marko (akagodyr)	60	43.94	54.88	6	10.00
6577.	hello (ajblizzard77)	60	74.28	101.44	20	33.33
6578.	Vaibhav (ahthserhsluk)	60	55.90	73.03	15	25.00
6579.	ahmet (ahmetyilmaz2002)	60	72.65	95.04	13	21.67
6580.	Harrison (happierwizard)	60	73.43	91.23	19	31.67
6581.	Joanne (jowelch25)	60	62.74	78.35	14	23.33
6582.	Urushihara (urushihara23)	60	40.64	52.36	5	8.33
6583.	makenna (kenniekat)	60	67.42	76.16	12	20.00
6584.	shiraku (otvxtyper)	60	78.26	91.36	16	26.67
6585.	ss (ssiq)	60	48.72	61.11	6	10.00
6586.	Rasmus (sbares)	60	92.00	109.14	22	36.67
6587.	Sandeep (sandeep_bhandari)	60	47.89	60.84	7	11.67
6588.	💓 (samhurwitz)	60	80.86	107.05	55	91.67
6589.	Rustam (rustam687)	60	86.04	111.45	20	33.33
6590.	harley (questionable0891)	60	50.13	65.93	7	11.67
6591.	NitroOrb (nitroorb)	60	86.85	112.81	21	35.00
6592.	Nicholas (nicholaslaw07)	60	78.84	101.20	13	21.67
6593.	MH (nibir4422322321)	60	55.81	68.67	5	8.33
6594.	NejcSLO (nfaca411)	60	52.62	67.34	9	15.00
6595.	x (mxlxdx)	60	128.65	175.95	24	40.00
6596.	Michael (ms_12)	60	77.34	98.72	13	21.67
6597.	Moritz (mogottsch)	60	82.23	96.97	23	38.33
6598.	Tinnaphop (mistertfy64)	60	96.44	120.46	19	31.67
6599.	MD Shahadat Hossain (md_sha...	60	46.29	56.41	8	13.33
6600.	Mat (mat78)	60	66.83	82.16	7	11.67
6601.	Mario (mariojr16)	60	72.50	90.82	16	26.67
6602.	Rachelle (foolishoni)	60	66.48	83.52	8	13.33
6603.	Flip (flip2theleft)	60	114.16	144.58	32	53.33
6604.	IndianGuy (fastindianguy)	60	94.05	107.45	31	51.67
6605.	jayden (fastest11yearoldtyp...	60	92.21	124.83	13	21.67
6606.	eric (ericsy)	60	100.04	118.32	23	38.33
6607.	Old Theme Rocks (dthp32776)	60	111.55	139.01	30	50.00
6608.	big slo (denvr)	60	72.90	91.51	13	21.67
6609.	AsadCoder (darkterror07)	60	74.40	103.10	14	23.33
6610.	Cole (coles_lambo_15)	60	87.11	110.85	22	36.67
6611.	Chan (cognacchan)	60	67.90	85.03	14	23.33
6612.	Sheep (celibustbike)	60	66.52	84.43	19	31.67
6613.	Carson (carsonting)	60	70.41	97.55	12	20.00
6614.	Jonas (calmdownnnnn)	60	73.54	93.43	10	16.67
6615.	Noah (bobapplepie)	60	101.78	117.34	26	43.33
6616.	Chua (big_boy_pack)	60	78.62	98.35	51	85.00
6617.	White (beast_5)	60	73.60	92.86	15	25.00
6618.	bayarjargal (bayaraajr)	60	62.12	79.39	27	45.00
6619.	Azaza (azazamaster)	60	57.64	67.70	11	18.33
6620.	AstroNomix (astronomix)	60	66.45	84.54	15	25.00
6621.	Aryan (aryan1504)	60	49.83	65.67	4	6.67
6622.	Ian (llamasquad)	60	83.61	105.32	19	31.67
6623.	Kiara (liptica_k)	60	70.03	85.59	10	16.67
6624.	thursdays (liljuicebox491)	60	87.61	126.63	16	26.67
6625.	Mark (lemon________)	60	84.24	116.00	19	31.67
6626.	Lent√es (lemoninapie)	60	101.38	135.48	28	46.67
6627.	fatma (khadigaz)	60	65.45	82.25	18	30.00
6628.	Jynn (jynngecko)	60	50.77	66.67	18	30.00
6629.	jivanf (jivan108)	60	141.79	178.93	47	78.33
6630.	Mic (jesusluvr)	60	71.21	91.52	16	26.67
6631.	Jenny (jenny_02)	60	84.19	107.92	13	21.67
6632.	JC (invoicingkarma)	60	84.63	103.69	16	26.67
6633.	Horizon (hwinangkoso)	60	69.79	83.28	16	26.67
6634.	thanh (hust9x)	60	64.71	75.47	12	20.00
6635.	Liban (hujala1)	60	144.19	173.54	45	75.00
6636.	Xavier (gshizzahs)	60	106.01	127.62	28	46.67
6637.	road to 100wpm (getoar112)	60	93.64	115.53	26	43.33
6638.	hngggg (m4saki)	59	88.58	112.14	25	42.37
6639.	lRaml (lsomeonel)	59	88.02	108.63	23	38.98
6640.	Jusuf (kz99)	59	83.38	103.40	17	28.81
6641.	JumpingPenguin (jumpingpeng...	59	85.79	103.73	23	38.98
6642.	JSlyk (jslyk)	59	69.92	95.16	19	32.20
6643.	Mujeeb's (jeffyglue)	59	120.48	151.67	39	66.10
6644.	burrito1 (jacobef2)	59	121.46	142.15	29	49.15
6645.	Jackoman (jackoman)	59	36.05	41.70	6	10.17
6646.	idost (idost)	59	63.75	72.70	14	23.73
6647.	∞ (gatewaydrug)	59	111.03	125.60	29	49.15
6648.	Santiago (santiago101604)	59	71.39	99.24	15	25.42
6649.	tstats[rtupps] (rtupps)	59	63.56	84.67	9	15.25
6650.	Sion (retardation69)	59	46.39	55.17	5	8.47
6651.	handshurt (ozzytheasian)	59	94.76	125.88	29	49.15
6652.	Deimer (ogdeimer)	59	70.26	95.18	15	25.42
6653.	Andrew (nosingaround)	59	121.38	142.54	29	49.15
6654.	Jordan (mrkentman)	59	81.21	100.73	20	33.90
6655.	m0gu (mogumogu_)	59	72.25	91.01	12	20.34
6656.	Marcus (marcusmandarin)	59	105.60	132.55	29	49.15
6657.	xdom (xdomiino)	59	82.69	106.41	21	35.59
6658.	weeAzuL (weeazul)	59	67.93	85.65	15	25.42
6659.	Volxage (volxage)	59	90.84	110.32	17	28.81
6660.	viper (viper3315)	59	67.21	78.35	10	16.95
6661.	none_of_ur_business (underc...	59	75.02	95.70	16	27.12
6662.	Miku (undeadninja)	59	83.34	96.63	15	25.42
6663.	Marc (tomatenmarc)	59	62.25	80.39	11	18.64
6664.	TITAN (titan_daddy)	59	55.26	73.24	12	20.34
6665.	The D Legend (the_d_legend)	59	84.02	97.02	14	23.73
6666.	TheZacher5645 (thezacher5645)	59	91.55	114.00	17	28.81
6667.	Hamz (thehamzarocks)	59	72.83	86.93	19	32.20
6668.	Tasnimul (tasnimul)	59	67.46	87.84	13	22.03
6669.	Sylvester (sylvestertyper)	59	94.27	110.76	17	28.81
6670.	Karina (syj4434)	59	79.22	100.26	25	42.37
6671.	Md Ahad Ali (sumon_ahmmed_001)	59	26.71	31.54	9	15.25
6672.	Shikhraj (shikhrajsingh)	59	107.81	129.86	25	42.37
6673.	Seb (sebastiancv)	59	87.46	106.19	19	32.20
6674.	ark (arkundu)	59	87.70	111.76	41	69.49
6675.	arjun (arjun_gamine)	59	54.87	70.02	7	11.86
6676.	Alex (alexlea444)	59	96.25	110.45	21	35.59
6677.	Feruz (akhbekdev)	59	45.31	56.41	6	10.17
6678.	Arthur (ajdem)	59	104.92	125.03	29	49.15
6679.	aa (aanyc)	59	59.58	71.25	9	15.25
6680.	Raj Gaurav (01indian)	59	56.45	67.56	15	25.42
6681.	Rageon (rageon787)	59	51.34	66.04	5	8.47
6682.	Sowm (sowm)	59	48.03	60.58	4	6.78
6683.	Vance (lamnbda)	59	62.62	79.27	9	15.25
6684.	Damian (bigsweat)	59	70.68	90.42	13	22.03
6685.	frost (frost99)	59	67.69	80.87	12	20.34
6686.	ants (fr4nc3)	59	116.43	138.27	30	50.85
6687.	finityfly (finity_fly)	59	113.79	131.06	26	44.07
6688.	Leroy (fazecringe)	59	87.22	107.09	20	33.90
6689.	Michael (ezykielue)	59	91.88	108.06	19	32.20
6690.	Vagesh (don1909)	59	60.66	68.67	9	15.25
6691.	Dhvanik (dj_viradiya)	59	56.39	67.67	12	20.34
6692.	Daniar (dankas23)	59	37.00	45.43	1	1.69
6693.	dani (daniellielikesanime)	59	67.92	82.65	10	16.95
6694.	Joey (coxoncable)	59	89.56	112.69	19	32.20
6695.	Connor Craig (conn_fused1)	59	86.36	102.10	13	22.03
6696.	Clint (clint_kun)	59	115.32	135.10	25	42.37
6697.	cheryl (cheryl08)	59	78.63	92.94	10	16.95
6698.	Kai (cheongengkai)	59	89.38	109.45	15	25.42
6699.	Charts (charizardpotato)	59	90.26	106.06	27	45.76
6700.	⭕⃤ (carmatain)	59	102.02	140.32	24	40.68
6701.	carl (captain_deadpooooool)	59	66.15	78.04	14	23.73
6702.	Viktor (c0re_dump)	59	66.11	84.70	14	23.73
6703.	Narut (blowingbubbles)	59	100.59	124.78	22	37.29
6704.	Joseph (bigboybo28)	59	76.04	93.30	21	35.59
6705.	Caleb (balecus53)	59	77.20	91.56	9	15.25
6706.	Ashray (ashraygupta1)	59	72.23	88.29	12	20.34
6707.	sussybaka (fknneeow)	58	85.88	104.85	14	24.14
6708.	EM_K (em_k)	58	83.98	100.82	18	31.03
6709.	Drew (drew1008)	58	70.11	84.39	18	31.03
6710.	Demtros (demtros)	58	91.87	115.63	25	43.10
6711.	relaxx (cloudkid)	58	98.70	121.45	21	36.21
6712.	Chino (chinotorres_142)	58	57.56	72.90	13	22.41
6713.	Marco (chino01)	58	74.77	90.11	11	18.97
6714.	Burning (burningyolo)	58	54.16	67.23	7	12.07
6715.	berk (birb_v2)	58	49.89	57.95	3	5.17
6716.	ㅤ (bazar397)	58	78.18	93.56	14	24.14
6717.	baekos (baekos)	58	57.96	73.40	9	15.52
6718.	athresh (athresh)	58	79.49	101.22	12	20.69
6719.	Ashen (ashencone)	58	62.84	74.01	10	17.24
6720.	Shahryar (_shahryar_pjr)	58	94.57	124.23	31	53.45
6721.	🏎️Ziad (ziad_hamdy)	58	54.82	73.70	4	6.90
6722.	Steven (xuqc01)	58	101.65	122.96	24	41.38
6723.	Wepeel (wepeel)	58	88.07	122.85	22	37.93
6724.	Adam (vincentadam)	58	70.91	82.22	13	22.41
6725.	Viki (vikiperle08)	58	65.11	88.92	15	25.86
6726.	pp (urppsmolhaha)	58	77.99	93.40	15	25.86
6727.	Bill (trainingb4tests)	58	96.88	127.99	22	37.93
6728.	purplefr|ction (tesla_diesel)	58	115.38	149.11	28	48.28
6729.	diko (sniperab3)	58	41.07	52.00	3	5.17
6730.	Sk1tt (sk1tt)	58	87.02	115.22	14	24.14
6731.	silver_hamburger (silver_ha...	58	33.25	44.48	6	10.34
6732.	Shoaib (shoaibesam)	58	55.78	76.97	2	3.45
6733.	For_real (mailindra)	58	84.63	106.18	18	31.03
6734.	QK Alice Duo (macz1991)	58	128.03	153.35	26	44.83
6735.	laljan (laljan)	58	57.92	68.66	10	17.24
6736.	Krowa (krowa)	58	82.26	100.05	17	29.31
6737.	Krunch (kommanderk)	58	61.81	75.27	9	15.52
6738.	kemiy (kemiy)	58	115.95	139.01	30	51.72
6739.	Karsen (karguy3)	58	79.41	98.34	19	32.76
6740.	Kanna (kannamanna)	58	78.76	96.45	16	27.59
6741.	Matthew (juanspoon)	58	110.65	135.70	39	67.24
6742.	Jeff (jeformica)	58	91.78	115.38	20	34.48
6743.	Wyatt (isometricman)	58	94.61	126.09	30	51.72
6744.	Ishaque (ishaque)	58	75.33	88.93	12	20.69
6745.	RedRashGrain (improvising_m...	58	86.98	101.13	19	32.76
6746.	Highfire1 (higfire1)	58	72.78	88.41	17	29.31
6747.	Tom (hes_the_fastest)	58	41.96	54.30	3	5.17
6748.	Dao (heavenrefining)	58	50.56	70.17	21	36.21
6749.	Glenn (glenn101107)	58	89.63	109.21	21	36.21
6750.	(scaphism)	58	130.32	166.57	39	67.24
6751.	Sahil (sahil21db)	58	87.01	106.76	10	17.24
6752.	ryo (ryolate)	58	85.87	101.85	19	32.76
6753.	(razor11223344)	58	87.78	100.28	23	39.66
6754.	tango (rangotango)	58	70.94	97.78	34	58.62
6755.	Rajesh (rajesh110494)	58	82.23	100.87	16	27.59
6756.	Damon (pvdorginal)	58	96.23	117.74	20	34.48
6757.	Sebastian (proudpole)	58	91.92	115.47	19	32.76
6758.	Professional (professional_...	58	76.44	95.55	16	27.59
6759.	WIZard (prasadbhoir6786)	58	76.02	111.14	13	22.41
6760.	Boog (pinchejoseph)	58	46.33	59.24	13	22.41
6761.	Pharrell (pharrell000000)	58	45.96	65.41	8	13.79
6762.	Ronnie (onie12)	58	98.89	134.91	23	39.66
6763.	Tyler (oktherefella)	58	105.98	131.93	29	50.00
6764.	Chih-hai (oceansfavor)	58	63.66	72.27	10	17.24
6765.	Nokzendi (nokzendi)	58	79.28	99.03	13	22.41
6766.	Deepanshu (namelesswonder)	58	53.83	69.93	6	10.34
6767.	zombo (midgetmigerian)	58	94.27	110.90	24	41.38
6768.	i have no (miamam)	58	96.68	132.73	20	34.48
6769.	Nathan (memewhat123)	58	62.69	77.17	7	12.07
6770.	ARA (araaraara2)	58	50.13	74.75	6	10.34
6771.	Mar (aqancake)	58	88.24	107.34	22	37.93
6772.	Alvise (anklud)	58	70.17	82.63	13	22.41
6773.	Dan Jeryll (almadendj)	58	119.68	133.30	32	55.17
6774.	Almas (almas016)	58	46.43	54.00	10	17.24
6775.	Akhil (akhil_kunadiya)	58	39.86	51.82	2	3.45
6776.	smuel (14adamssam)	58	70.32	83.66	13	22.41
6777.	Dr_Sagui (drsagui)	58	63.54	82.26	5	8.62
6778.	Lourens (lourens)	58	51.71	63.64	8	13.79
6779.	sweet (slowly_salty)	58	40.09	56.33	2	3.45
6780.	Zulfiqar (fiqar_29)	58	43.63	52.06	7	12.07
6781.	Zuel (zuel)	58	32.81	41.45	3	5.17
6782.	Anshu79 (anshu79)	57	62.05	79.78	15	26.32
6783.	and (andy_r8)	57	72.04	92.15	15	26.32
6784.	Ella (amhaissup)	57	91.96	113.44	18	31.58
6785.	Akuma (akumaayush)	57	60.24	73.22	4	7.02
6786.	S J (abhi_28)	57	71.58	92.30	20	35.09
6787.	Ziad (0ziadmohamed0)	57	71.25	82.89	16	28.07
6788.	pearce (09mantaray)	57	111.83	150.57	31	54.39
6789.	Charles (cwayne)	57	73.06	83.77	13	22.81
6790.	Andres (primedope27)	57	54.67	63.68	5	8.77
6791.	k. (luvmissjanet)	57	44.39	55.36	7	12.28
6792.	Matias (matias2030nuevo)	57	26.79	36.46	15	26.32
6793.	Michel (michelena)	57	66.54	85.50	13	22.81
6794.	dad (dadadu)	57	61.88	72.96	9	15.79
6795.	Neesh (neesh774)	57	101.32	127.80	50	87.72
6796.	Thomas (mrprgmr)	57	39.06	51.76	3	5.26
6797.	divya (divyaggle)	57	39.00	46.47	4	7.02
6798.	Im a (belowaveragegang_69)	57	53.81	89.44	13	22.81
6799.	A (lvorg)	57	72.13	88.19	17	29.82
6800.	luckylian123 (luckylian123)	57	71.20	94.04	18	31.58
6801.	Ali (lembugoreng)	57	91.91	111.30	15	26.32
6802.	krishan (krishan_pro)	57	60.72	76.63	14	24.56
6803.	Elvis (krewe11a)	57	148.59	166.93	0	0.00
6804.	Jacob (jakkbb)	57	80.38	94.07	32	56.14
6805.	jaeg3r (jaeg3r)	57	84.66	99.32	14	24.56
6806.	Jacob (jacobtolstrup)	57	51.37	64.43	5	8.77
6807.	jack (jack815)	57	98.48	125.58	25	43.86
6808.	Troy (ic3b3rg)	57	61.99	76.21	17	29.82
6809.	hbomb (hbomber)	57	64.28	84.49	25	43.86
6810.	Anthony (funger99)	57	85.82	101.31	10	17.54
6811.	F (frogliker)	57	72.98	85.65	11	19.30
6812.	Fan (firesale)	57	67.30	81.33	15	26.32
6813.	fesd (fesd20)	57	68.50	84.83	16	28.07
6814.	Eric (edestroyer2604)	57	66.98	77.31	14	24.56
6815.	Joe (dostojoe)	57	54.19	67.73	4	7.02
6816.	Mayank (divine_godspeed)	57	72.45	89.99	6	10.53
6817.	Ashvini (danger_anna)	57	49.76	66.80	11	19.30
6818.	Cristian (crism123dm)	57	59.58	78.16	9	15.79
6819.	Chinmay (chinmay26)	57	65.37	78.72	12	21.05
6820.	Bob (cakesenpie)	57	113.00	138.65	28	49.12
6821.	Jared (buckdancer)	57	96.47	115.20	21	36.84
6822.	Joey (bpextermin8)	57	95.44	117.10	24	42.11
6823.	Banzexxx (banzexxx)	57	73.32	83.01	12	21.05
6824.	Avery (ba0z1)	57	94.22	120.99	35	61.40
6825.	Travis (azgoalie)	57	66.10	88.17	13	22.81
6826.	avighna (avighna)	57	67.79	92.03	13	22.81
6827.	tstats[_skrt_skrt_] (_skrt_...	57	72.78	86.42	11	19.30
6828.	... (zviki)	57	68.52	80.82	17	29.82
6829.	zhen (zhen_pei)	57	87.34	118.40	16	28.07
6830.	Matthew (yourtrashkld)	57	90.15	106.15	20	35.09
6831.	Xray (xrayburst)	57	55.22	65.11	9	15.79
6832.	Wassim (wxssim)	57	67.36	91.45	19	33.33
6833.	wub (wub_wub)	57	95.11	117.60	26	45.61
6834.	ezza (winko_)	57	78.72	93.18	18	31.58
6835.	Ako ay (walangpera)	57	106.23	128.27	18	31.58
6836.	v (typer953)	57	81.01	109.00	19	33.33
6837.	Pratik (trippyhob)	57	97.17	116.47	25	43.86
6838.	Derp (thelol)	57	97.37	119.01	43	75.44
6839.	Taylor (taylorcuber717)	57	95.26	119.06	24	42.11
6840.	takenbyWine (takenbywine)	57	60.12	72.22	10	17.54
6841.	Shubham (shubham409)	57	29.33	40.73	8	14.04
6842.	Shiheng (sbiengo_sama)	57	72.51	86.59	21	36.84
6843.	Sarah (sarah_the_slow_typer)	57	53.34	67.58	7	12.28
6844.	sanayaa (sanayaa)	57	80.93	98.66	18	31.58
6845.	Rocco (roccoduck)	57	78.01	100.66	12	21.05
6846.	Rishi (rishipoonia)	57	36.93	53.78	6	10.53
6847.	de (paradoxpigeonlaptop)	57	147.99	193.51	35	61.40
6848.	Thomas (palsgod)	57	138.99	164.84	46	80.70
6849.	Pacu (pacutv)	57	91.64	109.85	11	19.30
6850.	Eddie (nightwing_eddie)	57	90.27	108.80	21	36.84
6851.	nicole (nicoleyee_)	57	57.40	69.86	13	22.81
6852.	Lemon (mrlemon)	57	73.30	104.64	13	22.81
6853.	NGONO (mnae)	57	40.43	57.79	2	3.51
6854.	Mark (markstone_141)	57	78.84	92.53	19	33.33
6855.	mamounitor (mamounitor)	57	55.79	85.75	11	19.30
6856.	rugbyBREAD (rugbybread4free)	56	93.59	111.03	24	42.86
6857.	Radek (radecekwriter)	56	85.35	99.32	18	32.14
6858.	Provocative (provocativepig...	56	90.19	112.10	20	35.71
6859.	Collins (princey)	56	55.88	66.59	7	12.50
6860.	Boeing (planetyper78)	56	100.02	117.84	25	44.64
6861.	Khastro (peterakd)	56	108.33	144.60	26	46.43
6862.	OvenHeat (ovenheat)	56	117.64	163.03	37	66.07
6863.	notoverhere (notoverhere)	56	66.11	85.42	12	21.43
6864.	Hamza (nerodine)	56	74.67	89.30	16	28.57
6865.	narze (narze)	56	86.80	123.42	15	26.79
6866.	Jay (myladyjay)	56	69.52	88.56	13	23.21
6867.	MoreZigLessZag (morezig)	56	62.86	78.11	14	25.00
6868.	Monjur 101 (monjur_ahmed)	56	33.76	41.70	5	8.93
6869.	mataio (mataioo)	56	41.61	51.48	8	14.29
6870.	James (frxction)	56	98.31	119.23	18	32.14
6871.	smolPixie (extraprincess)	56	86.03	105.21	18	32.14
6872.	Etienne (etienne_bepo)	56	93.17	111.64	3	5.36
6873.	Dave (davethreed)	56	56.11	68.03	5	8.93
6874.	Sid (cynocid)	56	93.82	117.15	21	37.50
6875.	Cylindian (cylindian)	56	104.53	123.73	21	37.50
6876.	Parth (cracker2111)	56	44.72	61.90	7	12.50
6877.	ch_tyt (ch_tyt)	56	72.86	90.96	13	23.21
6878.	chubbybala (chubbybala)	56	78.18	90.73	14	25.00
6879.	juggy (cannary)	56	46.10	61.48	6	10.71
6880.	brutalranked (brutalranked)	56	66.42	78.12	13	23.21
6881.	Jongchan (bot_chan)	56	75.94	95.03	9	16.07
6882.	Tawanda (bigx)	56	54.82	69.17	11	19.64
6883.	Benjamin (bigbentypes246)	56	75.61	90.98	15	26.79
6884.	besto (besto)	56	57.28	72.09	13	23.21
6885.	Ben (benjaminweschler)	56	80.46	107.50	18	32.14
6886.	Ahmed (beet790)	56	69.44	83.37	10	17.86
6887.	bananana (bana_na)	56	52.06	61.46	5	8.93
6888.	June (avvieey)	56	87.04	111.21	15	26.79
6889.	Holder (arcanezer0)	56	96.80	122.33	21	37.50
6890.	Andraž Gradišnik (andgrad)	56	102.96	123.32	25	44.64
6891.	ali (alifat)	56	50.00	58.55	5	8.93
6892.	Abhishek (abkrth)	56	78.14	93.47	15	26.79
6893.	abhi (abhi_sama)	56	77.02	96.89	18	32.14
6894.	0x045f (0x045f)	56	111.70	142.33	33	58.93
6895.	smooll (smoollbrain)	56	46.36	61.01	7	12.50
6896.	Ben (benjib)	56	78.45	98.02	17	30.36
6897.	ArcWand (arcwand)	56	79.86	101.98	13	23.21
6898.	tasnim (r4f1d)	56	37.28	51.86	6	10.71
6899.	tstats[kfinimizer] Kfinimiz...	56	49.11	68.18	6	10.71
6900.	rex (rex_k)	56	63.59	82.54	16	28.57
6901.	Gio (flordepapel)	56	88.65	108.21	16	28.57
6902.	Herman (monstrule)	56	61.70	73.40	11	19.64
6903.	G (igaurav)	56	35.04	49.02	7	12.50
6904.	sexy (sexykid)	56	48.69	60.44	7	12.50
6905.	Magnus (magnusfss)	56	54.48	64.49	11	19.64
6906.	Ludvig (luddez1)	56	93.04	113.82	23	41.07
6907.	✔️▄◘🚀!new_luca@y...	56	133.95	214.36	34	60.71
6908.	Santiago (londono19)	56	100.08	123.36	16	28.57
6909.	Alex (laralex)	56	85.10	100.32	21	37.50
6910.	Md Ibrahim Hossain (komlaka...	56	61.78	69.79	12	21.43
6911.	Hùng (kenkenkiota)	56	96.93	116.28	23	41.07
6912.	Andrea (kazari)	56	90.97	105.14	26	46.43
6913.	Kasiourasg (kasiourasg)	56	108.62	133.06	33	58.93
6914.	Kabadahija (kabadahija30)	56	59.63	72.51	3	5.36
6915.	Joey (jmschrum)	56	80.10	95.99	17	30.36
6916.	Jerichaux (jerichaux)	56	112.70	134.50	28	50.00
6917.	Ineluctable (ineluctable)	56	107.00	141.31	27	48.21
6918.	Hajun (improve_ever)	56	109.30	135.29	39	69.64
6919.	Ren Hariren (hari623)	56	105.94	123.27	36	64.29
6920.	KENNETH (happydino)	56	94.75	120.14	24	42.86
6921.	Atos (wolfcash)	56	87.05	100.56	15	26.79
6922.	Seri (vincent_aik)	56	93.17	109.08	22	39.29
6923.	Uxna (uxna)	56	103.73	127.16	26	46.43
6924.	Eric (unfazedglitch)	56	102.20	118.23	25	44.64
6925.	Vincent (turbovince)	56	63.76	73.14	14	25.00
6926.	Tobi_Uchiha_Rama (tobi_uchi...	56	45.98	55.22	9	16.07
6927.	sachin (timsixit)	56	54.87	71.89	9	16.07
6928.	TastyApple (tastyapple)	56	96.41	112.68	24	42.86
6929.	Svetoslav (svera)	56	54.33	64.66	6	10.71
6930.	stas (stasats)	56	32.77	42.49	0	0.00
6931.	Souhardya (souhardya98)	56	82.34	100.67	20	35.71
6932.	Jayden (slawsome)	56	56.45	67.73	2	3.57
6933.	Surya (shanky_111)	56	44.80	57.17	4	7.14
6934.	Ethen (__ethen_03)	55	72.51	89.58	11	20.00
6935.	Avi (_avi_)	55	96.38	112.36	20	36.36
6936.	Zahra (zahra_a)	55	50.60	62.20	14	25.45
6937.	Kaushik (yeswekey)	55	96.65	112.10	16	29.09
6938.	marsh (yepeyi)	55	131.86	155.37	34	61.82
6939.	Yaniv (yaniv691)	55	55.06	67.69	13	23.64
6940.	danny (xsoii)	55	57.54	71.43	8	14.55
6941.	Steven (xdstephano)	55	80.01	104.02	8	14.55
6942.	fck you latency (whihi)	55	127.31	145.90	29	52.73
6943.	VitaliK (vitalik_2961)	55	66.42	79.02	12	21.82
6944.	vexx32 (vexx32)	55	49.03	62.26	7	12.73
6945.	vayuputra (vayuputra)	55	50.60	67.75	9	16.36
6946.	Albert (tastiermite)	55	98.06	118.36	25	45.45
6947.	Phil (sticky1981)	55	69.27	83.62	17	30.91
6948.	Thomas (speedbro)	55	67.89	89.07	15	27.27
6949.	San (slowcatnospeed)	55	27.61	34.71	7	12.73
6950.	Shadow (shadow_devil)	55	61.76	81.37	9	16.36
6951.	St (amirey)	55	65.40	84.57	14	25.45
6952.	Alnebras04 (alnebras04)	55	63.95	91.13	9	16.36
6953.	Aljaz (aljazb)	55	62.04	75.25	12	21.82
6954.	Al-amin (alamin01)	55	34.25	41.20	4	7.27
6955.	Andy (akapgan)	55	75.24	94.72	15	27.27
6956.	nela camelia (agatha67)	55	43.95	57.62	5	9.09
6957.	Afraidofthebomb (afraidofth...	55	125.16	159.29	38	69.09
6958.	Adamite (adamite2k)	55	99.54	122.21	17	30.91
6959.	David (actavis666)	55	69.08	83.53	19	34.55
6960.	Asilbek (acilbek)	55	35.27	47.83	1	1.82
6961.	John Paul (gizoru)	55	52.60	64.27	9	16.36
6962.	Jez (jezmann)	55	49.85	65.77	9	16.36
6963.	Jojo (jojannes1)	55	66.29	85.55	9	16.36
6964.	tstats[david2444] (david2444)	55	76.24	90.75	13	23.64
6965.	choe (choechoichang)	55	88.00	106.92	22	40.00
6966.	Jai (jaipi)	55	40.78	57.98	6	10.91
6967.	Josh (hyper_amoeba)	55	66.47	82.30	24	43.64
6968.	Dylan (playboiidylan)	55	65.49	81.23	10	18.18
6969.	Lucy (ldarwish)	55	63.21	78.96	11	20.00
6970.	Jacob (jacob_legere)	55	80.99	96.74	16	29.09
6971.	Jupiter (content_jupiter1)	55	44.55	55.90	3	5.45
6972.	Ken (kunai502)	55	127.50	149.49	37	67.27
6973.	Badi (badi159)	55	71.55	86.98	14	25.45
6974.	Tengis (tengis)	55	48.47	59.52	1	1.82
6975.	hooj (hoojamaphut)	55	79.78	109.26	19	34.55
6976.	Gab (harold156)	55	50.93	63.70	5	9.09
6977.	Jack (jackneall)	55	41.29	51.12	5	9.09
6978.	kapforty (kapforty)	55	96.96	125.37	17	30.91
6979.	Sambhalang (samkchandy)	55	81.47	101.62	19	34.55
6980.	Robert (rzyao)	55	85.58	108.27	16	29.09
6981.	Russ (russcoder)	55	88.14	115.91	20	36.36
6982.	Ravindu (ravindu08)	55	62.38	75.68	11	20.00
6983.	Jack (randomdize)	55	71.50	103.47	13	23.64
6984.	Raging (ragingthunder)	55	89.65	107.19	21	38.18
6985.	Xavier (qiltz)	55	70.84	86.25	15	27.27
6986.	pingukalinu (pingukalinu)	55	55.76	70.78	4	7.27
6987.	Nikolay (niki12120)	55	48.20	61.14	26	47.27
6988.	Ying-Chen (nash_equilibrium)	55	54.16	64.73	6	10.91
6989.	Nabiha (nabiha_fatima01)	55	34.76	40.98	2	3.64
6990.	mellismacka (mellismacka)	55	91.21	108.15	21	38.18
6991.	McKle (mckle7)	55	85.17	101.79	14	25.45
6992.	Matt (mattmen)	55	46.87	68.13	3	5.45
6993.	Dalia (flowhy_)	55	76.42	93.03	17	30.91
6994.	Halo (fishmona)	55	57.50	74.46	8	14.55
6995.	Fireworks (fireworkkss)	55	96.25	111.19	22	40.00
6996.	Ficfiris (ficfiris)	55	62.38	72.94	10	18.18
6997.	Cobra (devanshj)	55	83.63	98.97	16	29.09
6998.	derfet (derfet)	55	53.31	66.08	6	10.91
6999.	David (davidcaron)	55	70.62	90.20	15	27.27
7000.	danydoo (danydoo)	55	68.36	79.40	14	25.45
7001.	Daisy (daisy_sun)	55	66.42	84.75	14	25.45
7002.	cool_whip (cool_whip)	55	88.91	106.04	12	21.82
7003.	Joe (cobiejoe96)	55	86.12	102.87	14	25.45
7004.	Ollie (cheerfulnihilist)	55	83.82	108.08	16	29.09
7005.	charlene (charlenemiao)	55	59.30	72.28	7	12.73
7006.	Krishna (chaithu97)	55	65.00	76.19	18	32.73
7007.	carina (carina_caily)	55	47.03	77.47	17	30.91
7008.	mike (brons48)	55	85.41	125.15	19	34.55
7009.	Brandon (brandonzfu)	55	93.43	125.23	22	40.00
7010.	Pin (bleeep)	55	70.45	82.28	16	29.09
7011.	Adrian (bigbadbui)	55	91.34	119.68	18	32.73
7012.	Barry (barry21)	55	75.61	90.86	9	16.36
7013.	Azaro (azaroarazenka)	55	124.86	157.57	45	81.82
7014.	YLime (lacua)	55	67.17	78.65	10	18.18
7015.	Konrad (konradgoldammer)	55	83.78	100.95	16	29.09
7016.	Victor (kizamui)	55	76.52	94.02	15	27.27
7017.	Kirby (kirbyjs)	55	65.89	84.06	12	21.82
7018.	fast af (josh53___)	55	94.10	112.89	23	41.82
7019.	Joseph (josefmcbrosef)	55	83.68	112.11	21	38.18
7020.	joseph (jmuganga544)	55	57.88	73.97	11	20.00
7021.	Jasur (jasurava)	55	30.89	44.81	9	16.36
7022.	Jaskirat (jaskiratsingh)	55	99.65	128.48	26	47.27
7023.	Jack (jack90001)	55	115.33	139.33	28	50.91
7024.	Pakko (iam_mzaa)	55	65.96	82.37	14	25.45
7025.	Donald (hotdognalds)	55	110.66	151.30	30	54.55
7026.	Jun Jie (lemontea387)	54	100.60	124.17	22	40.74
7027.	😳😳😳 (lanterex)	54	97.00	110.60	23	42.59
7028.	Made In (kosowarner)	54	112.42	133.99	47	87.04
7029.	toki (kizunajemini2205)	54	99.09	129.14	26	48.15
7030.	Teeratat (kiwi2002)	54	79.07	96.85	12	22.22
7031.	Alex (khanis1)	54	85.96	102.06	15	27.78
7032.	Keegan (keegan9503)	54	70.68	87.83	14	25.93
7033.	Basil (kaneki_k3n)	54	92.71	114.19	16	29.63
7034.	Joshua (joshuawn)	54	151.28	180.63	43	79.63
7035.	Jazz (jazzfunk37)	54	79.71	95.65	18	33.33
7036.	Jp (j12p21)	54	88.64	110.42	11	20.37
7037.	Ben (izeben)	54	100.78	122.07	17	31.48
7038.	ibean (ibean)	54	69.15	81.27	15	27.78
7039.	hulkari (hulkari)	54	64.13	76.81	16	29.63
7040.	BreadForAll (hollowshadow)	54	103.87	126.93	20	37.04
7041.	𒅃 (hdgamez)	54	112.64	134.23	30	55.56
7042.	Harjot (harjot_singh)	54	74.37	90.06	13	24.07
7043.	Colemak (half_as_fizzy)	54	85.68	105.61	18	33.33
7044.	Phil (gunner_shents)	54	35.39	41.95	3	5.56
7045.	Boris (goat_56)	54	127.92	199.81	33	61.11
7046.	Gazeekoo (gazeekoo)	54	65.59	78.26	12	22.22
7047.	Reuben (reubensong)	54	97.82	136.15	26	48.15
7048.	Raghavan G V (raghavangv)	54	74.83	96.79	15	27.78
7049.	Pszymek (pszym)	54	77.54	109.82	16	29.63
7050.	prince (prince_singh)	54	36.66	44.69	6	11.11
7051.	James Wolfe (primalnacl)	54	80.03	99.85	20	37.04
7052.	pranked (pranker666)	54	84.12	102.91	18	33.33
7053.	Cihsa (oddlysatisfly)	54	96.79	115.65	20	37.04
7054.	Dennis (ocrayat16)	54	72.07	91.36	12	22.22
7055.	Nicholas (nsabadicci)	54	91.68	117.88	17	31.48
7056.	Slava (not_okay)	54	74.75	83.76	9	16.67
7057.	daniel (notorious13366)	54	33.76	47.73	11	20.37
7058.	Kevin (noimkevin)	54	120.65	137.04	31	57.41
7059.	Chad (nicwin)	54	112.10	139.29	26	48.15
7060.	Nicholas (nicszerman)	54	82.12	100.65	19	35.19
7061.	nguyen (nguyenanh2004)	54	61.02	75.38	9	16.67
7062.	Yasir (nay_yar110)	54	56.25	79.15	5	9.26
7063.	Nate (nateog)	54	103.97	134.72	23	42.59
7064.	Muaj17 (muaj17)	54	88.04	110.32	36	66.67
7065.	molnar (molnaredom)	54	38.99	47.17	7	12.96
7066.	chapo (mnxchapo)	54	97.94	120.79	16	29.63
7067.	Maynard (mftrumpet)	54	104.36	133.63	27	50.00
7068.	Master (masterdvorak)	54	82.86	98.28	12	22.22
7069.	Simmons1 (_simmons)	54	71.89	88.11	16	29.63
7070.	Wujue (wujue)	54	59.59	68.26	12	22.22
7071.	SHIVA (vishu_01)	54	67.43	87.77	17	31.48
7072.	Dmitrii (typescore)	54	44.89	59.06	12	22.22
7073.	Talby (talby)	54	110.80	143.36	26	48.15
7074.	Sujeev (sujeev)	54	53.66	70.40	7	12.96
7075.	sturge (sturgee)	54	72.45	105.79	14	25.93
7076.	GoSTUDY (sticknleaf)	54	105.34	129.21	28	51.85
7077.	Stanley (stanleyzhang9)	54	111.58	135.86	33	61.11
7078.	tstats[ssohrab] (ssohrab)	54	97.75	129.86	15	27.78
7079.	e-mili (speedy_007)	54	91.71	117.01	15	27.78
7080.	erty (someone8888)	54	107.72	139.67	29	53.70
7081.	slayerofthend (slayerofthend)	54	112.72	144.10	35	64.81
7082.	Shishcobober (shishcobober2)	54	81.38	98.73	12	22.22
7083.	Rommel (seekercuriousityxx)	54	49.72	68.76	7	12.96
7084.	Joel (seasmoke)	54	73.10	90.04	11	20.37
7085.	Ava (argerami)	54	63.35	81.39	17	31.48
7086.	V (alfredpennywrth)	54	97.88	113.98	19	35.19
7087.	Alfie (alfie_op)	54	55.78	68.77	12	22.22
7088.	Round (aboutaroundabout)	54	104.67	124.39	26	48.15
7089.	Aaron (aarone123)	54	87.93	101.01	16	29.63
7090.	Aadarsh (aadarshmani)	54	59.74	71.17	8	14.81
7091.	Ravi (131raviarya)	54	78.88	91.44	11	20.37
7092.	Omar (atrozyte)	54	78.68	99.74	21	38.89
7093.	Alexander (ysgatora)	54	66.04	84.95	13	24.07
7094.	Minh (nhminh)	54	87.36	110.09	21	38.89
7095.	Ayush (tueely)	54	90.22	113.36	21	38.89
7096.	omar shereef (omar_shereef)	54	54.33	64.48	7	12.96
7097.	bluesight (maveblue)	54	54.48	66.21	4	7.41
7098.	Rohit (toba89)	54	50.77	61.47	2	3.70
7099.	Whil (whil)	54	91.72	111.55	21	38.89
7100.	MasterToru (mastertoru)	54	85.83	104.24	13	24.07
7101.	tokisuno (tokisuno)	54	103.19	127.93	29	53.70
7102.	Amare (endmaster64)	54	60.53	75.57	53	98.15
7103.	Emma (embunde7)	54	92.40	122.10	34	62.96
7104.	Ducu (ducu)	54	59.89	67.96	10	18.52
7105.	Douglas (douglaswaugh)	54	66.47	78.71	11	20.37
7106.	Timothy (dilexed)	54	51.00	66.76	7	12.96
7107.	David (davidthegreat)	54	65.99	86.81	16	29.63
7108.	A (dasupakiwi)	54	65.99	83.81	13	24.07
7109.	Scott (chivalrousbanana)	54	45.44	57.59	4	7.41
7110.	bruh (bruhmoment8964)	54	152.60	172.84	47	87.04
7111.	Armisael (brandonbro)	54	76.43	101.40	19	35.19
7112.	Bone (bonepriest)	54	83.81	119.60	16	29.63
7113.	2XKO WAITING ROOM (bloodyra...	54	100.88	125.12	15	27.78
7114.	Bleachinq (bleachinq)	54	85.32	103.50	12	22.22
7115.	Amarpreet (bhangu_05)	54	55.81	68.43	4	7.41
7116.	Biohazard (b10hazard_)	54	86.54	106.23	7	12.96
7117.	Krishna (aurum_est_potestas)	54	71.31	86.05	15	27.78
7118.	Arman (arminhammer)	54	50.91	66.58	4	7.41
7119.	fml (fmldave89)	53	77.35	111.42	13	24.53
7120.	TK (filfirst)	53	86.42	100.81	17	32.08
7121.	Ferricks (ferri_ks)	53	58.55	75.31	11	20.75
7122.	Fedwig (fedwig)	53	102.34	125.93	23	43.40
7123.	Ethan (ethanos42)	53	73.85	98.37	23	43.40
7124.	ed81 (ed81)	53	46.84	55.30	6	11.32
7125.	Dungus (duungus)	53	79.11	110.87	14	26.42
7126.	lelle (davinkyy)	53	64.01	79.83	12	22.64
7127.	Danny (danyeeast)	53	73.36	92.36	13	24.53
7128.	winter (cora_)	53	92.33	112.27	22	41.51
7129.	Deez (coolio458)	53	78.15	95.69	12	22.64
7130.	ChurM8 (churm8)	53	92.77	125.59	38	71.70
7131.	Mauro (chunkerchunk)	53	136.58	156.01	36	67.92
7132.	ben (chompytheturtle)	53	115.27	141.68	37	69.81
7133.	Chinmay (chinmays1999)	53	69.40	78.54	15	28.30
7134.	Gabriel (cashewsoda)	53	92.71	109.24	18	33.96
7135.	bueno (bueno94)	53	64.75	79.33	15	28.30
7136.	ZXCRYO (btscarbon)	53	49.79	63.50	8	15.09
7137.	Blue (blue_cow)	53	41.66	60.57	11	20.75
7138.	beek (beekul)	53	60.43	77.01	8	15.09
7139.	Bee (beejbeeabeey)	53	102.34	124.50	16	30.19
7140.	Azhar (azharbhat)	53	67.76	85.16	10	18.87
7141.	Atreides (atreidaus)	53	76.23	92.57	13	24.53
7142.	Alessandro (asterlr)	53	105.06	130.77	13	24.53
7143.	Aruzhan (arrrujjka)	53	37.20	45.69	5	9.43
7144.	Andrew (zengwendian)	53	106.39	120.56	24	45.28
7145.	Yuval (yuvalalfa)	53	98.69	129.63	23	43.40
7146.	:) (yuuuhhh)	53	88.88	110.23	18	33.96
7147.	yazan (yazan_2000)	53	33.67	45.48	3	5.66
7148.	Wwuly (wwuly)	53	51.89	74.07	5	9.43
7149.	wond (wond_k_)	53	77.53	91.39	15	28.30
7150.	Jimmy (user39_on_dvorak)	53	81.67	99.58	10	18.87
7151.	Harald (updatin)	53	81.59	90.47	13	24.53
7152.	Alexander (typelanterne)	53	115.05	134.66	21	39.62
7153.	Max (triangl12)	53	107.78	132.10	24	45.28
7154.	tania (tlee120)	53	111.12	123.95	22	41.51
7155.	Chadwick (supasurreal)	53	48.21	61.87	6	11.32
7156.	sir (sirflu)	53	48.68	59.24	6	11.32
7157.	Faris (silverskied)	53	73.82	88.52	10	18.87
7158.	LuminousEgg (luminousegg)	53	77.81	99.56	15	28.30
7159.	Link (link_hyrule)	53	111.91	140.37	30	56.60
7160.	Mikhail (limedimenine)	53	95.04	115.51	18	33.96
7161.	k (kperez755)	53	86.84	116.22	19	35.85
7162.	Gabby (kirbykirbykirby)	53	79.84	94.44	10	18.87
7163.	Kash79 (kashyap79)	53	78.74	87.71	14	26.42
7164.	Carlos (karldan)	53	56.92	69.23	7	13.21
7165.	M (kapsa)	53	75.00	87.15	11	20.75
7166.	Joy (joyjumper11)	53	92.32	115.39	23	43.40
7167.	tstats[jason823] Jason (jas...	53	84.59	110.92	17	32.08
7168.	Unigen (id3n)	53	111.73	133.11	30	56.60
7169.	Ryan (hougs)	53	60.93	76.34	9	16.98
7170.	HawkEye (hawk_eye)	53	79.20	104.88	12	22.64
7171.	Rowel Abrasado (hallelujahptl)	53	46.60	61.52	7	13.21
7172.	GreenUmbrella (greenumbrella)	53	77.58	94.99	16	30.19
7173.	Fusionbolt (fusionbolt)	53	79.14	102.79	21	39.62
7174.	Syimyk (sam_j5)	53	59.66	72.04	11	20.75
7175.	Rikey (reycon)	53	49.41	68.63	6	11.32
7176.	rdnblg (rdnblg2)	53	56.99	69.65	14	26.42
7177.	rap (raprics8)	53	50.70	64.69	4	7.55
7178.	Rafiul (rafiul41)	53	81.49	98.57	14	26.42
7179.	Dan (radio_falcon)	53	105.77	128.97	24	45.28
7180.	Matt (piza01134)	53	81.96	104.04	13	24.53
7181.	AP (phea0001)	53	62.04	75.37	10	18.87
7182.	Hugo (paulz_420)	53	52.82	71.52	10	18.87
7183.	Chirpy (pandress)	53	102.12	128.83	25	47.17
7184.	cheems (pachaczb_dvorak)	53	66.09	78.30	11	20.75
7185.	Mahmoud (opssheesh)	53	85.54	110.30	11	20.75
7186.	Ollie (ogreig)	53	73.14	94.76	26	49.06
7187.	huh (noirblnqqq)	53	81.51	100.22	18	33.96
7188.	Nabil (nabil_lam)	53	47.79	70.11	4	7.55
7189.	Matthew (mmongillo)	53	63.08	74.16	12	22.64
7190.	mira (mlp1214)	53	55.87	70.34	9	16.98
7191.	William (michaelp_2222)	53	104.34	129.28	29	54.72
7192.	Lets Gooooo!!! (mattymooo2021)	53	47.95	61.64	6	11.32
7193.	mangkaw (mangkaw)	53	80.82	98.48	15	28.30
7194.	NoobMaster (anakwibu04)	53	105.66	121.57	36	67.92
7195.	cal (achildslaughter)	53	103.93	127.60	20	37.74
7196.	Rohan (rohanvit)	53	52.11	67.91	6	11.32
7197.	zeyad (zeyad_yasser)	53	27.69	35.61	13	24.53
7198.	Elizabeth (elizabethjulia)	53	44.25	61.65	5	9.43
7199.	Anjali (lily2001)	53	63.10	79.69	20	37.74
7200.	jen (jccen)	53	42.46	52.57	11	20.75
7201.	Nick (gelatinpizza)	53	87.65	111.85	14	26.42
7202.	Yash (yash_1234)	53	81.67	100.09	12	22.64
7203.	Yashwanth (kakashiyash)	53	65.00	80.66	9	16.98
7204.	Brandon (brandowompus)	53	83.37	103.44	12	22.64
7205.	Blacknight6900 (blacknight6...	53	70.15	87.19	27	50.94
7206.	Generals (gwapoko12312323321)	53	64.33	83.54	11	20.75
7207.	Ankit (ankit_chauhan)	52	69.04	86.35	15	28.85
7208.	ali-goes (alibookie)	52	85.91	117.12	15	28.85
7209.	Neanderthal (alacrity95)	52	127.41	170.60	27	51.92
7210.	abindev (abindev)	52	31.78	41.86	7	13.46
7211.	Julia (348753021)	52	117.41	139.09	33	63.46
7212.	Kevin (kevin41714)	52	78.99	93.10	12	23.08
7213.	Josh (fearzenemy)	52	56.24	74.16	8	15.38
7214.	Gary (yrag)	52	69.01	88.79	15	28.85
7215.	Pourya (orangefourinchdoorh...	52	45.29	55.91	6	11.54
7216.	Alexander (aexae)	52	51.45	79.58	5	9.62
7217.	GoD (1_god_1)	52	61.68	74.42	4	7.69
7218.	Duc (maitheduc2002)	52	38.86	46.84	4	7.69
7219.	Ma (mahyunyi)	52	72.39	92.00	12	23.08
7220.	Onii-Chan (lowtall2006)	52	98.45	116.52	22	42.31
7221.	loungecore (loungecore)	52	98.76	116.52	21	40.38
7222.	lior (liorlubek)	52	58.84	78.33	10	19.23
7223.	LemonCatTAT (kiddie_sallie)	52	95.14	112.34	16	30.77
7224.	Kermilian Nguyen (kermilian...	52	59.22	75.08	10	19.23
7225.	Sadi (kandeemusic)	52	83.08	103.97	21	40.38
7226.	Suntery (jennk1)	52	59.26	71.39	9	17.31
7227.	Henrik (iupgrade)	52	95.94	116.15	22	42.31
7228.	Icchan (icchan84)	52	73.61	92.15	13	25.00
7229.	mr.hogsman (hogsman)	52	95.88	126.36	23	44.23
7230.	Henrique (henri3287)	52	45.84	56.94	3	5.77
7231.	Greg (gregdahwhale)	52	86.42	108.14	13	25.00
7232.	God (godlevel)	52	85.32	102.04	43	82.69
7233.	Elliot (girtholomew)	52	69.16	78.80	10	19.23
7234.	Fionalee (fionalee)	52	90.94	107.70	16	30.77
7235.	Tony (feetiswhynocaps)	52	90.09	112.37	19	36.54
7236.	lillian (fartgaret)	52	80.35	127.53	20	38.46
7237.	Eujean (eujean)	52	103.06	119.70	26	50.00
7238.	george (doctoras)	52	98.31	121.16	26	50.00
7239.	Delphie (delphie_)	52	106.44	127.60	27	51.92
7240.	nhim (chikiro)	52	62.88	83.20	7	13.46
7241.	max (chaxmase)	52	78.13	97.32	15	28.85
7242.	Ivan (breadguru)	52	51.62	61.47	7	13.46
7243.	Minh (blue002)	52	53.51	60.69	9	17.31
7244.	blendin (blendin11)	52	90.65	109.48	12	23.08
7245.	Batian (batiti51)	52	67.69	81.84	10	19.23
7246.	BARAA (barrettshot)	52	97.50	113.90	16	30.77
7247.	Ayokk (ayokk)	52	83.10	110.76	10	19.23
7248.	Jongwon (aviationchief)	52	90.67	121.04	45	86.54
7249.	ashalisalamdanam (ashalisal...	52	84.76	96.24	16	30.77
7250.	tyenavatyen (zombiewgoku77)	52	118.05	148.84	31	59.62
7251.	Zelalem (zolamk)	52	71.19	85.24	44	84.62
7252.	Matthew (zannon23)	52	90.32	108.55	14	26.92
7253.	Yutio (yutio)	52	48.88	58.20	3	5.77
7254.	vega (xxav)	52	75.12	94.39	11	21.15
7255.	Ivan (xaboff)	52	51.03	66.11	8	15.38
7256.	Mawon (wonlee)	52	90.76	109.45	19	36.54
7257.	▬|═══ﺤ (vikas112)	52	56.40	69.92	4	7.69
7258.	TOH (tohjh)	52	79.16	88.53	22	42.31
7259.	twitter.com/jidoreuu (tfuef...	52	124.15	149.30	34	65.38
7260.	TcJon (tcjon)	52	49.52	66.33	5	9.62
7261.	Nicholas (t0903591)	52	82.99	98.44	10	19.23
7262.	Sid (sxd_ss)	52	70.14	88.88	13	25.00
7263.	a (stanrude)	52	68.41	82.05	11	21.15
7264.	sfairat (sfairat)	52	55.24	63.56	6	11.54
7265.	shashi (sekhar184131)	52	81.38	98.42	13	25.00
7266.	Scar (scarskald)	52	66.64	88.05	15	28.85
7267.	Saurabh (saurabh002)	52	61.74	68.98	12	23.08
7268.	Corentin (risemu)	52	80.36	96.49	9	17.31
7269.	ダル (rex_rex)	52	75.80	102.57	15	28.85
7270.	John McCarthy (providerone)	52	102.83	118.87	25	48.08
7271.	PickleCork (proogle_can)	52	81.82	96.34	16	30.77
7272.	PracticeTouch (practicingto...	52	48.31	61.34	2	3.85
7273.	J (petalss)	52	67.98	84.54	11	21.15
7274.	pathhologic (pathhologic)	52	101.27	141.13	23	44.23
7275.	Parsa (parsasq)	52	55.49	70.14	9	17.31
7276.	atoms (overblown)	52	67.41	81.64	27	51.92
7277.	nope251 (nope251)	52	60.36	72.92	5	9.62
7278.	Ian (nelson_kempkey)	52	106.04	133.29	17	32.69
7279.	Morgan (morgbot)	52	109.06	139.30	26	50.00
7280.	Morgan (morgansoares6)	52	70.41	93.60	9	17.31
7281.	Morad (morad_the_beast)	52	70.52	80.61	11	21.15
7282.	Ben (meh_guy)	52	109.51	128.84	34	65.38
7283.	Chikin (sailestial)	51	92.33	115.78	18	35.29
7284.	Safi (safiikram)	51	44.56	55.00	5	9.80
7285.	beans (rlbeans)	51	86.22	106.81	19	37.25
7286.	Raghav (raghavlaad)	51	70.77	91.80	13	25.49
7287.	Pro (progeorge123)	51	100.13	131.70	24	47.06
7288.	PoopBug (poop_bug)	51	93.80	110.58	19	37.25
7289.	Phoenix (phoenixwolfer)	51	103.30	132.55	26	50.98
7290.	slug speed account (pasta2)	51	135.47	167.58	21	41.18
7291.	pepperooni (papipepperooni)	51	84.85	100.56	22	43.14
7292.	peckcs (opecks)	51	82.67	99.03	19	37.25
7293.	nehal (nehal1337)	51	115.13	134.72	28	54.90
7294.	Joshua (mrteeentee)	51	111.15	137.62	23	45.10
7295.	Mr. (mrasp)	51	61.74	78.31	13	25.49
7296.	anya (monarchunder)	51	95.90	124.26	29	56.86
7297.	Tenebrific (molkri)	51	92.55	107.25	17	33.33
7298.	Peetor (milleniumpoo)	51	86.04	114.36	13	25.49
7299.	Paolo (mcnugget25)	51	117.05	137.82	32	62.75
7300.	Max (maxma_69)	51	109.26	139.68	32	62.75
7301.	matan (matanselig)	51	27.31	34.56	6	11.76
7302.	Marwoleath (marwoleath)	51	76.49	90.97	7	13.73
7303.	OmaR (mandoo120)	51	51.77	63.83	7	13.73
7304.	Jako (frafdothehero)	51	76.89	93.34	10	19.61
7305.	Fametime (fametime)	51	126.59	166.10	34	66.67
7306.	Elie (eliepr0)	51	117.57	142.10	24	47.06
7307.	Doge (dopeydoge)	51	79.99	104.19	15	29.41
7308.	Daniel (dna89)	51	70.14	85.58	14	27.45
7309.	Tristan (devyl)	51	83.12	95.54	13	25.49
7310.	epic (densehelium)	51	72.33	84.11	16	31.37
7311.	Akhil (deathstroke99)	51	64.01	75.90	9	17.65
7312.	Dagger (daggerbxii)	51	66.80	86.83	12	23.53
7313.	Radius (d4iry)	51	131.99	172.61	35	68.63
7314.	criasier (criasier)	51	113.97	138.02	31	60.78
7315.	Jason (cookja2000)	51	86.95	109.56	11	21.57
7316.	Brandon (boredintern123)	51	127.60	151.95	40	78.43
7317.	Blake (blaketrombone)	51	84.26	108.56	19	37.25
7318.	bioboy246 (bioboy246)	51	105.35	131.73	23	45.10
7319.	Bekzodbek (bekzod003)	51	44.17	63.11	12	23.53
7320.	owen (beemochop)	51	67.98	83.75	6	11.76
7321.	Badal Babu (bcube_nimble)	51	93.90	106.78	19	37.25
7322.	leon (bangingmyheadonthewall)	51	62.65	83.51	8	15.69
7323.	heck (aw_heck)	51	38.89	53.45	6	11.76
7324.	Ava (ava_gina)	51	60.38	69.62	4	7.84
7325.	I want your things in my ro...	51	119.74	138.91	29	56.86
7326.	Alex (alex_mingguk)	51	73.27	95.76	13	25.49
7327.	aleph (alephyphen)	51	106.87	129.77	21	41.18
7328.	ahmed (ahmedmadgy711)	51	61.45	77.19	15	29.41
7329.	Adam (adumbsun)	51	101.63	134.43	23	45.10
7330.	adrianna (adriannna)	51	84.06	115.52	8	15.69
7331.	Abu Shaikh (abu_nibir)	51	67.46	78.11	11	21.57
7332.	Albert (abt8601)	51	96.62	113.54	23	45.10
7333.	𝔽₃₁ (2802)	51	104.78	124.05	30	58.82
7334.	Steve (lehoangkhang9)	51	76.22	89.88	15	29.41
7335.	Michaiah (pig101)	51	62.93	76.66	13	25.49
7336.	Jai (jaijoshi)	51	59.39	73.56	5	9.80
7337.	IdkFreaky (fs_frenchfries77)	51	66.55	76.20	11	21.57
7338.	Minate (minate)	51	53.24	64.44	4	7.84
7339.	Zi Liang (pohziliang)	51	57.97	71.58	11	21.57
7340.	Timo (vryzin)	51	48.72	63.36	5	9.80
7341.	Alyssa (agraha91)	51	64.83	76.84	15	29.41
7342.	Airwide (airwide)	51	40.16	47.01	7	13.73
7343.	Lorenz David (lupusregina)	51	83.82	105.50	14	27.45
7344.	Eric (mainsterr)	51	73.60	99.37	30	58.82
7345.	andrea (lotta98)	51	64.73	78.07	10	19.61
7346.	Kush (kushtek)	51	44.37	64.78	11	21.57
7347.	Kunal (kunal299)	51	76.08	94.11	15	29.41
7348.	Filip (keyboardwarrior772)	51	97.87	133.91	18	35.29
7349.	Jimmy (jx297)	51	103.59	117.21	24	47.06
7350.	Julian (julianalex2307)	51	92.63	129.17	21	41.18
7351.	JuanimelsPH (juanimels)	51	85.92	103.86	9	17.65
7352.	James (jpnjpn6)	51	87.48	109.54	22	43.14
7353.	Jeff (jooffy)	51	61.42	79.18	9	17.65
7354.	Melchorio (jcquints)	51	95.47	113.62	18	35.29
7355.	jamilxt (jamilxt)	51	60.96	73.84	14	27.45
7356.	Jamie (jamiegre)	51	114.59	141.98	25	49.02
7357.	Isak (isapan)	51	92.82	110.48	18	35.29
7358.	The Russian (imdarussian)	51	74.72	89.34	14	27.45
7359.	Jack (hyydenjakcz)	51	80.51	99.72	12	23.53
7360.	ばにらー　tired goodby...	51	123.37	177.82	21	41.18
7361.	Hitendra (hitendra)	51	72.68	96.01	37	72.55
7362.	zhz (haohauz)	51	126.73	156.22	35	68.63
7363.	shmoney (gupty_gang)	51	73.37	87.11	13	25.49
7364.	nanashi (greenjohnny135)	51	76.69	101.72	9	17.65
7365.	Darkhan (zhora577)	51	44.09	68.11	3	5.88
7366.	Delbert (zeckxel)	51	71.71	83.87	15	29.41
7367.	Yami (yamiph)	51	108.10	145.23	33	64.71
7368.	Ryan (xxhiny)	51	110.05	125.01	25	49.02
7369.	Jaris (xersai)	51	98.43	123.69	21	41.18
7370.	asphyxia (wylx)	51	65.44	93.04	12	23.53
7371.	William (wwuhoo)	51	75.85	94.00	14	27.45
7372.	Vyc (vyctor661)	51	93.70	115.49	17	33.33
7373.	Isaak (verysexyman)	51	51.21	66.12	5	9.80
7374.	Ernesto (venkinta)	51	86.14	103.46	21	41.18
7375.	Asto (ukikunz)	51	113.19	139.74	26	50.98
7376.	Teun (typingthunder)	51	48.63	57.89	2	3.92
7377.	consistently inconsistent (...	51	91.54	124.48	18	35.29
7378.	Kinst (swiftens)	51	89.68	110.73	16	31.37
7379.	Stevie (stevie_thee_shep)	51	99.82	130.06	24	47.06
7380.	Chaerity (ssamurai)	51	88.36	101.99	14	27.45
7381.	Vela (somkungza)	51	78.52	99.25	15	29.41
7382.	sofa (sofaaa)	51	98.39	129.19	15	29.41
7383.	Chad (sixpacksexy)	51	100.92	119.79	16	31.37
7384.	mosho (sidosido)	51	85.39	102.59	12	23.53
7385.	Shin (shinfx)	51	87.44	106.58	20	39.22
7386.	Shayan (shanoo92)	51	63.38	83.59	26	50.98
7387.	Zayden (zayden_blaze)	50	91.27	121.91	18	36.00
7388.	zeroguard (z3r0gu4rd)	50	46.83	55.81	7	14.00
7389.	Yung (yungmyg)	50	39.36	48.94	4	8.00
7390.	Mandom (xristos980)	50	69.15	80.17	10	20.00
7391.	ℱ𝔯𝔢𝔢𝔡𝔬𝔪...	50	83.93	102.78	13	26.00
7392.	root (wanna_be_pro)	50	51.34	63.61	3	6.00
7393.	Tempest (tempestreu)	50	58.07	71.47	10	20.00
7394.	Harri (teddybaker)	50	53.22	63.67	7	14.00
7395.	Tadas (tadasmak)	50	76.89	91.00	10	20.00
7396.	Sylptic (sylptic)	50	98.74	118.60	19	38.00
7397.	صنديد (sundid)	50	91.81	114.46	14	28.00
7398.	DK ALONE (speed_typing)	50	47.49	62.38	4	8.00
7399.	¯\_(ツ)_/¯ (some_guy4444)	50	91.21	110.26	16	32.00
7400.	Tommy (snoopyisop)	50	105.03	148.25	21	42.00
7401.	slower than s2000 (slowpacito)	50	140.91	173.35	40	80.00
7402.	simon (simonhor1)	50	91.04	118.59	16	32.00
7403.	Shreyas (shreyas_jani)	50	74.38	93.45	15	30.00
7404.	deceptive (sergisreal)	50	93.92	109.54	16	32.00
7405.	ks (sempiedram)	50	87.85	108.68	11	22.00
7406.	arimauta (arimauta)	50	43.28	56.71	1	2.00
7407.	Afaq (afaqkhan)	50	85.17	103.64	14	28.00
7408.	:] (acision)	50	78.38	93.71	15	30.00
7409.	2Slow (2slowkevin)	50	38.96	48.24	5	10.00
7410.	congrats on 1M club (23kuzn...	50	113.52	154.39	27	54.00
7411.	Katherine (kat5801)	50	52.65	64.00	1	2.00
7412.	SirAmateur (namelessamateur)	50	63.69	78.42	10	20.00
7413.	Ahmad (dr_ahmad)	50	42.55	53.38	5	10.00
7414.	Protek (protekripper)	50	38.30	48.00	5	10.00
7415.	chaaruzu (toishii)	50	63.55	82.57	5	10.00
7416.	Nate (jazzybanana)	50	50.19	63.92	9	18.00
7417.	Yuvraj (yuvraj_sharma)	50	64.06	79.40	12	24.00
7418.	DumbPeanut (dumb_peanut10)	50	45.40	56.10	4	8.00
7419.	Ankur (slownsteady108)	50	54.29	64.97	9	18.00
7420.	Thomas (tomtwo)	50	73.75	93.04	12	24.00
7421.	Thomas Wilde (negro100000_)	50	65.68	80.36	21	42.00
7422.	Happy129 (happy129)	50	63.68	78.76	6	12.00
7423.	SapCK (sapck)	50	99.91	122.21	21	42.00
7424.	Rodrigo (rugoso)	50	96.80	113.73	22	44.00
7425.	Isabella (refundmybirth_21)	50	60.97	79.86	12	24.00
7426.	pulkit (pulkitb)	50	31.04	46.89	4	8.00
7427.	lu (prymuslu)	50	90.70	106.76	16	32.00
7428.	Mihir (plibither8)	50	82.56	95.41	20	40.00
7429.	ben (panda_jellyfam)	50	97.44	117.27	25	50.00
7430.	PWian racer from chennai (o...	50	38.96	62.84	6	12.00
7431.	nostango (nostango)	50	79.68	93.83	16	32.00
7432.	Noridomi (noridomi)	50	86.96	102.83	14	28.00
7433.	ninja (ninja_op)	50	86.74	104.12	20	40.00
7434.	Nick (nick_txt)	50	93.53	120.25	23	46.00
7435.	TYPERACER (natem135)	50	96.73	126.65	17	34.00
7436.	Naga (nagaspar)	50	56.12	81.07	14	28.00
7437.	Narasimha Nadh (nadh_7)	50	70.93	86.99	15	30.00
7438.	Muhammad (muhammad95959)	50	44.84	52.48	7	14.00
7439.	MuffinMike (muffinmike)	50	91.06	108.87	13	26.00
7440.	Martin (mpgo13)	50	86.62	110.34	15	30.00
7441.	Matthew (mooncatcher)	50	73.63	96.51	9	18.00
7442.	Lloyd (milanh)	50	115.19	139.21	31	62.00
7443.	Steven (melkies)	50	80.94	90.94	16	32.00
7444.	mats (matserino)	50	49.84	65.02	6	12.00
7445.	TheStyne (fixinit1)	50	87.63	120.50	17	34.00
7446.	R0merol (farisfaikar_r)	50	73.40	88.74	16	32.00
7447.	yossi (exseibar)	50	57.21	72.88	3	6.00
7448.	Mohit (dumb_avocado)	50	51.99	65.89	5	10.00
7449.	Duc (dukenhu)	50	92.60	108.83	16	32.00
7450.	ddo (detdetjo)	50	81.26	94.55	15	30.00
7451.	yop (desuperslayer)	50	55.21	71.98	11	22.00
7452.	Name (defaultname)	50	79.63	111.87	15	30.00
7453.	don (dandhi)	50	85.70	102.46	20	40.00
7454.	Stoian (creep_fire97)	50	102.34	117.42	15	30.00
7455.	Connor (congoman)	50	47.47	59.95	4	8.00
7456.	Abhishek (coderguy1)	50	65.63	76.68	7	14.00
7457.	chlovis (chlovis)	50	28.02	41.81	7	14.00
7458.	Tilt (brianrk25)	50	72.05	85.73	49	98.00
7459.	BOBA (bobavfett)	50	54.58	66.60	6	12.00
7460.	G B (believeb)	50	27.09	37.49	33	66.00
7461.	китаец (artur_)	50	74.72	86.59	13	26.00
7462.	Arslan (arslan_03)	50	69.23	86.32	11	22.00
7463.	Maffin (m4ff1n)	50	83.47	98.10	13	26.00
7464.	Lepry (leprykun)	50	63.99	82.98	17	34.00
7465.	Y Lee (leengau)	50	58.82	77.50	7	14.00
7466.	Stephen (laddlez)	50	81.56	109.76	13	26.00
7467.	𝐊 𝐑 𝐀 𝐊 𝐄 �...	50	95.77	113.20	19	38.00
7468.	Kevin (kimchioncolemak)	50	96.01	109.53	21	42.00
7469.	Kaushik (kaushik_nna)	50	89.65	107.14	18	36.00
7470.	ジョーヨ (joeyo)	50	107.11	123.30	24	48.00
7471.	joanne (joannekim63)	50	92.89	109.95	23	46.00
7472.	Jose (jduran7)	50	80.34	103.63	14	28.00
7473.	Jake (jdogcat1)	50	62.28	79.84	9	18.00
7474.	Jai (jaideepjr)	50	105.54	122.79	16	32.00
7475.	Instinct (instinct1)	50	96.16	130.93	20	40.00
7476.	Enzo (hypertxters)	50	94.19	115.63	25	50.00
7477.	h (huyho1207)	50	90.08	118.18	27	54.00
7478.	hossameldien (hossam23177)	50	59.83	75.25	9	18.00
7479.	haidanos (haidanos)	50	79.98	94.44	12	24.00
7480.	H4ndss (h4ndss1)	50	84.38	105.87	16	32.00
7481.	Gaurav (gauravvv2204)	50	51.74	64.50	4	8.00
7482.	Joseph (gauntdarkness)	50	79.94	112.32	7	14.00
7483.	Mach 20 (mach20)	49	63.50	80.62	10	20.41
7484.	Lucifer (lucifer_kas)	49	88.36	116.04	23	46.94
7485.	repyx (lordgado)	49	51.27	69.40	7	14.29
7486.	Lilac (lilaclily)	49	21.91	28.51	9	18.37
7487.	Learn to pro (learntopro)	49	63.26	73.66	8	16.33
7488.	leaf (leafblower174)	49	103.59	139.80	32	65.31
7489.	Eduardo (laloaguirre720)	49	64.65	80.95	14	28.57
7490.	Q (kwhan)	49	103.38	124.09	27	55.10
7491.	jz (kokosha)	49	85.34	107.02	19	38.78
7492.	kiv (kivv)	49	86.85	108.88	20	40.82
7493.	kazden (kazdenetienne)	49	82.92	105.86	18	36.73
7494.	kalxoz (kalxoz97)	49	65.14	76.15	11	22.45
7495.	Tam (josephtambmt)	49	62.03	78.99	8	16.33
7496.	John (johnzeds)	49	77.38	95.20	8	16.33
7497.	Job (job007)	49	104.33	122.28	22	44.90
7498.	Ryan (jellyzerg)	49	90.81	105.96	21	42.86
7499.	FeelsGoodMan (jeffryvanessa1)	49	60.61	74.19	17	34.69
7500.	Jorge (jdominguezzz)	49	84.22	104.45	17	34.69
7501.	Jakm (jahkm)	49	47.89	60.92	8	16.33
7502.	Myro Bryan (iskwagong)	49	93.04	113.96	19	38.78
7503.	TypingGuy (iramus)	49	97.98	121.56	16	32.65
7504.	ABDELLATIF (hktitof)	49	61.26	79.90	11	22.45
7505.	Himanshu (himanshukpr)	49	42.69	50.83	4	8.16
7506.	haquaman_workman (haquaman_...	49	64.40	75.09	9	18.37
7507.	ILikeCars07 (gruhith)	49	86.25	97.81	12	24.49
7508.	rock dog (generic_exe)	49	81.62	95.19	16	32.65
7509.	Gianni (general_patches)	49	84.34	96.13	21	42.86
7510.	sammysamm (sammysamm)	49	77.68	94.92	12	24.49
7511.	Rully (rully_monas)	49	72.35	94.39	11	22.45
7512.	Rachael (rachaelpoedia)	49	58.83	68.90	7	14.29
7513.	zetria (primalknight)	49	143.50	169.47	33	67.35
7514.	F*ck Zelenskyy (overmake)	49	82.81	99.26	18	36.73
7515.	Orblil (orblil)	49	68.41	97.62	13	26.53
7516.	Glenn (nnelg)	49	98.81	133.27	7	14.29
7517.	FREE PALESTINE (needlepaws)	49	83.52	94.36	19	38.78
7518.	Brett (mrmahn)	49	110.64	125.97	33	67.35
7519.	may9 (may9)	49	60.47	71.84	12	24.49
7520.	Mati🅱IKL (mati2ooo)	49	97.95	116.03	20	40.82
7521.	Normal (marlon_caleb)	49	72.31	87.34	10	20.41
7522.	Priyanshu (_priyanshu_)	49	56.54	67.30	10	20.41
7523.	Ziad Zaki (ziadzaki)	49	90.83	133.52	23	46.94
7524.	adamz (zhaanga09)	49	79.58	100.71	17	34.69
7525.	Shayan (zackroos)	49	70.26	91.23	9	18.37
7526.	Tuomo (ystavani_marko)	49	66.14	79.55	11	22.45
7527.	Yordanes (yordanes)	49	39.14	48.74	1	2.04
7528.	__8k.11Ine_ (yassine999)	49	68.59	87.49	11	22.45
7529.	savannah (wiggywonka)	49	100.51	118.85	17	34.69
7530.	Gil (violetgil)	49	113.18	124.64	21	42.86
7531.	Venderex (venderex)	49	94.43	139.23	25	51.02
7532.	Vahid (vahidmoradpour)	49	35.41	43.39	0	0.00
7533.	Mason (unelevate)	49	111.79	136.11	32	65.31
7534.	TypingAway (typinggggggg)	49	84.57	99.95	15	30.61
7535.	tragiƘ (tragik)	49	95.80	121.53	45	91.84
7536.	Fran (tippidytap)	49	74.42	94.95	14	28.57
7537.	Tipper_Typer (tipper_typer)	49	77.81	100.87	13	26.53
7538.	Lawrence (thunder_drain)	49	78.05	103.66	12	24.49
7539.	Kerem (tearsfears)	49	67.01	81.93	8	16.33
7540.	Pragyan (swordfish999)	49	76.30	101.92	7	14.29
7541.	dozingoff (stopcomparing)	49	99.05	118.45	22	44.90
7542.	Samuel (spiriteater)	49	84.95	96.81	15	30.61
7543.	Sophia (sophianotfound)	49	66.02	93.43	8	16.33
7544.	yeet to space (sn00py1310)	49	72.69	97.84	17	34.69
7545.	Skyyy06 (skyyy06)	49	99.52	121.67	17	34.69
7546.	SH (shrony)	49	64.60	75.41	11	22.45
7547.	Shawna (shawnanic856)	49	93.97	111.89	17	34.69
7548.	Sebastian (sev___)	49	104.42	136.40	20	40.82
7549.	Danyl (seataco)	49	56.09	76.80	16	32.65
7550.	Arlene (arlenieeweenie)	49	132.39	165.75	35	71.43
7551.	Argon (argon273)	49	79.83	112.84	13	26.53
7552.	John (apathy_incarnate)	49	63.30	76.19	11	22.45
7553.	Antony (antonleghost)	49	89.37	116.44	15	30.61
7554.	Ankit (anktwd)	49	50.12	57.62	2	4.08
7555.	(altroq)	49	90.23	111.20	17	34.69
7556.	Adrian (adrianlee196)	49	117.16	133.24	26	53.06
7557.	Nicolas (acut3)	49	64.80	81.89	9	18.37
7558.	CrazyNeighbor (5qcheng007)	49	100.78	121.85	20	40.82
7559.	andrew (gorillaman9k)	49	67.28	82.64	30	61.22
7560.	pratham (pratham_s_k)	49	59.31	67.07	4	8.16
7561.	Kendall (fishstix_)	49	79.30	97.33	15	30.61
7562.	nakshatra (ng07)	49	20.62	25.38	9	18.37
7563.	Z4ZI3 (z4zi3)	49	65.71	78.32	41	83.67
7564.	Sankalp (sankalpgupta)	49	71.28	86.66	10	20.41
7565.	Fluroo (flurouu)	49	79.51	96.85	17	34.69
7566.	⚽⚽⚽⚽🏆🏆 (simon...	49	73.35	93.37	15	30.61
7567.	White (whitewolf04)	49	77.44	97.15	16	32.65
7568.	Non-quit acc (escri)	49	130.01	146.04	32	65.31
7569.	epigee (epigee)	49	105.37	128.88	17	34.69
7570.	Enclosed (enclosedletter)	49	85.02	103.09	17	34.69
7571.	ellie (ellmell13)	49	44.98	58.14	4	8.16
7572.	HMan (edhac)	49	98.06	123.46	16	32.65
7573.	Dziobak (dziobak)	49	92.59	118.74	15	30.61
7574.	Dumi (dumizeu)	49	43.92	55.47	6	12.24
7575.	Dontmindme (dontmindmepls)	49	50.62	62.40	5	10.20
7576.	Jay (dflkn4900s4)	49	82.99	99.21	16	32.65
7577.	DegageSpoon9280 (degagespoo...	49	53.11	63.13	6	12.24
7578.	Domo (dasuxosu)	49	85.71	116.49	20	40.82
7579.	Jake (darkxfade240)	49	79.43	93.73	12	24.49
7580.	Coru (coru12)	49	83.50	101.33	15	30.61
7581.	AHHH (chuckles1357)	49	88.83	110.67	11	22.45
7582.	Ryan Smith (chickenhelmet)	49	71.29	92.21	16	32.65
7583.	asdasd (chaizhengwen)	49	89.86	107.73	16	32.65
7584.	Celestrom (celestrom)	49	70.22	88.92	11	22.45
7585.	Carly (carlytarantino)	49	80.59	100.17	11	22.45
7586.	Typinator (candymn3)	49	100.75	124.45	17	34.69
7587.	Sml (cactusman215)	49	96.79	109.80	18	36.73
7588.	Bogoya (bogoya)	49	74.76	88.06	12	24.49
7589.	bobs (bobsbee)	49	33.91	49.31	4	8.16
7590.	Noah (bobothechimpanzee)	49	87.17	100.86	15	30.61
7591.	MM (blunderingpeon12)	49	82.81	99.86	12	24.49
7592.	Bryan (blcm123)	49	108.64	120.88	21	42.86
7593.	big (bigfudge14)	49	95.17	113.86	23	46.94
7594.	Beheshta (beheshta)	49	59.10	74.48	7	14.29
7595.	Marikyuun (bananaking121)	49	110.29	154.91	32	65.31
7596.	Pushkar (azuloto)	49	65.44	77.81	9	18.37
7597.	Ayush (ayush_1511)	49	67.34	80.07	18	36.73
7598.	aasdfa (awid)	49	90.29	104.59	16	32.65
7599.	𝕬𝖛𝖊𝖗𝖆𝖌�...	49	83.68	111.21	41	83.67
7600.	Ahnaf Shahriar (asifthegreat)	49	90.90	110.00	21	42.86
7601.	Leon (flopasd)	48	82.34	108.73	11	22.92
7602.	Justin (flamingoed02)	48	108.30	122.62	21	43.75
7603.	Fiona (fiona55)	48	88.15	104.17	13	27.08
7604.	Nik (fastesttyper101)	48	70.63	95.02	7	14.58
7605.	Nathan (el_cap_i_tan)	48	89.05	102.98	23	47.92
7606.	Edmund (edmundtyw1)	48	115.60	146.08	39	81.25
7607.	donkeysbanana (donkeysbanana)	48	83.83	105.76	18	37.50
7608.	Dylan (dmc71298)	48	103.60	129.06	27	56.25
7609.	Daniel (dansku01)	48	77.01	101.93	16	33.33
7610.	cubeian (cubeian)	48	59.09	74.41	5	10.42
7611.	CrpL (crippleed)	48	89.81	108.62	19	39.58
7612.	Captain (bobispro2)	48	110.13	124.54	25	52.08
7613.	Colin (blank9167)	48	114.35	141.20	26	54.17
7614.	Jherome Eduard (bl4nkk)	48	56.07	73.22	5	10.42
7615.	Soog (beez23)	48	93.50	105.05	11	22.92
7616.	auerabreak (auera)	48	81.98	98.06	11	22.92
7617.	(ashish_antil248)	48	57.93	74.74	8	16.67
7618.	tstats[_jamin_] (_jamin_)	48	85.27	102.65	25	52.08
7619.	zatoichi (zatoishwan)	48	114.17	143.04	21	43.75
7620.	Yash (yomiiiii)	48	68.18	94.89	11	22.92
7621.	Jeffrey (weijini)	48	74.82	92.32	8	16.67
7622.	h (vondo28)	48	82.62	108.53	9	18.75
7623.	Vladislove (vladislove)	48	94.51	108.65	10	20.83
7624.	Vishal (vishalsaxena)	48	50.88	63.70	4	8.33
7625.	Jared (varmitz1)	48	82.19	103.45	14	29.17
7626.	Vab (vaheebee)	48	93.36	104.27	15	31.25
7627.	UnreliableSpare (unreliable...	48	63.49	77.75	9	18.75
7628.	Pere (unbreaksee)	48	90.65	104.53	15	31.25
7629.	roni raz (unbelieveable)	48	117.17	138.36	25	52.08
7630.	Tom (tvdb2003)	48	54.30	65.33	3	6.25
7631.	Turbo (turbo_typist)	48	90.98	142.68	15	31.25
7632.	DatGG (tristanko)	48	57.61	75.52	4	8.33
7633.	touchtypepracticer69 (touch...	48	85.79	97.33	12	25.00
7634.	Speed (thenimblefinger)	48	120.29	166.50	22	45.83
7635.	Kunal (thegamerkunal)	48	74.04	94.75	10	20.83
7636.	Andy (tempestxciii)	48	74.91	92.10	29	60.42
7637.	Sugeeth (sugeeth14)	48	77.91	110.96	14	29.17
7638.	ssshanto (ssshanto)	48	116.03	150.32	21	43.75
7639.	Srean (sreantsm)	48	34.24	46.73	3	6.25
7640.	Sphage (sphage)	48	91.82	117.10	18	37.50
7641.	Taslima (smita123)	48	41.17	52.87	27	56.25
7642.	Skewlankus (skewlankus)	48	62.34	79.15	11	22.92
7643.	SilicGK (silicgk)	48	89.76	121.79	12	25.00
7644.	hehe (shindo333)	48	86.58	100.18	20	41.67
7645.	lithium's after image (lith...	48	127.09	148.68	30	62.50
7646.	Matt (lightning_mcqueef)	48	114.57	136.02	26	54.17
7647.	KA (keshavgrwl96)	48	81.35	104.98	7	14.58
7648.	Ken (kenrender)	48	42.21	50.38	3	6.25
7649.	Kc (kchehez)	48	75.10	94.90	6	12.50
7650.	June (ju_1304)	48	80.30	99.19	10	20.83
7651.	suns (jesse_kim)	48	67.08	86.23	20	41.67
7652.	Jam (jamtri)	48	114.19	134.91	26	54.17
7653.	Winter (jamesbandit)	48	52.11	62.60	3	6.25
7654.	Jai (jais)	48	83.61	99.55	12	25.00
7655.	Jack (jack2905)	48	94.84	117.44	18	37.50
7656.	Daniel (itypekindaquick)	48	64.71	76.29	9	18.75
7657.	Invictus (invictus69)	48	97.73	108.84	15	31.25
7658.	MKarma (im69d)	48	42.38	53.25	7	14.58
7659.	Ilana (ilana12)	48	57.72	68.22	6	12.50
7660.	hyhu (hyhy233)	48	78.12	91.45	11	22.92
7661.	arache (howeyzeh)	48	73.07	105.12	15	31.25
7662.	BNYKGDT (hopelessly_serious)	48	92.94	117.18	19	39.58
7663.	Teng (hentaiba3)	48	74.50	90.18	24	50.00
7664.	Hau (hauhauh)	48	73.54	86.29	15	31.25
7665.	Hadise (hadise)	48	123.30	161.15	31	64.58
7666.	Abdullah (ghadanfar)	48	96.33	119.45	17	35.42
7667.	Gridcoin (gabeneweii)	48	113.33	158.10	30	62.50
7668.	SackHeadSam (sackheadsam)	48	44.07	63.52	4	8.33
7669.	Ryan (ryanhz)	48	91.23	113.77	18	37.50
7670.	ron (ronj23)	48	75.50	89.81	9	18.75
7671.	ronaldo (ronaldo_gao)	48	100.88	131.04	18	37.50
7672.	Remy (rmds_dln)	48	84.39	121.02	23	47.92
7673.	Acceptance (riskirw)	48	110.90	130.05	27	56.25
7674.	Rido (ridoho)	48	63.50	82.35	14	29.17
7675.	Joash (raz3rdarkkill)	48	79.91	98.60	13	27.08
7676.	James (raking123)	48	71.88	89.41	11	22.92
7677.	Quinco (quinco)	48	45.83	61.29	5	10.42
7678.	Praveen (praveen3791)	48	84.72	98.48	11	22.92
7679.	Simon (plantsdragon)	48	59.25	73.54	11	22.92
7680.	Chris (papadroop1)	48	119.52	144.28	23	47.92
7681.	Minnot (omar10211)	48	60.66	80.63	9	18.75
7682.	Ogg (ogg_)	48	75.30	89.29	16	33.33
7683.	NU (nusensei)	48	103.07	133.53	26	54.17
7684.	Niv (nivkapadia)	48	62.36	77.66	13	27.08
7685.	Kevin (niveik)	48	94.78	126.50	17	35.42
7686.	nikolas (nicknt)	48	71.32	87.21	8	16.67
7687.	Amir (nao.paladin@yahoo.com)	48	102.00	121.34	24	50.00
7688.	MsStPeter (msstpeter)	48	74.48	91.51	14	29.17
7689.	mr (mr_pineapple069)	48	68.17	86.05	17	35.42
7690.	BOB (mroglan)	48	84.51	96.49	12	25.00
7691.	MRBC (mrbc)	48	57.90	76.42	6	12.50
7692.	MrPoop (mother_lover)	48	63.11	77.28	10	20.83
7693.	mgamble (mgamble)	48	78.73	96.41	10	20.83
7694.	Mohammed (md_islam)	48	78.36	90.68	12	25.00
7695.	Andrew (mcentag)	48	112.89	140.75	20	41.67
7696.	Marius (mariukas_)	48	78.06	88.41	10	20.83
7697.	Luis Victor (anubis_9)	48	74.25	86.48	11	22.92
7698.	Amritesh (anodyne12371)	48	36.07	51.13	2	4.17
7699.	amin (anmiimna)	48	60.34	73.40	8	16.67
7700.	Alex (amarcus0100)	48	52.65	66.83	10	20.83
7701.	alfie (alfieisback)	48	73.79	90.07	15	31.25
7702.	Aleksa (alexample)	48	80.08	93.30	16	33.33
7703.	Aidin (aidin177)	48	110.38	129.08	21	43.75
7704.	Acnologia (acnologia_123)	48	88.45	96.83	9	18.75
7705.	Frederich (acerx032)	48	87.41	106.71	18	37.50
7706.	tstats[0anonymous0123] (0an...	48	56.11	69.40	5	10.42
7707.	C4ll Me Sir (ssidd)	48	83.10	99.74	7	14.58
7708.	LaxiMax (laximax)	48	68.06	86.41	17	35.42
7709.	Noah (holyrhombi)	48	67.56	80.30	13	27.08
7710.	toby (tobyliekscows)	48	76.33	102.62	16	33.33
7711.	Luis (luggibuggi)	48	68.55	86.57	7	14.58
7712.	Apotekarne1337 (apotekarne1...	48	57.60	76.07	6	12.50
7713.	Panos (panospask)	48	58.95	76.12	13	27.08
7714.	mathder (willpackyourmother)	48	69.12	85.87	14	29.17
7715.	Klemensi (klemensi)	48	52.29	66.59	3	6.25
7716.	vrrrrrrrrm (olivrrm)	48	70.60	90.84	13	27.08
7717.	Jonondarnad (egoye)	48	65.40	82.11	36	75.00
7718.	Cam (cburr)	48	75.36	89.65	14	29.17
7719.	Sam (sam6420)	48	104.77	129.19	28	58.33
7720.	Kashmir (haris1)	48	48.85	61.95	4	8.33
7721.	Syed (syed_tahsin)	48	75.82	89.72	7	14.58
7722.	Alpuds (alpuds)	47	78.09	102.76	16	34.04
7723.	alis (aliss)	47	86.82	98.01	14	29.79
7724.	Georgios (aktorion)	47	47.83	56.80	2	4.26
7725.	J (akntmzjtj)	47	104.59	130.52	24	51.06
7726.	Adam (acassidy24)	47	71.11	90.39	11	23.40
7727.	Suvan (1080pixelz)	47	51.60	66.04	4	8.51
7728.	alberta (albertaa)	47	68.89	83.61	13	27.66
7729.	Kendii_Man (kendii_man)	47	79.04	100.04	28	59.57
7730.	Swagata (bulets)	47	53.86	62.83	10	21.28
7731.	Dhruv (dhruvmehta_409)	47	57.94	85.94	10	21.28
7732.	Plus (mpurasu)	47	56.41	70.58	7	14.89
7733.	Sagnik (shagzz_01)	47	60.82	77.90	8	17.02
7734.	kk (infinitq_z)	47	66.97	85.82	30	63.83
7735.	Maurya (maurya_21)	47	34.68	41.21	5	10.64
7736.	Jim (quacksoncrack)	47	81.55	108.33	17	36.17
7737.	Lonmanbeast (lonmanbeast)	47	70.39	83.05	9	19.15
7738.	Latif (lephant)	47	73.81	97.21	11	23.40
7739.	Samuel (kyoka_sui)	47	73.86	91.01	6	12.77
7740.	Wattsey (krwhlee15)	47	92.83	120.85	22	46.81
7741.	krs (krss)	47	63.55	76.97	15	31.91
7742.	KingBaby (kingzeroiii)	47	93.71	110.78	14	29.79
7743.	Dawn (kidlatako)	47	39.33	50.51	5	10.64
7744.	Kevin (kevzjhu)	47	107.54	131.16	18	38.30
7745.	kamoo (k4moo)	47	68.38	82.15	9	19.15
7746.	Jed (jedmedina)	47	81.13	112.14	11	23.40
7747.	Jill (jconn00)	47	67.79	82.93	9	19.15
7748.	JtG (jaylegee)	47	103.70	121.30	22	46.81
7749.	Jackson (jacksonmississippi)	47	76.30	102.90	13	27.66
7750.	itsKrish01 (itskrish01)	47	55.37	70.36	12	25.53
7751.	gtg dinner (ijikman)	47	110.76	133.69	18	38.30
7752.	Igor (igor2003)	47	70.74	88.92	11	23.40
7753.	Qida (ieatpizza)	47	72.35	85.02	8	17.02
7754.	Hari (hari_dev)	47	55.96	69.05	0	0.00
7755.	Henrik (grimmzl)	47	60.87	73.04	12	25.53
7756.	gc21 (giim_chyn)	47	92.42	115.53	17	36.17
7757.	George (geogeorge456)	47	54.92	73.21	8	17.02
7758.	zombie gaming (galaxybiscui...	47	83.23	105.32	17	36.17
7759.	Don Kaboul (gabbaryamdak)	47	70.44	85.45	15	31.91
7760.	Fred (fredxster)	47	66.33	80.12	4	8.51
7761.	Kamil (finessegod_)	47	78.23	100.02	12	25.53
7762.	Masquerade (fidtzy)	47	47.82	58.84	6	12.77
7763.	Eldritch (ficuno)	47	44.89	64.24	4	8.51
7764.	MY LIFE FOR PAKISTAN (eridpnc)	47	99.02	125.06	20	42.55
7765.	Eric (ericlauchiho)	47	62.55	79.71	8	17.02
7766.	Dev (devkoli)	47	48.93	64.49	3	6.38
7767.	Alyssa (destroyer090)	47	62.68	76.82	4	8.51
7768.	Deepan (deepan_hacker)	47	41.96	49.96	0	0.00
7769.	David (davers4)	47	78.77	110.18	13	27.66
7770.	fish (danf1)	47	95.34	112.09	19	40.43
7771.	chandara (chan92)	47	85.14	105.93	21	44.68
7772.	Carlkristie (carlkristie)	47	41.65	56.32	7	14.89
7773.	Millie (brunomarstm)	47	31.03	38.12	5	10.64
7774.	Beedle (bernod)	47	58.77	76.64	8	17.02
7775.	.... (_otto_)	47	59.19	72.27	7	14.89
7776.	Joy (_joy_)	47	65.94	80.34	8	17.02
7777.	Nurzhan (_bakytov_)	47	68.60	85.27	13	27.66
7778.	Giovanni (zombieagain)	47	56.30	67.89	3	6.38
7779.	Zach (zchen717)	47	113.17	135.80	24	51.06
7780.	yousuf (z3nko)	47	98.48	124.01	36	76.60
7781.	Yoru (yoruu12)	47	59.34	68.29	5	10.64
7782.	♪╠¥ö§€ƒ╣♫ (ye...	47	80.89	99.01	15	31.91
7783.	Garrick (yanawanas)	47	89.94	130.48	12	25.53
7784.	clement (xortoise)	47	70.07	87.00	18	38.30
7785.	William Vince (wvince02)	47	43.43	53.01	1	2.13
7786.	Sapphire (wl23)	47	85.08	106.14	14	29.79
7787.	Quibz (white_fire)	47	96.78	125.01	19	40.43
7788.	weicer (weicer)	47	92.81	113.75	17	36.17
7789.	WayLay (waylay17)	47	85.41	121.96	15	31.91
7790.	Virt (virtue_raj)	47	68.91	78.75	10	21.28
7791.	Vidit (vdop)	47	55.38	78.81	9	19.15
7792.	Maw (typemaw)	47	95.82	118.29	4	8.51
7793.	totaland (totaland)	47	62.97	75.38	8	17.02
7794.	Chris (tomatohead21)	47	112.45	136.42	18	38.30
7795.	Crackersontheshelf (taejung...	47	85.38	101.96	16	34.04
7796.	HowToTypin9 (supergodnes)	47	70.78	91.14	11	23.40
7797.	sprwhk (sprwhwk)	47	71.41	85.58	14	29.79
7798.	Zoey (soeyzandiego)	47	101.92	126.17	19	40.43
7799.	Stephen (slyspy)	47	49.54	65.64	1	2.13
7800.	DuongForeverAlone (sieunhan...	47	97.16	108.80	17	36.17
7801.	Joshua (shmucky)	47	122.61	137.88	24	51.06
7802.	Shino (shinobami)	47	46.48	58.53	4	8.51
7803.	Shiji (shiji_singh)	47	49.13	57.16	4	8.51
7804.	Sherzod Nadirov (sherzod_5)	47	29.62	37.67	5	10.64
7805.	Sarvang (sarlok393)	47	68.15	88.54	16	34.04
7806.	Raviraj (rvrjpdhr)	47	54.35	75.26	10	21.28
7807.	Jay (royjay)	47	61.56	78.11	8	17.02
7808.	regen45 (regen45)	47	32.41	45.23	4	8.51
7809.	Rishabh (rdmighty_i)	47	109.28	132.87	22	46.81
7810.	RageRaptor (rageraptor)	47	49.28	57.18	3	6.38
7811.	Kevin (popanto)	47	86.90	109.61	12	25.53
7812.	naige (pnolan55)	47	46.41	56.33	4	8.51
7813.	Chan (pizzx)	47	74.47	91.29	6	12.77
7814.	Petar (petars)	47	147.81	192.88	30	63.83
7815.	Flame (panutadk)	47	97.41	115.95	16	34.04
7816.	Ore (orediamond)	47	127.41	153.94	30	63.83
7817.	M (myles_jb)	47	101.78	124.37	20	42.55
7818.	mw3m (mw3m)	47	55.14	68.65	4	8.51
7819.	Doggy (mr_woofles)	47	73.50	113.18	14	29.79
7820.	Mr_Mic (mr_mic)	47	74.88	93.92	13	27.66
7821.	Priyansh (mrpriyansh)	47	61.24	71.20	7	14.89
7822.	Mriganka (mriganka)	47	66.37	85.86	8	17.02
7823.	Moishi (moishi)	47	84.10	102.73	14	29.79
7824.	Mohammad (mohammad__)	47	68.29	90.05	15	31.91
7825.	milki (milkepro)	47	59.49	85.99	9	19.15
7826.	racist (milfed)	47	49.90	72.48	7	14.89
7827.	Rostislav (mexanoz)	47	47.21	62.70	4	8.51
7828.	Marina (marniass)	47	98.94	117.84	15	31.91
7829.	Revolution (maqsoodwor)	47	21.50	33.55	8	17.02
7830.	Samir (samirissa)	46	55.13	72.45	9	19.57
7831.	Jai Nepal (sajalpoudel)	46	51.58	59.75	6	13.04
7832.	Ryan (ryanssd)	46	121.63	152.33	27	58.70
7833.	Caspian (qashu)	46	63.57	86.43	15	32.61
7834.	Pseudo (pseudo_here)	46	72.71	92.25	9	19.57
7835.	pp (priscillaaa)	46	86.05	107.03	10	21.74
7836.	Pranav (pranav16)	46	52.19	62.95	3	6.52
7837.	Sondr (pngstr)	46	75.10	88.56	11	23.91
7838.	⠀ (ploop123)	46	73.54	92.60	14	30.43
7839.	chiru (phenggot200darken)	46	79.54	99.71	9	19.57
7840.	Alexander (pharos)	46	44.10	64.34	15	32.61
7841.	Iveth (perlybomb)	46	55.45	67.74	8	17.39
7842.	PelMeni (pelmeni)	46	110.78	124.62	24	52.17
7843.	Paul (paulllx)	46	70.68	94.77	10	21.74
7844.	Angel (olivias69)	46	63.14	70.96	8	17.39
7845.	Abhimanyue (obsidian_abhi)	46	77.78	109.26	6	13.04
7846.	Nafiul (n_crypted)	46	67.50	80.70	6	13.04
7847.	NO_LYF (no_lyf)	46	63.98	79.18	14	30.43
7848.	barmanrahul (nothisisrahul)	46	69.72	83.74	10	21.74
7849.	Patiphan (nongper)	46	57.28	78.00	11	23.91
7850.	Nmn (nmn147)	46	60.52	73.44	11	23.91
7851.	Neel (neel19)	46	92.61	108.86	13	28.26
7852.	nadeem (nadeemgujjar)	46	67.89	80.09	10	21.74
7853.	Mohsen (mohsentypo)	46	63.22	74.60	17	36.96
7854.	Mayan (mayan__)	46	66.55	82.19	9	19.57
7855.	Max (maxim_brown)	46	65.34	81.60	8	17.39
7856.	Epzilon (epzilonn)	46	137.12	163.22	38	82.61
7857.	Edgar (edgarflorez)	46	38.79	48.94	3	6.52
7858.	Dweeb (dweb)	46	76.30	94.48	22	47.83
7859.	Eric (draydere)	46	101.48	115.04	14	30.43
7860.	Accuracy (dozwolonymein)	46	80.49	98.83	11	23.91
7861.	mike (doorman32)	46	95.79	117.62	20	43.48
7862.	d'toe 😎😎😎😎 (det...	46	88.24	117.04	12	26.09
7863.	Martin (demonakinale)	46	123.40	147.90	29	63.04
7864.	Derriel (ddcj90)	46	56.61	68.83	9	19.57
7865.	Need (damdebotush)	46	41.80	48.86	4	8.70
7866.	Corn Philips (cornphilips)	46	81.59	101.27	15	32.61
7867.	David (cmagic_f)	46	90.43	107.61	12	26.09
7868.	Check (checkmunza)	46	83.02	100.23	11	23.91
7869.	Steven (carnivorous_crustat...	46	31.41	43.04	3	6.52
7870.	Julia (bunnimochi)	46	68.65	91.66	10	21.74
7871.	Brian (brianyounq)	46	104.03	126.73	22	47.83
7872.	Broll (billwong28)	46	79.89	93.43	11	23.91
7873.	ARTAN (begaal97)	46	102.05	117.47	17	36.96
7874.	Harshit (awpsun)	46	66.06	83.01	11	23.91
7875.	Asnar (asnarsar)	46	33.94	54.33	5	10.87
7876.	Ash (ashbacchus)	46	59.98	73.65	5	10.87
7877.	ansendice (asendice)	46	67.51	88.62	10	21.74
7878.	Arata (aratatakeda)	46	65.67	84.28	5	10.87
7879.	Annie (annie48)	46	62.98	72.91	11	23.91
7880.	Alexander (alexanderbutcheeks)	46	70.13	84.10	5	10.87
7881.	Aji (ajimathew)	46	50.84	66.62	11	23.91
7882.	chris (aito_cornaro)	46	72.90	92.41	11	23.91
7883.	Mohamed (abo4ams)	46	76.33	85.06	13	28.26
7884.	Abdu (abduqodirov)	46	71.99	94.54	7	15.22
7885.	Eobard (abdouhamel)	46	84.01	111.08	15	32.61
7886.	J (22jcoluby)	46	50.01	61.79	3	6.52
7887.	Ned (13_w)	46	60.99	78.00	5	10.87
7888.	Divy (thivy)	46	58.74	81.95	8	17.39
7889.	Sai (moon_toong)	46	31.03	41.03	2	4.35
7890.	Ab (timaby)	46	41.14	53.21	3	6.52
7891.	Naman (naman_vj)	46	65.20	82.42	11	23.91
7892.	Aevaela (aevaela)	46	106.52	131.85	21	45.65
7893.	Rithwik (rithwiksharma)	46	81.43	103.07	10	21.74
7894.	karim (karimbdf)	46	47.26	57.98	5	10.87
7895.	Anj (anj2000)	46	57.70	71.69	9	19.57
7896.	Daniel (xdax)	46	59.53	74.32	3	6.52
7897.	Rene (yayrene)	46	54.39	65.71	4	8.70
7898.	Fabricio (ruk68)	46	46.21	59.71	6	13.04
7899.	Admiral (admiralspoon)	46	93.45	115.13	21	45.65
7900.	Karl (cheeseborgar)	46	70.94	82.08	8	17.39
7901.	Auf (auf10)	46	40.26	51.73	2	4.35
7902.	kim (kimblimblimz)	46	129.61	169.76	32	69.57
7903.	Kimberly (kimbear_)	46	56.45	67.46	6	13.04
7904.	Justin (juicet1n2)	46	130.98	155.08	27	58.70
7905.	Joshua (jhsieh10)	46	88.85	105.24	16	34.78
7906.	Jacob (intellectualbrick)	46	66.45	84.42	14	30.43
7907.	Aaron (insertwordshere)	46	112.30	144.74	39	84.78
7908.	sMarty (imrwonder2)	46	93.98	126.95	13	28.26
7909.	icecreamfilling (icecreamfi...	46	89.90	105.12	14	30.43
7910.	H A N S (hans_bk)	46	72.74	86.03	12	26.09
7911.	guest_typist_new (guest_typ...	46	83.27	106.82	12	26.09
7912.	Pim (_pmirum)	46	92.60	108.15	18	39.13
7913.	Emmy (_dadstype_)	46	83.60	103.24	12	26.09
7914.	Ziobr (ziobr)	46	92.00	108.72	19	41.30
7915.	Brohath (zevo100)	46	81.22	101.34	8	17.39
7916.	Enzo (yujiro144)	46	53.98	67.15	6	13.04
7917.	Sagar (xdronzer)	46	53.20	69.80	5	10.87
7918.	xahriman (xahriman)	46	73.95	93.32	11	23.91
7919.	wolfBream (wolfbream45)	46	122.41	139.13	29	63.04
7920.	will_t (will_t)	46	125.05	150.82	26	56.52
7921.	Wally101 (walrusboy101)	46	79.82	96.57	10	21.74
7922.	Daddy D (vr00m_)	46	59.78	79.80	8	17.39
7923.	Hans (ts6d)	46	77.61	94.56	13	28.26
7924.	thomas (tmastri)	46	74.60	94.22	6	13.04
7925.	Nathanael (tinkerer_nat)	46	82.28	102.93	12	26.09
7926.	Tilly (tillyrose)	46	92.55	111.13	20	43.48
7927.	Jitendra (techjittu)	46	49.86	61.77	5	10.87
7928.	誌綸 (tdog0507)	46	66.69	89.78	13	28.26
7929.	Aboostedninja (talonabuser)	46	96.12	125.00	15	32.61
7930.	Sunil (sunilislaz)	46	46.08	74.78	6	13.04
7931.	Suhas (suhaskurup)	46	87.53	101.81	13	28.26
7932.	SPyofgame (spyofgame)	46	89.45	106.47	26	56.52
7933.	spoon (spooderrr)	46	75.30	96.38	6	13.04
7934.	Christian (speciial)	46	58.83	70.93	6	13.04
7935.	BOOST~~~ (somen_chandra)	46	44.94	59.62	6	13.04
7936.	Yazeed (snake69)	46	82.73	106.03	15	32.61
7937.	Lexi (silentfungus)	46	30.50	48.74	10	21.74
7938.	SH (shokha09)	46	53.34	62.22	5	10.87
7939.	Hiraya (sheesh_24)	46	52.70	64.06	4	8.70
7940.	Saurav (seldom69)	46	59.91	73.26	8	17.39
7941.	Surendra (zurendra9)	45	73.52	86.32	9	20.00
7942.	Sam (zoinks_sam)	45	95.93	121.16	20	44.44
7943.	zin (zinzin27bs)	45	55.30	70.56	3	6.67
7944.	Daniel (zebrapopcorn)	45	95.45	124.22	18	40.00
7945.	Youssef (youssef_ait_bihi)	45	71.34	95.44	9	20.00
7946.	Yunus Emre (yemre95)	45	62.91	81.30	6	13.33
7947.	I'm_on_mobile (yeetusthyfetus)	45	99.60	126.08	23	51.11
7948.	yasser (yasserhr)	45	61.63	76.44	5	11.11
7949.	Varun (wolfie12)	45	56.12	65.03	4	8.89
7950.	Wiktor (wivvik)	45	47.64	60.21	5	11.11
7951.	Wesgar (wesgar)	45	67.82	77.78	15	33.33
7952.	Vikram (vikram_)	45	58.02	71.27	7	15.56
7953.	tstats[unoriginalname] (uno...	45	89.14	102.08	21	46.67
7954.	Tsetsen (unknownxxx)	45	69.46	82.45	34	75.56
7955.	Bray (turtlebray)	45	69.09	84.76	6	13.33
7956.	Sitraka (tsukimurphy)	45	85.34	100.63	9	20.00
7957.	Kennon (trainertaco)	45	67.77	80.69	10	22.22
7958.	Huan (thehuan2005)	45	68.85	90.34	11	24.44
7959.	Sh3y4sh (thegoldeneagle)	45	76.54	95.34	14	31.11
7960.	alberto (th3biscuit)	45	46.02	59.03	6	13.33
7961.	Ave (tessellatedtalent)	45	94.62	115.93	7	15.56
7962.	sv (sv_1419)	45	46.75	56.05	3	6.67
7963.	exqlouuebnfpgts (spitemim)	45	101.14	124.09	32	71.11
7964.	Kevin (spezzytv)	45	91.11	115.90	14	31.11
7965.	Bún Bò (snowk49)	45	90.48	111.07	13	28.89
7966.	Diego (snkybkyloike)	45	62.56	79.76	8	17.78
7967.	Sar (shift2alt)	45	59.62	70.68	13	28.89
7968.	Mona (segasunset)	45	82.78	103.03	18	40.00
7969.	Emma (aria_tran)	45	64.07	84.73	11	24.44
7970.	Rajat (arakanfudo)	45	54.76	68.75	42	93.33
7971.	(andyjoekool)	45	95.46	159.17	17	37.78
7972.	leibniz (anamaya11)	45	63.25	75.53	9	20.00
7973.	AmgdHussein (amgd_hussein)	45	46.95	55.74	5	11.11
7974.	Alex (alexstrang25)	45	98.63	116.63	17	37.78
7975.	Ankit (akjung478)	45	55.07	65.23	4	8.89
7976.	acrymoore (acrymoore)	45	87.69	101.48	15	33.33
7977.	Abbacchio (abbacchio)	45	96.62	115.66	14	31.11
7978.	Spark (5parkmark)	45	84.91	102.04	15	33.33
7979.	James (2janghoon)	45	119.58	152.64	24	53.33
7980.	abc (1714245ctk41)	45	88.68	108.03	14	31.11
7981.	100% (100percentaccurate)	45	100.45	120.64	20	44.44
7982.	REV (krevengek)	45	39.09	46.26	2	4.44
7983.	sebastian (teekq)	45	102.46	120.65	12	26.67
7984.	Kingpin (bahmandoor)	45	80.96	93.67	18	40.00
7985.	Moazzam (qwikiquartz)	45	66.23	75.42	10	22.22
7986.	Divyansh (elessar42)	45	34.58	47.38	6	13.33
7987.	Cameron (cammy24)	45	90.57	118.57	26	57.78
7988.	azer8 (azer8)	45	56.44	69.90	3	6.67
7989.	rr (rosandy10)	45	60.28	73.20	10	22.22
7990.	Vincent (supersayu)	45	105.82	123.77	21	46.67
7991.	Enrico (ricodmarlon)	45	83.18	100.86	11	24.44
7992.	Yammine (y__y)	45	77.63	90.53	11	24.44
7993.	gufu12 (gufu12)	45	48.30	63.22	38	84.44
7994.	James (buttcheeks34)	45	99.31	113.97	17	37.78
7995.	Sen (puggowuggo)	45	38.28	49.65	12	26.67
7996.	Kirk (maruts)	45	76.36	99.89	15	33.33
7997.	Ame (imtodess)	45	75.47	102.03	9	20.00
7998.	Mark (bufferx)	45	77.44	93.93	12	26.67
7999.	Shohruxxon (shohruxxon7)	45	50.39	67.28	3	6.67
8000.	Stacky (headstack)	45	101.21	135.86	21	46.67
8001.	Andreas Boulios (boulibouli)	45	65.20	84.68	6	13.33
8002.	arne (arnegutten)	45	54.76	64.54	5	11.11
8003.	Ross (rossmawd)	45	63.61	75.23	11	24.44
8004.	Roy (rocko95)	45	72.39	87.37	8	17.78
8005.	Michael (redwings20)	45	120.01	151.43	22	48.89
8006.	Pryl (pryl)	45	85.79	107.65	12	26.67
8007.	Poop (poopbuttpoop)	45	66.53	81.77	12	26.67
8008.	B (pbhavin8584)	45	44.39	54.74	0	0.00
8009.	Pastasoosi (pastasoosi)	45	49.97	60.86	3	6.67
8010.	passivestar (passivestar)	45	116.04	141.98	45	100.00
8011.	Zunbileg (ozbileg)	45	75.35	90.81	14	31.11
8012.	Asif (orthocresol)	45	79.68	91.61	10	22.22
8013.	Nrimanta (nwiziyanow)	45	45.37	63.69	12	26.67
8014.	Ritesh (novathor)	45	55.51	67.50	7	15.56
8015.	Nakura (nakura_sushi)	45	73.79	91.47	14	31.11
8016.	Naaman (nae26)	45	86.76	113.08	16	35.56
8017.	mushbert (mushbert)	45	55.60	69.40	12	26.67
8018.	E (mosanbrick)	45	106.64	124.13	20	44.44
8019.	k (mooneymooves)	45	69.48	88.19	5	11.11
8020.	miko (mikesxan)	45	74.77	89.17	18	40.00
8021.	Josiah (miitraa)	45	92.51	125.82	21	46.67
8022.	aWiltedRhythm (mbh38)	45	110.92	125.84	25	55.56
8023.	Max (maxube21)	45	59.46	70.51	12	26.67
8024.	Mason (mason8008)	45	95.45	116.30	16	35.56
8025.	Frosted (frosted_bruh)	45	75.24	89.17	7	15.56
8026.	Luke (frag_pumpkin)	45	61.28	71.66	6	13.33
8027.	fihee (fihee)	45	60.36	79.78	12	26.67
8028.	fedja (fedza)	45	108.59	123.14	20	44.44
8029.	ducky (duckyboy0)	45	53.80	62.97	2	4.44
8030.	Solomon (donutrk)	45	148.65	187.49	34	75.56
8031.	Didoff (didoff)	45	67.48	82.16	10	22.22
8032.	dhara (dhara12)	45	37.80	47.15	3	6.67
8033.	Cygnus (cygnuss)	45	135.57	161.12	32	71.11
8034.	CTLim (ctlim02)	45	76.54	96.78	11	24.44
8035.	Cool (creepycumber)	45	82.00	99.28	12	26.67
8036.	Conning (conning)	45	108.58	127.67	22	48.89
8037.	Chicken (chickenhide)	45	124.47	155.65	29	64.44
8038.	Zyrin (captainzyrin1024)	45	85.99	106.12	15	33.33
8039.	K (blue_addict)	45	60.43	81.49	9	20.00
8040.	Blazian444 (blazian444)	45	108.11	129.57	14	31.11
8041.	BEMZ (bemz_mc)	45	50.63	63.38	10	22.22
8042.	Izanagi (baguettianmysticism)	45	179.78	210.49	45	100.00
8043.	Kevinh (baconpool14)	45	98.38	129.56	17	37.78
8044.	Darda (babyonbaby)	45	101.49	126.74	21	46.67
8045.	Mahmoud (mahmoud_zaineldin)	45	63.68	80.32	8	17.78
8046.	Lutful (lutful)	45	44.30	50.79	6	13.33
8047.	Luciano (lucidokz)	45	72.75	99.55	9	20.00
8048.	Shiva (lord_kartikey)	45	26.15	38.20	12	26.67
8049.	lofr1t (lofr1t)	45	51.85	61.95	5	11.11
8050.	Louzani (lk_kheir)	45	42.77	54.30	2	4.44
8051.	Nicholas (legendarykeys)	45	81.36	101.45	13	28.89
8052.	Sai Venkat (ksvr)	45	57.41	71.60	7	15.56
8053.	KOU (koulangkaya)	45	59.89	72.75	7	15.56
8054.	Justin (jubnx)	45	54.17	69.90	5	11.11
8055.	Biggs (jobobhi)	45	86.52	104.73	14	31.11
8056.	Jubbers (jlin526)	45	125.23	144.28	31	68.89
8057.	Jeff (jeffwu1220)	45	93.41	110.12	13	28.89
8058.	Aether (its_deep)	45	51.14	66.72	13	28.89
8059.	ItsDuckyLol (itsduckylol)	45	77.45	91.02	9	20.00
8060.	Debasmit (inmessi)	45	59.57	68.40	14	31.11
8061.	XD (hphuonghehe)	45	61.31	74.68	8	17.78
8062.	Hiyoshi (hiyochan)	45	155.20	182.66	40	88.89
8063.	Eric (heeric)	45	110.41	123.99	19	42.22
8064.	Hassan (hassanjazzy143)	45	63.17	72.98	5	11.11
8065.	Halftimenerd1 (halftimenerd1)	45	52.92	64.01	7	15.56
8066.	GrandMaster (grandmaster101)	45	71.43	84.29	7	15.56
8067.	Ben (god0nline)	45	103.23	142.45	25	55.56
8068.	Gabbie (gg13)	45	75.47	91.30	9	20.00
8069.	Ganesh (gat786)	45	51.21	70.90	3	6.67
8070.	lumapools (lumapools)	44	92.18	107.46	16	36.36
8071.	dennis (ludennis0606)	44	89.06	107.72	11	25.00
8072.	luis (lozalui004)	44	66.21	79.33	5	11.36
8073.	Lord (lord_v)	44	72.12	85.07	11	25.00
8074.	Кирилл (life808)	44	93.29	118.20	15	34.09
8075.	Igor (kziv)	44	37.70	49.32	1	2.27
8076.	KeeG9x (keeg9x)	44	80.11	103.44	17	38.64
8077.	Kalin (kalin_a)	44	63.08	73.69	8	18.18
8078.	John (juseonghan)	44	120.26	149.15	22	50.00
8079.	Jim (jumsey)	44	82.73	106.62	13	29.55
8080.	S (juicebox_27)	44	91.22	115.55	17	38.64
8081.	now colemak! (jlam55555nonq...	44	125.54	145.63	32	72.73
8082.	Jin (jin_an)	44	73.36	87.55	14	31.82
8083.	JBK (jeyabalakrishnan)	44	44.24	53.65	3	6.82
8084.	jjerry (jerry_nyae)	44	85.74	104.88	7	15.91
8085.	Jake (jasala)	44	92.64	108.43	16	36.36
8086.	Izhar Ali (izhar368)	44	60.52	71.40	7	15.91
8087.	korn (itthikorn777)	44	49.77	59.56	5	11.36
8088.	isenze (isenze)	44	70.18	79.93	20	45.45
8089.	no (humeunculus)	44	124.97	146.82	24	54.55
8090.	Suhel (horacio_chopin)	44	70.42	83.00	9	20.45
8091.	heam (heamkream)	44	60.38	73.61	22	50.00
8092.	Harvey (harveyqqq)	44	86.21	101.28	12	27.27
8093.	Grey (grey2)	44	87.91	109.70	12	27.27
8094.	giovane thug (giovvah)	44	134.25	147.90	29	65.91
8095.	John (gakbo)	44	82.15	108.68	10	22.73
8096.	Jacob (gadekaja)	44	90.45	118.42	13	29.55
8097.	Ivan (s017180)	44	96.27	116.60	15	34.09
8098.	Robert (rwa102455)	44	101.59	119.88	17	38.64
8099.	tstats[rueo] (rueo)	44	49.16	60.77	5	11.36
8100.	Rounak (rouvai)	44	85.56	102.53	12	27.27
8101.	Rodrigo (rodrigoferrer)	44	87.93	101.55	17	38.64
8102.	Rikesh (rikesh)	44	100.75	129.96	25	56.82
8103.	Vineet (raovineet14)	44	58.01	66.38	5	11.36
8104.	Qi (qitang)	44	103.12	115.91	12	27.27
8105.	poobastank (poobastank)	44	76.17	93.24	7	15.91
8106.	pipez (pipez)	44	99.41	116.53	16	36.36
8107.	Kyle (pickles3201)	44	126.22	150.77	26	59.09
8108.	prehistoriczebra (penguin45)	44	62.21	84.74	13	29.55
8109.	An (pastwords)	44	75.59	93.48	16	36.36
8110.	Parth (parthpsh)	44	75.89	94.56	36	81.82
8111.	allie (oatmilf22)	44	62.62	83.78	11	25.00
8112.	¯\_(ツ)_/¯ (nopatno)	44	140.74	189.90	31	70.45
8113.	n0neya (noneyaaa)	44	98.82	114.28	17	38.64
8114.	Niraj (nirajkamat)	44	32.17	39.49	2	4.55
8115.	Yung N8 (ngreene5)	44	63.81	87.45	13	29.55
8116.	(nalyd_on_colemak)	44	101.29	156.07	0	0.00
8117.	J (mr_wood)	44	89.64	112.44	15	34.09
8118.	MrDot (mr_dot)	44	61.00	78.75	11	25.00
8119.	Mo (mosidhom)	44	87.52	109.37	13	29.55
8120.	aindriu (morrisa8)	44	66.24	80.89	8	18.18
8121.	Mohamed (mednoun)	44	63.18	72.10	5	11.36
8122.	Maybe (maybe413)	44	118.62	129.97	22	50.00
8123.	Chanokchon (mantarays)	44	61.80	70.32	9	20.45
8124.	(zesty11)	44	109.68	135.33	14	31.82
8125.	xain (xainq)	44	51.71	62.42	7	15.91
8126.	weston (westonu)	44	97.70	121.73	20	45.45
8127.	Vera (verabee9183)	44	62.15	79.52	9	20.45
8128.	uled (uled)	44	71.40	98.57	18	40.91
8129.	Ryan (typerace_ryan)	44	56.29	68.69	9	20.45
8130.	Dog (tropicaldog17)	44	65.86	86.50	9	20.45
8131.	Cornelio (tirdsaba)	44	53.66	65.54	7	15.91
8132.	Tobiloba (thetobitron)	44	88.34	105.42	9	20.45
8133.	John (thegangplankgod)	44	125.47	152.02	31	70.45
8134.	Ivan (t3ry444y)	44	55.82	65.34	4	9.09
8135.	Bailey (swagoneering)	44	103.19	122.40	14	31.82
8136.	oliver (sushiboyking)	44	94.83	114.58	14	31.82
8137.	chikke (srujan_chikke)	44	31.23	39.38	5	11.36
8138.	beans (squirtly)	44	106.58	126.96	21	47.73
8139.	Hieu (spicy888)	44	61.65	76.67	9	20.45
8140.	thetacosmurgf (smurfer1121)	44	112.00	131.52	22	50.00
8141.	smug (smugwise_the_brave)	44	79.71	100.87	21	47.73
8142.	Zack (smagroda)	44	74.52	85.25	16	36.36
8143.	Anuj (anujsharma411)	44	76.97	90.37	16	36.36
8144.	Ankush (ankushchavhan7596)	44	50.88	60.17	7	15.91
8145.	Ankith101 (ankith101)	44	51.93	69.48	7	15.91
8146.	Amit (amitu7)	44	68.39	83.04	11	25.00
8147.	Al (alriad)	44	59.47	68.28	11	25.00
8148.	Alex (alexkylelee)	44	105.51	138.04	22	50.00
8149.	Aero (aerosoul)	44	67.97	81.86	4	9.09
8150.	10SlowFingers (aabhas)	44	65.51	84.16	6	13.64
8151.	andrew (400wpmalphamale)	44	98.58	136.16	20	45.45
8152.	Ole (olenord)	44	79.53	93.77	11	25.00
8153.	pudding_ (ericedge3315)	44	83.74	97.66	12	27.27
8154.	Syterelic (syterelic)	44	76.52	95.06	14	31.82
8155.	Yuni (yuni190)	44	79.78	99.01	11	25.00
8156.	Balibari, (balibari)	44	73.51	91.13	10	22.73
8157.	Wu (recharge323)	44	48.92	60.35	4	9.09
8158.	Blob (blobby21)	44	62.27	84.11	6	13.64
8159.	Angel (cyclomos)	44	70.07	90.73	6	13.64
8160.	Anand 🇳🇵 (anand_from_...	44	60.66	78.10	7	15.91
8161.	Mohamed (lester_ze_molester)	44	50.54	65.33	3	6.82
8162.	Darkrydier (darkrydier)	44	90.30	114.68	14	31.82
8163.	Llyrad (sopthelast)	44	67.61	77.13	7	15.91
8164.	Regine (regineann)	44	74.19	90.07	10	22.73
8165.	John (fsxsteamboss)	44	57.90	70.69	7	15.91
8166.	Glen (foxdigits)	44	106.96	136.93	20	45.45
8167.	Abhishek (erabh)	44	45.41	56.49	9	20.45
8168.	69 WPM andy (eerietants)	44	69.60	93.46	13	29.55
8169.	tstats[easybeef] (easybeef)	44	62.42	80.11	5	11.36
8170.	Calvin (doyotko)	44	106.83	134.44	18	40.91
8171.	Dan (dgallerz)	44	84.88	106.43	14	31.82
8172.	(dev_origami)	44	96.10	117.05	15	34.09
8173.	Kshitij (desikheeda)	44	69.62	81.18	14	31.82
8174.	washu bishu (demo_admin)	44	121.53	143.36	21	47.73
8175.	Deadman (deadrohan19)	44	43.74	55.56	3	6.82
8176.	Ahmed (deadmoonsoldier)	44	66.78	79.70	9	20.45
8177.	Dash (darkdash)	44	98.73	116.61	17	38.64
8178.	Francis (coronadoloser76)	44	75.92	91.72	11	25.00
8179.	Alexander (codec4)	44	82.49	94.72	8	18.18
8180.	Sop (coachprincesssoppy)	44	67.02	80.39	11	25.00
8181.	Ethan (chung_ethan)	44	72.32	142.94	8	18.18
8182.	Coughingmouse (cexora)	44	63.46	84.33	3	6.82
8183.	Cedric (cedrilicity)	44	85.46	126.57	15	34.09
8184.	Captain (ccap)	44	39.26	50.94	37	84.09
8185.	TypeNightmare (bozijovel)	44	53.64	64.85	0	0.00
8186.	Blue (blueberkeley)	44	90.98	124.32	13	29.55
8187.	be (besalt)	44	85.22	105.90	10	22.73
8188.	k1mbap (beaned_fish)	44	107.78	129.52	29	65.91
8189.	Bae (baenimbae12)	44	84.02	105.70	13	29.55
8190.	bachu (bachu2020)	44	59.38	82.72	12	27.27
8191.	Andres (avillarreal14)	44	87.77	99.35	8	18.18
8192.	Ausar (ausar0)	44	106.92	124.00	22	50.00
8193.	Braylin (atlasrising)	44	106.87	117.08	24	54.55
8194.	Chatura (atakatus)	44	51.40	62.07	4	9.09
8195.	Alex (aselia_azim)	44	48.40	59.10	4	9.09
8196.	ea (fluxheat)	43	54.37	68.09	7	16.28
8197.	faith (flatypus)	43	114.16	146.48	28	65.12
8198.	Tausif (fishey3)	43	63.15	81.36	8	18.60
8199.	Ezzy (ezzzyz)	43	50.05	60.08	3	6.98
8200.	Megaracer BTW (erkytyper)	43	83.04	95.27	14	32.56
8201.	Danny (ecgab)	43	99.44	118.32	17	39.53
8202.	NCCFlame (dysfunctional_dra...	43	92.43	121.21	12	27.91
8203.	Disqusting (disqusting_mclo...	43	50.87	64.71	5	11.63
8204.	Дидакус (didacus)	43	96.71	110.21	17	39.53
8205.	Tony 🐱👤 (demon0192)	43	106.30	128.51	23	53.49
8206.	meow (dalayalia)	43	66.45	82.85	10	23.26
8207.	D (dabirik)	43	64.45	78.66	11	25.58
8208.	CopyNinja09 (copyninja_)	43	44.02	52.03	2	4.65
8209.	Christian (chrisshaw)	43	130.65	154.63	29	67.44
8210.	senpai (chottomatte)	43	86.74	117.60	10	23.26
8211.	Matt (chillmaster)	43	67.43	78.20	10	23.26
8212.	Chase (chezit7)	43	82.09	105.34	11	25.58
8213.	Cassie Lynn (cassielynz_00)	43	72.05	86.65	14	32.56
8214.	Quốc (cangu07042006)	43	112.48	132.39	22	51.16
8215.	typinggawd (brandon934)	43	90.42	115.00	19	44.19
8216.	Nick (bopob)	43	93.62	114.99	22	51.16
8217.	Bil3ygr (bil3ygr)	43	64.14	90.28	9	20.93
8218.	Berty (bertybert)	43	76.93	94.02	18	41.86
8219.	TypingNoob (bekarihh)	43	78.95	95.59	11	25.58
8220.	BanjoBoss (banjoboss)	43	96.08	119.71	20	46.51
8221.	Atom (atom_atom)	43	67.99	85.90	12	27.91
8222.	QuietObedientConsent (arrow...	43	92.78	114.36	13	30.23
8223.	po1nt (_po1nt_)	43	77.00	87.37	13	30.23
8224.	Phi (ze_phi)	43	87.20	102.13	16	37.21
8225.	tstats[yeunakho] (yeunakho)	43	38.49	54.04	3	6.98
8226.	adrian (yeahaight)	43	52.00	75.05	5	11.63
8227.	Coffee Boy (xuantungbrian)	43	45.43	53.92	1	2.33
8228.	Eloona (wombatinmaison)	43	91.27	112.37	14	32.56
8229.	Juan (wolf_1)	43	64.83	77.32	8	18.60
8230.	Prince (wayward_prince)	43	79.88	109.68	13	30.23
8231.	Allan (unknownfiles)	43	100.06	120.76	15	34.88
8232.	Mihkel (tikstiks)	43	81.40	101.94	17	39.53
8233.	Charles (themythicalvlad)	43	107.64	118.91	22	51.16
8234.	Rafael (syrena)	43	87.96	109.14	13	30.23
8235.	Great (synergy__)	43	91.99	113.97	17	39.53
8236.	Steven (steventheplayer)	43	73.38	91.68	16	37.21
8237.	steveleeb (steveleeb)	43	131.27	152.07	22	51.16
8238.	SHRI (srinivasdokare)	43	53.41	69.96	4	9.30
8239.	☞sondv (sondv)	43	90.82	111.04	16	37.21
8240.	Phinix (soaringphinix)	43	84.11	99.62	10	23.26
8241.	Hieu (sn1rep)	43	58.14	70.61	6	13.95
8242.	sirjan (sirwolf208)	43	60.86	67.55	15	34.88
8243.	Dan (sirdanofthedirt)	43	81.61	99.37	11	25.58
8244.	Sarah (shetzah)	43	78.22	99.93	8	18.60
8245.	severed_toast (severedtoast)	43	102.50	140.59	15	34.88
8246.	:( (magtraxer)	43	102.29	134.71	15	34.88
8247.	Trianglateral (luckyashraj)	43	61.16	69.95	7	16.28
8248.	Mohamed Abdallahi (lim_elno...	43	48.33	64.18	8	18.60
8249.	Harley (legendharley)	43	99.28	118.65	19	44.19
8250.	Vũ (khanhyeuquan)	43	88.58	108.08	13	30.23
8251.	shinkou (kashinkou)	43	57.04	75.24	23	53.49
8252.	Jack (jackiechips)	43	31.13	41.66	7	16.28
8253.	Sam (ie_dead)	43	72.41	101.69	9	20.93
8254.	Himanshu (himanshumishra3198)	43	59.74	68.65	11	25.58
8255.	hhdhwuus (hhdhwuus)	43	72.46	88.67	9	20.93
8256.	Momo (helloworldwhatniceday...	43	98.35	120.89	12	27.91
8257.	salad fingers (guuul)	43	117.18	138.03	20	46.51
8258.	Elliot (gofire8)	43	86.32	106.30	7	16.28
8259.	goe (goeeeeeeee)	43	83.16	99.75	0	0.00
8260.	tameflame (gabrieljohngabri...	43	82.04	95.82	9	20.93
8261.	Sanwal (sanwal_junejo0007)	43	47.98	61.30	2	4.65
8262.	Sangi (sangi38)	43	92.00	103.88	13	30.23
8263.	Salehbin (saleh_mksd)	43	34.86	42.47	0	0.00
8264.	ruby (rubymuzz)	43	61.10	85.57	8	18.60
8265.	Kyle Johnson (rickharrisoncoc)	43	85.60	102.58	16	37.21
8266.	Rey (reypanerz)	43	51.38	65.10	8	18.60
8267.	Butchy (randomguy4ever)	43	70.42	90.17	12	27.91
8268.	(quadroopl)	43	159.40	185.48	27	62.79
8269.	j (potatostock)	43	72.13	94.08	11	25.58
8270.	tstats[pook_dvorak] (pook_d...	43	102.35	125.57	15	34.88
8271.	Philip (plip_1021)	43	85.46	94.17	12	27.91
8272.	George (peposss)	43	86.40	94.96	12	27.91
8273.	osso (osso94)	43	70.02	94.49	15	34.88
8274.	oskar (osny19)	43	105.14	123.12	18	41.86
8275.	katie (okaykatieokay)	43	80.06	94.36	8	18.60
8276.	nicole (nkkicole)	43	74.94	94.36	10	23.26
8277.	Aaron (nightcreators)	43	104.37	127.86	16	37.21
8278.	1234 (nemesistroy)	43	70.04	108.55	11	25.58
8279.	lmao (nate11111)	43	101.19	119.32	15	34.88
8280.	Napplebee (napplebee)	43	60.70	73.73	7	16.28
8281.	Nabeel (nabz126)	43	52.76	64.38	6	13.95
8282.	Mohammed (mohammed55555)	43	82.39	93.10	14	32.56
8283.	Mikel (mikelhector)	43	78.10	96.72	19	44.19
8284.	Melas (melas1)	43	98.97	117.14	12	27.91
8285.	Maruberry (maruberry)	43	100.61	126.75	15	34.88
8286.	Armando (mandy1339)	43	84.36	98.47	12	27.91
8287.	Arda (ardat96)	43	59.82	73.44	11	25.58
8288.	Ankit Sarkar (ankitsarkar)	43	49.74	65.46	40	93.02
8289.	Ivan (aivan2)	43	71.97	85.96	11	25.58
8290.	Armon (airtyper_11)	43	82.09	109.59	11	25.58
8291.	ahmed (ahmed393)	43	68.39	76.61	4	9.30
8292.	Aayam (aayam_04)	43	38.62	49.65	1	2.33
8293.	MIke (3nd4u)	43	65.10	86.03	16	37.21
8294.	Leinad (msdfar)	43	72.87	96.59	10	23.26
8295.	iron4in2020 (iron4in2020)	43	64.56	73.71	13	30.23
8296.	Abil (phr0zencr3w)	43	47.03	57.16	7	16.28
8297.	Edward (smegle2)	43	53.55	67.80	4	9.30
8298.	imhemantchaubey (hemantchau...	43	42.56	58.20	2	4.65
8299.	Jake (jake1151)	43	50.52	60.49	2	4.65
8300.	Kpusta (cabbagemans)	43	76.74	91.18	11	25.58
8301.	Josh (josh122203)	43	65.74	80.01	7	16.28
8302.	ryujin's footrest (iankenneth)	43	77.08	90.72	14	32.56
8303.	sygn (sygn_ray)	43	39.72	46.68	2	4.65
8304.	harabau (harabau)	43	70.75	84.65	14	32.56
8305.	Angel (angelrami003)	42	51.55	64.20	2	4.76
8306.	Andrei (andyspeed)	42	72.19	89.57	13	30.95
8307.	Amarant (amarant_)	42	68.27	84.99	7	16.67
8308.	Ahpoo (ahpoo)	42	82.43	103.29	12	28.57
8309.	Adlin (adlin_typer18)	42	69.73	87.84	15	35.71
8310.	accorn (accorn279)	42	128.51	145.35	28	66.67
8311.	Abe (abe299)	42	51.83	67.85	6	14.29
8312.	Rafael (23woodyj)	42	89.86	108.01	13	30.95
8313.	Hunter (sascroc)	42	78.62	98.22	7	16.67
8314.	Fred (fgrady3)	42	60.60	72.51	4	9.52
8315.	Sanjero (sanjero)	42	63.88	77.55	9	21.43
8316.	Vinamr (h_e_y)	42	88.05	101.58	9	21.43
8317.	Eric (kusikiwi)	42	90.12	120.92	11	26.19
8318.	Cloudyrain (cloudy_rain)	42	44.78	60.40	4	9.52
8319.	Hanif (hanifimaduddin)	42	50.28	71.50	6	14.29
8320.	Ceus (simply_ceus)	42	67.92	79.56	12	28.57
8321.	J (jbddiesel)	42	59.70	73.05	11	26.19
8322.	Theo (theomorrison)	42	82.54	97.67	9	21.43
8323.	shanky (shasha06)	42	33.06	43.73	4	9.52
8324.	Raja (rajatype)	42	59.86	77.93	8	19.05
8325.	Pjmarella05 (pjmarella05)	42	55.93	68.36	5	11.90
8326.	Mindy (minnie3319)	42	76.53	89.21	16	38.10
8327.	Wolfgang (wolfgang_69)	42	46.00	62.33	3	7.14
8328.	Fastpoke (make_me_better)	42	69.22	86.07	11	26.19
8329.	maikim (maikim)	42	74.58	90.26	12	28.57
8330.	Mahatej Varma (mahatejvarma)	42	67.32	84.94	11	26.19
8331.	Aman (mag1k_iwnl)	42	63.88	79.92	14	33.33
8332.	Mad (mad888)	42	93.01	117.10	28	66.67
8333.	Luvie (luvie1310)	42	74.73	91.75	15	35.71
8334.	llameow (llameoww)	42	114.04	134.83	25	59.52
8335.	MeguminQT (leonathor)	42	90.48	101.83	20	47.62
8336.	Justin (leethelethal)	42	93.52	111.58	11	26.19
8337.	watchdominion.com (leegunner)	42	100.76	125.28	14	33.33
8338.	kanak (k_a_n_a_k)	42	44.20	58.78	3	7.14
8339.	Andrei (kulturedschwein)	42	54.20	74.25	4	9.52
8340.	sync (kjh2196)	42	102.63	116.28	17	40.48
8341.	Kirti (kirti773)	42	49.43	76.98	3	7.14
8342.	ω (kerdax)	42	79.94	97.66	8	19.05
8343.	john (jpom16)	42	58.77	71.89	9	21.43
8344.	Joshua (joshua172)	42	93.45	115.21	17	40.48
8345.	Aleksije (jastar)	42	45.53	58.60	8	19.05
8346.	Taco (i_the_sausage)	42	86.74	108.92	8	19.05
8347.	ivan (ivanchok)	42	94.14	118.25	15	35.71
8348.	tstats[isakooooo] (isakooooo)	42	121.50	144.23	21	50.00
8349.	Isaac (hyperkids)	42	119.60	142.62	18	42.86
8350.	Noah (hvon)	42	104.42	125.19	19	45.24
8351.	Hussain (hussainkhan)	42	56.80	71.57	4	9.52
8352.	Hreyfill Hreyfill (hreyfill)	42	144.13	180.23	35	83.33
8353.	hahnur (hahnurk)	42	98.28	116.57	16	38.10
8354.	sarah (hahaimsmart)	42	86.17	106.76	15	35.71
8355.	gst (gsttyping)	42	40.96	49.51	4	9.52
8356.	Miyamura (grapewiggler)	42	78.65	94.86	14	33.33
8357.	Gooby (goobygod)	42	98.48	123.90	25	59.52
8358.	Ara (goatrager)	42	64.45	89.79	10	23.81
8359.	Tugssaikhan (gantsogtt)	42	53.14	69.83	9	21.43
8360.	ludwigg (froggg)	42	75.39	100.33	6	14.29
8361.	James (fintero)	42	66.15	83.16	12	28.57
8362.	Eli (elity)	42	72.37	88.07	8	19.05
8363.	(egahbh)	42	134.81	153.40	28	66.67
8364.	Adam (ediggity152005)	42	120.01	135.57	24	57.14
8365.	Dmitriy (dimasidorenko)	42	53.68	62.39	7	16.67
8366.	Talha (digitaldruglord)	42	68.36	75.84	9	21.43
8367.	David (dgiddens928)	42	78.37	101.41	9	21.43
8368.	Devesh (dev344)	42	81.45	92.43	12	28.57
8369.	nielr (danyl)	42	61.76	81.42	6	14.29
8370.	Dingo Dango (dankwanktank)	42	70.65	91.64	14	33.33
8371.	Dude (damonjammin)	42	55.87	72.80	6	14.29
8372.	daikonsama (daikonsama)	42	52.00	66.66	6	14.29
8373.	Daniel (d123aniel)	42	95.71	118.96	18	42.86
8374.	crz316 (crz316)	42	41.23	49.16	2	4.76
8375.	retired, for now ᐢ.‸.�...	42	91.39	104.90	16	38.10
8376.	Chris (chrisk_04)	42	60.25	78.47	5	11.90
8377.	Charlie (charlieeeee)	42	92.54	110.30	16	38.10
8378.	Creams4 (chadzuko)	42	91.72	120.01	10	23.81
8379.	Bodyguard (bxdygxard)	42	50.42	64.07	3	7.14
8380.	Issaree (boranorben)	42	55.68	66.93	2	4.76
8381.	Pranav (bodiez)	42	75.20	101.24	16	38.10
8382.	Bobirjon (bob_pro)	42	61.00	72.84	11	26.19
8383.	Gibson (better_gibby)	42	99.59	120.04	13	30.95
8384.	Ben (benjals9)	42	59.61	78.49	10	23.81
8385.	dean (aydeano)	42	88.19	117.73	10	23.81
8386.	ariyaninj (aryaninj)	42	48.78	70.89	9	21.43
8387.	Zombie (zombiecoder)	42	39.67	50.32	3	7.14
8388.	Kyle (zan9etsu)	42	58.49	73.38	12	28.57
8389.	Yazan (yazan_al)	42	67.72	78.93	12	28.57
8390.	Yas'-' (yaser_)	42	64.92	79.80	6	14.29
8391.	Chris (wupops)	42	62.04	82.00	12	28.57
8392.	MistakesWereMade (workmanty...	42	81.85	99.00	16	38.10
8393.	Adrian (whyisthisnotavailable)	42	104.98	135.56	26	61.90
8394.	Why (whyare)	42	78.91	132.92	10	23.81
8395.	Vova (v_hg_p)	42	56.41	76.53	4	9.52
8396.	vix (vrinze)	42	77.26	92.64	9	21.43
8397.	usstudent101 (usstudent101)	42	107.97	140.13	22	52.38
8398.	Roma (useflame)	42	88.20	103.80	12	28.57
8399.	w_mb1 (trundling)	42	89.42	106.40	23	54.76
8400.	Alisher (tourist671)	42	60.62	74.81	14	33.33
8401.	justice (totorek)	42	39.86	51.27	2	4.76
8402.	keychronk6 (theonlydvorakguy)	42	103.68	121.06	18	42.86
8403.	sw0rd (sw0rd)	42	82.17	101.65	15	35.71
8404.	Tomas (sumtinlazy)	42	108.11	126.92	19	45.24
8405.	reever (ssamu)	42	85.59	108.09	11	26.19
8406.	Ahmad (slayman19)	42	133.57	168.27	27	64.29
8407.	Ludwig (simontypo)	42	68.42	86.75	15	35.71
8408.	shrenik (shrenikr235)	42	90.85	128.02	16	38.10
8409.	Shiv (shivam9_)	42	58.98	73.97	13	30.95
8410.	Shift (shiftw)	42	77.05	94.54	14	33.33
8411.	Scooby (scoobydooby)	42	53.33	65.51	2	4.76
8412.	Sanyeet (sanyeet)	42	86.50	104.89	14	33.33
8413.	Sam (sam3456)	42	87.01	110.61	10	23.81
8414.	Ruben (rubenzhang)	42	93.46	108.15	15	35.71
8415.	RjTvqH (rjtvqh)	42	68.99	84.55	7	16.67
8416.	Ros (ric_ros_839)	42	41.46	48.75	5	11.90
8417.	Fedor (raxker)	42	47.26	53.67	1	2.38
8418.	Rain (rainy)	42	70.00	98.38	10	23.81
8419.	Parv (parvmodi)	42	56.93	65.66	6	14.29
8420.	omarmejiaa (omarmejiaa)	42	54.57	67.02	6	14.29
8421.	Niofer (niofer)	42	77.76	98.52	8	19.05
8422.	nea (neapollotan)	42	70.67	85.42	8	19.05
8423.	Naulitus (naulitus)	42	69.15	79.64	11	26.19
8424.	Kristijonas (nasyrke)	42	78.70	90.81	16	38.10
8425.	1step (narcindin)	42	104.88	130.93	14	33.33
8426.	Dominik (monteymontey)	42	89.74	112.01	14	33.33
8427.	Anonymous (mntlprblm)	42	87.52	113.60	17	40.48
8428.	mt (migclare)	42	87.69	109.61	13	30.95
8429.	Lőrinc (mbalazs)	42	107.93	119.31	24	57.14
8430.	Mathyou (mathyou_177)	42	69.84	78.80	5	11.90
8431.	Masy (masy404)	42	66.49	82.20	36	85.71
8432.	Sander (s4ndert)	41	61.21	85.26	12	29.27
8433.	Rubin (rubintypes)	41	81.34	95.39	12	29.27
8434.	Robby (roweki21)	41	81.90	100.17	14	34.15
8435.	Ripon Kumar (riponcse)	41	60.05	79.24	9	21.95
8436.	Stefan (ringding)	41	102.93	122.57	12	29.27
8437.	Rimuru (rim_uru)	41	54.19	64.16	3	7.32
8438.	R1CZ4RD (riczard)	41	51.61	61.81	4	9.76
8439.	Richie (richiemoring)	41	45.90	58.78	2	4.88
8440.	Shawn (rcvroom)	41	109.02	128.62	25	60.98
8441.	raymond (raymondgggg)	41	81.18	100.20	4	9.76
8442.	Ravi (raviparasar1997@gmail...	41	67.90	84.08	10	24.39
8443.	Renzo (raccon)	41	76.12	99.26	13	31.71
8444.	person (person625)	41	108.56	121.97	18	43.90
8445.	oToToT (ototot3ot)	41	68.70	80.80	10	24.39
8446.	noctedie (noctedie)	41	70.28	98.35	13	31.71
8447.	Nishit (nishit130)	41	60.79	77.15	9	21.95
8448.	Nick (nicklong1599)	41	109.19	127.53	21	51.22
8449.	Naren Manikandan (nane_m)	41	64.68	77.56	8	19.51
8450.	ko (nakanidashite)	41	63.08	85.91	12	29.27
8451.	Mon (m_nguyen05)	41	63.26	73.72	10	24.39
8452.	Princh (mvprinch)	41	113.99	135.75	24	58.54
8453.	Ricky (muffinpotato)	41	99.70	116.99	23	56.10
8454.	Moola_80wpm (moola_80wpm)	41	59.96	71.36	7	17.07
8455.	Kato (mkatoh)	41	87.50	108.43	15	36.59
8456.	Mukul (mega_mukul)	41	56.23	63.26	6	14.63
8457.	Potato (mega_juicer)	41	92.27	115.41	9	21.95
8458.	thomas (maxipixels)	41	77.76	102.62	13	31.71
8459.	Bojongkers (manqjayak)	41	98.90	122.33	18	43.90
8460.	frog! (froggysauce)	41	72.21	92.18	17	41.46
8461.	FRATNIX (fratnix)	41	70.68	84.35	13	31.71
8462.	Takumi (fractylz)	41	92.30	112.54	11	26.83
8463.	flaskur (flaskur)	41	88.42	103.39	10	24.39
8464.	A (fdsjaklfdsaj)	41	96.66	113.91	16	39.02
8465.	Luffy (fawnful)	41	52.87	65.34	4	9.76
8466.	Urolbek (faithful_1707)	41	65.48	77.01	8	19.51
8467.	karovD (fablem_workman)	41	77.18	97.88	12	29.27
8468.	mushykeys (exileflame282004)	41	68.87	85.60	4	9.76
8469.	Reetu Raj (eternal77)	41	41.57	50.39	7	17.07
8470.	Jennifer (ennyvanna)	41	18.02	22.53	7	17.07
8471.	John (enhoj22)	41	75.54	84.41	8	19.51
8472.	Emiesh (emiway247)	41	42.75	52.52	12	29.27
8473.	Joze (el_lobe)	41	106.08	127.65	18	43.90
8474.	Carrot (elelin)	41	58.03	72.36	11	26.83
8475.	BiggyBallsHD (egg_plant_pete)	41	53.29	65.86	3	7.32
8476.	Chris (eb_p0pe)	41	99.10	136.65	14	34.15
8477.	Dunkmasta (dunkmasta)	41	93.44	114.21	21	51.22
8478.	beep (doinyamom1337)	41	56.11	68.56	6	14.63
8479.	Jochwa (djoshuahebert)	41	80.67	96.33	12	29.27
8480.	D. (dissonvnt)	41	63.56	84.21	6	14.63
8481.	Dean (de4n_whit3)	41	100.06	127.57	25	60.98
8482.	colin (crustyrustonline)	41	55.67	79.48	7	17.07
8483.	N (crazycalm007)	41	88.14	105.61	9	21.95
8484.	CPL62Connor (cpl62_connorx)	41	53.93	68.84	9	21.95
8485.	coolfission (coolfission)	41	118.84	130.70	21	51.22
8486.	Confetix (confetix)	41	94.40	118.53	14	34.15
8487.	Cheney (cheneyc9999)	41	81.28	104.20	16	39.02
8488.	catfree (catfree)	41	116.05	130.95	21	51.22
8489.	Carter (carter44502)	41	87.76	102.10	10	24.39
8490.	Jasckon (camochameleon56)	41	79.18	95.06	11	26.83
8491.	sixten (calvin2)	41	81.25	98.70	11	26.83
8492.	b (byron911)	41	68.62	94.85	11	26.83
8493.	Brock (brockbnntt)	41	84.25	110.86	15	36.59
8494.	Brendan (brendanlo4)	41	93.10	109.18	19	46.34
8495.	tstats[borzoian40] (borzoia...	41	87.46	106.13	18	43.90
8496.	Boomer (boomer_typer)	41	88.51	111.75	9	21.95
8497.	Noob (bloodylord)	41	46.17	63.67	11	26.83
8498.	Bikash (bikash_grg)	41	70.29	88.20	9	21.95
8499.	Mouse (atypingmouse)	41	71.65	87.41	12	29.27
8500.	Karina (asapkarina)	41	74.39	102.85	13	31.71
8501.	Jack (arcinae)	41	120.42	152.31	27	65.85
8502.	Amir (48u_54l1m)	41	78.46	90.37	10	24.39
8503.	Denny (yoanesdenny)	41	57.54	70.73	5	12.20
8504.	Periodude (rastapasta_ke)	41	61.02	72.94	9	21.95
8505.	light (light_dawn)	41	55.70	67.01	5	12.20
8506.	Connor (connoc)	41	54.71	71.28	4	9.76
8507.	kem (krelma)	41	90.70	110.83	17	41.46
8508.	Kiet (fagala)	41	46.99	54.05	5	12.20
8509.	Ben (xlockedbw)	41	44.00	60.38	1	2.44
8510.	Miguel Demonteverde (migs0999)	41	64.74	85.65	11	26.83
8511.	MajesticBudder (majesticbud...	41	78.70	91.54	6	14.63
8512.	𝔏𝔦𝔪𝔬𝔟𝔢�...	41	55.53	64.94	2	4.88
8513.	Lalith Sharma (lalith_sharma7)	41	40.17	51.70	6	14.63
8514.	Lelu (laku_)	41	121.76	143.02	24	58.54
8515.	Kyle (kyman73)	41	99.97	127.06	16	39.02
8516.	Pawan (kpawans00533)	41	66.03	78.43	5	12.20
8517.	Kitzuney (kitzuney)	41	85.05	95.74	13	31.71
8518.	NO (kinda_weird_bro)	41	42.86	56.04	6	14.63
8519.	Sebastian (jschavesr)	41	59.82	74.99	3	7.32
8520.	JC (jollibeech)	41	76.61	90.80	23	56.10
8521.	Jake (jkdriven)	41	81.06	98.75	10	24.39
8522.	Jiawei (jiaweilin)	41	54.96	69.59	5	12.20
8523.	Jack (jack__toast)	41	81.20	96.08	9	21.95
8524.	flaneur simp (inariii)	41	149.68	183.65	8	19.51
8525.	kei (impeeverything)	41	129.64	165.19	25	60.98
8526.	illa (iladnas)	41	54.44	68.45	6	14.63
8527.	Jim (hockeyhead019)	41	96.29	110.93	14	34.15
8528.	Manish (hi_son)	41	43.74	62.48	6	14.63
8529.	Gunter (gunter1963)	41	47.35	58.60	5	12.20
8530.	Kieran (godquack)	41	65.91	76.75	10	24.39
8531.	Mr (glock19)	41	64.46	83.03	5	12.20
8532.	get_on_board (get_on_board)	41	98.39	114.39	21	51.22
8533.	georgebax (gbax)	41	94.51	112.69	14	34.15
8534.	Andrew (fyir)	41	71.31	90.35	13	31.71
8535.	Nyx (_nyxx_)	41	27.17	31.39	13	31.71
8536.	zefanya24k (zefanya24k)	41	111.80	132.29	18	43.90
8537.	banvotesgames (x_adware)	41	123.34	153.41	16	39.02
8538.	Bryan (xxavalonxx)	41	64.62	75.39	11	26.83
8539.	Waterman304 (waterman304)	41	99.27	111.75	12	29.27
8540.	Walnert (walnert)	41	96.60	115.29	24	58.54
8541.	Hai (vroyibg)	41	61.00	72.31	8	19.51
8542.	Pieter (umbravanlocks)	41	67.73	82.16	6	14.63
8543.	Car (ufoes)	41	75.76	93.51	7	17.07
8544.	Uladzislau (tumilok)	41	66.73	79.42	12	29.27
8545.	AJ (theloafingone)	41	109.08	131.73	28	68.29
8546.	em (thelawsofjay)	41	130.68	155.15	29	70.73
8547.	Bro (termog)	41	72.68	87.45	14	34.15
8548.	sean (tak32)	41	83.66	99.97	5	12.20
8549.	Josh (syztyqus)	41	82.97	94.64	14	34.15
8550.	Sujal (sujal_fast)	41	53.98	69.14	4	9.76
8551.	Hhhh (strawbirry)	41	93.41	116.88	14	34.15
8552.	Simone (simone79)	41	76.57	83.88	12	29.27
8553.	Gabe (silentsnake2398)	41	72.50	85.63	9	21.95
8554.	SHU (shu_ik)	41	84.80	107.25	14	34.15
8555.	BAZINGA (shruthi_)	41	54.42	61.89	3	7.32
8556.	Alex (servicer)	41	76.07	96.92	12	29.27
8557.	SECsplitOND (secsplitond)	41	96.58	122.99	20	48.78
8558.	scubtle (scrubsworth)	41	88.31	100.20	15	36.59
8559.	Ruby (_truby)	40	66.36	91.66	9	22.50
8560.	Alex (zipphys)	40	82.07	101.67	10	25.00
8561.	Ja (zentojamorn)	40	80.89	106.66	12	30.00
8562.	Yasser (yesserspeed)	40	64.68	78.61	12	30.00
8563.	ぜんじろう (yablu)	40	57.68	68.31	16	40.00
8564.	Sarves (xmemestar420)	40	98.53	122.17	13	32.50
8565.	Mato (xholm)	40	57.15	66.17	7	17.50
8566.	Whitecap (whitecap)	40	65.08	79.41	7	17.50
8567.	Wealthycentro (wealthycentro)	40	82.54	103.51	18	45.00
8568.	karina (wattisgone)	40	88.85	108.57	14	35.00
8569.	Enosh (watahec)	40	83.27	101.76	13	32.50
8570.	Vanessa (vanessahjp)	40	61.11	76.01	10	25.00
8571.	name (username04)	40	75.58	94.66	10	25.00
8572.	Uros (uroskrunic1988)	40	88.01	100.11	13	32.50
8573.	Joshua (twinklestarchild)	40	65.85	82.61	13	32.50
8574.	Esi (tsoob)	40	52.09	60.79	3	7.50
8575.	Tsuguto (tkogamer)	40	81.16	100.12	8	20.00
8576.	Doomer (thedoomer)	40	71.92	86.24	14	35.00
8577.	miranda (tfond)	40	75.60	83.95	10	25.00
8578.	Taco (tacobandit)	40	103.89	125.83	12	30.00
8579.	Shivam (swadhwa)	40	70.59	91.93	13	32.50
8580.	superss2104 (superss2104)	40	71.84	89.48	7	17.50
8581.	Sravan (sravanstg)	40	54.45	64.70	8	20.00
8582.	sqbaee (sqbaee)	40	41.50	47.72	5	12.50
8583.	Sonase (sonase19)	40	65.25	82.62	10	25.00
8584.	Joe Smith (slowtypingdino)	40	41.04	54.47	1	2.50
8585.	Joe (siyyy)	40	107.83	132.28	17	42.50
8586.	sir (sirhelp)	40	86.70	100.98	10	25.00
8587.	Alex (silverax3)	40	87.71	101.78	13	32.50
8588.	shinutsi (shinutsi)	40	89.76	104.62	17	42.50
8589.	Barry (shahkulu)	40	72.01	93.19	23	57.50
8590.	Soham (shadeoxide)	40	97.76	115.19	16	40.00
8591.	chandra (sekhar_88)	40	69.54	81.59	9	22.50
8592.	Ahadh (sedoninju)	40	53.88	63.77	9	22.50
8593.	Ariel (arielkusnoto)	40	68.72	84.73	8	20.00
8594.	Ansh (anshghosh)	40	93.24	114.88	16	40.00
8595.	Aditya (anonymoose17)	40	89.91	110.91	9	22.50
8596.	Daniel (akr115)	40	48.67	58.68	3	7.50
8597.	AbsoluteZeroK (absolutezero...	40	88.54	105.39	15	37.50
8598.	Aaron (aasworth)	40	75.05	94.35	10	25.00
8599.	Aarondn34 (aarondn34)	40	82.68	98.97	6	15.00
8600.	Peter (1_peter_1)	40	53.56	60.60	5	12.50
8601.	Dennis (1nys)	40	76.95	100.45	12	30.00
8602.	(19wpmavg)	40	87.07	104.79	16	40.00
8603.	Speedy (iamspeeeeeeeed)	40	53.82	65.14	1	2.50
8604.	Astolfo (astolfokawaii)	40	36.14	46.94	4	10.00
8605.	Yogender Singh Jadon (yogen...	40	91.79	113.91	17	42.50
8606.	champ (kalmaxz)	40	41.00	58.01	6	15.00
8607.	mal (malrie)	40	55.00	66.44	6	15.00
8608.	Crinum (crinum)	40	49.23	69.29	4	10.00
8609.	Ahnaf (crimson_doe)	40	57.10	67.72	4	10.00
8610.	SOUL (soul699)	40	44.57	61.15	10	25.00
8611.	jackes (jackez)	40	32.00	41.95	0	0.00
8612.	Ibrohim (reedox)	40	47.11	59.72	9	22.50
8613.	Cryptic (mbgamer01248)	40	68.34	81.42	11	27.50
8614.	Rahil (thekaratekid)	40	81.23	105.87	34	85.00
8615.	Guido (guidofe)	40	59.61	77.76	5	12.50
8616.	30 wpm typer (harshshelar)	40	37.80	47.86	2	5.00
8617.	TextingDriver (shandysk)	40	68.86	76.90	6	15.00
8618.	sarthak (sarthak14327)	40	52.95	64.00	3	7.50
8619.	Rowan (rusicus)	40	72.42	93.01	10	25.00
8620.	geoff_g (roy_the_gizm0)	40	51.68	63.53	6	15.00
8621.	Roy (royzz)	40	87.06	108.36	16	40.00
8622.	rothdu (rothdu)	40	80.52	97.55	9	22.50
8623.	Zapphy (ronaldlincon)	40	88.15	114.57	27	67.50
8624.	Ronak (ronakkaria)	40	101.66	138.65	20	50.00
8625.	Trung (rohan86)	40	61.16	71.09	8	20.00
8626.	rodaina (rodaina)	40	35.28	47.77	4	10.00
8627.	Earnest (redwhirl)	40	87.88	97.91	15	37.50
8628.	Razor (razor_1)	40	72.05	91.34	11	27.50
8629.	FREE XANDER (razorlemon2)	40	146.36	223.70	25	62.50
8630.	Matt (purple_gorilla21)	40	71.66	88.96	9	22.50
8631.	Raphael (purified_salt)	40	69.45	86.39	10	25.00
8632.	Bodhi$attiva (ptran)	40	84.85	107.19	11	27.50
8633.	Artichoke (poofydragon)	40	74.62	93.73	11	27.50
8634.	Jason (poleam)	40	86.38	112.95	15	37.50
8635.	getfingrd (piggo1228)	40	103.82	123.80	16	40.00
8636.	Joel (phitsuh)	40	101.94	121.32	19	47.50
8637.	Dimitri (penguinhams)	40	93.03	120.74	14	35.00
8638.	Paul (obtrunco)	40	83.86	95.04	9	22.50
8639.	Andy (nycnets15)	40	111.38	143.47	19	47.50
8640.	Kazz (nutkazz)	40	74.72	91.56	12	30.00
8641.	Norbert (norbert515)	40	93.91	113.99	15	37.50
8642.	justme (nightval)	40	96.04	126.08	15	37.50
8643.	Nicole (nickizard)	40	45.48	69.96	3	7.50
8644.	Viktor (niandog)	40	52.96	66.25	5	12.50
8645.	Nawaraj Bista (nawaking)	40	52.87	65.54	4	10.00
8646.	Joe Mama (musicalsquire)	40	121.44	148.43	20	50.00
8647.	Mohamed (mohamedemad13)	40	72.92	87.51	10	25.00
8648.	Jack (modesties)	40	84.05	100.25	14	35.00
8649.	micur (micur)	40	107.00	125.57	21	52.50
8650.	Mendel (mendeljacks)	40	96.96	113.57	20	50.00
8651.	Memat (memat)	40	97.98	121.18	23	57.50
8652.	Mikel (meekay)	40	96.57	119.64	14	35.00
8653.	medo (medocool)	40	79.00	94.62	10	25.00
8654.	Nicholas (massive_nick)	40	72.74	94.89	20	50.00
8655.	tstats[manuelnara] (manueln...	40	51.98	66.44	4	10.00
8656.	Kieran (manawa)	40	77.39	100.48	15	37.50
8657.	Feras (frsbg)	40	92.36	118.28	13	32.50
8658.	fakhry (fakhryodi)	40	67.77	87.57	10	25.00
8659.	paranoid (enemy1337)	40	77.34	95.89	9	22.50
8660.	dwikydd (dwikydd)	40	77.77	91.83	12	30.00
8661.	ballentine (drinkitup)	40	106.14	130.07	24	60.00
8662.	Tahsin (drevil13)	40	84.92	99.19	12	30.00
8663.	Dorel (dorelm)	40	80.86	107.01	12	30.00
8664.	David (david_nguyen21)	40	67.70	82.03	4	10.00
8665.	curtavian (curtavi)	40	44.17	53.78	3	7.50
8666.	CulinArki (culinarki)	40	78.25	91.98	7	17.50
8667.	Blank (ct7567)	40	92.37	104.88	10	25.00
8668.	chuu (chuuceae)	40	100.76	127.19	36	90.00
8669.	Chet (chethus)	40	100.50	120.75	12	30.00
8670.	Peter (ch9cken)	40	93.39	123.21	12	30.00
8671.	Candlelight (candlelight8)	40	84.72	103.65	12	30.00
8672.	Abdullah (bunajim)	40	62.84	80.58	12	30.00
8673.	Braden (brad9181)	40	74.95	93.51	10	25.00
8674.	Bottlecapbottom (bottlecapb...	40	57.41	67.03	4	10.00
8675.	botlof (botl0f)	40	77.60	93.18	7	17.50
8676.	Joe (bop1000)	40	100.84	116.67	16	40.00
8677.	Emmanuel (blaez_)	40	67.73	78.58	16	40.00
8678.	BJ (bjfoutz00)	40	89.25	115.49	8	20.00
8679.	Bhuvanesh (bhuvaneshh)	40	35.44	43.56	3	7.50
8680.	roshan (bhattaroshan)	40	81.13	89.51	11	27.50
8681.	BetTheDerp (betthederp)	40	108.85	140.35	27	67.50
8682.	Betelgeuse (betelgeuse2310)	40	45.81	60.24	2	5.00
8683.	BakesChamp (bakes1223)	40	111.03	132.62	23	57.50
8684.	Aviral (aviralbh1)	40	87.10	103.01	17	42.50
8685.	Yogeshwar (mad_steins)	40	63.43	76.81	5	12.50
8686.	lolwut9001 (lolwut9001)	40	116.83	148.85	24	60.00
8687.	logicism (logicism)	40	105.52	123.76	17	42.50
8688.	Lil (liljuicy)	40	97.04	127.12	14	35.00
8689.	Lorenzo (leroiken11)	40	76.26	97.84	6	15.00
8690.	(lassolass)	40	80.65	97.62	13	32.50
8691.	Landers (landersex)	40	94.15	106.61	16	40.00
8692.	KronosBruh (kronosbruh)	40	63.04	86.20	7	17.50
8693.	Kris (kris510)	40	54.20	61.05	4	10.00
8694.	kr02lc (kreadzz)	40	81.05	109.00	17	42.50
8695.	Felipe (krakon_3)	40	74.21	90.43	8	20.00
8696.	Kornel (kornelt)	40	76.82	94.03	9	22.50
8697.	killerman (killerman_007)	40	54.19	73.81	12	30.00
8698.	Kiiryuu (kiiryuu)	40	110.57	127.39	19	47.50
8699.	Marcin (kawre)	40	92.21	117.08	14	35.00
8700.	Katherine (katherinekelly2012)	40	73.76	88.93	27	67.50
8701.	Kamen (kamen08)	40	63.74	82.01	11	27.50
8702.	Md Abdul (kader)	40	34.09	47.88	1	2.50
8703.	Josh (josh_carlin)	40	63.11	78.61	8	20.00
8704.	johnick44 (johnick44)	40	71.24	83.16	7	17.50
8705.	Jewmo (jewmo)	40	88.37	107.20	24	60.00
8706.	N o y b (jet1k)	40	105.04	120.75	19	47.50
8707.	Jester (jestertyper)	40	142.46	175.43	24	60.00
8708.	Jakob (jakobgran)	40	63.13	80.59	9	22.50
8709.	Jack (jacknachos)	40	77.89	96.09	12	30.00
8710.	J0kerJ4y (j0kerj4y)	40	106.58	124.16	18	45.00
8711.	skippie (itsskippie)	40	104.65	123.50	21	52.50
8712.	marvic (itsmarvic)	40	85.43	106.94	12	30.00
8713.	Issam (issam_08)	40	57.11	69.35	5	12.50
8714.	Ishaan (ishaanmahajan)	40	46.76	56.86	24	60.00
8715.	Jan (ingenieur)	40	84.19	97.98	12	30.00
8716.	Aayush (imqwerty)	40	106.82	123.26	21	52.50
8717.	ihateonyou (ihateonyou)	40	126.77	156.08	27	67.50
8718.	iCanBreathe (icanbreathe)	40	91.42	114.80	15	37.50
8719.	hotbx (hotbxlockbx)	40	80.80	93.90	15	37.50
8720.	Harry (harrycc3000)	40	87.08	100.23	16	40.00
8721.	Gareth (garethlyh)	40	90.19	109.84	13	32.50
8722.	lucas (lucas757)	39	86.98	104.17	9	23.08
8723.	Lotus (lotus7)	39	99.91	118.74	14	35.90
8724.	Locus (locus_)	39	54.47	62.33	3	7.69
8725.	Fredric (lockheart456)	39	74.26	89.07	9	23.08
8726.	Omik (litynity)	39	44.79	61.33	7	17.95
8727.	Tiger (lilnhan)	39	79.69	92.83	6	15.38
8728.	Jozef (lawalamp12)	39	88.91	101.58	20	51.28
8729.	kyle (kylesch)	39	104.23	115.48	13	33.33
8730.	kyasaa (kyasaa)	39	70.38	81.77	13	33.33
8731.	Hehe (kumotz)	39	64.91	85.18	17	43.59
8732.	Manas (kingmanas)	39	74.26	87.08	8	20.51
8733.	Nathan (killzs)	39	68.69	83.40	9	23.08
8734.	kila (kila_lol)	39	57.04	68.22	3	7.69
8735.	kifumi (kifumi)	39	113.94	129.96	19	48.72
8736.	Khawla Halim (khawla_hlm)	39	39.46	46.23	3	7.69
8737.	keval (keval18)	39	70.20	84.11	10	25.64
8738.	Le Kang (kangkanglw)	39	71.26	89.85	11	28.21
8739.	josiah (josiah_is_weird)	39	60.87	73.25	8	20.51
8740.	ジョン (johnr_)	39	110.11	150.97	21	53.85
8741.	Johnny (johnnyquest30)	39	91.10	104.81	37	94.87
8742.	Jen (jen_23)	39	83.09	108.86	18	46.15
8743.	William (ithan)	39	64.11	85.13	9	23.08
8744.	Izzy (ishey)	39	101.73	126.32	14	35.90
8745.	Inrieal. (inrieal)	39	56.93	67.74	4	10.26
8746.	InboxRatio (inboxratio)	39	74.67	87.59	13	33.33
8747.	can we have some simple sho...	39	120.72	162.37	23	58.97
8748.	. (hiradesuwu)	39	59.30	73.00	11	28.21
8749.	himanshu (himanshukumar_ce)	39	47.85	60.52	4	10.26
8750.	Brandon (hereisausername2)	39	150.39	178.38	19	48.72
8751.	llllllllll (gndndfs)	39	61.28	74.07	10	25.64
8752.	. (ggsnipes)	39	85.52	103.00	14	35.90
8753.	George (geoju)	39	85.15	106.75	13	33.33
8754.	Saphrog (saphrog)	39	69.89	87.36	8	20.51
8755.	Varun (salmonwings8207)	39	59.19	72.60	10	25.64
8756.	Sajal (sajal0809)	39	45.05	55.95	3	7.69
8757.	ALIF (ronin98)	39	58.78	70.46	6	15.38
8758.	Ricky (rickestsot)	39	96.82	118.33	19	48.72
8759.	rethya (reimogi)	39	117.21	142.62	18	46.15
8760.	Rehan (rehan_vibes)	39	52.60	70.22	25	64.10
8761.	Ray (ray_jan)	39	32.33	39.32	1	2.56
8762.	Jr (rattllingsecret)	39	60.20	74.34	26	66.67
8763.	Gary (prtuc2)	39	78.36	91.13	10	25.64
8764.	Allan (pronewb2325)	39	56.48	68.06	8	20.51
8765.	PRANADALA (pranadala)	39	76.76	88.57	17	43.59
8766.	Anar (pomegarnet)	39	57.74	74.56	7	17.95
8767.	pono (pnawan)	39	88.35	115.13	17	43.59
8768.	Pluufi (pluufi)	39	104.97	125.56	34	87.18
8769.	Gwen (planetzero)	39	45.99	60.23	4	10.26
8770.	Xhu (okxhu)	39	75.88	91.51	11	28.21
8771.	Kostboss (okostas)	39	112.56	127.64	18	46.15
8772.	Rami (nub_paws)	39	92.74	106.00	14	35.90
8773.	Allay (noob_wrath)	39	94.81	111.10	12	30.77
8774.	kdjaiel (nobody42)	39	26.60	35.42	3	7.69
8775.	ni (nischalace)	39	64.08	81.41	12	30.77
8776.	Angel (ninjasneak543)	39	82.67	97.77	13	33.33
8777.	Nilias (nilias121)	39	79.42	92.58	11	28.21
8778.	Ali (naseria1)	39	62.28	80.64	10	25.64
8779.	Nabil (nabil_aldihni)	39	107.72	132.51	20	51.28
8780.	Alex (mysterybox)	39	90.46	115.68	20	51.28
8781.	Austin (millerlite)	39	54.24	65.94	3	7.69
8782.	Christopher (milk38)	39	42.73	54.26	2	5.13
8783.	Enkh-Och (mglstew)	39	84.24	110.74	26	66.67
8784.	It's Davda ✅👣 (meetdavda)	39	118.84	137.59	25	64.10
8785.	Louis (meenepo)	39	107.31	137.45	15	38.46
8786.	maufry (maufry)	39	90.79	112.64	11	28.21
8787.	Divyansh (_divyanshwastaken)	39	24.25	33.53	9	23.08
8788.	( ͡° ͜ʖ ͡°) (zarthax69)	39	100.58	125.44	19	48.72
8789.	Allison (zarfynn)	39	89.36	106.26	15	38.46
8790.	Shivesh Tiwari (yuvanastra)	39	66.22	87.77	13	33.33
8791.	Le (yorkist)	39	55.32	68.36	9	23.08
8792.	yonatan (yonatanlib)	39	59.74	71.03	2	5.13
8793.	Venus (xxvenusxx)	39	70.39	91.87	10	25.64
8794.	William (williamc7879)	39	124.41	158.72	33	84.62
8795.	Jason (wepanator)	39	60.83	76.15	8	20.51
8796.	William (wdk5013)	39	88.87	111.65	16	41.03
8797.	Roger (walki_bv)	39	47.82	54.94	3	7.69
8798.	Vlad (vladdycrz)	39	90.48	112.48	11	28.21
8799.	Vivek (vivekjoshi556)	39	77.90	96.07	11	28.21
8800.	vee (veedoze)	39	86.09	107.14	10	25.64
8801.	Tiago (tiagval)	39	57.11	75.43	7	17.95
8802.	Thunder (thunder05)	39	38.19	50.26	0	0.00
8803.	spoon (thrownspoon)	39	65.82	83.09	6	15.38
8804.	The Medium (themedium)	39	61.57	71.27	6	15.38
8805.	Bourdon 16' (thekeyofg)	39	90.86	103.39	14	35.90
8806.	suff (suffy2)	39	53.80	71.86	9	23.08
8807.	burgir. (sub10cuber)	39	103.45	126.27	14	35.90
8808.	0 (studdab)	39	54.82	63.38	2	5.13
8809.	ya (stfudesu)	39	96.75	125.33	15	38.46
8810.	Juey (spyrox)	39	66.94	79.54	6	15.38
8811.	Loudy (skolchem)	39	54.11	65.03	5	12.82
8812.	Kevin (siacker)	39	128.18	160.52	28	71.79
8813.	Shobaik (shobaik_04)	39	49.54	60.38	6	15.38
8814.	ariferrari (ariferrari)	39	60.99	75.90	6	15.38
8815.	Max (antmanmax)	39	122.66	141.91	24	61.54
8816.	Anmulla (anmulla)	39	29.53	39.44	5	12.82
8817.	Andy (andyjg47)	39	107.49	140.00	19	48.72
8818.	anand (anandzzz1973)	39	64.01	81.59	15	38.46
8819.	Aman (aman_7002)	39	39.87	47.18	5	12.82
8820.	ALostKorean (alostkorean)	39	104.52	132.05	16	41.03
8821.	Arthur (agouraptor)	39	45.13	60.46	2	5.13
8822.	Jacques (acesfracked)	39	79.45	91.61	13	33.33
8823.	Syam (aaasssppp)	39	43.11	56.85	10	25.64
8824.	রাতুল (1415926535...	39	58.27	72.11	5	12.82
8825.	Hugo (vangoulard)	39	50.18	63.76	4	10.26
8826.	Elec (elecki)	39	56.65	70.95	14	35.90
8827.	Narki (narkivitek)	39	62.07	78.77	4	10.26
8828.	Daniel (yourfqace)	39	90.37	116.85	15	38.46
8829.	Kingsley (cyber_br0)	39	46.07	57.92	4	10.26
8830.	Kartikeya (karotiko)	39	70.21	87.60	9	23.08
8831.	TPK (tpk_coff33)	39	48.81	62.47	6	15.38
8832.	eli (ollro)	39	56.11	70.69	14	35.90
8833.	yousef (yousef3)	39	33.16	43.83	11	28.21
8834.	Bruzsa (bruzs)	39	54.41	66.37	2	5.13
8835.	saketh (saketh_v)	39	47.80	57.44	4	10.26
8836.	Shagirthan (vemidse)	39	42.70	48.23	4	10.26
8837.	Noodles (47noodles)	39	72.92	82.35	20	51.28
8838.	eivind (limberton)	39	68.77	95.80	13	33.33
8839.	Racharg (freedobby)	39	73.40	90.50	7	17.95
8840.	Benny (fransiskusbenny)	39	55.10	68.73	5	12.82
8841.	fen (fen10)	39	107.41	155.44	22	56.41
8842.	slowboiken (fastken)	39	81.66	98.93	9	23.08
8843.	Ethna (ethna)	39	86.46	103.72	11	28.21
8844.	end (end_pro)	39	65.76	82.72	7	17.95
8845.	EkBros (ekbros9_)	39	76.11	96.31	8	20.51
8846.	kuan-yu (edisonhello)	39	78.97	90.36	5	12.82
8847.	Raul (eatmydusthoe)	39	67.64	83.68	7	17.95
8848.	Driew (driew)	39	88.73	113.79	14	35.90
8849.	From the river to the sea (...	39	86.75	111.10	11	28.21
8850.	Kuczora (drael1024)	39	99.05	123.02	19	48.72
8851.	Daniele (dprimon)	39	36.62	46.38	3	7.69
8852.	Robin (dontcallmenymphadora)	39	80.41	96.52	11	28.21
8853.	Dongles (dongles)	39	128.11	159.88	28	71.79
8854.	DONATETOWATERAID (donatetow...	39	117.94	141.04	28	71.79
8855.	David (dlreed27)	39	102.06	116.07	21	53.85
8856.	Danky (dankyv1)	39	60.68	71.60	11	28.21
8857.	Clone (clonex1)	39	60.63	73.61	7	17.95
8858.	Tomas (clickity_clark)	39	49.12	62.17	3	7.69
8859.	Mike (cherryot)	39	89.49	109.17	9	23.08
8860.	charlotte (charltypes)	39	64.94	75.92	16	41.03
8861.	Cavid (cavid)	39	54.09	63.91	4	10.26
8862.	B (bz___)	39	149.86	196.51	26	66.67
8863.	Ian (bunnyian)	39	86.56	106.28	8	20.51
8864.	brocco (brocollie)	39	81.42	99.88	12	30.77
8865.	Soonbeom (bringu2h)	39	57.19	64.33	7	17.95
8866.	UWU (blizztera)	39	77.44	89.14	15	38.46
8867.	Beksultan (bexultan)	39	89.87	107.06	16	41.03
8868.	_ (baoy)	39	88.68	111.98	12	30.77
8869.	Chloe (bananatyper9)	39	98.00	125.69	14	35.90
8870.	Alvin (ayesizzle)	39	101.47	116.01	17	43.59
8871.	Arsalnovt (arsalnovt)	39	68.05	85.08	11	28.21
8872.	Filthy (filthyballer)	38	55.92	66.87	5	13.16
8873.	ferris (ferrisiscool)	38	82.37	100.06	13	34.21
8874.	Feriiii (feriiiiiiii)	38	54.22	63.41	5	13.16
8875.	EthanDennisttv (ethandennis)	38	107.63	130.94	14	36.84
8876.	john (er3g10us)	38	54.38	70.00	10	26.32
8877.	dox3 (dox3m)	38	61.60	75.79	12	31.58
8878.	aoeu (dengzacd)	38	132.19	152.75	21	55.26
8879.	DR (dekesta_)	38	114.74	144.22	28	73.68
8880.	Sangyoung (ddragoons)	38	121.72	154.36	24	63.16
8881.	Karthik (darthmortem)	38	60.00	73.95	6	15.79
8882.	Michael (clayjar)	38	120.20	137.27	22	57.89
8883.	Hello (clappy)	38	74.63	89.63	13	34.21
8884.	C4MFZ (c4mfz)	38	67.48	81.72	7	18.42
8885.	Kevin (busterz)	38	43.48	52.58	3	7.89
8886.	Burger (burgercheese)	38	110.84	134.18	24	63.16
8887.	brobie (brobie747)	38	96.31	120.45	14	36.84
8888.	Bit (bitnerik)	38	66.28	77.37	6	15.79
8889.	Henry (barihenry)	38	96.91	114.69	15	39.47
8890.	Awkward (awkward_fruitcake)	38	90.00	100.82	9	23.68
8891.	Peter (avezan)	38	95.33	127.93	14	36.84
8892.	Jake (aurelias)	38	104.76	128.77	12	31.58
8893.	PrairieBaron (atbaron)	38	77.29	93.98	9	23.68
8894.	AspectOfTheNerd (aspectofth...	38	94.59	125.63	15	39.47
8895.	Asylbek (askodzhenaliev)	38	35.10	43.55	14	36.84
8896.	Arthur (art8urch3ng)	38	53.03	68.61	5	13.16
8897.	🏎️frank (__slowtypist__)	38	110.93	128.20	14	36.84
8898.	Intertial (yuvi_birdi)	38	70.47	83.08	7	18.42
8899.	yuth (yuth_isme)	38	51.54	62.91	7	18.42
8900.	James (youngthe)	38	45.40	55.40	4	10.53
8901.	Ulises (xindrome)	38	64.49	78.34	6	15.79
8902.	Xeogran (xeogran)	38	172.82	198.75	35	92.11
8903.	Etalm (walter_gilbert)	38	114.43	142.09	22	57.89
8904.	Wowa (vovsanka)	38	67.04	77.60	6	15.79
8905.	Vmanalt (vmanalt)	38	94.07	111.99	17	44.74
8906.	Viet Trung (viettrung9012)	38	93.27	106.99	18	47.37
8907.	Jorryn (vicmg)	38	81.35	98.09	7	18.42
8908.	Uways (uways)	38	66.04	86.43	7	18.42
8909.	Charles (tyuule)	38	95.89	122.28	21	55.26
8910.	Tayden (tydn12)	38	76.41	97.01	10	26.32
8911.	Christian (trotuele)	38	75.14	88.13	7	18.42
8912.	Triton (tritonthetrident)	38	71.71	85.72	12	31.58
8913.	Thomaskov (thomas861205)	38	60.61	71.40	5	13.16
8914.	Last (thelastmuffin)	38	102.12	118.05	14	36.84
8915.	Dasha (thedashaier)	38	87.73	100.44	17	44.74
8916.	James (th3james)	38	79.75	97.93	10	26.32
8917.	sk (teslateslatesla)	38	89.09	108.60	7	18.42
8918.	T (tegicupala)	38	91.66	103.05	14	36.84
8919.	Tashima (tashima42)	38	83.55	109.79	13	34.21
8920.	Grandjudge (talonted)	38	81.59	102.17	11	28.95
8921.	Aaron (suckmeoffhoe)	38	68.63	81.94	8	21.05
8922.	Professor (steveisawesomer)	38	62.10	74.28	10	26.32
8923.	snowdenwald (snowdenwald)	38	80.78	97.50	9	23.68
8924.	Sneha (sneha_1610)	38	35.65	46.48	3	7.89
8925.	Luka (smilyee)	38	57.30	69.74	7	18.42
8926.	Christ (slowasf1)	38	106.69	132.84	16	42.11
8927.	Samuel (slee2)	38	63.08	81.66	4	10.53
8928.	Shubham (shubham2007)	38	44.64	60.49	1	2.63
8929.	shubham (shubham1999)	38	92.32	115.66	15	39.47
8930.	Shlock (shlockington)	38	105.12	124.56	19	50.00
8931.	Sharkbait (sharkydabnab)	38	84.27	106.53	13	34.21
8932.	Shantanu (shantanugupt)	38	44.74	55.13	6	15.79
8933.	Jeffrey (seedotgrass)	38	72.47	83.95	11	28.95
8934.	lin (lty2002)	38	60.33	83.67	10	26.32
8935.	The Papal State (loquiera)	38	97.07	113.06	11	28.95
8936.	Hitscan (loonatick_src)	38	93.12	112.79	15	39.47
8937.	Marty (lagoskid)	38	71.28	91.47	17	44.74
8938.	Kevin Carl (kevincarl09)	38	59.07	67.53	7	18.42
8939.	Kaushik (kaushik13)	38	64.13	85.68	10	26.32
8940.	karina (kar1na_)	38	53.48	66.34	5	13.16
8941.	mmmmm (kamenrider345)	38	77.30	95.24	11	28.95
8942.	Kagamine Len (kagamine_len)	38	97.00	120.45	9	23.68
8943.	Amir (justinpaper)	38	43.23	53.12	7	18.42
8944.	Joseph (jsph273)	38	106.14	124.34	21	55.26
8945.	Jerry (jerryr5279)	38	94.55	124.68	13	34.21
8946.	Ellie (jellylie2005)	38	67.79	79.65	6	15.79
8947.	Jacob (jeepers_jake)	38	109.95	134.13	22	57.89
8948.	Jan Kozaruk (jackoza)	38	22.60	32.17	21	55.26
8949.	(ilikeponyz20)	38	94.55	110.44	15	39.47
8950.	Vladislav (iivlad)	38	59.87	74.39	8	21.05
8951.	G (hyperglide)	38	129.62	152.16	22	57.89
8952.	heclord (heclord)	38	93.13	108.04	11	28.95
8953.	H. (hblord)	38	96.47	110.06	21	55.26
8954.	hs (hakanserce)	38	75.85	91.08	8	21.05
8955.	Hajar (hajar424)	38	89.76	113.89	10	26.32
8956.	Gustas (guzhazi)	38	84.29	114.28	13	34.21
8957.	Ozz (gravechill)	38	98.95	129.78	15	39.47
8958.	0 (gochoo)	38	93.39	107.68	13	34.21
8959.	Oscar (scarigam)	38	88.85	102.08	3	7.89
8960.	Sanad (sanad)	38	33.34	42.38	7	18.42
8961.	Saba (samsungexynos)	38	78.93	104.43	10	26.32
8962.	Sami (sami_66)	38	49.28	56.52	3	7.89
8963.	Jayseek (saltymood)	38	71.94	93.63	10	26.32
8964.	sagar (sagarlama)	38	37.14	47.80	3	7.89
8965.	Protein (rsandland)	38	84.77	98.75	9	23.68
8966.	Roman (roman_kovalchuk)	38	57.91	67.17	2	5.26
8967.	Thi (rodingersmg)	38	87.67	107.95	11	28.95
8968.	Mistakes Were Made (rhino1998)	38	73.18	88.72	11	28.95
8969.	Renson (renson1)	38	107.05	137.45	16	42.11
8970.	中学 (randomguyhe)	38	83.09	100.15	9	23.68
8971.	Crudux-Crue (raman_rr)	38	54.37	65.22	3	7.89
8972.	ragnarok (ragnarokiscomming)	38	79.51	98.60	9	23.68
8973.	Quintino (quintino123)	38	94.15	109.04	8	21.05
8974.	LiterallyYou (quesket)	38	74.61	97.88	8	21.05
8975.	pogi (pogy)	38	47.95	69.18	9	23.68
8976.	owo :3 (playtoomuchgames)	38	98.43	127.26	10	26.32
8977.	Viktor (pineapple212)	38	94.30	127.46	12	31.58
8978.	jayp (phrasez)	38	92.72	122.02	27	71.05
8979.	не встретил бо�...	38	151.56	166.12	34	89.47
8980.	Tosti-ijzer (paupermongool)	38	99.14	112.80	10	26.32
8981.	bat (origluun)	38	79.59	92.82	8	21.05
8982.	clooverhoover (olivesandlem...	38	67.74	95.00	9	23.68
8983.	nyouhas (nyouhas_)	38	90.35	112.45	20	52.63
8984.	Noukarin (noukarin)	38	84.41	106.47	10	26.32
8985.	Nitrogen (nitrogen_addict)	38	47.89	59.10	3	7.89
8986.	Nemsi (nemsii)	38	128.77	145.52	23	60.53
8987.	Arden (moo_o)	38	93.50	121.21	13	34.21
8988.	kayg (miryokucolemakdh)	38	84.10	106.25	20	52.63
8989.	shum (michaelshumshum)	38	84.01	101.00	12	31.58
8990.	Mewn (mewn)	38	78.47	95.27	12	31.58
8991.	Muhammad Amin (mast1999)	38	53.99	77.14	17	44.74
8992.	Marouane (maromaro02)	38	53.48	64.09	2	5.26
8993.	Mark (markachuang)	38	88.90	108.64	16	42.11
8994.	Manas (manasmahanand)	38	60.43	70.92	11	28.95
8995.	abracadabra (ariunerdene)	38	35.17	43.51	11	28.95
8996.	loli (annalise00)	38	76.11	91.46	9	23.68
8997.	Anmol (anmoljaat_)	38	43.19	52.69	9	23.68
8998.	Anha (anha05)	38	64.25	77.88	6	15.79
8999.	Angelo (angelo123123)	38	124.38	149.20	26	68.42
9000.	angelic (angeliccalling)	38	29.28	43.70	4	10.53
9001.	Michael (anfestan)	38	29.88	40.25	5	13.16
9002.	anas (anas771989)	38	51.53	61.11	3	7.89
9003.	AmazingKitchen (amazingkitc...	38	86.92	100.85	10	26.32
9004.	Altair (altairaltair)	38	50.98	65.80	7	18.42
9005.	Juan (alcaann)	38	67.79	83.93	13	34.21
9006.	Akshay (akshayxw69)	38	70.50	85.60	4	10.53
9007.	Dara (adoran)	38	79.87	100.97	8	21.05
9008.	Slow Typer (4rs3n1c)	38	76.60	90.14	19	50.00
9009.	potato (potatoattack)	38	77.63	90.29	13	34.21
9010.	Anton kenneth lee bell (m011y)	38	77.20	94.35	9	23.68
9011.	Robert (robboy)	38	76.67	102.90	5	13.16
9012.	dove (nach9208)	38	90.29	111.18	14	36.84
9013.	BlackVerse (drako201)	38	62.74	77.80	7	18.42
9014.	mangesh (muxx)	38	29.32	38.99	8	21.05
9015.	tstats[ankur_123] (ankur_123)	38	63.60	79.09	9	23.68
9016.	Michal (murb)	38	58.55	69.88	7	18.42
9017.	WeWake (we_wake)	38	55.85	66.37	4	10.53
9018.	Paulo (bibon98)	38	72.97	89.80	11	28.95
9019.	Leemon (leemon_slice)	38	34.70	54.83	3	7.89
9020.	vsn (miniliki)	38	90.52	109.45	14	36.84
9021.	Michael (biggerpeach)	38	74.27	90.94	6	15.79
9022.	Genta (azcr1_)	38	34.92	43.25	17	44.74
9023.	Kian (kiwiyan)	38	91.76	110.38	26	68.42
9024.	pavan sai (pavan2569)	38	57.95	70.00	5	13.16
9025.	iris (noom3000)	38	73.78	92.97	11	28.95
9026.	happyft (happyft)	38	123.91	159.64	19	50.00
9027.	Lambo (lambodhar)	38	56.05	68.50	27	71.05
9028.	forehead (piratebs)	38	124.51	151.56	20	52.63
9029.	Alex (alkan137)	37	90.49	121.30	16	43.24
9030.	Aeriana (aer000)	37	44.70	57.57	3	8.11
9031.	GODLIKE (acrimeisnotfine)	37	71.09	93.38	13	35.14
9032.	Lintang (8inx)	37	31.58	40.32	6	16.22
9033.	nattapakon (63100932)	37	26.83	30.92	12	32.43
9034.	Mohammad Imam (1mam)	37	70.85	85.12	13	35.14
9035.	Willow (02_wl_04)	37	68.55	83.09	19	51.35
9036.	bigchick (bigchickbird)	37	87.29	106.11	11	29.73
9037.	AKarudwal (akarudwal)	37	47.19	63.93	5	13.51
9038.	mouni (mouni90)	37	48.01	57.17	1	2.70
9039.	Arif (arif_shahriar)	37	54.11	64.18	3	8.11
9040.	Mara (mara_bbg)	37	76.37	93.11	7	18.92
9041.	yaboi (yaboironny)	37	82.17	94.99	10	27.03
9042.	Stephen (potsee)	37	76.77	90.21	9	24.32
9043.	Drombulje (drombulje)	37	32.71	40.11	2	5.41
9044.	soph (nasasoph)	37	57.16	66.09	4	10.81
9045.	Bappo (bappoxd)	37	73.49	87.77	9	24.32
9046.	Jakin (anonymousty)	37	92.59	115.02	15	40.54
9047.	Pitfulll (pitfulll)	37	47.72	58.98	3	8.11
9048.	Naman (nnamansingh)	37	33.99	47.32	4	10.81
9049.	roth (roth_31)	37	50.65	59.61	0	0.00
9050.	Blue (bluzs)	37	58.04	66.98	6	16.22
9051.	WeiWeiMan (weiweiman)	37	97.95	118.31	18	48.65
9052.	Luke (lukedood)	37	106.48	137.71	21	56.76
9053.	juliana (lilfl3shy)	37	47.32	54.72	5	13.51
9054.	LightUnicorn839 (lightunico...	37	39.47	49.88	1	2.70
9055.	Roast (lemonshine)	37	59.68	76.45	7	18.92
9056.	RENIEL RENZ (leiner_ross15)	37	73.39	83.94	12	32.43
9057.	Ali (lasthunter69)	37	61.03	78.22	7	18.92
9058.	Lai (lai_)	37	80.05	94.35	11	29.73
9059.	Kijurin (kijurin)	37	75.26	90.83	12	32.43
9060.	Kelvin (kelvin666)	37	60.85	71.14	10	27.03
9061.	Kyla (kdawg22)	37	95.16	109.56	21	56.76
9062.	kamal (kamaluddin)	37	37.68	46.35	1	2.70
9063.	tstats[kafuu] (kafuu)	37	104.33	140.60	20	54.05
9064.	詠璿 (justforfun0906)	37	56.78	67.11	7	18.92
9065.	Justanalek (justanalek)	37	69.27	79.65	5	13.51
9066.	Jimmy (jimmyr1027)	37	90.87	126.65	25	67.57
9067.	Jason (jason_the_human)	37	58.16	70.65	8	21.62
9068.	Jamie (jamiekwok)	37	48.19	54.99	1	2.70
9069.	Justin (j98101237)	37	66.43	85.65	10	27.03
9070.	69 (i_am_better_than_u_lol)	37	66.11	85.48	27	72.97
9071.	amanita! (irving1234028)	37	116.00	142.93	18	48.65
9072.	Intetsu (intetsun6)	37	30.12	36.70	2	5.41
9073.	Oscar (iloveveck)	37	60.99	84.20	2	5.41
9074.	iks de (iksdebro)	37	92.56	117.83	13	35.14
9075.	hewan (ikan_laut)	37	32.55	36.83	5	13.51
9076.	Bart (hubba485)	37	117.82	136.26	17	45.95
9077.	Rain (hlbentz)	37	125.33	143.54	22	59.46
9078.	Max (hihello12327)	37	70.26	87.86	11	29.73
9079.	gyfan10 (gyfan10)	37	75.03	93.31	8	21.62
9080.	Gustav (gustavelmqvist)	37	86.31	107.77	12	32.43
9081.	Grosse (grossescheisse)	37	56.96	72.20	6	16.22
9082.	Grace (gracejin)	37	38.66	51.80	0	0.00
9083.	Dawg (goon_goonster)	37	87.37	104.00	13	35.14
9084.	Nakoa Blue (goldtiger7)	37	39.50	48.51	1	2.70
9085.	Frostsights (frostsights)	37	100.29	119.34	11	29.73
9086.	Purpl3 (froghie)	37	67.18	89.56	14	37.84
9087.	Sentinel (fedayeen)	37	83.62	98.49	12	32.43
9088.	Erza (ewalk91098)	37	51.99	60.30	5	13.51
9089.	sky (elsecaller)	37	88.60	98.93	6	16.22
9090.	Thundering (electricbiscuit)	37	121.21	139.26	16	43.24
9091.	Echo (echo316)	37	78.02	103.61	7	18.92
9092.	Alex (eagles1106)	37	105.95	151.99	22	59.46
9093.	ZeroNine (dtrix)	37	106.86	137.44	11	29.73
9094.	Diego (diegogamer0528)	37	53.47	65.44	11	29.73
9095.	Diamond (diamond_desu)	37	67.40	85.76	13	35.14
9096.	Joe mom (deroze)	37	92.58	106.58	9	24.32
9097.	Deanna (deanna123)	37	74.02	97.24	6	16.22
9098.	Shawn (cubershz)	37	114.78	137.62	19	51.35
9099.	chubbypugs21 (chubbypugs21)	37	88.39	106.33	11	29.73
9100.	Hugh Janus (chrispoulos)	37	74.26	85.62	11	29.73
9101.	Celia (ccelo)	37	48.67	68.06	5	13.51
9102.	Ivan (budabudimir)	37	86.51	102.15	12	32.43
9103.	Bonzi (bonzibuddy420)	37	104.44	148.88	15	40.54
9104.	Ryan (bluesquirrel)	37	87.14	109.97	12	32.43
9105.	learning djorjak (blondebois)	37	87.23	110.52	14	37.84
9106.	Majed (bestwifi)	37	87.58	101.64	19	51.35
9107.	bbcola18 (bbcola18)	37	101.54	130.91	17	45.95
9108.	Bart (bartok)	37	65.81	84.14	14	37.84
9109.	barrybee789 (barrybee789)	37	58.86	70.13	4	10.81
9110.	baekd (baekde)	37	83.53	110.69	10	27.03
9111.	i like typing (a_hole)	37	52.05	68.57	25	67.57
9112.	Aviv (avivbn263)	37	120.97	132.93	19	51.35
9113.	WAD (_waddup_)	37	66.20	82.54	14	37.84
9114.	Ian (zento_x)	37	62.35	72.81	5	13.51
9115.	InHuMaN (yminag123)	37	111.41	127.49	16	43.24
9116.	yessine (yessine14)	37	62.66	77.81	9	24.32
9117.	Ethan (yaboinugget)	37	124.67	152.04	18	48.65
9118.	FTL (xxfangtingxx)	37	72.44	86.56	8	21.62
9119.	W (w_v_)	37	94.39	120.43	18	48.65
9120.	Ben (wippidy)	37	75.15	91.62	9	24.32
9121.	hi (watlok)	37	131.93	159.04	20	54.05
9122.	Vishal (vpm911)	37	77.15	98.92	5	13.51
9123.	Vatsala (vatsala)	37	60.92	71.61	7	18.92
9124.	u8y7541 (u8y7541)	37	136.10	160.55	25	67.57
9125.	Ball Sweat (typing_man_man)	37	76.77	89.99	8	21.62
9126.	I am in school rn (typingin...	37	85.68	98.66	15	40.54
9127.	Abhinav (typingcompany)	37	37.94	50.03	3	8.11
9128.	Type (type_racer_15)	37	67.71	81.06	8	21.62
9129.	Jack (turtlejack)	37	53.67	63.28	5	13.51
9130.	TTMo1 (ttmer)	37	143.58	187.08	30	81.08
9131.	Rock (trailersg)	37	68.13	77.88	9	24.32
9132.	Fast (too_fast_foru)	37	63.89	73.55	5	13.51
9133.	John (tmikelburg)	37	107.16	137.61	10	27.03
9134.	Fae (suga_spice)	37	38.72	48.76	12	32.43
9135.	Amarnath (stormprod)	37	71.93	99.10	11	29.73
9136.	Andrew (sq_leonhart)	37	97.87	116.36	18	48.65
9137.	Sophia (sophia2020)	37	82.57	101.88	4	10.81
9138.	. (solorex_)	37	82.57	120.32	25	67.57
9139.	Erick (sockeymeow)	37	92.46	110.13	7	18.92
9140.	light (skepnap)	37	42.39	54.79	1	2.70
9141.	Jojuh (shojubruh)	37	90.86	112.81	19	51.35
9142.	shiru (shiruetto68)	37	116.07	142.18	19	51.35
9143.	Shenen (shenenjump)	37	104.95	122.65	20	54.05
9144.	Jason (saltybaskets)	37	90.47	106.31	10	27.03
9145.	Kyle (sadkhaki)	37	53.97	64.96	3	8.11
9146.	Aru (s3rikbaeva)	37	46.26	61.90	5	13.51
9147.	Rold (roldmargruv)	37	66.82	82.54	22	59.46
9148.	Aarsh (revolt1ng)	37	65.90	77.70	8	21.62
9149.	Rekordea (rekordea)	37	85.20	113.35	13	35.14
9150.	1 (reforme)	37	76.34	89.24	9	24.32
9151.	Parvez (pz1971)	37	73.45	83.35	14	37.84
9152.	Yevhenii (prinzeugen)	37	85.23	100.44	14	37.84
9153.	radar (pranav24)	37	59.93	71.62	13	35.14
9154.	andrew (potatoh)	37	83.73	102.11	11	29.73
9155.	light (pinkyhurts)	37	74.47	87.95	10	27.03
9156.	PancakeDAWGZ (pancakedawgz)	37	121.02	139.42	19	51.35
9157.	Liad (ozonzono)	37	74.78	93.74	6	16.22
9158.	orde (orde)	37	103.03	129.43	10	27.03
9159.	Omar (omarabzd)	37	86.97	106.78	15	40.54
9160.	Omer (okirnap)	37	86.79	102.96	9	24.32
9161.	NC3 (nickkcastaneda)	37	63.10	81.42	13	35.14
9162.	Mohammad (naveedroy)	37	36.90	44.41	3	8.11
9163.	nadeem (nadeemgujjar560)	37	64.50	80.02	11	29.73
9164.	azaab (minsato)	37	69.10	85.07	7	18.92
9165.	Matthew (mbryantms)	37	110.89	130.70	19	51.35
9166.	Jason (r_matey)	36	94.14	110.31	11	30.56
9167.	rufus (rufi999)	36	53.03	63.74	3	8.33
9168.	Raimbek (rk_avilbekov)	36	53.26	65.38	6	16.67
9169.	R (renxsis)	36	98.93	136.50	11	30.56
9170.	Kabera (rcdude27)	36	107.00	123.88	15	41.67
9171.	Ramona (ramonaflowers101)	36	98.01	110.32	15	41.67
9172.	Adam (photoequal)	36	31.41	37.67	2	5.56
9173.	Persy (persy)	36	62.44	82.96	8	22.22
9174.	(pepeworm_colemak)	36	148.60	217.82	10	27.78
9175.	:) (pennani)	36	82.65	95.46	17	47.22
9176.	P (patrickkayne)	36	74.01	94.57	4	11.11
9177.	John (parallaxjedi)	36	98.11	110.13	13	36.11
9178.	Napat (omakaze)	36	65.64	80.86	7	19.44
9179.	caden (okaydern)	36	93.82	107.72	18	50.00
9180.	odezzki (odezzki)	36	81.20	96.98	11	30.56
9181.	NutMonger (nutmonger)	36	68.10	82.42	8	22.22
9182.	yess (notavailabe)	36	103.17	124.76	15	41.67
9183.	Mulosh (mulosh)	36	109.71	125.93	16	44.44
9184.	Lawrence (mrlab)	36	74.86	90.63	7	19.44
9185.	M (mostafam)	36	83.07	102.81	11	30.56
9186.	willy (monvment)	36	80.63	98.14	14	38.89
9187.	Mons (monstoonix)	36	82.05	94.42	11	30.56
9188.	Mohib (mohib33)	36	81.36	96.23	18	50.00
9189.	Mekrigen (mekrigen)	36	62.17	73.53	7	19.44
9190.	MasterMind (master__mind)	36	90.96	104.25	17	47.22
9191.	Marc (maroenzo)	36	89.16	106.18	13	36.11
9192.	Marcel (marcelmladi)	36	30.32	37.79	9	25.00
9193.	Mantis (mantisplays)	36	97.02	127.43	8	22.22
9194.	Fiji (fijired2)	36	88.38	110.76	12	33.33
9195.	Fabricio (ffontesb)	36	42.81	52.95	7	19.44
9196.	Exxotix (exxotix)	36	62.30	90.93	16	44.44
9197.	Eugene (entilaren)	36	99.82	121.37	21	58.33
9198.	elizabeth (elizabeth1ee)	36	116.29	136.46	21	58.33
9199.	Richard (elevatecrazy_yt)	36	86.46	104.02	11	30.56
9200.	egg (egguard)	36	80.33	98.02	7	19.44
9201.	Egbadon (egbadon)	36	52.18	61.46	7	19.44
9202.	John (dyst0pia)	36	62.85	76.86	26	72.22
9203.	Concomitant (dvorakdork)	36	99.17	109.62	16	44.44
9204.	dissonantly (dissonantly)	36	107.10	130.99	18	50.00
9205.	Cyberstrike (cyberstrike)	36	43.39	56.02	3	8.33
9206.	Cucu (cucu_grey)	36	62.44	72.44	7	19.44
9207.	Crehan (crayon144)	36	60.64	68.61	11	30.56
9208.	scr4tchman (connerkainnerkai)	36	78.54	90.96	12	33.33
9209.	👺 (confiscar)	36	92.79	113.27	10	27.78
9210.	Christopher (codaki)	36	47.81	59.99	5	13.89
9211.	Kai (ckai)	36	84.89	109.76	6	16.67
9212.	Finna (captfinn)	36	71.69	81.44	7	19.44
9213.	Cameron (camalb02)	36	42.39	53.06	1	2.78
9214.	asdftr (buhdo)	36	74.59	90.21	10	27.78
9215.	Batkhishig (btkshg)	36	75.39	86.78	9	25.00
9216.	bruuuh (bruhxfish)	36	101.21	120.41	12	33.33
9217.	Bruno (brbeans)	36	90.49	114.29	12	33.33
9218.	Bipin (bipin_emp123)	36	57.10	66.94	5	13.89
9219.	abdullah (billnyezenazispy)	36	58.25	67.76	10	27.78
9220.	Bernice Hee Shu Qi (bernice...	36	69.16	80.88	6	16.67
9221.	Bek (bekkk)	36	52.53	61.41	7	19.44
9222.	aver (aversioneer)	36	63.14	76.69	5	13.89
9223.	gta (asldkfj)	36	72.80	90.31	7	19.44
9224.	ashbellebsha (ashbel_g)	36	87.59	113.25	9	25.00
9225.	Mateo (asetato)	36	69.26	86.32	8	22.22
9226.	Arun (arun808)	36	101.98	122.81	16	44.44
9227.	Arthur (arturopakastur)	36	105.82	120.88	14	38.89
9228.	Rajat (argentum_1807)	36	73.05	86.53	9	25.00
9229.	James (arctos)	36	48.43	59.08	1	2.78
9230.	🐢🐢🐢🐢 (amogh1420)	36	93.58	109.06	16	44.44
9231.	Amit (amitkarmakar13)	36	79.85	99.43	14	38.89
9232.	Daniel (amai727)	36	116.19	146.70	20	55.56
9233.	Joosep (aktos)	36	92.49	111.38	13	36.11
9234.	akram (akrambr)	36	37.48	46.06	3	8.33
9235.	Ayedread (ade15)	36	72.18	84.09	7	19.44
9236.	Fuel plane (1pavanb)	36	54.78	67.90	14	38.89
9237.	Happy (happy_jms)	36	69.54	87.29	15	41.67
9238.	Soul (quentinlikesaot)	36	76.79	96.82	9	25.00
9239.	james (jamesfarmer)	36	71.67	87.30	11	30.56
9240.	Peyton (peytonk608)	36	77.92	90.55	4	11.11
9241.	Henry (parrotfish)	36	101.78	119.89	15	41.67
9242.	Octagonal (octagonalwalnut)	36	111.16	138.44	21	58.33
9243.	arcticfox (spiky_echidna)	36	70.98	102.71	7	19.44
9244.	yam (yamazakura)	36	66.64	89.51	6	16.67
9245.	Harith (6krypto)	36	49.23	59.80	5	13.89
9246.	OLMA - (lyndon29)	36	36.76	47.39	6	16.67
9247.	Rushikesh Dhatinge (rushike...	36	32.84	39.42	5	13.89
9248.	Gabrielle (gabriellerose86)	36	58.76	71.79	6	16.67
9249.	Quavis (jewishween)	36	83.26	100.91	14	38.89
9250.	amine (laribi)	36	31.07	37.38	5	13.89
9251.	Molly (butteryfly)	36	79.74	94.09	6	16.67
9252.	Cypan :) (ckrawetko)	36	24.12	33.25	8	22.22
9253.	isabella (coscarellai070)	36	52.59	63.67	4	11.11
9254.	Luiz (lznetorox)	36	69.26	85.33	8	22.22
9255.	Luis Francisco (luifrancgom)	36	37.14	50.16	2	5.56
9256.	LubedCube (lubed_cube)	36	61.01	71.97	10	27.78
9257.	Leaderboard is (leaderboard...	36	94.19	139.30	10	27.78
9258.	Arsen (konars_04)	36	25.60	33.86	3	8.33
9259.	Necrophos (komaroffski)	36	77.70	98.40	9	25.00
9260.	bob (kkgd)	36	92.51	105.43	16	44.44
9261.	Asian (kiniiranai)	36	92.69	108.06	12	33.33
9262.	Karimu (karimuosman)	36	107.43	122.79	21	58.33
9263.	El (kandel)	36	61.28	82.47	5	13.89
9264.	kabir raj (kabir26)	36	60.59	69.06	6	16.67
9265.	Aria (juicyhaluja)	36	116.04	156.76	18	50.00
9266.	Joshua (joshuahd)	36	81.89	98.99	14	38.89
9267.	Jordan (jordatypist)	36	106.80	132.79	13	36.11
9268.	Jonathan (jonathankim1999)	36	83.29	100.04	9	25.00
9269.	ghostofnav (jokerhyper)	36	73.28	86.50	9	25.00
9270.	Eric (joker4120)	36	63.43	79.83	8	22.22
9271.	Jean (jeanerino)	36	60.18	72.11	10	27.78
9272.	its_Atrap (its_atrap)	36	94.36	111.53	15	41.67
9273.	itssarcazm (itssarcazm)	36	92.81	115.14	10	27.78
9274.	Amdadul (imlak)	36	45.00	59.61	3	8.33
9275.	Wapiro (ihatejuices)	36	68.80	79.53	6	16.67
9276.	BOz (hyund0)	36	117.38	133.49	22	61.11
9277.	Christine (hugowolf)	36	96.04	115.77	19	52.78
9278.	Sporadic (howsporadic)	36	121.90	154.98	26	72.22
9279.	Aisier (hfssma)	36	94.88	109.44	16	44.44
9280.	herman (herman159)	36	93.70	109.66	9	25.00
9281.	Heorhii (heorhii_hryhorov)	36	82.44	99.96	8	22.22
9282.	Anthony (gphobes)	36	118.94	148.08	21	58.33
9283.	Ricardo (golden_boi)	36	55.44	64.47	4	11.11
9284.	gandastik (gandsatik)	36	84.70	98.82	11	30.56
9285.	Damiano (fullomen)	36	83.43	93.28	6	16.67
9286.	Zol (zoltac)	36	89.46	116.18	8	22.22
9287.	Shelby (zalak_b)	36	60.98	76.07	2	5.56
9288.	Vinícius (yamatano)	36	57.01	64.62	4	11.11
9289.	Xavieku (xavieku)	36	68.48	80.50	14	38.89
9290.	Westly (wslafleur)	36	114.69	133.06	19	52.78
9291.	Ethan (wolfiedude14)	36	65.62	83.28	30	83.33
9292.	chris (walchrisc)	36	80.03	92.80	15	41.67
9293.	Vision (vision_of_infinity)	36	80.19	92.45	9	25.00
9294.	Jack (tzak)	36	113.77	132.42	15	41.67
9295.	tlbi (tla109)	36	106.41	135.72	24	66.67
9296.	Evan (theworkmanmuffin)	36	77.06	88.49	11	30.56
9297.	thespaghetti27 (thespaghett...	36	67.11	90.39	12	33.33
9298.	thepenguinmonkey (thepengui...	36	79.28	90.02	7	19.44
9299.	Tesla (teslalord)	36	92.93	112.83	16	44.44
9300.	Tanvir (tanvir187)	36	87.92	110.45	9	25.00
9301.	Do (tai230)	36	55.99	66.85	4	11.11
9302.	Sujit (sujit2000)	36	73.65	92.42	12	33.33
9303.	Guest (solovf)	36	155.36	205.65	32	88.89
9304.	akum! (solargiants)	36	43.54	55.01	3	8.33
9305.	KJ (snthaoeu)	36	117.46	136.94	16	44.44
9306.	Levi (sniperkiller2)	36	61.73	73.39	9	25.00
9307.	(slowghost)	36	201.90	242.96	34	94.44
9308.	Salem (slomy0010)	36	47.93	57.16	3	8.33
9309.	(slimaniimededdineabderrah...	36	55.62	66.87	5	13.89
9310.	Twinkle (sirius_07)	36	51.24	59.36	1	2.78
9311.	Chris Klenø (sircw)	36	135.33	172.14	29	80.56
9312.	Kladdigt (sigius)	36	93.49	109.71	11	30.56
9313.	tgb524 (_yuno)	35	105.75	128.14	18	51.43
9314.	devil_02 (_ebad_)	35	41.83	52.55	4	11.43
9315.	yntylox (yntylox)	35	37.39	55.96	3	8.57
9316.	Muhammad (xxvv)	35	74.05	89.87	8	22.86
9317.	Evans (xerodo)	35	83.56	95.13	13	37.14
9318.	Johannes (xcillingx)	35	56.66	68.86	5	14.29
9319.	Usman (x1itachi)	35	112.96	143.34	17	48.57
9320.	Wizrud (wizurd_)	35	78.33	91.31	6	17.14
9321.	veryfast (veryfastxd)	35	92.30	108.76	9	25.71
9322.	offblacc (vekikornjaca)	35	87.41	109.11	17	48.57
9323.	Taiki (vegantaiki)	35	71.03	89.24	11	31.43
9324.	Michael (val_slow)	35	86.18	102.59	14	40.00
9325.	typer_trainer (typer_trainer)	35	90.36	110.13	12	34.29
9326.	ANUP (typekashyap)	35	68.61	83.78	9	25.71
9327.	jeff (typecringe)	35	105.10	120.44	14	40.00
9328.	Sergey (tsykurawork)	35	59.44	69.71	8	22.86
9329.	Nazib (tony_129)	35	60.58	76.14	9	25.71
9330.	doncheadle (timothyqian)	35	97.56	117.74	16	45.71
9331.	Thiemo (thiemok)	35	68.21	80.50	7	20.00
9332.	Eric (thiccbrick)	35	72.31	104.53	11	31.43
9333.	Boipelo (the_big_bp)	35	38.47	45.83	5	14.29
9334.	∞ (technolojesus)	35	68.03	75.84	8	22.86
9335.	Non (tata32000)	35	75.20	92.06	8	22.86
9336.	Tardy (tardyislazy)	35	74.67	90.22	11	31.43
9337.	McLovin (tappytyper)	35	103.56	121.86	11	31.43
9338.	adin (tappineapple)	35	93.02	121.86	13	37.14
9339.	Swastik (swastik220705)	35	56.06	66.22	6	17.14
9340.	Soner (soner)	35	127.62	155.63	21	60.00
9341.	sol (solshad)	35	69.64	89.60	6	17.14
9342.	Choco (slowest_sloth)	35	61.78	79.38	5	14.29
9343.	Gabriel (slenders)	35	70.08	100.56	20	57.14
9344.	roy (shote)	35	55.35	64.44	1	2.86
9345.	Alex (aqin24)	35	108.74	121.43	19	54.29
9346.	ANDRAGOMOR (andrago_)	35	47.05	59.31	1	2.86
9347.	subham (alexus78)	35	58.19	67.36	9	25.71
9348.	Aelius (aelius_l)	35	120.10	146.43	16	45.71
9349.	Adzeyns (adzenys)	35	97.72	118.45	16	45.71
9350.	AIbek (3xter)	35	56.86	65.05	2	5.71
9351.	Magieschnuller (magieschnul...	35	70.56	79.15	9	25.71
9352.	aeign (eyncore)	35	70.66	85.64	6	17.14
9353.	Kxngh#0001 (kingh17)	35	60.30	74.72	26	74.29
9354.	safia (safia1607)	35	50.76	62.36	2	5.71
9355.	Xingyu (findmealone)	35	46.54	66.30	6	17.14
9356.	JSD (_jsd)	35	44.11	56.19	1	2.86
9357.	Anav (dark_winter)	35	75.29	90.51	9	25.71
9358.	shahidul islam (prantoislam...	35	44.90	55.32	7	20.00
9359.	ahmed (mamado69)	35	51.31	62.49	5	14.29
9360.	Allison (ixonic_alli)	35	38.72	50.36	0	0.00
9361.	Thumb (tomtom__ever)	35	100.97	125.80	13	37.14
9362.	NotInfinite (notinfinite)	35	79.00	97.07	12	34.29
9363.	Ahemed (a_loose_cannon)	35	59.34	68.53	9	25.71
9364.	Aditya (aditya786123)	35	59.11	72.52	7	20.00
9365.	Angus (type_yahweh)	35	72.25	84.94	12	34.29
9366.	van (thien3060)	35	67.93	84.00	7	20.00
9367.	Simeon (simbg)	35	36.98	46.40	3	8.57
9368.	Eva (etty_mijing)	35	92.71	111.66	18	51.43
9369.	Nahid Hasan Pallab (pallab4...	35	56.17	68.38	4	11.43
9370.	Rick (eric1699)	35	70.70	81.04	8	22.86
9371.	Cris Anthony (crisanthonio_...	35	39.97	47.62	3	8.57
9372.	Say_the (saythe)	35	63.36	80.07	6	17.14
9373.	Shohidujjaman (sajib975)	35	45.26	56.39	33	94.29
9374.	Saber (saberspeed777)	35	100.41	121.44	13	37.14
9375.	Jay (saberon1402)	35	63.74	72.90	0	0.00
9376.	K (rynetemp)	35	70.81	102.61	9	25.71
9377.	amy (rose51203)	35	99.67	125.87	8	22.86
9378.	رحيم (rahim06)	35	59.71	70.11	3	8.57
9379.	Gavin (qwertyparty)	35	98.07	121.19	14	40.00
9380.	Peter (ptrmai)	35	83.20	95.56	9	25.71
9381.	Under (polish_underdog)	35	107.43	119.89	22	62.86
9382.	PK (pkhou)	35	49.72	64.29	3	8.57
9383.	aerisslowers (pietrucha33)	35	77.51	98.83	9	25.71
9384.	1234 (perfect_practice)	35	112.01	132.53	17	48.57
9385.	PoonPounder (p00np0under)	35	63.96	76.58	12	34.29
9386.	Gilbert (ooblek)	35	87.73	106.44	10	28.57
9387.	Anton (noviru)	35	72.11	87.33	9	25.71
9388.	Novas (novas_arcos)	35	81.88	94.14	7	20.00
9389.	Ninja (ninjaacat)	35	90.09	108.48	12	34.29
9390.	Neil (neilborde)	35	101.33	122.55	12	34.29
9391.	Camden (mypenguinbuddy)	35	103.31	132.65	14	40.00
9392.	Ryan (moseqa)	35	63.90	82.02	3	8.57
9393.	Jacob (monkeybenq)	35	105.83	129.58	18	51.43
9394.	misab (misabshibu)	35	20.67	31.08	14	40.00
9395.	Dagareth (mindcrime)	35	86.19	105.25	8	22.86
9396.	Jemo (mille_colombes)	35	78.62	96.08	11	31.43
9397.	MilkhoundTTV (milkhound)	35	107.39	140.66	12	34.29
9398.	MHR (mhrofficial)	35	58.47	72.91	6	17.14
9399.	Ajay (metacorb)	35	56.11	66.16	4	11.43
9400.	Louis 🤴🏾 (matiny)	35	51.19	61.84	2	5.71
9401.	Mark (mark666)	35	67.81	96.93	16	45.71
9402.	Maple (maplesyrup789)	35	83.13	101.69	17	48.57
9403.	OTL (floormint)	35	63.11	69.79	7	20.00
9404.	Financier (financier)	35	121.50	141.06	16	45.71
9405.	Farhan M. (farhanmasud)	35	83.36	95.04	8	22.86
9406.	David (fantasticdavid)	35	68.89	86.04	8	22.86
9407.	🥇 Evan C. (evancnavarro)	35	103.47	118.45	13	37.14
9408.	Max (elsancho5)	35	94.06	112.56	10	28.57
9409.	ahmed (elkfafy)	35	55.99	71.17	2	5.71
9410.	Rob (ebqs)	35	57.16	68.45	4	11.43
9411.	Daniel (dsonger20)	35	90.13	112.44	13	37.14
9412.	Derek (doggish)	35	92.99	109.74	12	34.29
9413.	Wasabi (distartor)	35	54.78	65.83	7	20.00
9414.	Adi (diddly_doo)	35	84.13	95.31	7	20.00
9415.	Deron (deronpianoplayer)	35	74.68	92.40	10	28.57
9416.	dedendje (dedendje)	35	83.58	94.95	8	22.86
9417.	Darian (darian_adiwarna)	35	80.84	104.45	11	31.43
9418.	DanGaL2017 (dangal2017)	35	65.56	77.19	10	28.57
9419.	Crayon (crayonsc)	35	81.24	98.78	9	25.71
9420.	cortmarshal (cortmarshal)	35	97.59	122.44	12	34.29
9421.	Comfy_Kitten (comfykitten)	35	100.58	119.53	13	37.14
9422.	citrus (citrustrack)	35	111.85	131.40	21	60.00
9423.	Chris (chrislowe)	35	82.27	100.06	12	34.29
9424.	chalk (chalkboard)	35	78.33	91.20	11	31.43
9425.	Dharma (cdharmateja)	35	78.97	95.88	20	57.14
9426.	I love ctrl + backspace (ca...	35	85.10	106.68	14	40.00
9427.	Carter (cartermanator)	35	65.63	82.45	5	14.29
9428.	Cadence (cadence_workman)	35	114.99	135.64	24	68.57
9429.	Caco (cacopholey)	35	85.09	111.00	11	31.43
9430.	Name (buttface69)	35	128.77	151.17	18	51.43
9431.	Brt (brtboi)	35	70.37	90.71	7	20.00
9432.	Bread (breadandbuddha)	35	98.88	117.08	25	71.43
9433.	Christian (bobbyjrrocks)	35	82.84	108.76	6	17.14
9434.	shellyshellyshellyumm (blue...	35	100.35	114.97	13	37.14
9435.	Dhia Eddine (bl1ndk)	35	48.10	56.94	1	2.86
9436.	Anish (bira_01)	35	58.22	69.92	8	22.86
9437.	big (bigfinger420)	35	103.43	122.40	13	37.14
9438.	FoolSt0p (beanenthusiast)	35	89.24	114.63	12	34.29
9439.	Bartłomiej (baryla69baryla69)	35	79.40	90.78	14	40.00
9440.	Camel (bandar314@yahoo.com)	35	67.21	84.63	7	20.00
9441.	Bridget (bahns)	35	60.83	80.96	8	22.86
9442.	Ilya (azeti1)	35	52.35	58.42	6	17.14
9443.	Abdelrahman (awebdo)	35	55.27	65.87	2	5.71
9444.	Dalle (ash_ish)	35	76.01	100.43	9	25.71
9445.	mtn (m0untain)	35	71.54	88.19	8	22.86
9446.	Hayaku (m0tt0_hayaku)	35	53.49	66.39	3	8.57
9447.	lysrac (lysrac)	35	66.62	88.81	5	14.29
9448.	Lux (lux_winters)	35	105.64	127.96	23	65.71
9449.	Guilherme (luxidu)	35	75.60	86.45	11	31.43
9450.	justin (lookitsjustin)	35	90.19	110.67	15	42.86
9451.	Robert (lonewulf92)	35	120.96	156.81	19	54.29
9452.	Kylie (kyky_)	35	98.86	111.56	12	34.29
9453.	kpsmelvin (kpsmelvin)	35	55.50	67.04	5	14.29
9454.	Kizu (kizuiyo)	35	89.08	111.26	10	28.57
9455.	Kish (kisharora)	35	57.23	69.68	10	28.57
9456.	Blessed (king_blessed)	35	61.78	81.10	9	25.71
9457.	kilkuwu (kilkuwu)	35	79.16	93.29	9	25.71
9458.	Kenny (kenny053)	35	41.17	49.69	6	17.14
9459.	Shalowley (keepitcookie)	35	78.84	99.14	6	17.14
9460.	KarstenPH (karstenplayz)	35	47.26	64.77	10	28.57
9461.	arnav (junkbaby)	35	118.61	147.69	21	60.00
9462.	Juls (juls22)	35	93.33	106.04	8	22.86
9463.	Jokūbas (jokstercube)	35	74.51	91.00	14	40.00
9464.	JimDeezy (jimdeezy)	35	106.25	145.37	14	40.00
9465.	Jorge (jfgf11)	35	78.06	99.90	6	17.14
9466.	Jeffryl (jeffryl26)	35	47.44	55.36	5	14.29
9467.	jazz (jazzhand)	35	50.53	60.06	2	5.71
9468.	Shiba (jasjaapdua)	35	88.15	105.05	17	48.57
9469.	Simon (jangjun0901)	35	94.35	117.79	12	34.29
9470.	J (jacktwamb52)	35	105.48	120.56	12	34.29
9471.	Jackson (jackfast)	35	43.12	50.53	1	2.86
9472.	IVAN (ivil)	35	55.90	66.31	6	17.14
9473.	Muhammed (iosonoosha)	35	83.21	100.62	8	22.86
9474.	Ingyou (ingsta)	35	113.21	126.20	15	42.86
9475.	Hani (imonster_22)	35	83.52	109.15	16	45.71
9476.	Guest (imadethisfornoreason)	35	42.83	57.07	1	2.86
9477.	Jack (ikombo)	35	129.63	144.11	23	65.71
9478.	|I|I|I|I|I|I| (iknowwhatimd...	35	81.88	97.84	11	31.43
9479.	Ignacio 🧉 (ignatirabo)	35	69.53	87.28	9	25.71
9480.	Lukas (iamlukas)	35	50.18	62.98	3	8.57
9481.	Amir (iamir)	35	64.87	80.80	8	22.86
9482.	Matthew (hotdawg200)	35	69.75	83.81	7	20.00
9483.	Chuck (helicopter123)	35	121.45	140.37	25	71.43
9484.	x0.25 speed (hazyy324)	35	95.51	113.07	12	34.29
9485.	Joshua (gottajet)	35	72.50	85.28	7	20.00
9486.	Jason (goosejuice)	35	84.26	98.60	6	17.14
9487.	Giovanni (giosda)	35	139.36	179.94	23	65.71
9488.	Martin (gibom)	35	75.28	87.30	10	28.57
9489.	Emil (genjimaster)	35	82.23	93.90	13	37.14
9490.	GeekThrill (geekthrill)	35	56.74	69.14	2	5.71
9491.	gameing (gameing_)	35	65.50	79.51	8	22.86
9492.	Salchica (machete24x)	34	90.93	117.34	9	26.47
9493.	Locksley (locksng12)	34	83.74	99.40	13	38.24
9494.	Lanlana (llnfriend)	34	54.26	74.15	17	50.00
9495.	theerapat (lipertal)	34	62.36	81.72	8	23.53
9496.	Nick (lemech)	34	55.07	71.39	6	17.65
9497.	Kshitij (kshitij_srv)	34	70.17	80.42	6	17.65
9498.	kosmanaut (kosmanaut)	34	90.68	107.06	10	29.41
9499.	Kiran (kkdatkiran)	34	78.80	90.49	8	23.53
9500.	John (kircher32245)	34	80.11	111.73	14	41.18
9501.	Peter (kamikaze1336)	34	79.76	104.47	13	38.24
9502.	Jacq (jvjacq)	34	61.18	79.35	8	23.53
9503.	Justin (jpsmith)	34	51.79	63.86	2	5.88
9504.	Jorgle (jorgleframpleton)	34	88.20	99.62	13	38.24
9505.	Jon (jonc5201)	34	85.81	100.11	13	38.24
9506.	Jackie (johnsonj13)	34	68.70	83.76	14	41.18
9507.	ttv/J0bro (jobrocraftstep)	34	89.54	110.89	10	29.41
9508.	Jha (jha94)	34	120.52	145.78	22	64.71
9509.	Jetless (jetless27)	34	65.28	84.05	7	20.59
9510.	jc.ekrem (jc_ekrem)	34	76.95	95.13	11	32.35
9511.	JaydenPrbhd (jayden_prbhd010)	34	66.37	89.82	6	17.65
9512.	+923326006034 (janan9233260...	34	57.88	72.31	6	17.65
9513.	!dreamer#9577@dscrd (jaixhi...	34	63.06	77.68	8	23.53
9514.	jad (jadtriestyping)	34	78.49	92.55	3	8.82
9515.	Jalen (jaalen21)	34	86.33	102.57	12	35.29
9516.	itbolt (itbolt)	34	95.85	128.38	17	50.00
9517.	Ivan (ipenipent)	34	111.82	131.82	23	67.65
9518.	Race (im_not_cheating_ur_wi...	34	90.80	107.34	13	38.24
9519.	Robbie (idkloltype)	34	45.68	56.43	4	11.76
9520.	ryan (hopedarklord1)	34	116.89	140.38	20	58.82
9521.	Hk (hk2257853)	34	48.68	61.73	4	11.76
9522.	Hikaru (hikaruk)	34	58.13	67.83	4	11.76
9523.	heikrana (heikrana)	34	69.81	79.50	10	29.41
9524.	Mark (haxos)	34	90.70	104.82	13	38.24
9525.	Tzemis (greekjames)	34	90.41	118.03	14	41.18
9526.	brooklyn (furretmastr)	34	106.88	126.24	12	35.29
9527.	ABC (funnelcake9)	34	122.69	137.00	17	50.00
9528.	raffa (scoradian)	34	93.51	103.55	15	44.12
9529.	sangay (sangay2018)	34	53.77	65.47	1	2.94
9530.	Pakistan is my Love (sancbae)	34	57.44	71.80	19	55.88
9531.	Sami (samitariq94)	34	125.00	142.96	27	79.41
9532.	ogamiseta (samarthos)	34	119.95	129.56	12	35.29
9533.	salmi (salmitot)	34	88.90	105.94	15	44.12
9534.	Sadra (sadra17)	34	102.04	121.03	15	44.12
9535.	Russian (russian_comrade)	34	68.68	80.59	11	32.35
9536.	Ruben (ruben_ashughyan)	34	68.73	85.42	8	23.53
9537.	Mike (roguecurlybracket)	34	98.11	114.51	10	29.41
9538.	Robsonwp (robsonwp)	34	86.38	102.34	9	26.47
9539.	Raghav (rkaushal_03)	34	39.54	47.95	2	5.88
9540.	Richie (richiele_01)	34	94.53	119.92	15	44.12
9541.	Lorum (rexicide)	34	105.21	136.33	14	41.18
9542.	Fin (resarded)	34	63.08	85.66	10	29.41
9543.	(rektbydoge21)	34	83.49	99.87	8	23.53
9544.	Ricky (rcheungwtf)	34	95.71	115.68	9	26.47
9545.	Wai Yon (ravesplash)	34	70.65	79.24	17	50.00
9546.	Rageon (rageon718)	34	62.01	72.55	12	35.29
9547.	Emad Iqbal (racer47)	34	88.89	104.01	10	29.41
9548.	Racecar (racecar_lettuce)	34	125.54	137.37	22	64.71
9549.	Quagsire (quagsireyaj)	34	78.35	98.72	15	44.12
9550.	Aviral (programmer_typist)	34	65.52	85.78	7	20.59
9551.	MD. Rashedul (porosh45)	34	58.72	75.48	5	14.71
9552.	pedro (pedrovales)	34	53.88	63.93	3	8.82
9553.	Pawan (pawan_kumar)	34	68.93	81.90	7	20.59
9554.	Warley (patrickwarley)	34	41.71	54.24	1	2.94
9555.	nocchio (nocchio)	34	100.29	119.60	10	29.41
9556.	Ninth (ninth_player)	34	89.52	104.33	23	67.65
9557.	go easy (nielsenco)	34	115.51	139.69	27	79.41
9558.	Nam (nchu027)	34	84.00	111.22	14	41.18
9559.	Nam3tA3n (nam3tak3n)	34	52.59	67.16	1	2.94
9560.	Naba (naba0224)	34	95.28	106.29	15	44.12
9561.	mulluch (mulluchian)	34	76.90	97.63	6	17.65
9562.	mmlvx (mmlvx)	34	63.91	74.88	11	32.35
9563.	grieves (mmcph36)	34	81.49	91.99	4	11.76
9564.	Miz (miztypes)	34	110.23	125.64	16	47.06
9565.	gradient (misaelmmorales06)	34	94.37	111.20	12	35.29
9566.	ash (mikadole)	34	89.87	109.88	15	44.12
9567.	Migsgd (migelawan123)	34	131.34	151.21	27	79.41
9568.	Adam (merrth)	34	95.95	111.42	6	17.65
9569.	Mole (mementomole)	34	51.44	68.42	8	23.53
9570.	Micheal (mbroaders)	34	74.77	89.88	9	26.47
9571.	Matthew (matthewdilks)	34	85.51	111.09	17	50.00
9572.	Masked (masked_error)	34	60.27	72.97	11	32.35
9573.	Marinos (marinosdim)	34	52.59	63.36	1	2.94
9574.	Zhroon (znub)	34	81.52	103.73	9	26.47
9575.	zizonesol (zizonesol)	34	63.93	75.75	10	29.41
9576.	zeko (zekoo)	34	108.22	124.54	13	38.24
9577.	Tyler (yppah)	34	104.24	117.27	18	52.94
9578.	bofa (xxx_bofa_xxx)	34	107.48	118.74	12	35.29
9579.	boop (xkeons)	34	48.41	57.88	0	0.00
9580.	Dylan (xdylkay)	34	108.39	122.85	20	58.82
9581.	Derek (xdirection)	34	95.80	117.24	14	41.18
9582.	Wuchereria (wuchereria)	34	105.17	121.56	19	55.88
9583.	wingman41 (wingman41)	34	81.99	98.53	9	26.47
9584.	JEFF (wimpyjeff)	34	69.55	86.26	10	29.41
9585.	unholy (virus_)	34	55.65	69.72	6	17.65
9586.	Charlotte (videogame_hacker)	34	133.74	161.56	28	82.35
9587.	Hey (veeceebee)	34	93.23	116.89	18	52.94
9588.	Vedant (ved2254)	34	69.97	80.33	7	20.59
9589.	Valeria (valeriacervel)	34	65.72	79.41	6	17.65
9590.	Tyrocune (tyrocune)	34	58.94	69.64	8	23.53
9591.	Jericho (typersimon)	34	86.95	98.30	10	29.41
9592.	Daphne (trippyonions)	34	67.32	86.97	7	20.59
9593.	Maksym (trickstermaks)	34	70.96	91.34	7	20.59
9594.	Tom (tom1110)	34	65.77	90.73	8	23.53
9595.	Iocus (tisabay)	34	62.46	83.61	3	8.82
9596.	Timofey (timofey_s)	34	90.26	104.19	9	26.47
9597.	Thunderwith (thunderwith)	34	94.54	130.13	14	41.18
9598.	rae (thedarkoknight)	34	91.38	113.05	16	47.06
9599.	thebeesknees (thebeesknees_)	34	83.67	104.44	16	47.06
9600.	Connor (swedish_master)	34	67.17	81.52	6	17.65
9601.	Cthulhu (survivcthulhu)	34	74.76	92.38	6	17.65
9602.	superultimate23 (superultim...	34	57.47	73.37	6	17.65
9603.	Dan (subprime)	34	114.23	143.24	21	61.76
9604.	Stick (stick69)	34	59.45	71.92	6	17.65
9605.	Cameron (spinnie123)	34	56.93	67.96	4	11.76
9606.	an average vietnamese typis...	34	79.98	113.28	9	26.47
9607.	Mitsuo (sp33d1sk3y)	34	102.19	118.46	14	41.18
9608.	Sole (soleduck)	34	122.41	152.43	14	41.18
9609.	ada (smdge)	34	76.16	99.45	9	26.47
9610.	Smack (smack_ke)	34	60.33	69.10	6	17.65
9611.	(singalong_monkey)	34	87.06	102.70	14	41.18
9612.	yan (shocker142)	34	91.62	105.78	12	35.29
9613.	katie (shartball)	34	57.25	70.69	5	14.71
9614.	Corona Time (shamalamakiwi)	34	71.91	91.61	10	29.41
9615.	Serenity (seerenityy)	34	115.84	134.37	21	61.76
9616.	appu (appu46)	34	50.52	61.25	5	14.71
9617.	ApocJTL (apocjtl)	34	89.05	115.85	10	29.41
9618.	Small (amaro123)	34	84.48	103.96	7	20.59
9619.	Alstr (alstr)	34	90.90	118.69	15	44.12
9620.	ali (alianggie)	34	48.76	61.25	3	8.82
9621.	Aji (ajiwahyuw)	34	94.90	109.00	17	50.00
9622.	Ahsan (ahsanhussain)	34	103.08	119.64	13	38.24
9623.	Frangsinatra (addaxer)	34	83.04	105.83	10	29.41
9624.	Artichamp (abhrajit_saha)	34	78.44	93.13	8	23.53
9625.	Abhishek (abhi_720)	34	43.12	54.78	1	2.94
9626.	Abdullah (abdullahshah_)	34	45.51	55.04	1	2.94
9627.	Aadil (aadil0392)	34	68.10	86.23	10	29.41
9628.	ARTHUR (4rthur)	34	85.17	107.92	12	35.29
9629.	krittika (mojitroll)	34	73.19	83.47	7	20.59
9630.	lerii (lerii)	34	46.47	59.86	3	8.82
9631.	Matthew (mpfstudios)	34	52.23	66.38	5	14.71
9632.	Aziza (meem_grfx)	34	52.50	62.55	3	8.82
9633.	Neelie (neeliee)	34	101.00	115.05	15	44.12
9634.	Triyanshu (triyanshu1996)	34	58.68	72.36	6	17.65
9635.	Jesse (jrochefo)	34	61.13	69.42	5	14.71
9636.	Elya (elyagolry)	34	43.03	58.44	8	23.53
9637.	JB (chequer)	34	123.54	146.50	19	55.88
9638.	swapnil (sj480)	34	30.52	37.53	4	11.76
9639.	Nuradil (nuradil_zhambyl)	34	107.29	130.16	14	41.18
9640.	Jakob (shaquer)	34	82.62	101.76	11	32.35
9641.	Paul (pauljurgens)	34	65.07	78.85	9	26.47
9642.	Kevin (hylo28)	34	103.58	123.87	14	41.18
9643.	Jannett (jannett)	34	24.72	35.66	5	14.71
9644.	kai (iiiiikai)	34	55.62	72.12	5	14.71
9645.	PP (s090351114)	34	53.69	63.39	7	20.59
9646.	Jeremy (jeteryankee2)	34	80.99	102.92	13	38.24
9647.	Pharaoh (pharaoh_zr)	34	61.38	81.36	14	41.18
9648.	Thanh (alians)	34	69.55	82.52	7	20.59
9649.	do better (do_better)	34	71.87	90.82	8	23.53
9650.	Phillip (jurten)	34	94.31	123.36	24	70.59
9651.	Ted (ted_j_kaczynski)	34	75.31	92.92	14	41.18
9652.	Nikobaby (robemigani)	34	73.91	96.38	8	23.53
9653.	tstats[rafid149] (rafid149)	34	74.68	99.44	6	17.65
9654.	Justin (flamebun)	34	99.54	118.83	16	47.06
9655.	Fauzan (fblues)	34	89.04	99.18	10	29.41
9656.	Eryk (fatmamma)	34	91.09	102.49	8	23.53
9657.	Askefise (fast_as_sanic)	34	90.72	114.99	18	52.94
9658.	Marcus (fakedefulty)	34	41.40	57.26	3	8.82
9659.	Fabi (fabilula)	34	43.40	57.05	3	8.82
9660.	Erl (erlisgod)	34	54.36	63.01	4	11.76
9661.	Skraap (elskrapo)	34	86.51	104.59	7	20.59
9662.	elbert (elbert1104)	34	59.27	70.35	6	17.65
9663.	harsh spacebar broke lol (d...	34	56.40	71.78	6	17.65
9664.	Dileep (dileepnk)	34	87.57	117.66	11	32.35
9665.	Vandy (desmaid)	34	105.13	124.53	18	52.94
9666.	John (dent12)	34	53.75	67.20	7	20.59
9667.	Prdel (dendritic_cell)	34	62.74	69.68	9	26.47
9668.	Jay (cutecanadian)	34	57.33	69.82	8	23.53
9669.	Iyanically (cryptic_cosmic)	34	80.39	96.72	10	29.41
9670.	sion (crossblade06)	34	75.31	87.13	11	32.35
9671.	Mehraj Mahmood (comiccypressm)	34	33.87	41.16	0	0.00
9672.	Andrew Li (combatwombat123)	34	78.00	91.51	12	35.29
9673.	Clement (clem_jestin)	34	48.53	55.28	2	5.88
9674.	Cindy (cindy1889)	34	69.69	83.36	16	47.06
9675.	Adrian (cheeseshrub)	34	74.18	98.28	8	23.53
9676.	Cameron (camerong123)	34	119.11	143.68	19	55.88
9677.	brindobob (brindobob)	34	138.97	160.83	27	79.41
9678.	Brihoness (brihoness)	34	63.84	76.24	9	26.47
9679.	Alexgiomuel (bionicmjallday...	34	56.04	72.97	4	11.76
9680.	ben (bentypemaster)	34	64.30	76.00	4	11.76
9681.	Benjamin (benhundos)	34	84.16	96.81	8	23.53
9682.	bbygirlturtle (bbygirlturtle)	34	49.59	67.23	7	20.59
9683.	Bob (baine001)	34	74.90	95.54	5	14.71
9684.	loser (badatenglish)	34	88.83	113.70	12	35.29
9685.	Ash (ash_ketchump)	34	49.01	65.62	4	11.76
9686.	Vladimír (froggz)	33	107.11	124.04	23	69.70
9687.	forever_extinct (forever_ex...	33	77.44	103.84	7	21.21
9688.	umang patel (fiasty)	33	48.73	59.55	3	9.09
9689.	Jake (faljake)	33	86.51	112.38	16	48.48
9690.	Esraa (esraa14)	33	17.64	28.41	10	30.30
9691.	Samantha (epoxicx)	33	74.23	101.00	7	21.21
9692.	Enreden (enreden)	33	74.49	95.51	11	33.33
9693.	Eico (eico66)	33	75.77	90.03	11	33.33
9694.	Eduardo (eduardofreitas)	33	59.84	71.35	4	12.12
9695.	tstats[ebenezer13579] (eben...	33	107.44	132.69	7	21.21
9696.	doniee (doniee)	33	101.14	114.70	12	36.36
9697.	streetcar (dohrn1i)	33	74.67	94.43	17	51.52
9698.	Jard (dogspa)	33	105.78	122.95	17	51.52
9699.	Jan (de_necromancer)	33	47.49	60.21	5	15.15
9700.	Deen (deenibsyed)	33	87.98	99.50	9	27.27
9701.	Eric (wangjangler)	33	81.92	94.70	7	21.21
9702.	Grant (datasianguy23)	33	111.13	136.03	17	51.52
9703.	Daniel (danntheman21)	33	54.70	68.78	5	15.15
9704.	Dankerino (dankerinohd)	33	79.43	94.15	11	33.33
9705.	amalia (chowdergirl)	33	87.21	108.56	10	30.30
9706.	butane (butanebutton)	33	81.09	96.80	23	69.70
9707.	breadedsouth (breadedsouth)	33	69.22	101.25	4	12.12
9708.	August (boxcybrawler)	33	66.59	75.12	8	24.24
9709.	Emmett (bigblueyeti)	33	77.58	90.81	5	15.15
9710.	binay (biany671)	33	36.80	46.06	3	9.09
9711.	Bermet (bermetibr)	33	36.26	44.93	0	0.00
9712.	JumboTub4 (ben_is)	33	68.75	86.78	7	21.21
9713.	baker (bakervai001)	33	37.25	46.60	1	3.03
9714.	Hari (baby1_jimmy)	33	121.69	145.25	17	51.52
9715.	Awnvar (awnvar)	33	55.22	70.53	4	12.12
9716.	adam (armorcle__)	33	110.31	132.16	15	45.45
9717.	Zerrox (zerrox)	33	100.50	116.99	16	48.48
9718.	Vilantas (zenblax)	33	44.47	49.97	7	21.21
9719.	Zedrick (zedrickbr)	33	128.24	152.60	25	75.76
9720.	Doyle (zdubhghaill)	33	68.28	82.14	6	18.18
9721.	Zac (zactus_)	33	57.97	70.02	4	12.12
9722.	Kutya (ysakovvvs)	33	42.67	52.62	4	12.12
9723.	YaBoi (yab0i)	33	63.78	74.61	4	12.12
9724.	(xxgamerprofunxx)	33	95.23	111.89	7	21.21
9725.	Xeethra (xeethra)	33	89.14	105.31	15	45.45
9726.	Santosh (wow123__)	33	50.37	60.55	4	12.12
9727.	Wella (wella05)	33	61.23	75.92	24	72.73
9728.	Tom (voiovinili)	33	70.54	89.53	7	21.21
9729.	vamsi (vamsibharadwaj)	33	55.90	64.41	3	9.09
9730.	Uziel1595 (uziel1595)	33	61.57	74.97	7	21.21
9731.	Simon (unclesimon)	33	60.59	93.68	18	54.55
9732.	Uddaya (uddaya)	33	61.93	77.17	8	24.24
9733.	ɥsǝdǝǝᗡ (toxin_d)	33	67.61	80.77	12	36.36
9734.	Scarlet (tongli10)	33	69.71	82.98	10	30.30
9735.	timmy (timmy14)	33	75.81	88.63	11	33.33
9736.	TIFF (tiffanytai888)	33	44.55	51.01	3	9.09
9737.	Kurt (thydark)	33	104.77	124.55	19	57.58
9738.	Thithiesha (thithiesha)	33	69.37	80.85	11	33.33
9739.	Sam (the___sam)	33	71.65	84.52	5	15.15
9740.	Ryan (theguy985)	33	87.38	119.70	14	42.42
9741.	Matthew (thefinchler)	33	71.23	80.89	6	18.18
9742.	Taquid (taquid)	33	70.50	85.79	12	36.36
9743.	Tair (tako_01)	33	33.51	41.03	2	6.06
9744.	Jake (superduperjake)	33	86.47	100.04	12	36.36
9745.	sulux (sulux_14)	33	52.45	60.62	0	0.00
9746.	Sylvaen (suggestedrp)	33	90.44	107.64	11	33.33
9747.	Kersey (strythio)	33	107.43	125.43	23	69.70
9748.	David (spurgeon)	33	82.43	107.54	4	12.12
9749.	Spike (sp4rks)	33	64.51	83.90	10	30.30
9750.	Socceryolo (socceryolo)	33	57.90	79.55	5	15.15
9751.	Guest (slowpokest)	33	77.61	104.52	7	21.21
9752.	(slowandinaccurate)	33	121.79	164.93	19	57.58
9753.	Lagmybsf (sk0ttt)	33	90.36	109.44	13	39.39
9754.	Gilbert (sigalingging_23)	33	88.21	102.77	7	21.21
9755.	xD (shabanllokmja)	33	54.25	67.51	4	12.12
9756.	Sestain (sestain)	33	76.29	91.21	9	27.27
9757.	JDizzle (serinus)	33	99.27	132.74	13	39.39
9758.	Couldn't be you (malthekr)	33	83.50	95.89	29	87.88
9759.	m0nst3r (m0nst3r9)	33	54.30	67.43	7	21.21
9760.	Liam (lwebb167)	33	79.87	89.06	9	27.27
9761.	LuciD (luci_d)	33	82.95	94.26	15	45.45
9762.	tstats[lil_issam312] (lil_i...	33	31.93	39.19	1	3.03
9763.	King Bygone (lil_bygone)	33	95.41	117.08	7	21.21
9764.	Wen (legendxiang)	33	87.54	105.84	11	33.33
9765.	Noah (l0cket)	33	61.39	75.56	4	12.12
9766.	krystall (krrystall)	33	57.37	74.94	7	21.21
9767.	Krish (krish_agn)	33	43.05	56.27	14	42.42
9768.	Ludvig (krang)	33	60.44	73.16	9	27.27
9769.	kevin (kevinstj)	33	94.53	127.61	11	33.33
9770.	keb (kerringtonbridges)	33	57.64	74.94	6	18.18
9771.	MOHANA (kanthetimohana)	33	59.92	70.37	0	0.00
9772.	Kalin (kamarel)	33	84.93	104.81	13	39.39
9773.	Yoshi (justayoshi)	33	74.27	91.65	6	18.18
9774.	Guest (jun16)	33	82.80	96.27	11	33.33
9775.	Ice (juicedicee)	33	73.25	92.19	9	27.27
9776.	Joshua (joshuajunhee)	33	83.54	116.76	10	30.30
9777.	Jonah (jonahtzy)	33	76.86	106.28	12	36.36
9778.	Ron(ald) (jellybeanman)	33	97.38	114.32	20	60.61
9779.	James (jameslroll)	33	114.33	134.74	19	57.58
9780.	Puntlander (jamaquube)	33	76.19	87.05	8	24.24
9781.	Jáky (jaky_)	33	45.45	53.33	4	12.12
9782.	Aryan (jai_ho420)	33	42.56	57.11	2	6.06
9783.	Ivan (ivangoh321)	33	79.35	88.46	7	21.21
9784.	Lynnette (its_lynnie27)	33	111.80	173.89	19	57.58
9785.	khy (itskhylmao)	33	59.91	75.57	27	81.82
9786.	iterative (iterative)	33	36.76	45.44	1	3.03
9787.	Insany (insanyngame)	33	64.11	73.28	17	51.52
9788.	Oflu61 (ilkerb)	33	113.26	133.30	18	54.55
9789.	hutab (hutab)	33	66.50	81.97	14	42.42
9790.	Adam (hodowcaowiec)	33	82.38	93.37	8	24.24
9791.	HK_TeddyBear (hk_teddybear)	33	39.10	52.69	4	12.12
9792.	HiroHero (hirohero89)	33	100.80	121.10	13	39.39
9793.	tstats[harryrich02] (harryr...	33	61.89	73.09	5	15.15
9794.	hao (haoatran)	33	93.76	106.25	18	54.55
9795.	Hachikachi (hachikachi)	33	105.01	123.28	18	54.55
9796.	Habibur (habiburrahman_mu)	33	43.81	68.34	8	24.24
9797.	G_low (g_low)	33	59.13	89.87	11	33.33
9798.	Adam (goodboyadam)	33	101.39	130.26	9	27.27
9799.	R (ghostboy)	33	89.58	115.28	19	57.58
9800.	Bootstrap (gaurav021992)	33	66.86	86.57	19	57.58
9801.	sasquatch (sasquatchplatypus)	33	40.63	53.57	5	15.15
9802.	Andrew (sasamori)	33	92.48	110.11	12	36.36
9803.	rodrigo (rodtronx)	33	74.61	86.41	4	12.12
9804.	RITIK (ritik1999)	33	32.32	38.22	3	9.09
9805.	Vivian Le (riru)	33	65.03	76.29	3	9.09
9806.	Ridans (ridans)	33	78.22	98.63	7	21.21
9807.	Rhune (rhunetro)	33	68.21	80.14	6	18.18
9808.	ralf (rhalfik)	33	72.48	92.53	10	30.30
9809.	Ben (random_peepsle12)	33	64.17	74.53	7	21.21
9810.	ramu kumar (ramu_kumar)	33	63.43	76.93	10	30.30
9811.	rambalaji (rambalaji)	33	75.54	98.37	11	33.33
9812.	Rakshit_dvorak (rakshit007)	33	78.13	95.08	14	42.42
9813.	rajan (rajan_singh123)	33	44.73	53.91	22	66.67
9814.	raging_wolf (raging_wolf)	33	56.67	69.97	3	9.09
9815.	r0hkx (r0hkx)	33	88.63	111.67	8	24.24
9816.	Quang (puangpro__6969)	33	58.32	69.23	15	45.45
9817.	Will (pozzpyo)	33	93.73	104.39	13	39.39
9818.	PJ (pjk519)	33	64.72	80.31	8	24.24
9819.	Ed (pelly1863)	33	86.29	99.87	6	18.18
9820.	Pegasus X (pegasusx)	33	34.08	45.58	1	3.03
9821.	Happy (paimon__)	33	70.39	86.15	7	21.21
9822.	Null (nullstring)	33	91.65	106.44	11	33.33
9823.	Nuan (nuan56)	33	72.06	91.79	7	21.21
9824.	(nt_chill)	33	99.88	118.27	12	36.36
9825.	Luke (nsaagent115)	33	92.30	112.83	12	36.36
9826.	Garbage (nerdballer)	33	127.63	151.31	22	66.67
9827.	Nik (nazeki)	33	96.37	123.41	19	57.58
9828.	Andrew (narchio)	33	98.45	118.93	10	30.30
9829.	Yuko (naoyuko)	33	77.53	84.74	7	21.21
9830.	Naomi (namtheyam)	33	98.29	116.51	16	48.48
9831.	Perhs (mrbunnym)	33	64.72	85.51	7	21.21
9832.	mky (mky1)	33	85.35	101.89	13	39.39
9833.	ig @emkloco (mkplayz)	33	80.40	96.05	6	18.18
9834.	Mitchell (mitchell721)	33	74.00	100.07	5	15.15
9835.	laffytaffy (mihirsm)	33	69.49	86.36	4	12.12
9836.	Mitchell (mdyer44)	33	86.53	107.17	11	33.33
9837.	chaotix (mcomm7)	33	75.13	89.31	6	18.18
9838.	Maxi (maxi25)	33	65.32	79.69	7	21.21
9839.	Marky (mark2most)	33	69.93	85.59	4	12.12
9840.	Mandeep (mani7246)	33	66.43	80.56	10	30.30
9841.	starsick (ardentauthoress)	33	103.72	122.72	18	54.55
9842.	Appel (appelboer)	33	75.42	93.39	11	33.33
9843.	Annie (anniesimp)	33	77.07	91.33	10	30.30
9844.	Anisath Kirubakaran (anisath)	33	44.44	52.69	4	12.12
9845.	AnesDZ (anes201)	33	79.72	93.98	11	33.33
9846.	alex j (alexjonelis)	33	64.61	82.88	14	42.42
9847.	Alexey (aleksn7)	33	68.06	82.70	5	15.15
9848.	Anton (alejendaryguy)	33	104.58	121.95	1	3.03
9849.	TulBott (alb3rth3nry)	33	101.29	118.77	14	42.42
9850.	AGTNurat (agtnurat)	33	119.05	142.35	20	60.61
9851.	abnf (abnf)	33	78.89	90.44	9	27.27
9852.	Max (2zmaxx)	33	96.02	117.32	14	42.42
9853.	Angel (angelbullet)	33	76.31	87.82	12	36.36
9854.	macc (softiebby)	33	87.57	112.23	9	27.27
9855.	shshsh (alex2003_)	33	47.36	55.76	2	6.06
9856.	Julien (dadcomeback)	33	92.87	106.88	14	42.42
9857.	Arun (arunkodumuru)	33	66.75	81.24	9	27.27
9858.	Ajeet (stripedcat12)	33	66.36	79.79	10	30.30
9859.	ARF (arf_g3)	33	72.01	87.45	11	33.33
9860.	Sun (sun730)	33	105.34	121.70	14	42.42
9861.	sarah (samuro)	33	114.40	136.04	18	54.55
9862.	GreenMilk (greenmilk7)	33	70.57	97.55	8	24.24
9863.	Fold Folded (nomine)	33	86.85	99.28	11	33.33
9864.	Anky (ankybisen)	33	39.65	50.29	1	3.03
9865.	Gojdoma (gojdoma1910)	33	78.73	99.94	11	33.33
9866.	sinnoh (serokai1721)	33	71.92	94.60	10	30.30
9867.	carzard (carzard)	33	52.58	61.67	5	15.15
9868.	remu (remu_gareu)	33	61.62	69.32	0	0.00
9869.	Gergő (gergi7600)	33	63.71	81.53	7	21.21
9870.	Arespi (arespi)	32	89.93	101.79	8	25.00
9871.	Antombomb (antombomb)	32	32.36	45.83	3	9.38
9872.	Anthony (anthonyjhwu)	32	47.72	56.60	2	6.25
9873.	Adebayọ (annonp)	32	67.67	89.19	8	25.00
9874.	milyn (alymilyn)	32	64.82	74.86	10	31.25
9875.	All-Rounder_28 (allrounder28)	32	74.26	96.16	9	28.13
9876.	good (afternoonracer)	32	81.80	101.02	14	43.75
9877.	🐌 (adas291)	32	77.21	86.48	12	37.50
9878.	Ace (acechow)	32	91.85	113.51	10	31.25
9879.	Abhishek (abhikumar98)	32	65.78	76.72	7	21.88
9880.	Abdullah (abdullahbb102)	32	71.71	94.92	4	12.50
9881.	Thomas (2minute)	32	68.82	76.45	9	28.13
9882.	Leo (1_typer_boy_1)	32	86.91	101.78	8	25.00
9883.	Nick (1chompy_)	32	79.40	90.82	11	34.38
9884.	Ramakant (ramakant)	32	35.46	49.52	1	3.13
9885.	Spectral (sspectral)	32	60.16	74.76	3	9.38
9886.	Toni (meecoula)	32	90.54	106.34	10	31.25
9887.	Joaquin (joaquino19)	32	46.45	57.39	21	65.63
9888.	Matt (hoopenator)	32	62.39	79.16	7	21.88
9889.	Adrian (apa9906)	32	71.55	90.94	30	93.75
9890.	Yuvi (yuva_yuvi)	32	44.14	55.24	5	15.63
9891.	Yul (toonguy)	32	90.22	120.20	16	50.00
9892.	sheg (shegsheg)	32	76.66	92.80	8	25.00
9893.	Alexander (thefastgumby)	32	56.60	64.95	5	15.63
9894.	Uran (uran001)	32	56.91	67.16	15	46.88
9895.	Austin (asasa3092)	32	71.45	89.36	7	21.88
9896.	Soham (microsword)	32	71.32	82.80	7	21.88
9897.	Liam (liamdasilva)	32	80.39	97.22	4	12.50
9898.	m (llelouchh)	32	80.25	96.46	9	28.13
9899.	Buka (obuka)	32	41.59	52.24	3	9.38
9900.	mark (heaterbeater)	32	93.12	111.77	9	28.13
9901.	Melon (mailmelon)	32	54.98	67.17	4	12.50
9902.	MAGNUS (magnus03)	32	57.01	80.73	6	18.75
9903.	Lucia (lucialima)	32	47.18	56.25	2	6.25
9904.	Christopher (lord_pretzel)	32	86.94	109.25	7	21.88
9905.	long (longlonglong)	32	64.58	80.46	7	21.88
9906.	Lojants (lojants1)	32	95.77	111.65	10	31.25
9907.	Albert (lnseed)	32	77.28	96.30	6	18.75
9908.	Eric (llmangoll)	32	66.10	82.09	17	53.13
9909.	LAO (legendoflaohan)	32	69.92	85.76	8	25.00
9910.	Brylle (latios12349)	32	55.25	64.48	1	3.13
9911.	Lathoa (lathoa)	32	79.99	95.29	17	53.13
9912.	Kyle (kyle_15)	32	43.36	57.37	1	3.13
9913.	-_- (kxs5)	32	110.77	124.92	24	75.00
9914.	Alberto Balsalm (kutaybozkurt)	32	70.56	82.63	12	37.50
9915.	twitch.tv/klokkismann (klok...	32	126.39	151.08	8	25.00
9916.	hyunki (kirene)	32	72.34	82.12	10	31.25
9917.	Keith (keithlor)	32	127.22	147.69	18	56.25
9918.	🥴 (kangjushang)	32	50.65	61.50	1	3.13
9919.	v(._.)v (justbeatya)	32	64.92	78.96	6	18.75
9920.	Julian (julianeadie)	32	53.33	63.03	3	9.38
9921.	Julia (juliaar)	32	56.76	70.15	7	21.88
9922.	Juggernaut (jugg07)	32	96.32	112.60	11	34.38
9923.	James (jrm371)	32	75.85	103.51	11	34.38
9924.	Joshua (joshque)	32	92.67	110.35	4	12.50
9925.	Jose (jgeer)	32	66.16	75.42	6	18.75
9926.	JackBurst (jackburst)	32	107.16	125.24	12	37.50
9927.	Joey (j0ash08)	32	56.37	66.32	16	50.00
9928.	Hasit (invincible678)	32	59.20	87.45	5	15.63
9929.	Highly unskilled (intenseag...	32	152.54	201.70	20	62.50
9930.	Smitty W. (ifartfire)	32	71.42	84.18	7	21.88
9931.	ICE TEA (ice_tea911)	32	59.33	70.89	5	15.63
9932.	Victor (hueylouisnonews)	32	90.74	103.70	12	37.50
9933.	Claire (house_cat)	32	71.14	81.98	7	21.88
9934.	Hobo (hobo_rapper)	32	83.82	101.30	8	25.00
9935.	AHEN (henneberg)	32	104.15	138.74	12	37.50
9936.	haidilaohotpot (haidilaohot...	32	81.26	91.41	7	21.88
9937.	Gleb (gsavchenko)	32	59.90	68.84	3	9.38
9938.	Graham (grayham11)	32	85.08	99.76	9	28.13
9939.	scarFace (gray25905634)	32	72.53	92.65	7	21.88
9940.	Grace (gracecatan)	32	118.34	131.73	14	43.75
9941.	GoldenSnitch (goldensnitch73)	32	84.96	103.83	7	21.88
9942.	Glad (glad99)	32	74.68	94.57	7	21.88
9943.	Giovanni (giovannigando)	32	80.27	89.92	8	25.00
9944.	Graham (gfoote)	32	96.44	108.33	12	37.50
9945.	Andrew (get_hyped20)	32	95.11	115.36	17	53.13
9946.	Flex (flexiblerhyme30)	32	58.01	71.49	8	25.00
9947.	Chuanyao (finalconflux)	32	87.96	111.04	13	40.63
9948.	Eric (envyhope)	32	87.24	103.21	9	28.13
9949.	engager (engager)	32	65.41	73.88	2	6.25
9950.	Emily (emilyk_3357)	32	93.47	114.49	12	37.50
9951.	Elsawy (elsawy636)	32	78.48	87.78	6	18.75
9952.	SirCanaanDoyle (elevayshun)	32	113.39	143.05	18	56.25
9953.	SlipperySlope (eeilu)	32	77.30	88.62	10	31.25
9954.	Dustin (dustindp99)	32	94.58	110.69	12	37.50
9955.	Dustin (dustin099)	32	87.74	104.16	12	37.50
9956.	The (dhemagicianking)	32	117.51	140.75	14	43.75
9957.	(dev_rec)	32	150.31	185.43	17	53.13
9958.	David (davejiggy)	32	62.52	75.09	5	15.63
9959.	Darkleonard (darkleonard)	32	109.16	124.14	12	37.50
9960.	Danat (danat_ayazbayev)	32	98.52	113.93	10	31.25
9961.	Dammsugaren (dammsugaren)	32	81.09	95.00	11	34.38
9962.	Curo (curo)	32	77.73	91.73	8	25.00
9963.	Cosmin (cosmyd)	32	58.91	69.20	3	9.38
9964.	cookie (cookienbo)	32	79.04	107.54	9	28.13
9965.	Sai Srujan Kumar (chsrujan)	32	95.43	106.39	9	28.13
9966.	Carlos (carlos_007)	32	63.56	75.91	8	25.00
9967.	Espii (carlespe13)	32	69.68	82.79	14	43.75
9968.	Brennan (brennanminns)	32	86.41	104.38	12	37.50
9969.	Putu (boostedwrx)	32	114.72	145.23	17	53.13
9970.	Gordon (boboiv)	32	87.37	114.90	8	25.00
9971.	ameerah (bluecandy)	32	98.63	109.51	16	50.00
9972.	Bibek (bibek_)	32	80.42	94.70	4	12.50
9973.	Prem (batprem)	32	58.02	67.59	3	9.38
9974.	Zack (averyackz)	32	62.71	85.23	8	25.00
9975.	Morpheus14 (atilla_14)	32	81.94	95.50	13	40.63
9976.	Aaron (asc_the_fighter)	32	23.57	28.75	7	21.88
9977.	aron (aron25)	32	95.65	111.05	20	62.50
9978.	Venom (_venom)	32	77.04	94.46	10	31.25
9979.	AaronIsADonkey (_gg_ez_)	32	114.93	137.46	14	43.75
9980.	Zenith (zenith1g)	32	43.65	54.54	1	3.13
9981.	Hoang (yungrax)	32	57.50	68.37	6	18.75
9982.	Yogesh (yogesh9770)	32	45.98	70.07	4	12.50
9983.	MooD (xslel)	32	97.99	125.49	11	34.38
9984.	tstats[xeg28] (xeg28)	32	84.39	94.88	11	34.38
9985.	a (xdxdxd1234)	32	80.99	92.84	4	12.50
9986.	Welame (welame)	32	82.47	96.96	0	0.00
9987.	ColeMacca (weenyboi)	32	75.76	89.97	8	25.00
9988.	Melissa (wally88)	32	99.28	110.54	11	34.38
9989.	Vladi (wacy11)	32	89.41	113.06	10	31.25
9990.	Sunil (w0rds)	32	60.18	79.30	5	15.63
9991.	VYCanis (vycanis55)	32	97.03	105.75	15	46.88
9992.	THE STARDUST (void07)	32	62.15	79.19	7	21.88
9993.	Timo (ustimoger)	32	60.48	76.69	11	34.38
9994.	Will (urbanmist)	32	80.91	94.96	13	40.63
9995.	Ahmed (uproo)	32	63.08	80.86	8	25.00
9996.	Uncreeperble (uncreeperble)	32	84.78	117.56	10	31.25
9997.	AA (typee45)	32	44.22	54.69	6	18.75
9998.	tropics (tropicswpm56)	32	75.48	88.81	11	34.38
9999.	Tonchi (tonch1)	32	95.00	109.04	15	46.88
10000.	Alex (titleist_pro_v1x)	32	79.70	98.94	18	56.25
10001.	Jonathan (the_mechanical)	32	97.86	123.52	9	28.13
10002.	Ronny (the_mandalorian)	32	42.89	56.64	2	6.25
10003.	theaveragedude (the_avg_dude)	32	81.03	98.09	8	25.00
10004.	Timothy (thekoreanbanana)	32	82.68	97.09	14	43.75
10005.	Lightning (thecarsfan)	32	68.55	76.71	7	21.88
10006.	Taybuscus (taybuscus)	32	71.57	88.24	8	25.00
10007.	OnlyStanz (tanni)	32	87.00	104.98	12	37.50
10008.	HASHTAG (talk_is_cheap_like...	32	121.98	141.39	17	53.13
10009.	E (boop_bop)	32	47.23	57.08	0	0.00
10010.	Edward (supereduardus)	32	97.94	117.04	17	53.13
10011.	שפיצער (spitzer722)	32	65.51	85.56	7	21.88
10012.	Saim (spirit_)	32	77.11	101.49	9	28.13
10013.	slowmxbrowns (slowmxbrowns)	32	87.49	103.65	10	31.25
10014.	SLEEPINGzZZ (sleepingzzz)	32	53.20	64.03	5	15.63
10015.	Simeon (sim80)	32	122.38	148.29	17	53.13
10016.	Shon (shonboy21)	32	63.33	75.19	4	12.50
10017.	Shiasuni (shiasuni)	32	114.25	138.24	20	62.50
10018.	Shaun (shaunlooi)	32	84.04	99.07	11	34.38
10019.	Ahanaf Shahriar (shahriar013)	32	48.65	59.37	1	3.13
10020.	Logan (shadows36)	32	69.44	93.82	10	31.25
10021.	scpals (scpals)	32	79.22	102.64	10	31.25
10022.	Sarafraj (sarafraj)	32	49.57	57.20	1	3.13
10023.	Samadou (samadou_10)	32	80.59	102.96	12	37.50
10024.	RyZe (ryzehopz)	32	62.16	80.30	10	31.25
10025.	Ryan (ryanlondon)	32	57.11	72.48	6	18.75
10026.	Tyler Rankin (rxnkin)	32	66.81	80.96	6	18.75
10027.	ronald (ronaldalbarn)	32	87.25	105.65	7	21.88
10028.	Rocks D. (rocksdxebec00)	32	58.24	69.36	6	18.75
10029.	Bakugo (respiro72)	32	118.43	136.95	22	68.75
10030.	Rachel (rachel85881)	32	105.30	118.79	21	65.63
10031.	Anna (rabbitpickles69)	32	93.70	129.75	11	34.38
10032.	Raagaception (raagaception)	32	83.33	105.41	11	34.38
10033.	uzi (r3yna)	32	74.33	92.13	12	37.50
10034.	brownbelly (pvthg)	32	86.92	109.81	12	37.50
10035.	PRACTICE (practicecar)	32	117.33	143.37	19	59.38
10036.	PropheticNPC (potencity)	32	90.79	110.76	8	25.00
10037.	player (player172)	32	39.13	96.44	9	28.13
10038.	Arsh (piratexx)	32	78.04	90.39	23	71.88
10039.	ninii (paniini)	32	91.87	110.12	17	53.13
10040.	Amine (ov4h)	32	59.26	74.26	8	25.00
10041.	Lego (outboxer009)	32	44.65	51.82	3	9.38
10042.	organic (organic__filter)	32	61.72	73.36	6	18.75
10043.	Oscar (oguana)	32	67.44	82.83	6	18.75
10044.	Nico (npvalerio8)	32	89.39	109.18	13	40.63
10045.	Stalin (notdavidcameron)	32	117.89	146.39	18	56.25
10046.	Aanshu (noob_typist_404)	32	68.52	79.94	12	37.50
10047.	Martin (niquid)	32	76.77	90.93	9	28.13
10048.	Nieid (nieid)	32	87.99	116.68	14	43.75
10049.	nakkisoppa666 (nakkisoppa666)	32	98.04	131.34	9	28.13
10050.	Nazarbek (na2a_)	32	111.38	125.58	15	46.88
10051.	Milan (m_i_n_o)	32	56.55	71.07	4	12.50
10052.	Mackenzie (music1713)	32	34.75	40.44	0	0.00
10053.	mukrohin (mukrohin)	32	90.41	109.08	9	28.13
10054.	muhammad (muhd99)	32	68.99	79.29	10	31.25
10055.	Matt Tierney (mtierney111)	32	76.22	100.14	9	28.13
10056.	Percy (mraudiodrama)	32	98.57	116.05	14	43.75
10057.	Matthew (mpb0401)	32	67.64	80.40	5	15.63
10058.	Tanakrit (mogoon)	32	56.34	65.62	7	21.88
10059.	Mamdouh (mmdh)	32	64.44	80.67	11	34.38
10060.	nah (ministermeme)	32	93.31	111.67	9	28.13
10061.	Meruem (meruem1919)	32	140.92	173.02	23	71.88
10062.	Kaung Pyae (meandmyfriend4)	32	57.76	70.40	6	18.75
10063.	Sean (masian08)	32	90.16	105.90	5	15.63
10064.	Sarang (sargfromind)	31	46.32	57.91	4	12.90
10065.	Samit (samitkapoor)	31	77.69	97.04	8	25.81
10066.	ShyKnee (samflysure)	31	58.81	67.96	3	9.68
10067.	nanoray (saliciti)	31	94.02	116.20	11	35.48
10068.	sadwipe (sadwipe)	31	79.80	91.18	7	22.58
10069.	Rubber (rubberduckcolemak)	31	83.35	110.28	10	32.26
10070.	Raul (rromer41)	31	58.41	71.35	0	0.00
10071.	Roy (royroyking)	31	89.89	113.16	10	32.26
10072.	Rikka (rikka_takanashi)	31	123.04	152.90	18	58.06
10073.	Rhevan (rhevan)	31	53.22	61.49	10	32.26
10074.	Reyque (reyquexd)	31	107.93	129.88	10	32.26
10075.	Raul (raule_maule)	31	69.52	83.88	7	22.58
10076.	Raj (raj__)	31	88.12	106.16	10	32.26
10077.	Rad (radandrei)	31	99.77	110.83	19	61.29
10078.	prasanjith (prasanjith)	31	61.64	73.03	3	9.68
10079.	Ivan (pop5a)	31	90.77	113.99	10	32.26
10080.	perm (perm_typeracer)	31	62.34	72.55	3	9.68
10081.	Paul (paulg2k_csgo)	31	73.53	87.80	7	22.58
10082.	Geetansh (pandaculture)	31	74.25	87.42	5	16.13
10083.	OMGnesststats[omgness321] (...	31	69.92	88.99	7	22.58
10084.	Mudit (n___)	31	68.19	79.50	8	25.81
10085.	Nyp3r (nyp3r)	31	59.96	70.85	3	9.68
10086.	NoNo (nonoesimposible)	31	110.07	126.26	15	48.39
10087.	nitrosquid (nitrosquid)	31	96.52	126.27	10	32.26
10088.	nagz (naxumi)	31	82.96	113.98	10	32.26
10089.	mustard maiden (mustardmaiden)	31	115.69	135.64	16	51.61
10090.	Mukhametkali (mr_koten)	31	31.14	39.45	8	25.81
10091.	Mesotelioma (mesotelioma)	31	92.08	107.17	13	41.94
10092.	Max (max_6058)	31	82.06	95.36	10	32.26
10093.	Markus (markustelser)	31	76.50	87.84	14	45.16
10094.	bashar (fuddle_)	31	40.18	53.64	2	6.45
10095.	Faiq Ayubi (froxt)	31	60.54	91.50	8	25.81
10096.	Flying (flyingdemon)	31	50.88	67.32	6	19.35
10097.	fathima (fathimaa)	31	46.92	58.17	2	6.45
10098.	Erik (ezhou21)	31	94.09	116.92	13	41.94
10099.	neo (eliteneo)	31	92.92	110.74	7	22.58
10100.	Leif (electricronny)	31	109.64	127.83	16	51.61
10101.	paul (dunzo18)	31	69.12	95.05	5	16.13
10102.	Isaac (dolemitesundae)	31	88.50	109.05	7	22.58
10103.	Thai (despotron)	31	95.92	115.01	7	22.58
10104.	Daniel (dasno)	31	67.83	78.14	4	12.90
10105.	Pascal (darm4n)	31	92.18	106.22	8	25.81
10106.	Mad_Dog (darkus_dragonoid)	31	83.05	94.86	11	35.48
10107.	. (darkis)	31	112.39	144.41	21	67.74
10108.	Cramp (crampdg)	31	111.13	130.71	16	51.61
10109.	Conor (conorwalsh1601)	31	63.68	82.96	8	25.81
10110.	Chris (chris_9001)	31	87.13	107.14	19	61.29
10111.	ChivalKnight (chivalknight)	31	75.32	88.79	8	25.81
10112.	chillresident (chillresident)	31	95.76	109.58	8	25.81
10113.	Ben (chewy_bran)	31	76.59	91.69	7	22.58
10114.	Catrinet (catrinet)	31	35.90	41.85	0	0.00
10115.	Schuyler (captainsky03)	31	109.90	131.60	15	48.39
10116.	Bertalan (brtln)	31	69.74	86.79	15	48.39
10117.	Steven (boomkat)	31	88.12	113.59	9	29.03
10118.	Tom (bobtom8482)	31	86.73	109.19	12	38.71
10119.	Paul (bisente006)	31	53.41	69.77	10	32.26
10120.	Binamra (binamra)	31	64.89	91.97	6	19.35
10121.	C (bigcdub)	31	60.82	79.98	9	29.03
10122.	bader (bhilal)	31	36.62	45.93	2	6.45
10123.	Bhaskar (bhaskar942)	31	59.11	73.79	3	9.68
10124.	Brendan (bfay)	31	97.06	119.12	10	32.26
10125.	Roberto (bertdog1995)	31	93.36	105.15	9	29.03
10126.	BeastBoy (beastboykadil)	31	49.25	61.30	2	6.45
10127.	Avrick (avmend)	31	73.34	91.73	11	35.48
10128.	laundromatt (austen_washer)	31	90.65	116.11	12	38.71
10129.	Renato (ato2000)	31	89.83	106.89	10	32.26
10130.	Bruno (armitageb)	31	108.22	132.01	14	45.16
10131.	No Mistakes (apsnacks)	31	92.86	114.27	7	22.58
10132.	Gio (apex_shrimp)	31	71.81	80.33	6	19.35
10133.	Anton (antonium)	31	77.70	102.65	12	38.71
10134.	AnniK (anni_k)	31	90.77	111.53	13	41.94
10135.	Amit (amitsetty)	31	125.04	144.79	11	35.48
10136.	alyssa (alyyyssa)	31	98.07	113.14	9	29.03
10137.	Alex (alexyoung)	31	78.30	95.77	4	12.90
10138.	Andrew (ajw5196)	31	57.92	77.89	5	16.13
10139.	Alasdair (aisaem)	31	106.23	121.14	15	48.39
10140.	AgentGarbo (agentgarbo)	31	74.72	93.62	7	22.58
10141.	Aditya (aditya_2703)	31	68.76	83.45	3	9.68
10142.	abdullah (abdullah1233)	31	58.28	72.10	7	22.58
10143.	Abhishek (abc_cs)	31	88.97	102.42	8	25.81
10144.	asphyxia (aag3098)	31	61.25	71.52	4	12.90
10145.	Igor (6eamed)	31	92.59	112.78	10	32.26
10146.	1980 (1980ops)	31	104.63	119.28	14	45.16
10147.	Poul ib Uitsatikitseq (13fu...	31	33.27	44.34	1	3.23
10148.	martiangnome (martiangnome)	31	71.90	78.62	8	25.81
10149.	zainal (ali200276)	31	54.16	65.20	3	9.68
10150.	Suwidiana (suwidhi)	31	70.54	90.76	12	38.71
10151.	DolnaNaka (dolnanaka)	31	72.98	93.29	10	32.26
10152.	Lost (lostviajero)	31	91.00	105.40	13	41.94
10153.	Audrey (cow_rj1204)	31	49.96	83.86	9	29.03
10154.	QWERTYsamuel (gottagofast1111)	31	49.98	58.90	3	9.68
10155.	Julian (corpse13)	31	71.00	83.22	8	25.81
10156.	screaM (scream_)	31	122.64	148.84	20	64.52
10157.	Vanessa (vanoob)	31	54.25	66.40	5	16.13
10158.	Yashaswe (yash_10)	31	76.54	94.44	11	35.48
10159.	mgLover (mannyglover)	31	46.42	53.67	0	0.00
10160.	Jacob (jacobdante)	31	68.66	79.12	7	22.58
10161.	K (335469854)	31	109.02	129.18	16	51.61
10162.	tbgracy (tbgracy)	31	68.43	80.21	2	6.45
10163.	Aman (_aman_)	31	56.52	61.69	6	19.35
10164.	Gumbers (gumborb)	31	57.18	67.93	3	9.68
10165.	Starlitblond (melaniemc)	31	59.17	73.32	6	19.35
10166.	Sourab (voyager7)	31	60.62	71.75	5	16.13
10167.	cicerolb27 (cicerolb03)	31	99.20	120.72	18	58.06
10168.	Jackson (deepfryinit)	31	95.98	127.14	8	25.81
10169.	aurophoe (aurophoe)	31	90.63	109.16	11	35.48
10170.	P-chan (pchan555)	31	66.19	89.44	6	19.35
10171.	Olivia (livbanks)	31	67.75	83.51	10	32.26
10172.	JackPlayZ31 (jackplayz31)	31	46.49	55.76	2	6.45
10173.	Mads (madsbv)	31	95.95	112.66	15	48.39
10174.	Max (madmax89)	31	81.42	90.96	6	19.35
10175.	Luthfi (luthfiidrus1612)	31	68.50	78.85	10	32.26
10176.	June (lumierevi)	31	84.04	98.72	9	29.03
10177.	lotok (lotok_14)	31	86.52	108.30	8	25.81
10178.	Bob Gnarly (lobmys)	31	76.93	97.01	10	32.26
10179.	LittleYun (littleyun)	31	72.96	91.74	8	25.81
10180.	N (lin_snarp)	31	45.93	60.44	3	9.68
10181.	Chicony osu! (leva_russian)	31	85.99	98.85	11	35.48
10182.	LeTwash (letwash)	31	73.51	92.03	9	29.03
10183.	Lasped (lasped)	31	91.43	109.67	7	22.58
10184.	Ram (laiforever)	31	46.67	55.48	3	9.68
10185.	Jacob (labotski)	31	65.89	79.97	5	16.13
10186.	Benjamin (kullaaaa)	31	72.16	84.44	8	25.81
10187.	nitram (kros9987)	31	62.93	74.77	4	12.90
10188.	Kowalski (kowalski_)	31	109.59	129.52	15	48.39
10189.	Mayumi (kogl_mieko)	31	68.56	84.33	4	12.90
10190.	Kevin (kidview)	31	68.44	86.43	1	3.23
10191.	Kunihiko (keuno)	31	62.72	72.90	7	22.58
10192.	Ma (kenma262)	31	88.46	101.82	9	29.03
10193.	Jweel (jweel_kar)	31	46.14	55.89	4	12.90
10194.	Jason (jwangbang)	31	82.76	95.45	8	25.81
10195.	just_tito (just_tito)	31	33.10	41.84	1	3.23
10196.	Mattis (juicedrabbit)	31	77.43	94.02	9	29.03
10197.	Jonathan (jonathan081)	31	95.75	117.04	12	38.71
10198.	Jet (jetwinjo)	31	54.03	62.24	4	12.90
10199.	javonte (javonteslow)	31	118.15	153.82	22	70.97
10200.	jam (jamhill)	31	61.29	72.31	5	16.13
10201.	J (jairo_113)	31	57.02	69.78	11	35.48
10202.	ix4l (ix4l19)	31	68.79	79.13	8	25.81
10203.	Rahul (itzrall)	31	64.86	85.59	8	25.81
10204.	itypeabove130only (itypeabo...	31	134.05	157.89	19	61.29
10205.	John (imsoepic)	31	96.33	109.62	10	32.26
10206.	A. Moe Gus (iltg)	31	75.34	90.82	10	32.26
10207.	HxntedRex (hxntedrex)	31	95.21	108.24	11	35.48
10208.	Howard (howardpx2016)	31	108.04	123.93	9	29.03
10209.	not (hayso)	31	110.89	130.44	15	48.39
10210.	nahte (hawkzle)	31	46.78	61.20	6	19.35
10211.	hamin (hamin)	31	102.80	129.19	16	51.61
10212.	Hagen (hag3nl)	31	63.06	70.23	8	25.81
10213.	wolff (gwolff)	31	151.40	175.67	25	80.65
10214.	Gourango (gsrajeni)	31	66.92	83.64	6	19.35
10215.	gre (gregoryrogel)	31	59.32	72.30	5	16.13
10216.	augh (goodmint)	31	81.00	101.90	9	29.03
10217.	dog (ginasmocha)	31	82.35	118.51	11	35.48
10218.	Nicholas (gigamammothtyper123)	31	57.35	75.42	3	9.68
10219.	Huy (giahuy7753)	31	67.89	82.99	5	16.13
10220.	HUONO (gghuono)	31	83.70	95.90	13	41.94
10221.	Spartan Warrior (gerogeka1111)	31	72.24	91.01	7	22.58
10222.	Gautam (gbasak)	31	52.35	60.03	0	0.00
10223.	Nikola (_not_)	31	47.92	54.44	1	3.23
10224.	mo (yo_mo)	31	56.29	68.65	3	9.68
10225.	lol (yowennnn)	31	80.55	99.53	11	35.48
10226.	melon (yoonity_)	31	114.05	131.49	21	67.74
10227.	Yani (yani916)	31	77.74	89.96	7	22.58
10228.	marco (xqz_u)	31	65.21	74.50	9	29.03
10229.	Seizoxu (xezious)	31	92.64	110.99	15	48.39
10230.	fnf (whitezetra)	31	89.66	111.88	9	29.03
10231.	Whelps (whelps)	31	115.37	152.09	18	58.06
10232.	K (wh0mst)	31	62.91	73.50	4	12.90
10233.	Virbox (web_user)	31	96.99	110.98	11	35.48
10234.	Watrdos (watrdos)	31	84.52	103.12	8	25.81
10235.	Jeffrey (vlasfack)	31	68.36	81.39	7	22.58
10236.	Orca (virtualorca)	31	80.47	92.02	11	35.48
10237.	Lux (veyro)	31	63.15	73.35	10	32.26
10238.	Hah (verdaderopan)	31	102.75	119.17	11	35.48
10239.	Ultimate_Coder (ultimate_co...	31	107.99	122.04	17	54.84
10240.	Jammie (nonquit) (typos_zzz)	31	176.19	217.38	22	70.97
10241.	Dog (typing_doggo)	31	97.14	115.16	14	45.16
10242.	Turuo (turuo)	31	66.51	79.81	7	22.58
10243.	Alex (tsaalex)	31	91.52	108.03	9	29.03
10244.	Trevor (trevor10)	31	30.38	39.83	3	9.68
10245.	😈 (topthis)	31	94.81	111.46	8	25.81
10246.	James (the_swan)	31	108.69	127.33	21	67.74
10247.	Daniel (teraminx)	31	129.32	142.46	25	80.65
10248.	Eugene (taiwansfinest)	31	96.05	119.95	10	32.26
10249.	Mr. (superfat)	31	63.07	75.11	4	12.90
10250.	Stuart (stuart000little)	31	56.44	66.17	4	12.90
10251.	Rowan (spindlecreek)	31	66.82	80.48	5	16.13
10252.	gixxer (somewhat_noob)	31	74.93	89.03	5	16.13
10253.	Catering (sneevy)	31	116.30	131.33	14	45.16
10254.	sai (smuna13)	31	80.47	96.11	5	16.13
10255.	slowAf (slow_af_dvorak)	31	87.95	113.67	6	19.35
10256.	Sukanya (siriros)	31	31.44	40.28	2	6.45
10257.	shuaib (shuaibabrar)	31	68.97	80.48	7	22.58
10258.	Shanon (shadowyshadows)	31	148.71	179.84	24	77.42
10259.	Andreas (sgtreent)	31	87.81	105.61	15	48.39
10260.	sev (sev4tou)	31	58.85	66.58	7	22.58
10261.	Binscuit (scoutzc)	31	70.51	83.82	8	25.81
10262.	samir (_samir)	30	83.75	107.13	25	83.33
10263.	ArV (_arv_)	30	62.59	70.62	6	20.00
10264.	Jacob (zoloto67)	30	96.95	111.58	12	40.00
10265.	Hazique Mirza (ziquemirza)	30	50.67	59.09	1	3.33
10266.	zeropollyvtuber (zeppi)	30	130.25	151.08	23	76.67
10267.	Zear (zear5)	30	74.83	92.83	7	23.33
10268.	Callum (yuihirasawa)	30	86.87	101.63	14	46.67
10269.	sebi (ysebi)	30	62.95	73.01	6	20.00
10270.	Yoongo (yoongo)	30	91.14	104.93	10	33.33
10271.	Winson (wwang038)	30	89.70	107.27	15	50.00
10272.	Arnold (wiktor172003)	30	83.19	99.28	6	20.00
10273.	walid (walid1997)	30	77.74	90.60	8	26.67
10274.	Derek (vonarxd)	30	90.39	98.97	6	20.00
10275.	Mike (unforgotten)	30	108.35	134.75	17	56.67
10276.	ayeitsme (ughg)	30	53.95	75.07	3	10.00
10277.	Kameloc (twoddle2)	30	80.74	92.64	8	26.67
10278.	Tops (tufeng)	30	68.83	84.90	10	33.33
10279.	Translator (trnsltr)	30	95.79	112.72	12	40.00
10280.	Pavel (trialtry)	30	76.87	88.17	12	40.00
10281.	Aidan (trabpukcip)	30	108.04	129.04	16	53.33
10282.	Tina (tprentis22)	30	61.58	70.91	4	13.33
10283.	Anthony (tonymontaro)	30	74.77	84.87	5	16.67
10284.	Toasted (toasted_)	30	71.91	84.30	8	26.67
10285.	tnn21 (tnn21)	30	105.67	140.90	8	26.67
10286.	thundr (thundr001)	30	43.71	54.01	1	3.33
10287.	Theo (the_o_choked)	30	78.91	92.61	7	23.33
10288.	notorioustype (thenotorious...	30	49.61	57.62	3	10.00
10289.	Johan (thehutt)	30	70.72	81.34	19	63.33
10290.	tesseract (tesseract1996)	30	56.48	70.51	4	13.33
10291.	Ethan (terean)	30	113.21	126.72	18	60.00
10292.	syz (syzzzzzzz)	30	62.29	78.08	3	10.00
10293.	SWAPNIL (swapnil326)	30	81.50	94.58	12	40.00
10294.	Isak (stitchy_)	30	62.73	83.31	10	33.33
10295.	Starry (starsky123)	30	92.88	111.53	13	43.33
10296.	Griffin (speedyboi4506)	30	101.55	129.61	14	46.67
10297.	SOBO (sobo)	30	76.58	88.18	6	20.00
10298.	lol (sngtx)	30	81.81	103.50	8	26.67
10299.	Cassi (slowerthanmolasses)	30	59.47	73.09	4	13.33
10300.	Avery (skipperbud)	30	73.43	86.16	7	23.33
10301.	Josh (shrekker)	30	119.95	141.48	13	43.33
10302.	sho (shoshosho1)	30	59.93	75.22	10	33.33
10303.	JS (shadyshadez)	30	104.34	122.15	14	46.67
10304.	Sergej (segi)	30	65.89	88.13	2	6.67
10305.	x (sealnot123)	30	81.65	97.84	9	30.00
10306.	Arif (areyf)	30	49.92	60.02	6	20.00
10307.	Ayon (apaul23)	30	107.81	124.59	14	46.67
10308.	angry (angryfingers)	30	65.65	76.93	8	26.67
10309.	Alyan (alyanm)	30	114.36	135.84	5	16.67
10310.	Alvin (alwin630)	30	96.69	116.00	11	36.67
10311.	Alex (alexlizx)	30	82.54	98.45	6	20.00
10312.	Axolotl (aj0l0tl)	30	69.83	79.56	3	10.00
10313.	Afiq (afiqapon91)	30	52.38	64.89	2	6.67
10314.	Adres (adres)	30	53.12	62.32	4	13.33
10315.	sigma (adelshehadeh)	30	64.69	79.48	5	16.67
10316.	Aaron (aaronfrdumb)	30	60.07	74.98	8	26.67
10317.	Lars (aaberg)	30	87.20	100.60	5	16.67
10318.	Bot (348866896)	30	92.61	114.57	8	26.67
10319.	2E13 (1d14)	30	69.76	83.87	13	43.33
10320.	1776 (17_abe_76)	30	56.03	71.86	4	13.33
10321.	10time (10time)	30	38.53	58.21	5	16.67
10322.	0hyeah (0hyeah)	30	55.01	67.44	4	13.33
10323.	Joshua (josheems)	30	85.83	110.11	8	26.67
10324.	Sup (harry_kane)	30	50.83	60.65	4	13.33
10325.	big fudge (bigfudge84)	30	44.45	59.07	4	13.33
10326.	Arvi (arvi4321)	30	91.04	117.07	13	43.33
10327.	Yousuf (khanyousuf)	30	59.05	69.15	7	23.33
10328.	Parnika:) (parnika)	30	58.53	68.58	4	13.33
10329.	Magi (magi_dragon)	30	86.68	105.44	9	30.00
10330.	Dalton Machart (dzmachart25)	30	56.19	71.97	4	13.33
10331.	Blue (blue03)	30	74.44	102.28	14	46.67
10332.	Anjani (aryastark91)	30	93.78	107.97	8	26.67
10333.	Vincent (vincent16th)	30	51.30	61.45	7	23.33
10334.	will (ballsinjaws)	30	71.18	84.57	5	16.67
10335.	taco (tacoooooo)	30	73.11	85.12	5	16.67
10336.	Tommy (jymmot)	30	109.40	125.92	18	60.00
10337.	haskdfa (asdfbaewf)	30	93.03	110.71	14	46.67
10338.	P (guest2911)	30	63.92	90.50	7	23.33
10339.	Colin (legeometry)	30	133.89	156.52	27	90.00
10340.	dave (shalomski)	30	40.35	48.64	1	3.33
10341.	Ahmed (skaly)	30	44.87	55.49	19	63.33
10342.	Aidan (a_danroos)	30	68.65	83.68	9	30.00
10343.	qwerty (spellboundmage)	30	94.11	114.70	18	60.00
10344.	Gamewatchable (gamewatchable)	30	99.84	129.03	16	53.33
10345.	shubham (sk_07)	30	33.22	40.83	1	3.33
10346.	Sazs (sazs_)	30	57.31	65.28	17	56.67
10347.	jeremy (tunefullcobra)	30	56.30	67.57	7	23.33
10348.	Guian Cyrus (guiancyrus14)	30	63.44	80.02	7	23.33
10349.	XDloco (xdloco)	30	71.21	82.89	15	50.00
10350.	Jhairus (jhairus)	30	61.43	73.71	6	20.00
10351.	sunil (sunil01)	30	28.26	36.17	4	13.33
10352.	Sashaw (sashaww)	30	90.43	111.33	9	30.00
10353.	SiD (samueldim)	30	89.94	102.12	13	43.33
10354.	Ryan (ryan3760)	30	54.26	67.48	3	10.00
10355.	rum3r (rum3r)	30	69.04	78.75	6	20.00
10356.	Riser (riser1)	30	60.77	74.61	8	26.67
10357.	riggers (riggers)	30	62.85	81.35	6	20.00
10358.	revoosh (revoosh)	30	103.80	119.42	14	46.67
10359.	Rassulkhair (rassulkhair)	30	54.81	64.62	4	13.33
10360.	Sapphic Llama (rare_taco)	30	51.24	68.84	2	6.67
10361.	Rankoll (rankoll)	30	75.66	86.90	10	33.33
10362.	RadAlienware (rad_alienware)	30	65.86	79.53	6	20.00
10363.	Rich (r1hh)	30	87.19	108.99	10	33.33
10364.	IwasFASTonQWERTYnowIuseDVOR...	30	78.27	95.51	7	23.33
10365.	ben (prizmoasd)	30	96.10	112.97	8	26.67
10366.	Caleb (prismiasma)	30	112.65	128.97	11	36.67
10367.	Jakub (prism1349)	30	68.06	81.64	4	13.33
10368.	Pointyepic (pointyepic)	30	97.55	118.78	13	43.33
10369.	MiazMe (pmax)	30	85.57	102.28	9	30.00
10370.	Jesse (pinec0ne)	30	82.55	94.40	8	26.67
10371.	Petter (ph140)	30	82.44	108.59	13	43.33
10372.	pewpewdevildog (pewpewdevil...	30	80.98	92.13	7	23.33
10373.	Peter (petermc2007)	30	94.94	109.55	15	50.00
10374.	fan de Iknash (pedrou)	30	113.19	139.72	15	50.00
10375.	Patrick (patclark)	30	91.23	101.92	11	36.67
10376.	Rodrigo (pacha2880)	30	71.12	81.85	7	23.33
10377.	Piyush (p1yu5h)	30	59.38	67.88	7	23.33
10378.	OwenF (owenf)	30	46.64	72.39	0	0.00
10379.	Oliver (oviewill)	30	66.63	75.87	6	20.00
10380.	Nox (nymanne)	30	99.52	117.69	16	53.33
10381.	nother (nother)	30	54.95	66.47	6	20.00
10382.	B (nonemorenegative)	30	100.86	144.79	12	40.00
10383.	Sochi (noizi)	30	74.61	94.52	6	20.00
10384.	DaddyChill (nightynine)	30	54.43	68.67	2	6.67
10385.	Nicholas (nemath)	30	87.27	106.65	10	33.33
10386.	Nelvin (nelvin27)	30	89.48	109.67	9	30.00
10387.	Piyabuht (nekktheredsand)	30	72.83	90.63	8	26.67
10388.	Naitik (naitik_lisa)	30	39.95	48.93	2	6.67
10389.	muzakh (muzakkiha)	30	87.52	104.02	6	20.00
10390.	Muhammad Musharaf (musharaf35)	30	59.36	74.04	8	26.67
10391.	Murfy (murfychia)	30	70.17	81.58	11	36.67
10392.	Aman (multiversal_aspirator)	30	64.91	70.77	6	20.00
10393.	MtDewaholic (mtdewaholic)	30	103.85	123.99	8	26.67
10394.	Mr (mrmindgames)	30	91.61	109.83	25	83.33
10395.	MJ (mj_02)	30	93.53	107.60	15	50.00
10396.	Mich (michdaevinci)	30	74.36	93.16	7	23.33
10397.	Mohamad (mhmd_khlf)	30	87.44	95.75	5	16.67
10398.	merlot (merlotsuma)	30	43.68	54.50	3	10.00
10399.	Mayur S (mayur_chirttaragi)	30	60.57	72.35	4	13.33
10400.	mike (maykqwe)	30	93.95	114.04	11	36.67
10401.	stay fresh cheese bags (maw...	30	137.38	157.12	22	73.33
10402.	Clay Cain (fredrafferty)	30	45.26	55.43	2	6.67
10403.	jonas (frallan34)	30	61.45	76.37	8	26.67
10404.	Fly1nthe5ky (fly1nthe5ky)	30	85.23	100.80	9	30.00
10405.	Floopy (floopy__)	30	100.89	122.19	16	53.33
10406.	monster (flamewarz)	30	74.06	94.11	11	36.67
10407.	Joe (fireflygrave)	30	82.66	105.98	5	16.67
10408.	Kauã (fernandes10)	30	72.60	86.93	9	30.00
10409.	myth (fear_ed)	30	118.48	135.71	22	73.33
10410.	Anton (fantoniko)	30	52.43	56.30	1	3.33
10411.	Marcus (evanitez)	30	120.04	143.45	15	50.00
10412.	Eugene (eugeneteoh)	30	96.15	122.21	12	40.00
10413.	Ethan (etwa)	30	98.27	115.34	16	53.33
10414.	E. (esheby)	30	62.51	72.56	5	16.67
10415.	Steven (engine210)	30	76.04	91.14	8	26.67
10416.	neo (eliteneo_dvo)	30	87.49	101.05	8	26.67
10417.	Franzvic (elbruh)	30	90.91	117.93	9	30.00
10418.	typingishard (dweepers)	30	92.70	112.60	7	23.33
10419.	Andrew (dodapotato)	30	44.22	58.53	2	6.67
10420.	Dizzi (dizzitypes)	30	93.80	116.00	8	26.67
10421.	didi (didi_pot)	30	69.83	81.25	7	23.33
10422.	nah (determination_)	30	114.42	136.75	14	46.67
10423.	Jeremy (definee)	30	86.80	104.16	5	16.67
10424.	Shan (debayon4545)	30	104.14	139.38	16	53.33
10425.	Vihas (datlightning)	30	82.83	102.74	8	26.67
10426.	Siddharth (darksun27)	30	55.04	65.57	6	20.00
10427.	daniel (danfinch07)	30	44.44	52.86	4	13.33
10428.	Daniel (daknk)	30	56.82	65.72	6	20.00
10429.	weird keyboard (cyphex)	30	100.95	118.61	9	30.00
10430.	Sashreek (cygnus206)	30	75.89	94.27	11	36.67
10431.	Liny (counting_star)	30	64.90	79.23	7	23.33
10432.	Norman (codificat)	30	80.07	92.63	10	33.33
10433.	YZZUB (chuang010896)	30	84.23	103.25	10	33.33
10434.	1myvar (chowchunfu)	30	104.31	121.99	15	50.00
10435.	Chad (chadkorrea)	30	56.38	68.64	5	16.67
10436.	|)are2|_eap (cepetir)	30	90.85	109.02	7	23.33
10437.	cagdas (cagirtas)	30	64.45	74.85	8	26.67
10438.	Brian (brian3927)	30	95.84	118.26	11	36.67
10439.	bq666 (bq666)	30	66.79	88.30	6	20.00
10440.	bp4dn (bp4dn)	30	100.22	121.91	11	36.67
10441.	bongking (bongking)	30	87.78	115.56	8	26.67
10442.	Bodie (bodejazz)	30	84.86	98.14	10	33.33
10443.	BobdeThird (bobdethird)	30	95.83	136.53	12	40.00
10444.	Blue (blue03yt)	30	74.44	102.28	14	46.67
10445.	BlazeAries (blaze_aries)	30	75.13	87.61	8	26.67
10446.	Ben (benthenoob961)	30	64.62	89.04	6	20.00
10447.	sheeeeeeeeeeeeeeeeeeeeeeeee...	30	61.20	82.46	6	20.00
10448.	Peter (beepseeker)	30	110.35	142.20	14	46.67
10449.	be4r (be4r_)	30	63.11	71.10	3	10.00
10450.	avisheek (avisheek)	30	46.30	84.29	1	3.33
10451.	Asmus (asmus__)	30	59.17	75.14	6	20.00
10452.	Ásþór (asibasi)	30	80.50	97.65	8	26.67
10453.	Charles (armdev)	30	79.68	96.91	14	46.67
10454.	King (maichen777)	30	88.64	100.11	8	26.67
10455.	qwerty (longhongc)	30	80.92	94.76	6	20.00
10456.	Lokinoha (lokinoha)	30	73.79	85.08	3	10.00
10457.	Ivan (ljakpa)	30	95.32	104.93	10	33.33
10458.	Pengu (lilpengu)	30	83.88	100.25	10	33.33
10459.	chetty (lilchetty_x3)	30	86.18	95.87	11	36.67
10460.	E (le_chonks)	30	82.25	102.79	21	70.00
10461.	Letter (letterofpower)	30	80.73	100.93	1	3.33
10462.	slow_racer (left_arm_chinaman)	30	57.46	66.57	2	6.67
10463.	Leah (leahlovesjisung)	30	80.82	93.79	13	43.33
10464.	khlaid (kmaf)	30	63.25	84.38	6	20.00
10465.	Krish (kkrish100)	30	78.94	101.73	7	23.33
10466.	kimhong01 (kimmong)	30	74.61	82.27	7	23.33
10467.	Damyian (kight)	30	97.25	126.33	11	36.67
10468.	Kaimetsu (kaimetsu)	30	98.88	127.08	11	36.67
10469.	Ansar (kabdik)	30	35.72	43.17	2	6.67
10470.	Juicedit (juicedit)	30	102.09	127.72	10	33.33
10471.	Me (juicedcows)	30	93.78	117.64	5	16.67
10472.	Juantonomoe (juantonomoe)	30	115.30	131.74	18	60.00
10473.	John (johncha15724)	30	95.83	110.30	10	33.33
10474.	Joe (joemamma121)	30	68.78	85.35	10	33.33
10475.	Jacob (jkhindo64)	30	92.52	109.54	8	26.67
10476.	cody (jiji247)	30	145.81	163.33	23	76.67
10477.	Jasmine (jasmine5752)	30	54.43	62.52	5	16.67
10478.	Ivan (ivanplaystr)	30	105.69	116.85	16	53.33
10479.	Ivan (ivanh922114)	30	64.80	76.01	7	23.33
10480.	Khaled (itskhaled)	30	39.70	58.31	2	6.67
10481.	Joshua (insanelol)	30	83.44	99.02	9	30.00
10482.	Im Hacker (im_hacker)	30	100.05	117.55	16	53.33
10483.	Dana (icantthinkofausername)	30	117.19	135.51	20	66.67
10484.	Mason (hyojin2k)	30	98.91	112.01	13	43.33
10485.	namdo (huynhnamdo96)	30	66.16	74.23	4	13.33
10486.	Hot Cross Puns (hot_cross_p...	30	97.86	112.31	29	96.67
10487.	James (horjamez)	30	63.93	76.14	7	23.33
10488.	Henrique (hnrqe)	30	98.69	150.82	12	40.00
10489.	Richard (heferous)	30	57.35	78.52	3	10.00
10490.	Hamang (hamangpincong)	30	50.05	60.76	5	16.67
10491.	Alicja (gymnast2008)	30	50.88	62.59	3	10.00
10492.	Guber (guberxz)	30	62.43	73.55	9	30.00
10493.	Gnany (gnanyadapa)	30	48.77	65.93	5	16.67
10494.	Jack (giglioroninomicon)	30	103.88	126.94	10	33.33
10495.	Garamonde (garamonde)	30	75.21	90.51	10	33.33
10496.	Ickooo (gamerchancer)	30	82.41	96.04	8	26.67
10497.	Jakub (f_ckshit)	30	69.18	80.81	11	36.67
10498.	m3d (m3dsh)	29	74.66	91.81	10	34.48
10499.	Lyons (lyoons)	29	121.07	150.05	24	82.76
10500.	Lush (lush_krom)	29	98.15	111.25	15	51.72
10501.	smino (lucskosur420)	29	61.86	78.26	5	17.24
10502.	Machine (longshort)	29	58.23	75.27	6	20.69
10503.	Nate (lobdog)	29	84.66	106.23	8	27.59
10504.	Lil (lil_wymn20)	29	38.90	46.32	3	10.34
10505.	LadaSedan (ladasedan)	29	83.61	94.63	3	10.34
10506.	Angel (kyngbui)	29	114.91	149.41	15	51.72
10507.	kyletsetse (kyletsetse)	29	126.40	150.80	26	89.66
10508.	kottt (kweent182)	29	97.72	107.92	9	31.03
10509.	Kamiltoni (ktonig1221)	29	33.07	52.81	3	10.34
10510.	E (knight250)	29	70.20	83.28	27	93.10
10511.	Rae (kmacc)	29	51.08	67.51	2	6.90
10512.	Kevin (kevinmeseeyou)	29	102.31	114.28	9	31.03
10513.	kenneth (kenneth29)	29	65.34	77.45	3	10.34
10514.	Nektarios (kapiras)	29	37.41	50.06	2	6.90
10515.	Md Ziaur Rahman (juall)	29	39.92	52.35	2	6.90
10516.	Jacob (jsmith182)	29	89.34	102.31	14	48.28
10517.	Joshua (joshnah)	29	86.06	105.44	11	37.93
10518.	Joshua (joshbenja)	29	97.33	110.35	9	31.03
10519.	Jayuke (jontrask)	29	102.10	125.30	13	44.83
10520.	Jokrr (jokrr7)	29	77.10	88.67	10	34.48
10521.	JC (joker801)	29	44.46	49.46	2	6.90
10522.	Jerod (jeroddddd)	29	109.54	129.55	14	48.28
10523.	Jeev (jeevjoel)	29	70.26	92.63	7	24.14
10524.	Jeemin (jeemini)	29	101.64	124.15	13	44.83
10525.	Jayden (jayballr)	29	81.88	102.68	7	24.14
10526.	Jacques (jacquesp)	29	85.95	104.94	3	10.34
10527.	Jackelton (jackelton)	29	93.27	112.13	10	34.48
10528.	tstats[jaadunath] (jaadunath)	29	74.84	90.85	8	27.59
10529.	IamUrs (i_am_urs)	29	82.03	102.77	5	17.24
10530.	imi (imitavor)	29	55.81	68.16	2	6.90
10531.	Jeon (idnyhn)	29	94.31	117.29	12	41.38
10532.	hyeonk (hyeonk)	29	99.56	122.70	12	41.38
10533.	Hridoy (hridoymahmud71)	29	40.79	46.96	2	6.90
10534.	Raheeb (hoenchioma)	29	57.57	71.02	2	6.90
10535.	Wixxers (heyitswixx)	29	62.08	80.05	13	44.83
10536.	dsc.gg/uk-train (hellomynam...	29	63.75	82.58	19	65.52
10537.	haaa (h505)	29	73.73	84.84	7	24.14
10538.	GMHazem (gm_hazem02)	29	72.90	90.73	5	17.24
10539.	CheetahDude (ghysdd)	29	96.15	115.88	11	37.93
10540.	Dum (getintherobotshinji)	29	99.55	118.62	17	58.62
10541.	George (gecovin)	29	96.90	118.65	11	37.93
10542.	Kowala Bear (gaverpro)	29	141.83	168.60	20	68.97
10543.	loiyus (fuzxy)	29	101.53	121.95	10	34.48
10544.	Namoonia (sasti_chars)	29	61.54	81.66	4	13.79
10545.	Brendyy (sabtooth)	29	126.39	141.21	18	62.07
10546.	Ryan (rya02)	29	61.97	77.57	7	24.14
10547.	Karl (refllexz)	29	80.67	96.08	7	24.14
10548.	Niklas (reeklas)	29	54.85	60.60	21	72.41
10549.	Ray (ray1829)	29	114.37	144.37	18	62.07
10550.	Rainbow (rainbowdudebh)	29	125.39	157.75	19	65.52
10551.	Gnomeツ (raging_gnome)	29	110.72	142.00	14	48.28
10552.	Romeo (r0mpan)	29	42.89	51.68	10	34.48
10553.	Praise (praisehim)	29	115.05	130.41	11	37.93
10554.	Peter (pklly)	29	60.39	78.07	5	17.24
10555.	Pinoy (pinoytypist01)	29	83.32	99.34	3	10.34
10556.	PingingCarrot16 (pingingcar...	29	67.29	89.20	7	24.14
10557.	Pina (pina_pog)	29	125.50	156.11	23	79.31
10558.	Pere_Gil (pere_gil)	29	77.26	89.26	3	10.34
10559.	Savannah (peaches39)	29	70.82	85.20	8	27.59
10560.	Chee (pcheekz)	29	50.12	67.30	7	24.14
10561.	Patrick (patbl)	29	87.20	108.40	14	48.28
10562.	ThePastor (pastor3974)	29	63.59	89.87	5	17.24
10563.	Paracoax (paracoax)	29	106.39	128.42	13	44.83
10564.	Thomas (nunu464)	29	60.48	74.57	9	31.03
10565.	THE KID (nschattner)	29	94.91	118.90	10	34.48
10566.	Novades (novades)	29	69.51	86.45	9	31.03
10567.	℮ (nicepal)	29	137.30	155.75	22	75.86
10568.	Esmeralda (niccon)	29	83.07	97.44	5	17.24
10569.	Neske (neske)	29	98.48	124.67	14	48.28
10570.	(nenontank_)	29	90.05	135.08	10	34.48
10571.	Nalahatra (nalahatra)	29	47.90	67.43	2	6.90
10572.	Mustafa (musthelegend)	29	90.93	106.47	7	24.14
10573.	MoresVance (moresvance)	29	102.82	125.22	15	51.72
10574.	Bijay (moneybijay)	29	93.12	112.76	11	37.93
10575.	lucas (moisturisingcream)	29	66.09	77.83	7	24.14
10576.	Georgi (mitevw)	29	32.58	41.20	1	3.45
10577.	Milky (milkxy)	29	96.83	115.09	19	65.52
10578.	Munkhsuld (mbior)	29	74.13	82.99	8	27.59
10579.	Mark (mariktypes)	29	117.56	141.94	16	55.17
10580.	gerleva (_mr_e_)	29	65.95	74.99	5	17.24
10581.	fastest (_fastest_typist)	29	75.48	96.56	11	37.93
10582.	Z-Dvorak (zzdarke)	29	71.87	91.63	8	27.59
10583.	zhem_ (zhem)	29	107.52	130.10	14	48.28
10584.	Zharfan (zharfanadli)	29	94.03	113.62	16	55.17
10585.	Zeryx (zeryx_typing)	29	72.83	83.07	5	17.24
10586.	zei (zeizuta)	29	28.27	34.59	7	24.14
10587.	Zakaria (zackzack1224)	29	82.35	98.31	11	37.93
10588.	Sam (yaboisam_)	29	88.83	108.16	11	37.93
10589.	Luna (xluna420)	29	81.38	95.01	17	58.62
10590.	Andrew (wongsifu)	29	83.61	99.08	16	55.17
10591.	Kelvin - Colemak (winlost)	29	108.44	122.12	14	48.28
10592.	William (willteee)	29	99.74	123.77	8	27.59
10593.	Jared (willetsjared)	29	73.42	90.09	7	24.14
10594.	WhiteRose (whiter9se)	29	37.83	45.97	0	0.00
10595.	David (wdnch)	29	76.75	91.79	9	31.03
10596.	W (wbhizzle7)	29	100.71	122.04	6	20.69
10597.	( ͡° ͜ʖ ͡°) (warrine...	29	61.23	78.26	5	17.24
10598.	VSF (vsf123)	29	28.36	34.47	5	17.24
10599.	Victor (victorm900)	29	71.20	79.01	4	13.79
10600.	Vaibhav (vibhix)	29	75.17	90.60	6	20.69
10601.	Nick (vergil_00)	29	75.23	93.45	11	37.93
10602.	Lucas (veraluc)	29	96.99	119.25	8	27.59
10603.	Jacob (vanosgaming2014)	29	118.97	138.04	17	58.62
10604.	Yupa (valleyofthewin)	29	72.08	80.06	2	6.90
10605.	Umalis (umali)	29	54.85	66.59	7	24.14
10606.	Fealing (typistboy)	29	88.11	104.98	6	20.69
10607.	Twistees (twisteesboy)	29	79.63	98.98	15	51.72
10608.	It's me! (tuppence)	29	65.31	84.15	7	24.14
10609.	Justin (trudeaucooks)	29	138.37	195.76	22	75.86
10610.	Troy (troydaigneau)	29	94.96	118.90	5	17.24
10611.	Zkye (trestiel)	29	72.24	93.09	9	31.03
10612.	Roo (trepur349)	29	100.82	123.97	11	37.93
10613.	cody (tkdanimal)	29	70.15	83.74	5	17.24
10614.	Majid (thetypingnerd852)	29	36.59	48.39	4	13.79
10615.	swooshmcgoosh (swooshmcgoosh)	29	107.82	133.38	14	48.28
10616.	owen (sushisynth12)	29	83.43	102.45	5	17.24
10617.	Bertie (sunstonesharptor)	29	70.38	84.29	0	0.00
10618.	Eric (sumtypaway)	29	63.32	84.41	6	20.69
10619.	Suhas (suhoos)	29	103.68	125.67	16	55.17
10620.	gae (subtoentaloop)	29	77.92	99.76	7	24.14
10621.	stash (stash_)	29	43.16	53.76	2	6.90
10622.	Teddy (stargazingteddy)	29	53.16	63.88	4	13.79
10623.	tstats[sspaghettii] (sspagh...	29	92.74	108.16	9	31.03
10624.	Austin (splashtime)	29	97.36	109.88	14	48.28
10625.	grammy (spicybbqsauce)	29	64.64	78.51	4	13.79
10626.	Pinkies (smile_typer)	29	100.43	115.66	15	51.72
10627.	Regan (smalltymehero)	29	63.14	73.04	5	17.24
10628.	skepsi87 (skepsi87)	29	45.16	58.23	5	17.24
10629.	Priscilla (simplyscience)	29	121.78	150.53	23	79.31
10630.	Silent G (silentgisback)	29	115.03	135.93	15	51.72
10631.	꧁🎧웃 ֆɨɖɖɦǟռȶ...	29	60.03	78.10	7	24.14
10632.	Jhonnathan Ramirez (siaxais)	29	40.62	57.90	0	0.00
10633.	yung (shwn)	29	122.29	148.27	17	58.62
10634.	Sharath (sharathnirmala)	29	54.43	67.72	4	13.79
10635.	shantanu (shantothegreat)	29	67.63	85.57	5	17.24
10636.	o (seticl)	29	99.88	125.44	11	37.93
10637.	seer23 (seer23)	29	77.05	91.69	21	72.41
10638.	Apathy (apathyy)	29	87.88	103.90	8	27.59
10639.	Anshit (anshitgrg)	29	51.73	68.42	3	10.34
10640.	Bob (allanbarry)	29	71.56	81.63	12	41.38
10641.	Cyber (alifarra)	29	72.61	91.83	11	37.93
10642.	aldrigon (aldrigon)	29	93.68	120.66	18	62.07
10643.	Andi (agraumann)	29	68.58	89.33	8	27.59
10644.	AggieMet (aggiemet)	29	61.26	83.31	9	31.03
10645.	7amada (7amada)	29	80.80	91.86	6	20.69
10646.	duy (69discombobulates)	29	61.93	72.52	12	41.38
10647.	Edward (1934__)	29	89.36	116.03	12	41.38
10648.	k (edhne)	29	60.40	74.07	7	24.14
10649.	Lisbeth (l1sbeth_dam)	29	44.86	60.20	2	6.90
10650.	Ambuj (ambujsingh)	29	56.29	68.48	6	20.69
10651.	Littenator (littenator)	29	58.98	71.94	5	17.24
10652.	Brur (brur)	29	62.94	77.10	8	27.59
10653.	Jakub (jintax)	29	54.95	66.97	6	20.69
10654.	ashley (ashleyyyuwu)	29	35.72	45.84	3	10.34
10655.	Aries (notanaries)	29	93.22	108.28	13	44.83
10656.	Mani (manissekhon)	29	58.05	73.85	18	62.07
10657.	Caltos (caltos_virnam)	29	87.89	105.42	9	31.03
10658.	kalki (draken_14)	29	52.60	60.68	7	24.14
10659.	Ross Geller (ross191139)	29	58.15	66.55	5	17.24
10660.	Levi (levi4th)	29	64.70	82.00	3	10.34
10661.	Brock (fastmurphtype)	29	73.40	80.83	17	58.62
10662.	Lucas (lucasthetypingmaster)	29	89.09	103.21	8	27.59
10663.	R Worth (_crbn)	29	50.67	59.75	1	3.45
10664.	VinnyZ (vinnyzed)	29	79.07	99.84	13	44.83
10665.	Vincent (just_carbon)	29	72.43	83.82	5	17.24
10666.	Jobenveer (jobenveer)	29	30.44	39.83	4	13.79
10667.	Blizzard (_bl1zzard)	29	64.21	79.22	12	41.38
10668.	mrooogaboooga (foulackfoula...	29	90.90	114.56	4	13.79
10669.	Mavis (firkinmugs)	29	72.22	83.97	9	31.03
10670.	Henk (fattieruns)	29	74.33	86.55	8	27.59
10671.	tstats[faiz_legend] (faiz_l...	29	71.60	94.41	6	20.69
10672.	nootnoot (ezoid_nootnoot)	29	50.89	68.92	7	24.14
10673.	vion (evions)	29	47.64	66.10	2	6.90
10674.	Eder (edertyper)	29	88.13	103.04	10	34.48
10675.	Ora Ora (eddyyang2003)	29	102.36	115.96	19	65.52
10676.	Hektor (dr_sparkles)	29	60.15	75.88	14	48.28
10677.	Zap (drdecember)	29	70.75	86.00	7	24.14
10678.	Doven (doven)	29	85.36	104.01	13	44.83
10679.	dev (devgiri0082)	29	66.03	76.84	0	0.00
10680.	Deepak (deepakthegreat)	29	60.67	79.63	5	17.24
10681.	david (davie04)	29	88.59	106.18	8	27.59
10682.	davidbird764 (davidbird764)	29	106.74	125.03	13	44.83
10683.	Ishmam Jarif Daula (daula507)	29	53.54	71.37	15	51.72
10684.	Connor (ctw0611)	29	124.64	146.89	22	75.86
10685.	Akashi (coppokim)	29	43.05	53.25	6	20.69
10686.	CoolGuy (cool_guy5583)	29	72.16	85.76	12	41.38
10687.	Kyjro (codertimeing)	29	66.98	85.09	6	20.69
10688.	Cinari (cinari)	29	96.87	108.54	6	20.69
10689.	Chris (chrisrapid)	29	50.54	57.17	5	17.24
10690.	Chris (chrislh221)	29	91.33	103.66	13	44.83
10691.	Chi (chiphan1993)	29	122.33	138.40	16	55.17
10692.	CHIEN (chient)	29	101.29	112.36	10	34.48
10693.	Cassidy (cassidyfaith)	29	90.36	129.61	12	41.38
10694.	yanzhi (cakeuuuu)	29	78.40	91.18	10	34.48
10695.	Ben (bv_nie)	29	87.57	112.42	8	27.59
10696.	Brian (brianbanri)	29	90.98	107.98	11	37.93
10697.	caden (breezynotcheezy)	29	65.98	92.27	11	37.93
10698.	Brayden (braddin123)	29	94.97	114.42	11	37.93
10699.	Bridget (boomsey)	29	99.48	124.37	13	44.83
10700.	Suvhoraj (blazing_cuber)	29	50.49	67.66	3	10.34
10701.	Bertra (bertraml)	29	81.70	93.04	8	27.59
10702.	berkay (berkayyalin)	29	92.91	107.45	13	44.83
10703.	Bennie (beneficial_bean)	29	71.56	89.70	9	31.03
10704.	Dustin (belyea)	29	101.63	127.62	12	41.38
10705.	Kaymart (barrix)	29	71.15	97.00	10	34.48
10706.	Khesar (babywicker)	29	52.22	67.79	1	3.45
10707.	Will (awesomeguy1427)	29	63.71	76.10	5	17.24
10708.	Andy (avocadocream)	29	81.23	101.99	6	20.69
10709.	Andrew (astrel)	29	107.15	123.81	10	34.48
10710.	Aman (ashriv88)	29	80.26	104.84	8	27.59
10711.	Nando (frozgamingz)	28	98.15	121.77	12	42.86
10712.	Freowy (freowy)	28	89.25	106.94	6	21.43
10713.	Francisco (francisc0)	28	56.08	74.36	2	7.14
10714.	Fopuy (fopuy)	28	107.80	124.49	14	50.00
10715.	v (fnut)	28	79.83	97.62	21	75.00
10716.	John (flyingraven)	28	97.31	116.68	11	39.29
10717.	flopvx (flopvx)	28	98.47	123.70	8	28.57
10718.	firxe (firxe139)	28	85.84	100.80	8	28.57
10719.	Fidelity (fidelityssj)	28	107.76	119.34	11	39.29
10720.	Jacob (fastjacob)	28	114.36	133.91	15	53.57
10721.	tommy (err0reverafter)	28	103.97	122.15	16	57.14
10722.	(erokopes)	28	128.36	144.59	16	57.14
10723.	Eric (ericniyigaba)	28	56.98	73.22	3	10.71
10724.	Emily (emstand)	28	95.61	105.47	12	42.86
10725.	Eli (elikgeneral)	28	82.00	94.11	5	17.86
10726.	Gawiweu (edugg98)	28	62.86	78.32	8	28.57
10727.	David (dvdtan20)	28	78.47	89.37	3	10.71
10728.	David (du6e)	28	51.41	62.73	1	3.57
10729.	Drowg (drowg)	28	51.49	62.32	5	17.86
10730.	Donovan (donnyredzone)	28	59.85	71.22	4	14.29
10731.	Dioscene (dioscene)	28	115.59	135.34	15	53.57
10732.	Delvin (delvinsabrin)	28	78.30	88.74	6	21.43
10733.	Delve (delve17)	28	101.91	117.42	19	67.86
10734.	Lennox (datshall)	28	81.59	99.21	3	10.71
10735.	Martin (datlos)	28	48.22	58.75	0	0.00
10736.	Luc (darth_luc)	28	45.16	60.29	2	7.14
10737.	Darlena (darlena)	28	97.67	124.57	9	32.14
10738.	Gustavo Fring (cxmpy)	28	101.01	119.25	11	39.29
10739.	Jon (customabilities)	28	105.92	127.12	14	50.00
10740.	. (crazyhow7)	28	52.57	69.43	1	3.57
10741.	sowhoami (cptsprinklez)	28	79.79	95.31	12	42.86
10742.	Courtney (clc0778clc)	28	101.63	126.57	11	39.29
10743.	chuck1ehead (chuck1ehead)	28	55.27	73.89	4	14.29
10744.	Chris (chrissquid)	28	83.66	104.28	9	32.14
10745.	Walter (chimken1234)	28	84.45	106.70	10	35.71
10746.	Kritik (chaoseyy)	28	63.77	78.56	5	17.86
10747.	canadavid1 (canadavid1)	28	38.43	49.95	2	7.14
10748.	vjalt (bullymaguire)	28	71.20	84.40	6	21.43
10749.	Bala Klava (brullsker)	28	71.81	80.60	7	25.00
10750.	Bitgalle (bitgalle)	28	85.67	95.41	11	39.29
10751.	Antatia (bi0hazrd_522)	28	77.21	94.53	6	21.43
10752.	Anjan (beaszt_nix)	28	93.84	111.28	9	32.14
10753.	Vinícius (batovs)	28	57.11	71.95	6	21.43
10754.	Basone01 (basone01)	28	74.68	89.74	11	39.29
10755.	Muhammed (a_mhmmd)	28	74.62	86.10	7	25.00
10756.	albatross (awehiuaf)	28	97.87	120.13	15	53.57
10757.	Atsubyo (atsubyo)	28	79.91	104.59	4	14.29
10758.	Kartik (artist007)	28	50.87	65.19	4	14.29
10759.	arthur (arthurc999)	28	55.40	69.27	4	14.29
10760.	Stacks (_stacksqueue2)	28	62.39	77.73	6	21.43
10761.	Max (_maxkoo_)	28	61.43	67.11	4	14.29
10762.	Lucky (_lucky__verma__)	28	21.62	30.50	5	17.86
10763.	Jalex (_jalex)	28	49.17	59.33	1	3.57
10764.	Asim (_asim_)	28	83.56	94.47	10	35.71
10765.	nattapakon (zudiyeah)	28	25.82	33.03	1	3.57
10766.	Justin (zexcel)	28	118.30	128.91	13	46.43
10767.	Youri (yourischuur)	28	100.73	125.78	9	32.14
10768.	yihuididi (yihuididi)	28	54.38	65.53	3	10.71
10769.	Yexsys (yexsys)	28	76.23	105.00	6	21.43
10770.	e2blu (yellowe2)	28	108.93	126.84	11	39.29
10771.	((: (yeeyeehehe)	28	117.94	135.53	13	46.43
10772.	(xyztcube)	28	94.60	104.91	9	32.14
10773.	xhqrry has two fingers (xhq...	28	68.18	78.08	8	28.57
10774.	Edward (xarvus)	28	93.86	111.93	9	32.14
10775.	John (wolman511)	28	110.58	133.39	12	42.86
10776.	THE JEWELL (wildhorsesthe2nd)	28	103.05	137.92	15	53.57
10777.	Wiktor (wicker6)	28	78.62	98.43	6	21.43
10778.	will (whitedarko)	28	94.46	114.44	12	42.86
10779.	Keyser (whereskeyser)	28	92.87	116.61	11	39.29
10780.	George (wavy_shakespeare)	28	72.04	88.76	12	42.86
10781.	tdsar (volterxien)	28	110.00	126.69	14	50.00
10782.	Andrew (viper42usa)	28	92.18	101.89	6	21.43
10783.	Vinesh (vineshdodiya)	28	50.89	58.39	3	10.71
10784.	Vinay (vinaynani92)	28	82.53	98.85	11	39.29
10785.	Josh (vaximus)	28	85.77	100.73	7	25.00
10786.	vamsi (vamsivadrevu)	28	88.02	109.34	8	28.57
10787.	vakilral (vakilral)	28	85.46	99.12	7	25.00
10788.	Joshua (typing_huh1)	28	99.79	120.59	14	50.00
10789.	Ryo (troublecuber)	28	80.66	93.66	3	10.71
10790.	Andrew (trazer)	28	103.66	112.63	8	28.57
10791.	Gary (traeyoung)	28	143.78	171.50	20	71.43
10792.	Tokugawa (tokugawapants)	28	131.61	152.08	17	60.71
10793.	Evan (toastypoints)	28	97.57	119.97	15	53.57
10794.	Harry (tls278)	28	60.18	68.78	8	28.57
10795.	Daniel (theyluvdaniell)	28	73.68	89.94	5	17.86
10796.	ry (therylyndshow)	28	80.40	97.18	8	28.57
10797.	Totus (thepenguin183)	28	91.30	117.94	11	39.29
10798.	༼ つ ◕_◕ ༽つ (the...	28	78.38	95.76	8	28.57
10799.	Themi (themis3000)	28	59.76	68.45	5	17.86
10800.	Duncan (thedunco)	28	90.11	104.30	9	32.14
10801.	Ethan (thatonepear)	28	106.02	117.46	10	35.71
10802.	telorbuzzu (telorbusu)	28	113.40	133.37	15	53.57
10803.	Justin (tacder)	28	41.09	53.07	2	7.14
10804.	Abdulhadi (surebeta)	28	58.85	68.04	3	10.71
10805.	Sunbites (sunbites_4610)	28	81.38	102.48	15	53.57
10806.	Benjamin (strangelyroblo)	28	74.27	91.81	7	25.00
10807.	Spy (spy12150)	28	103.82	118.52	13	46.43
10808.	Chris P. Bacon (spicy_toast)	28	88.28	104.95	11	39.29
10809.	Be At Peace (spacepajamas)	28	89.03	100.56	11	39.29
10810.	Smoke (smoke91)	28	86.52	102.11	6	21.43
10811.	Sludge (sludgeneedbeer)	28	48.47	58.31	4	14.29
10812.	sleepy (sleepy_tf)	28	92.72	117.76	10	35.71
10813.	skeleton (skeleton0)	28	101.29	117.20	13	46.43
10814.	tstats[sinkingecstasies] (s...	28	105.27	128.78	10	35.71
10815.	ShowMeDaWay (showmak)	28	53.51	68.49	12	42.86
10816.	Shimbo (shimbobaby)	28	63.45	80.47	19	67.86
10817.	sherif (sherifu3)	28	35.89	43.11	1	3.57
10818.	Shadowfader (shadowfader)	28	39.09	45.19	3	10.71
10819.	Black ★ Star (sh1nobie)	28	117.80	150.35	8	28.57
10820.	Nady (serufidesu)	28	64.49	79.91	6	21.43
10821.	Malondee (malondee)	28	93.39	107.95	8	28.57
10822.	Malchez Link (malchez)	28	62.96	77.95	5	17.86
10823.	sunny (maff_)	28	95.82	111.26	16	57.14
10824.	lpd11 (lpd11)	28	85.39	93.21	9	32.14
10825.	Roy (lordkite)	28	92.27	117.65	12	42.86
10826.	(loom981)	28	121.60	145.51	13	46.43
10827.	‹/hex› (linguistic)	28	106.64	123.08	14	50.00
10828.	IONIS (liaro0903)	28	98.01	109.08	5	17.86
10829.	Law (law_sm)	28	74.26	93.68	9	32.14
10830.	i am the best (kzara6)	28	67.37	84.81	10	35.71
10831.	David (klydden)	28	103.67	115.12	10	35.71
10832.	B (kinfthaderp)	28	118.59	136.09	12	42.86
10833.	Kimi (kimichanga)	28	50.52	59.86	6	21.43
10834.	nick (kicknenton)	28	86.56	97.76	11	39.29
10835.	Kheersagar (kheersagar)	28	36.92	44.69	4	14.29
10836.	Kevin (kevinfjbecker)	28	41.11	48.17	4	14.29
10837.	Kayyy (kayyy99)	28	38.30	49.42	0	0.00
10838.	karsten (karstensen)	28	67.42	83.26	5	17.86
10839.	sparda (kamoess0)	28	86.50	101.62	8	28.57
10840.	kaede (kaede1)	28	75.62	94.24	3	10.71
10841.	Mac (justmac)	28	72.79	87.18	1	3.57
10842.	oli (johnvenz16)	28	89.91	101.87	12	42.86
10843.	Josh (jnavin54)	28	52.55	63.45	3	10.71
10844.	Jmam (jmam)	28	103.40	125.90	10	35.71
10845.	A (jllkii123)	28	67.65	77.16	9	32.14
10846.	James (jayuplink)	28	85.07	98.82	8	28.57
10847.	Jem (jampr)	28	93.53	109.67	9	32.14
10848.	jake (jakez)	28	53.20	64.79	6	21.43
10849.	Jack (jack8888)	28	130.20	178.00	1	3.57
10850.	Nuggs (itsmenuggetz)	28	72.68	94.97	10	35.71
10851.	Itay (itay4430)	28	102.05	127.04	14	50.00
10852.	isaiah (isaiahturnip)	28	109.15	135.05	14	50.00
10853.	Peter (ironman2711)	28	55.60	74.55	6	21.43
10854.	Impulsetyper (impulsetyper)	28	78.40	90.00	7	25.00
10855.	EpikPanda (imanepikpanda)	28	57.26	67.36	7	25.00
10856.	Sam (idcaboutnames)	28	77.36	88.55	10	35.71
10857.	Ian (ian1806)	28	132.87	150.74	15	53.57
10858.	Ethan Jeff (hypernacho)	28	89.01	115.96	9	32.14
10859.	Rathalos (honored1234)	28	64.83	77.41	5	17.86
10860.	Hoang (hoangama)	28	58.01	67.55	3	10.71
10861.	Hmjo707 (hmjo)	28	92.59	122.09	13	46.43
10862.	Aldar Kose (hkoldas)	28	67.48	80.81	10	35.71
10863.	Sub to spenzalo (hi_shoemaker)	28	121.59	145.52	15	53.57
10864.	Hideto (hikimarun)	28	73.67	90.96	8	28.57
10865.	Andrew (happie)	28	72.99	87.96	3	10.71
10866.	G (gtyper123)	28	47.56	60.45	5	17.86
10867.	Vaibhav (genius6)	28	62.63	84.02	11	39.29
10868.	Robert (furyon700)	28	74.75	98.64	5	17.86
10869.	Guillermo (schobzax)	28	123.46	154.23	21	75.00
10870.	Sawill (sawill)	28	78.73	94.61	6	21.43
10871.	Steve (sanptyper)	28	107.28	118.97	11	39.29
10872.	Sanjar0126 (sanjar0126)	28	62.45	73.64	10	35.71
10873.	spam (sammywammyllamma)	28	94.75	109.11	12	42.86
10874.	Sagi (sagi_hv)	28	38.05	45.18	1	3.57
10875.	Ryuu (sacreddany)	28	83.24	96.00	7	25.00
10876.	RZ5D (rz5d)	28	90.21	113.32	16	57.14
10877.	Gabriel (ryulzaki)	28	62.46	85.54	6	21.43
10878.	Rishay (rishayg)	28	58.09	68.07	6	21.43
10879.	Monica (ricefun)	28	92.78	106.46	8	28.57
10880.	Reyna (reyeg4)	28	79.06	97.05	13	46.43
10881.	doraemon (reazulislam)	28	60.66	71.48	5	17.86
10882.	SDF (rc12chy)	28	37.27	47.21	4	14.29
10883.	Ravshan (ravshan)	28	54.45	66.09	3	10.71
10884.	RashidTalib123 (rashid_tali...	28	89.49	105.99	13	46.43
10885.	rain (qwimnetypes)	28	79.48	100.29	10	35.71
10886.	moni (pzza404)	28	68.05	97.90	7	25.00
10887.	JO (pinkvelociraptor)	28	58.89	72.90	9	32.14
10888.	Mona (picolee)	28	49.59	62.35	6	21.43
10889.	Alan (papizene)	28	71.45	85.65	5	17.86
10890.	﹤୨♡୧﹥ (pa1ntwater)	28	56.32	68.26	2	7.14
10891.	orthohalmak (orthohalmak)	28	72.42	81.88	8	28.57
10892.	nyoomian (nyoomian)	28	100.24	109.45	10	35.71
10893.	Nitta (nitta814)	28	85.49	96.19	7	25.00
10894.	nikki (nikki0420)	28	63.36	72.05	8	28.57
10895.	Niceable (niceable)	28	89.33	108.69	9	32.14
10896.	Dr. NedStark (nedstark2_0)	28	34.75	41.48	3	10.71
10897.	The (navya2008)	28	44.23	62.77	6	21.43
10898.	Nathan (nathanbotas)	28	121.77	155.23	15	53.57
10899.	Nalchee (nalchee1)	28	111.41	131.99	7	25.00
10900.	Prathamesh (mystic_1)	28	71.08	82.88	9	32.14
10901.	Mister (mystery_qwerty)	28	80.99	91.56	12	42.86
10902.	Michael (mrk0508)	28	88.58	98.49	9	32.14
10903.	Cal (mrbegon)	28	69.14	81.09	6	21.43
10904.	Martin (mpenkov)	28	74.06	97.89	3	10.71
10905.	John (mernst)	28	77.80	89.80	5	17.86
10906.	Mehrshad (mehr74)	28	80.37	117.25	4	14.29
10907.	Meeb (meeb24)	28	103.20	134.60	12	42.86
10908.	Mark (maverick2455)	28	61.85	71.67	3	10.71
10909.	Matt (mattserblo)	28	82.59	99.42	15	53.57
10910.	Mark (markgeorge)	28	64.59	73.57	4	14.29
10911.	meemw (markenmaw)	28	72.46	87.37	5	17.86
10912.	Adrian (mangojuice_)	28	82.93	95.93	9	32.14
10913.	ariel (arielsoko)	28	102.43	124.20	15	53.57
10914.	Archery (archeryiskey)	28	107.58	124.80	9	32.14
10915.	🚀 (aqua_desu)	28	133.79	158.94	18	64.29
10916.	Anton (antonchen)	28	123.04	151.91	27	96.43
10917.	Andy (andy_andy)	28	57.94	67.91	4	14.29
10918.	Anceint (anceint)	28	83.04	101.10	10	35.71
10919.	Ali (alishyper12)	28	86.35	105.83	15	53.57
10920.	Akshay (aksseet)	28	120.43	147.47	19	67.86
10921.	Adam (adxam)	28	70.49	81.07	5	17.86
10922.	adarsh_rzh (adarsh_rzh)	28	59.15	75.44	8	28.57
10923.	Raz (adashi)	28	83.94	107.08	12	42.86
10924.	Abhinav (abhinav42)	28	53.26	61.88	3	10.71
10925.	Adrian (aadoy_)	28	51.28	67.82	2	7.14
10926.	index finger spacebar user ...	28	118.89	138.17	10	35.71
10927.	teeto (1005sv)	28	93.37	116.87	8	28.57
10928.	T (0_________0)	28	67.56	79.57	6	21.43
10929.	Logan (g0atb0lt)	28	74.53	107.50	8	28.57
10930.	Pat2475 (pat2475)	28	44.13	60.70	3	10.71
10931.	Quinn (wind_chaser)	28	36.28	45.06	3	10.71
10932.	Hexa (hexaa)	28	69.26	83.99	4	14.29
10933.	Quynh (spinelsun)	28	73.94	87.02	10	35.71
10934.	Angelos (mangas)	28	68.91	81.44	6	21.43
10935.	Ken (twofourty)	28	77.37	89.64	11	39.29
10936.	sarat (saratrajput)	28	74.59	86.51	5	17.86
10937.	darkDEMISE (dark_demise)	28	72.43	84.91	5	17.86
10938.	Mae (mimstermae)	28	111.71	133.40	17	60.71
10939.	Philip (bigasianmidget)	28	75.86	90.18	11	39.29
10940.	Zander (aok9999)	28	54.65	70.71	4	14.29
10941.	Slow Typist (oatsy)	28	80.68	92.43	5	17.86
10942.	David Baril (dbaril2002)	28	61.29	73.61	6	21.43
10943.	Liddle (0_night)	28	68.96	80.58	5	17.86
10944.	Martin (martinlq)	28	62.91	72.15	4	14.29
10945.	kuroo (kurodra5634)	28	42.25	51.06	2	7.14
10946.	Fromix (fromix)	28	108.50	132.31	16	57.14
10947.	Soham (infitro)	28	32.12	39.82	3	10.71
10948.	Karrot (karrotdraws)	28	87.45	100.94	6	21.43
10949.	Rori (rori_)	28	77.72	91.96	6	21.43
10950.	|||||||||||||||||| (breadfr...	28	65.87	83.24	2	7.14
10951.	aubs (kokokokie)	28	56.90	69.30	3	10.71
10952.	Georgi (zoreau)	28	62.57	82.79	5	17.86
10953.	Tzurok (tzurok)	28	66.89	77.68	6	21.43
10954.	YourWorst (ajplayzthat)	28	68.99	95.36	10	35.71
10955.	Rensevt (rensevt)	28	57.12	64.45	4	14.29
10956.	arham (arham_doshi)	27	51.86	59.27	2	7.41
10957.	AranKz (arankz)	27	81.82	97.26	7	25.93
10958.	d1ff1cult (apysch)	27	117.08	128.54	15	55.56
10959.	Ahmad (apathicss)	27	74.55	90.43	17	62.96
10960.	Tran Thai Anh (anh_tran123)	27	65.66	73.83	5	18.52
10961.	ana (anachokheli)	27	46.19	57.77	1	3.70
10962.	Aman (amansharma10)	27	62.45	74.86	5	18.52
10963.	Kelven (agentbowtie)	27	60.76	73.89	7	25.93
10964.	Aecor (aecor)	27	103.06	114.74	7	25.93
10965.	Adam1t (adam1t)	27	60.93	77.96	5	18.52
10966.	Abonkwe (abonkwe)	27	79.94	96.83	9	33.33
10967.	tstats[abhishekyeskholiya] ...	27	79.30	95.45	8	29.63
10968.	Marco (abababaaaa)	27	69.96	86.13	6	22.22
10969.	pwned (16wpm)	27	84.91	95.55	4	14.81
10970.	Sinuro (0sty)	27	76.13	102.22	13	48.15
10971.	Hifjul (hifjul)	27	57.03	70.07	2	7.41
10972.	James (adamorjames)	27	61.51	74.72	7	25.93
10973.	Daniel (dxnielchoo)	27	64.69	88.80	10	37.04
10974.	Brandan (brandanprice)	27	56.05	70.98	4	14.81
10975.	matthew (hewasnumber1)	27	65.63	83.89	6	22.22
10976.	Ognian (ogihaxer)	27	56.54	69.27	20	74.07
10977.	Stalast (stalast)	27	89.46	111.87	1	3.70
10978.	Ivan (potatokingdom)	27	85.78	101.01	6	22.22
10979.	scoutie (scoutieee)	27	77.05	92.46	6	22.22
10980.	Jon (rockitman)	27	102.66	141.32	12	44.44
10981.	Kevin (iuhnivek)	27	82.90	95.84	4	14.81
10982.	Samin (_nimas)	27	53.58	66.14	2	7.41
10983.	harsha (master_ogasaku)	27	36.31	46.15	3	11.11
10984.	Stephanie (zoomer1)	27	32.80	46.09	1	3.70
10985.	Arshak (arshak00)	27	56.28	64.02	5	18.52
10986.	Sebastian (cohnan)	27	74.66	88.39	8	29.63
10987.	ToothDK (dkindred)	27	68.92	98.62	24	88.89
10988.	Wegster (nico88villa)	27	56.69	66.15	9	33.33
10989.	Cayden (klxverzz)	27	45.45	58.60	7	25.93
10990.	Harry (harryswan)	27	66.16	93.02	10	37.04
10991.	La (listentonct)	27	68.52	81.52	9	33.33
10992.	Fahd (faddyboi)	27	85.80	106.50	7	25.93
10993.	ardabil (ardabil)	27	20.13	25.86	6	22.22
10994.	hw4nb (hw4nb)	27	57.65	76.19	5	18.52
10995.	Julia (malh)	27	34.34	41.61	2	7.41
10996.	Bryan (lufrewaffle)	27	60.61	70.68	5	18.52
10997.	Sauce (lolplox123)	27	107.22	148.79	9	33.33
10998.	boo (lolitsme)	27	75.52	88.70	6	22.22
10999.	Everest (likethemountain)	27	77.16	95.76	7	25.93
11000.	David (leepictrollexd)	27	108.70	126.26	16	59.26
11001.	Naresh (learnrapid)	27	47.38	57.06	5	18.52
11002.	Laznia (lasthomeless)	27	56.06	65.26	1	3.70
11003.	tak power (langsungg)	27	85.15	96.64	7	25.93
11004.	Thpp (kulaspa)	27	97.62	114.51	13	48.15
11005.	kuchukas (kuchukas)	27	51.25	62.64	2	7.41
11006.	Kostia (kostia)	27	52.10	63.27	4	14.81
11007.	Underscores4Fun (koskos)	27	79.88	96.72	6	22.22
11008.	potato (kongkan_)	27	98.75	113.49	13	48.15
11009.	Kyle (kle33)	27	67.16	78.30	8	29.63
11010.	Alvin (kishoarima)	27	62.32	71.27	4	14.81
11011.	Shahobiddin (khusniddinov_uz1)	27	55.07	65.38	6	22.22
11012.	keytiX (keyti)	27	41.62	49.69	2	7.41
11013.	Kenneth (kensan73)	27	103.48	118.68	18	66.67
11014.	Membrane69 (keifermatthew)	27	89.05	109.14	9	33.33
11015.	Kaeso (kaeso_krupp)	27	92.70	107.69	12	44.44
11016.	kaare (kaare)	27	78.35	105.45	8	29.63
11017.	k3n (k3nnn)	27	138.95	152.38	20	74.07
11018.	Julian72696 (julian72696)	27	93.64	119.37	7	25.93
11019.	John (john_sharks)	27	78.65	85.76	5	18.52
11020.	John (jimminyyy)	27	81.73	108.41	9	33.33
11021.	Jonathan (jimbothegreat)	27	76.80	99.57	10	37.04
11022.	JesseCarl (jessecarl)	27	72.17	85.85	6	22.22
11023.	Jaz (jazwolff)	27	61.25	73.60	3	11.11
11024.	Jose Antonio (jarceantonio)	27	76.80	94.80	7	25.93
11025.	Jake (jakexx)	27	86.12	113.90	9	33.33
11026.	Vytenis (jackeddj)	27	69.90	86.67	8	29.63
11027.	Jjajangmyeon (izzu)	27	72.90	88.04	7	25.93
11028.	irving (irvingnivri)	27	78.68	91.03	5	18.52
11029.	찬우 (inphinity)	27	122.11	163.87	14	51.85
11030.	Ben (hurstsys)	27	52.55	62.41	1	3.70
11031.	Radu (horixyt21)	27	93.87	108.65	8	29.63
11032.	Scott (holyomgida)	27	101.76	118.87	10	37.04
11033.	Louis (hlouis)	27	111.34	131.18	16	59.26
11034.	Rotem (hi_im_rotem_2006)	27	68.45	83.53	7	25.93
11035.	mashed_potato (hello_world199)	27	67.43	80.09	7	25.93
11036.	Lasse Hededal (hededal)	27	70.46	86.33	7	25.93
11037.	Luke (harrislp1979)	27	59.64	73.20	8	29.63
11038.	ﱞﱞﱞﱞﱞﱞﱞﱞﱞ...	27	84.43	98.55	14	51.85
11039.	Gabe (gsoares026)	27	111.25	143.58	22	81.48
11040.	sangvar (greeker)	27	71.64	87.19	13	48.15
11041.	Ainsley (giannis199)	27	69.36	83.48	6	22.22
11042.	Tan (ghtann)	27	78.30	90.45	5	18.52
11043.	Adam (george_williams14798)	27	109.14	131.04	14	51.85
11044.	M.Verstappen (gameroubas)	27	102.55	119.64	12	44.44
11045.	Gabby (gabbychan)	27	66.85	83.75	8	29.63
11046.	folgue02 (folgue)	27	84.17	99.42	9	33.33
11047.	FireGumz (firegumz)	27	56.51	74.00	4	14.81
11048.	fei (feiamor)	27	63.46	84.58	6	22.22
11049.	Fave (fave_22)	27	52.81	59.18	2	7.41
11050.	Henry (fastypr)	27	88.00	106.38	15	55.56
11051.	distopia (far_sunflower)	27	53.15	64.05	1	3.70
11052.	Fabricio (fabrox)	27	68.33	87.52	7	25.93
11053.	Vincent (ezbread)	27	69.79	85.89	11	40.74
11054.	Evan (estarr14)	27	52.35	63.45	2	7.41
11055.	Ellen (eeecp)	27	76.18	88.15	6	22.22
11056.	Edilbek (edok_mal4)	27	48.77	65.67	3	11.11
11057.	bum_fluff (dritt)	27	124.47	137.60	18	66.67
11058.	Dylan (drink_windex)	27	69.78	82.91	4	14.81
11059.	Djaenk (djaenk)	27	107.27	147.99	16	59.26
11060.	Vit (denysvit)	27	84.10	94.97	12	44.44
11061.	Dennis (dendendenlee)	27	61.36	73.31	6	22.22
11062.	Dein (deinfreund)	27	116.63	136.95	27	100.00
11063.	wet nightmare (daviddloco)	27	92.74	105.41	13	48.15
11064.	Dev (darkpi)	27	71.32	85.34	3	11.11
11065.	Darin (darin_ss)	27	46.12	65.96	1	3.70
11066.	Daedalus (daedalusmahda)	27	87.39	98.46	14	51.85
11067.	æ (c_c_c)	27	91.10	126.62	10	37.04
11068.	cung (cungdongma)	27	76.54	91.42	10	37.04
11069.	Craig (craiggsell)	27	68.81	77.40	5	18.52
11070.	Chirath (cp_guy)	27	64.17	78.68	6	22.22
11071.	Casey (covertmidget)	27	66.90	81.79	15	55.56
11072.	BUS (bus12)	27	94.09	108.94	8	29.63
11073.	Sahabuddin (blitzbibi)	27	51.72	59.97	4	14.81
11074.	Ben (blister99)	27	110.76	126.13	19	70.37
11075.	Bionodroid (bionodroid)	27	69.21	82.00	3	11.11
11076.	BigBreadBaker (bigbreadbaker)	27	130.01	158.06	19	70.37
11077.	bianca (bi4nc4hannah)	27	53.08	64.87	10	37.04
11078.	Ethan (bewilderex63)	27	107.72	136.22	12	44.44
11079.	bayu (bayun2445)	27	45.38	55.99	2	7.41
11080.	bacy (bacy)	27	54.05	66.97	2	7.41
11081.	Ahmed (a_h5s_h)	27	52.62	63.78	0	0.00
11082.	arman (arman_types)	27	112.81	145.96	13	48.15
11083.	Mohamed (_mohammed_taha_)	27	64.18	72.47	2	7.41
11084.	z3x7 (zegadb)	27	69.45	84.44	7	25.93
11085.	zeeko (zeekomeeko)	27	61.27	71.82	8	29.63
11086.	Zachry (zachwn)	27	81.79	98.67	6	22.22
11087.	My (z0rtzp1zku)	27	74.94	87.09	9	33.33
11088.	Lance Toby (ybot28)	27	67.35	83.38	9	33.33
11089.	Jayden (y4nrui)	27	106.17	125.97	14	51.85
11090.	wooson (wooson)	27	69.94	81.80	6	22.22
11091.	gamem (wkdgurtna)	27	69.43	92.44	8	29.63
11092.	Wesley (wesleymelon)	27	116.75	145.46	13	48.15
11093.	Warren (war_30)	27	59.64	76.94	5	18.52
11094.	Victor (vlnash2002)	27	93.58	108.41	12	44.44
11095.	Viwarrior (viwarrior)	27	80.40	95.48	7	25.93
11096.	Aleksandar (virage94)	27	55.61	67.37	4	14.81
11097.	bruhmoment (victorio_)	27	102.73	129.15	7	25.93
11098.	Vicodin (vicodin_freeman)	27	91.02	116.81	8	29.63
11099.	revile you (vfctyrant)	27	139.91	159.73	24	88.89
11100.	Vedanta Sharan (vedbro)	27	40.34	58.81	3	11.11
11101.	Uwu (uwudesuka)	27	79.16	91.70	12	44.44
11102.	Usmon (usmonjonh)	27	50.64	70.38	14	51.85
11103.	Vincent (tyt14)	27	58.04	77.77	3	11.11
11104.	Tyson (tysonking33)	27	46.20	59.86	0	0.00
11105.	Mack (tron__)	27	99.20	111.48	10	37.04
11106.	Felix (tresflex)	27	86.70	107.76	9	33.33
11107.	Jonowo (trainerjono)	27	109.15	126.95	15	55.56
11108.	Elton John (tonundrum)	27	56.74	72.00	7	25.93
11109.	t (tomn114)	27	132.18	154.88	16	59.26
11110.	ᕙ(˵ ಠ ਊ ಠ ˵)ᕗ (...	27	79.57	99.41	9	33.33
11111.	kevin (titiloka)	27	40.80	47.19	2	7.41
11112.	Timothy (timothy5597)	27	64.63	79.24	4	14.81
11113.	Harsh (the_slow_one_123)	27	48.38	62.29	3	11.11
11114.	Thelonious (thelonious)	27	76.72	93.34	7	25.93
11115.	Alfie (theaqualord)	27	106.87	134.87	19	70.37
11116.	Thane (thaynt)	27	94.51	114.31	12	44.44
11117.	Teodor (teo_climber)	27	65.14	77.28	5	18.52
11118.	Temu (temex)	27	85.63	92.55	12	44.44
11119.	StellarDoc11 (tarth15)	27	80.50	96.70	17	62.96
11120.	Sunyog (sunyog)	27	43.08	65.20	5	18.52
11121.	Sunny (sunnylee0123)	27	123.07	146.10	20	74.07
11122.	omar (streetfighterlan123)	27	149.16	192.98	15	55.56
11123.	spycow27 (spycow27)	27	95.40	105.96	26	96.30
11124.	Aurora (sparrowfan101)	27	96.84	114.22	9	33.33
11125.	sevgik (soranges)	27	88.48	123.64	7	25.93
11126.	Snowy (snowysauce)	27	109.57	130.15	12	44.44
11127.	Todor (todoriko)	27	31.29	38.52	1	3.70
11128.	Bobby (slowtyper557)	27	112.83	128.22	13	48.15
11129.	skywalker123 (skywalker123)	27	80.26	99.38	2	7.41
11130.	Nenad (sima_car)	27	60.05	73.97	3	11.11
11131.	6969 (silky_)	27	107.48	118.55	13	48.15
11132.	Silent (silent_solous)	27	108.13	129.46	20	74.07
11133.	barack (shming)	27	118.31	135.06	20	74.07
11134.	shahrukh (shahrukh77)	27	61.74	74.00	8	29.63
11135.	Duc (setokouse)	27	75.17	91.05	11	40.74
11136.	Sanjay (sanjaysins)	27	58.17	71.85	5	18.52
11137.	Saif (saif_kitaz)	27	57.10	64.80	4	14.81
11138.	Dr. (saddathasan)	27	67.20	79.49	6	22.22
11139.	Saber (saber2756)	27	98.74	128.74	12	44.44
11140.	Soumyajeet (s0umyajeet)	27	82.55	89.03	13	48.15
11141.	Violet (rxviolet)	27	81.98	100.89	8	29.63
11142.	Ruben (rubsi)	27	79.07	96.43	11	40.74
11143.	Roger (rogerboston)	27	59.43	77.53	4	14.81
11144.	robot (robotbb)	27	49.76	64.32	4	14.81
11145.	Rictor (rictormidgekin)	27	94.12	114.17	8	29.63
11146.	Amit (red2black)	27	65.84	78.92	8	29.63
11147.	Ben (realolympian)	27	64.10	78.05	6	22.22
11148.	Alikhan (realikh)	27	84.49	97.77	9	33.33
11149.	randomyr (randomyr)	27	93.81	107.09	11	40.74
11150.	raeraven (raeraven)	27	39.02	47.24	4	14.81
11151.	Caleb (qwerty345)	27	55.16	63.69	11	40.74
11152.	A (qkrdnwls6)	27	76.74	96.10	26	96.30
11153.	Psalmer (psalmer)	27	73.71	91.94	10	37.04
11154.	prans (prans12)	27	60.26	75.26	3	11.11
11155.	Adam (pop123gyg)	27	29.82	35.90	2	7.41
11156.	Himanshu (pluto_ish)	27	72.89	93.45	20	74.07
11157.	pz (pingzhi)	27	77.75	87.56	4	14.81
11158.	George (piehead567)	27	96.26	109.78	14	51.85
11159.	Phenos (phenos)	27	102.48	126.47	10	37.04
11160.	Pena (pena_perse)	27	57.29	65.58	3	11.11
11161.	Chanel (pandabean)	27	88.18	109.16	6	22.22
11162.	paldoo (paldoo)	27	72.78	92.21	6	22.22
11163.	Nizar (oxlord)	27	77.58	93.17	8	29.63
11164.	Dale (owenone)	27	113.31	127.97	20	74.07
11165.	Ali (oplo)	27	99.42	122.04	9	33.33
11166.	ollybollydisco (ollybollydi...	27	70.11	95.54	5	18.52
11167.	NuclearBacon (nuclearbaconyt)	27	61.11	88.84	7	25.93
11168.	OysterRice (notterrancehuang)	27	119.71	137.82	16	59.26
11169.	BeGood (notideal)	27	85.19	106.40	6	22.22
11170.	N0VA (nooova)	27	65.52	81.62	7	25.93
11171.	Noobiest (noobiestmaster)	27	71.14	93.38	7	25.93
11172.	Nate (nhanzel)	27	86.47	105.54	7	25.93
11173.	Muhammad (muhammad_pak)	27	86.96	106.06	9	33.33
11174.	Mr (mrrius99)	27	66.26	76.42	12	44.44
11175.	Emre (mr3mr3)	27	109.70	126.43	17	62.96
11176.	Rylan (moonraker505)	27	87.24	110.10	17	62.96
11177.	ng (minhtuhay123)	27	75.09	90.87	6	22.22
11178.	milop (milop)	27	71.90	85.46	9	33.33
11179.	Velocitys (mikesyeet)	27	83.01	102.79	8	29.63
11180.	Mike (mikereze)	27	54.26	68.54	1	3.70
11181.	Darren (meodaze)	27	106.07	122.82	16	59.26
11182.	Michael Loh (mclec950125)	27	75.23	84.45	7	25.93
11183.	MAYANK (mayank10)	27	46.87	54.25	2	7.41
11184.	M (maxopie)	27	85.41	97.79	6	22.22
11185.	Max (maxarfvidsson)	27	73.44	91.78	7	25.93
11186.	Max (max2004awesome)	27	102.66	119.10	9	33.33
11187.	Hugh (mathimati)	27	99.29	126.17	17	62.96
11188.	Mary (marymyers)	27	94.97	113.28	12	44.44
11189.	scampe (scampe)	26	104.59	119.87	16	61.54
11190.	asdf (rushlync)	26	79.75	92.70	6	23.08
11191.	Colemak (road2work100)	26	83.15	98.16	7	26.92
11192.	Zoe (riverz)	26	86.64	105.31	7	26.92
11193.	Kuzma (rikoj02)	26	93.01	115.42	9	34.62
11194.	R1 (richthe1kid)	26	94.33	117.46	9	34.62
11195.	Ricardo (ricardo1610)	26	66.92	78.50	5	19.23
11196.	repeatt (repeatt)	26	81.96	101.96	7	26.92
11197.	Sir RB (rblogan3)	26	59.83	70.13	5	19.23
11198.	Rajiv (rajiv_431)	26	41.26	51.78	3	11.54
11199.	Raivo (raivopleika)	26	32.16	43.30	2	7.69
11200.	vijay (pykethtitan)	26	91.74	111.58	10	38.46
11201.	Pro (pro_talon)	26	35.02	41.13	0	0.00
11202.	Preaben (preabae)	26	81.31	100.77	6	23.08
11203.	Omar (postmodernpostman)	26	110.35	134.30	14	53.85
11204.	Porkyy (porkyp10)	26	103.15	129.61	14	53.85
11205.	Rahul (pirate_racer)	26	49.98	58.33	0	0.00
11206.	Phire (phire_xic)	26	67.42	92.24	7	26.92
11207.	Peppito (peppito)	26	118.34	147.12	18	69.23
11208.	palisfpauul (palisfpauul)	26	96.34	107.97	11	42.31
11209.	ozzyy (ozzyy_163)	26	63.75	77.18	10	38.46
11210.	zero (ozero)	26	100.68	117.30	11	42.31
11211.	Just (ottovon)	26	65.47	85.37	4	15.38
11212.	Oscar (oscrrrrrrr)	26	61.37	84.67	9	34.62
11213.	Osaji (osaji)	26	80.48	93.53	7	26.92
11214.	Stuart (orihsenak)	26	70.05	83.71	8	30.77
11215.	Thomas (onlyphams)	26	85.02	112.28	7	26.92
11216.	Marco (oblq)	26	77.65	92.52	6	23.08
11217.	hard to type (obahi)	26	36.38	42.02	2	7.69
11218.	Nathan (n_tber)	26	30.53	43.81	5	19.23
11219.	noahrwilly (noahrwilly)	26	87.52	99.28	9	34.62
11220.	Nino (ninodoko)	26	121.66	137.50	14	53.85
11221.	Niklas (niklash)	26	89.40	109.37	9	34.62
11222.	Nikee (nikee25)	26	83.96	97.95	11	42.31
11223.	Benji (nepzy)	26	82.51	98.96	13	50.00
11224.	Niko Zhang (neko23)	26	81.53	98.14	7	26.92
11225.	Daniel (nedgcb)	26	88.75	110.05	7	26.92
11226.	c (nb888)	26	109.49	125.02	11	42.31
11227.	Nasar (nasarlagenda)	26	60.57	75.75	6	23.08
11228.	Nanashi (nanasheen)	26	98.95	128.05	9	34.62
11229.	naileuX (naileux)	26	85.47	110.45	10	38.46
11230.	MyBihLuhDoCocaine (mybiluhd...	26	97.65	124.05	11	42.31
11231.	workmanLayout (mustelad)	26	81.64	95.42	8	30.77
11232.	Mustafa (mustafaalyagoub)	26	88.16	101.69	5	19.23
11233.	Fluffy (musketeer)	26	52.41	67.78	6	23.08
11234.	mursh (mursh)	26	64.41	88.03	8	30.77
11235.	Eicy (moreseicy)	26	77.49	87.64	7	26.92
11236.	Mojo (mojo1289)	26	81.26	100.11	12	46.15
11237.	Julise (mintytea)	26	42.58	54.26	4	15.38
11238.	mike (mike4madness)	26	68.20	76.06	6	23.08
11239.	saba (midvert)	26	71.18	83.67	14	53.85
11240.	methodiical (methodiical)	26	82.44	104.61	3	11.54
11241.	Matthijs (matthijsb)	26	65.73	80.99	5	19.23
11242.	mart9n (mart9n)	26	108.46	120.89	17	65.38
11243.	Marcus (marcustham)	26	59.44	69.46	5	19.23
11244.	Darrick (mapleroasted)	26	84.40	108.73	10	38.46
11245.	FisH...MaN (fish_man)	26	81.69	101.21	26	100.00
11246.	Fernando Morato (fernandomo...	26	72.34	86.29	4	15.38
11247.	Fandom (fandom_girl)	26	58.09	72.28	7	26.92
11248.	Ian (e__n)	26	102.73	120.81	8	30.77
11249.	Ivan (evanmico)	26	87.46	96.71	19	73.08
11250.	Andrew (entranco)	26	90.97	108.58	9	34.62
11251.	emczuk (emczuk)	26	115.87	130.68	8	30.77
11252.	Earth (earth_chan)	26	94.29	112.62	15	57.69
11253.	Dana (dwhite84)	26	71.54	98.14	10	38.46
11254.	Darren (dtwcdarren)	26	76.79	98.14	4	15.38
11255.	droLnomeD (drolnomed)	26	77.98	97.47	5	19.23
11256.	Jake (drjakeman)	26	118.24	133.71	21	80.77
11257.	Denis Çerri (deniscerri)	26	90.62	109.04	10	38.46
11258.	DD (ddcute)	26	60.98	70.77	9	34.62
11259.	Dave (davidkim123)	26	106.72	123.96	14	53.85
11260.	bailey (darkness04)	26	59.00	98.72	11	42.31
11261.	Dan (danmarculet)	26	106.71	115.70	14	53.85
11262.	Davvy (daavvyy)	26	92.87	122.59	11	42.31
11263.	H (curlwurl)	26	89.97	105.32	6	23.08
11264.	abhay (cs_abhay)	26	77.46	93.86	6	23.08
11265.	Asrar (cruzen)	26	62.56	73.47	3	11.54
11266.	Jason (cowlodger123)	26	93.18	127.93	18	69.23
11267.	stranger (courage_iberg)	26	50.18	65.73	4	15.38
11268.	cooper (cooperwoop)	26	73.92	95.55	10	38.46
11269.	Max (convie)	26	98.11	119.20	8	30.77
11270.	Cristian (cmatiasc)	26	97.16	112.43	13	50.00
11271.	Ozan (clutchupmate)	26	104.55	130.95	11	42.31
11272.	Sebastian (cloutimus)	26	88.66	104.95	12	46.15
11273.	Sebastian (clicthekeys)	26	45.95	75.91	0	0.00
11274.	Charles (chuckly)	26	81.02	95.26	5	19.23
11275.	Lim (chiyennn)	26	67.07	75.89	7	26.92
11276.	alex (chinese69)	26	108.75	127.44	14	53.85
11277.	CelestialAmber (celestialam...	26	86.88	101.97	10	38.46
11278.	mo (ceiba)	26	81.38	95.98	5	19.23
11279.	Cecil (cecil_behar64)	26	89.33	96.98	5	19.23
11280.	Carter (cartersaechoa92)	26	89.53	104.10	6	23.08
11281.	tw0f1v3w0n (capricitor)	26	103.78	124.44	14	53.85
11282.	Justin (bothon21)	26	100.93	122.88	12	46.15
11283.	Blaize (bomoko)	26	73.82	85.93	8	30.77
11284.	Dakota (boda69)	26	50.03	58.64	3	11.54
11285.	William (bnuldun)	26	92.42	114.05	9	34.62
11286.	KMMOPJ1 (blueflammednezha)	26	64.00	78.53	7	26.92
11287.	Blitzgate (blitzgate)	26	77.79	92.30	6	23.08
11288.	Aaron (bigfategg)	26	77.89	91.84	7	26.92
11289.	Darren (baochun2)	26	94.81	115.47	11	42.31
11290.	ballz (ballzbazz)	26	71.36	78.39	6	23.08
11291.	Daddy (badassabd)	26	47.42	64.22	4	15.38
11292.	qwe (azeem838)	26	37.03	45.04	3	11.54
11293.	AxelDT (axman292)	26	81.63	93.97	6	23.08
11294.	Thomas (ashryx)	26	92.19	109.96	9	34.62
11295.	Arunkumar (arunkumar49)	26	72.15	87.49	12	46.15
11296.	APS (arsh_aps)	26	68.65	83.22	7	26.92
11297.	Alex (aralizer)	26	50.35	58.37	2	7.69
11298.	applecards (applecards)	26	60.47	75.67	5	19.23
11299.	Anurag (anuragbhatt)	26	69.05	87.58	1	3.85
11300.	Mike (anaperius)	26	48.30	59.36	13	50.00
11301.	Anas (ananzeh)	26	67.58	77.81	5	19.23
11302.	Anthony (an1hony)	26	97.84	116.86	6	23.08
11303.	A (amartindale)	26	43.26	54.67	2	7.69
11304.	Nissan GT-R (amalyano)	26	72.27	82.02	6	23.08
11305.	Jasper (ajaystr)	26	56.09	65.46	4	15.38
11306.	Advik (advik123)	26	59.07	66.98	7	26.92
11307.	Achuyat (achuyat)	26	38.17	48.86	2	7.69
11308.	Abhirup Das (abhirupdas200)	26	72.07	99.17	8	30.77
11309.	Abas (abasf14687)	26	62.20	80.39	9	34.62
11310.	Ayoub (4youb)	26	36.49	44.65	10	38.46
11311.	Jeff (3deer6)	26	59.55	75.12	4	15.38
11312.	Wzq (3125114)	26	88.32	100.52	6	23.08
11313.	Blake (25kangboyang)	26	94.73	116.77	9	34.62
11314.	Ahmed Husayn (pr1vate)	26	44.90	53.92	4	15.38
11315.	KURM (kurm)	26	47.03	58.64	2	7.69
11316.	kyvu (kyvu)	26	89.20	113.63	5	19.23
11317.	VerTue (xmarc)	26	67.33	83.37	9	34.62
11318.	J (jus_t)	26	55.50	67.70	4	15.38
11319.	Voldemar (voldemortenz)	26	39.97	50.32	1	3.85
11320.	Dark (raynous)	26	57.32	66.60	4	15.38
11321.	del (yggdrasilll)	26	78.12	89.85	7	26.92
11322.	Swice (swice)	26	57.44	71.69	5	19.23
11323.	Turd (turd_nugget1337)	26	50.80	63.98	2	7.69
11324.	M1 (m1_englondon)	26	62.65	73.09	3	11.54
11325.	Xavier (xavierboutot)	26	71.46	84.97	7	26.92
11326.	Segale (barbara01)	26	86.61	102.15	8	30.77
11327.	Eddie (e2damilla)	26	66.99	81.72	10	38.46
11328.	Chee (pigupenguin)	26	81.31	97.66	15	57.69
11329.	Nard (hackerskeyboard)	26	89.54	100.17	7	26.92
11330.	Hisham (kaalan007)	26	52.55	61.03	3	11.54
11331.	Stefano (stefano98)	26	33.21	44.67	1	3.85
11332.	Acks (acksmurder)	26	52.52	70.56	2	7.69
11333.	Trace (kerotace)	26	44.16	53.75	1	3.85
11334.	Sean (seanso952)	26	104.32	118.98	11	42.31
11335.	Onlyifpanda (zailahmae)	26	48.83	61.40	0	0.00
11336.	Ashraf (ataibani001)	26	88.04	98.41	7	26.92
11337.	Estrode (estrode)	26	81.52	103.61	15	57.69
11338.	Thanos (thanosrr)	26	64.24	75.00	7	26.92
11339.	Fatso (fatsolebatso)	26	82.17	103.26	18	69.23
11340.	Nautilus (nautilus_3374)	26	50.37	61.89	3	11.54
11341.	Mackyy. (mackipecko)	26	122.99	138.37	23	88.46
11342.	Daan (macdann6)	26	82.77	97.00	7	26.92
11343.	i am (lynx_noob)	26	32.62	40.50	5	19.23
11344.	Jamliv (lvpec)	26	66.83	82.05	5	19.23
11345.	Lubo (lubokkanev)	26	101.44	117.88	10	38.46
11346.	zhiyu (losterzu)	26	77.91	96.71	10	38.46
11347.	Tao (litao91)	26	89.51	106.59	8	30.77
11348.	liperdi (liperdi)	26	53.55	59.36	2	7.69
11349.	IChun (lighttodie)	26	88.89	104.44	8	30.77
11350.	Lee Bing Bong (lee_bing_bong)	26	95.79	117.54	13	50.00
11351.	kwonman99 (kwonman99)	26	91.15	112.54	8	30.77
11352.	Kuma (kumatero1)	26	62.31	75.93	5	19.23
11353.	Brandon (kosaido)	26	76.58	88.82	11	42.31
11354.	kopok (kopokopok)	26	66.62	82.88	4	15.38
11355.	Seth (kliney4)	26	74.38	85.33	7	26.92
11356.	Khaled (khaled2252)	26	97.95	117.38	11	42.31
11357.	Vince (kerokeroro)	26	68.82	82.14	4	15.38
11358.	Lucia (kenyousmile)	26	57.86	69.03	2	7.69
11359.	Kek_LordDvorak (kek_lorddvo...	26	80.72	101.06	6	23.08
11360.	Kay (kaylakhots)	26	79.48	95.62	17	65.38
11361.	Kasey (kaseshib)	26	85.13	105.36	6	23.08
11362.	KirinChibi (k4nna)	26	119.76	139.44	21	80.77
11363.	Jumpye (jumpye)	26	134.62	157.71	18	69.23
11364.	JVY (julvi)	26	68.71	86.06	9	34.62
11365.	Juggle (juggle6)	26	115.56	133.86	16	61.54
11366.	Josh (jtaube)	26	84.75	97.01	7	26.92
11367.	jesse (jessef_9000)	26	76.06	96.94	10	38.46
11368.	JEREYO05 (jereyo05)	26	44.37	54.27	3	11.54
11369.	Jay (jay_cubed22)	26	97.92	111.99	9	34.62
11370.	Suh dude (jaykwon)	26	85.88	106.84	6	23.08
11371.	j (jas1yne)	26	101.29	114.99	9	34.62
11372.	deez (ishkena)	26	88.38	112.01	22	84.62
11373.	imslowaf (imslowafuwu)	26	75.64	89.54	8	30.77
11374.	Ed (illuxionist)	26	94.99	113.70	16	61.54
11375.	Ian Jerome (ianjerome)	26	54.20	62.58	7	26.92
11376.	Lucas (huy1804)	26	69.28	88.49	7	26.92
11377.	HunTer (hunter420)	26	43.96	50.06	3	11.54
11378.	arif (hmmmnotokay)	26	73.50	93.97	7	26.92
11379.	hunt (hmich)	26	91.37	105.25	15	57.69
11380.	Cody (hippolytus)	26	93.19	124.79	9	34.62
11381.	Hien (hien1201)	26	76.25	83.82	5	19.23
11382.	lane (hiddenplays)	26	29.22	34.88	0	0.00
11383.	Adithiya (havlen1)	26	53.96	63.02	2	7.69
11384.	... (h01001010)	26	89.58	108.86	6	23.08
11385.	Varun Goyal (govarun)	26	63.05	73.07	5	19.23
11386.	Gnanendar (gnanickky)	26	57.64	64.69	3	11.54
11387.	Gintoki (ginnoji)	26	67.93	84.94	6	23.08
11388.	Ghislaine (ghislanemaxwell)	26	89.08	110.26	12	46.15
11389.	Abdur (genway_dev)	26	37.99	52.23	4	15.38
11390.	Garvežiukas (garvezinis)	26	70.04	98.75	8	30.77
11391.	Gabe (gabuthebabu)	26	95.82	112.08	13	50.00
11392.	Greatest (_greatestever_)	26	66.41	79.48	9	34.62
11393.	Emrys (zyronwhite123)	26	51.57	63.23	0	0.00
11394.	will (zootzootie)	26	84.98	103.06	8	30.77
11395.	Peter (zoodoo)	26	97.70	119.13	12	46.15
11396.	Zitwitcool (zitwitcool)	26	46.88	57.80	4	15.38
11397.	DY (yuyue1)	26	99.80	120.07	13	50.00
11398.	Charlie (xharlie)	26	83.12	101.41	5	19.23
11399.	wood warrior (wood_warrior)	26	62.95	73.98	5	19.23
11400.	Seth (wongaa)	26	74.35	94.23	9	34.62
11401.	Trying (whatisyourtalent)	26	55.09	72.75	5	19.23
11402.	wgreenihrcorp2 (wgreenihrco...	26	52.54	64.24	8	30.77
11403.	Jacob (werjac)	26	72.70	90.04	5	19.23
11404.	Winson (weezy_winson)	26	81.59	120.74	11	42.31
11405.	Wakil (wakil7)	26	54.77	66.89	6	23.08
11406.	Vishnu Chauhan (vishnuchauhan)	26	74.18	83.78	9	34.62
11407.	vicky (vickysiva007)	26	53.30	61.37	5	19.23
11408.	Victoria (vicksun)	26	59.47	67.92	2	7.69
11409.	Vivi (veevaa)	26	75.77	88.21	8	30.77
11410.	Ved (ved_)	26	32.31	44.43	1	3.85
11411.	Unai (unaiberis)	26	81.51	92.29	12	46.15
11412.	Patrick (ugonnaeatthatcrois...	26	67.33	80.51	6	23.08
11413.	krunal (triplekbro)	26	66.36	84.00	14	53.85
11414.	LM (trashtocash)	26	63.49	76.56	3	11.54
11415.	Mitch (toddlerdust)	26	134.49	149.07	0	0.00
11416.	tinkureddy (tinkureddy)	26	86.13	104.35	13	50.00
11417.	Timothy (timothy273)	26	63.49	75.00	7	26.92
11418.	Heather (tilly_day)	26	57.00	64.98	7	26.92
11419.	Christian (thermikk)	26	87.16	113.86	7	26.92
11420.	(thereayou)	26	84.06	99.22	8	30.77
11421.	Theo (theogv)	26	97.41	116.39	13	50.00
11422.	thavin (thavinxz)	26	73.98	88.35	8	30.77
11423.	Johnny (thatbigboy)	26	113.97	129.71	13	50.00
11424.	Itachi (thanos_18)	26	39.95	53.90	4	15.38
11425.	Terairk (terairk)	26	106.12	121.79	2	7.69
11426.	Teddie (teddie37)	26	65.07	76.47	7	26.92
11427.	tia (teayah)	26	58.89	71.81	9	34.62
11428.	taseh (taseh)	26	117.27	129.91	14	53.85
11429.	Leia (s_leia)	26	127.32	167.05	17	65.38
11430.	Dragon (susuthichansushi)	26	82.74	98.26	6	23.08
11431.	Linus (starhiro654)	26	92.41	115.72	9	34.62
11432.	s (sqood)	26	69.34	83.12	6	23.08
11433.	Speedswiper (speedswiper)	26	111.08	128.03	12	46.15
11434.	SPEED (speedbear)	26	109.86	128.32	11	42.31
11435.	War (sorted99)	26	54.99	64.29	3	11.54
11436.	SJ (sonialj)	26	53.05	62.78	4	15.38
11437.	A.A.Fouad (snkpl)	26	69.35	81.74	5	19.23
11438.	Aleksei (snejink)	26	38.23	48.56	0	0.00
11439.	Jeremy (slorsx89)	26	72.53	86.15	6	23.08
11440.	Kendall (skeletonsinc)	26	105.14	123.79	13	50.00
11441.	John (sirfightsalot)	26	77.81	92.38	7	26.92
11442.	Dev (sident)	26	99.68	118.14	14	53.85
11443.	Siberius (siberiusalpha)	26	63.40	76.80	7	26.92
11444.	Shreyash (shreyash_he)	26	32.28	37.26	7	26.92
11445.	Joe (shmooo)	26	113.22	131.36	13	50.00
11446.	N0rmL (_mee_)	25	92.91	104.64	10	40.00
11447.	old layout (_darya_)	25	86.47	105.95	6	24.00
11448.	allison (_allisonsun)	25	62.98	73.15	5	20.00
11449.	Zonic (zonic77)	25	94.43	105.51	14	56.00
11450.	zalpro (zalpro)	25	62.98	77.19	4	16.00
11451.	Yaas (yaas63)	25	58.52	69.76	3	12.00
11452.	Katie (xkaytea)	25	81.07	97.91	7	28.00
11453.	Wynton (wyntonrude17)	25	77.29	100.57	6	24.00
11454.	Saksham (wrath101)	25	78.82	98.38	6	24.00
11455.	Max (winstonlisa)	25	110.94	130.31	12	48.00
11456.	Will (willbo2006)	25	60.82	78.54	4	16.00
11457.	Wawa (wawasc)	25	74.33	92.01	2	8.00
11458.	opperhoofd (wart)	25	62.69	72.89	5	20.00
11459.	BrammetjeBaas (vyx_spaghettt)	25	55.64	61.76	1	4.00
11460.	Phillip (vuzula)	25	36.04	47.54	3	12.00
11461.	volt (voltb)	25	72.64	90.28	5	20.00
11462.	tstats[vishalvoid] (vishalv...	25	38.62	45.92	2	8.00
11463.	Veedek (veedek)	25	87.91	111.31	8	32.00
11464.	UzanR (uzanr)	25	55.63	64.73	2	8.00
11465.	MK (uosom)	25	77.12	98.12	7	28.00
11466.	VNLEASHED (unlevshed)	25	71.35	89.14	9	36.00
11467.	Timo (ubulin)	25	94.24	111.36	10	40.00
11468.	Txeru (txeru)	25	71.58	79.32	25	100.00
11469.	Quyen (tsaiduk)	25	82.96	102.11	8	32.00
11470.	Erik (trixx7)	25	74.18	91.72	7	28.00
11471.	anon (triphosphate)	25	89.50	106.49	10	40.00
11472.	TotalledZebra (totalledzebra)	25	109.22	129.34	17	68.00
11473.	Tim (timoteo_lol)	25	93.15	109.98	9	36.00
11474.	Thunderz (thunderz2016)	25	101.78	118.21	12	48.00
11475.	The_rock (the_rock97)	25	47.25	61.99	2	8.00
11476.	Ternimus (ternimus)	25	74.91	83.79	10	40.00
11477.	TANEdos (tanedos)	25	90.93	107.96	7	28.00
11478.	Syed (syedmadad)	25	58.85	77.71	2	8.00
11479.	Sweater (swtr)	25	77.49	98.12	7	28.00
11480.	Ethan (sweethan)	25	97.38	113.11	4	16.00
11481.	Aviel (suxhe)	25	94.81	117.81	6	24.00
11482.	Kasper (suttergren)	25	52.61	59.06	1	4.00
11483.	Surreal (surreal_cereal)	25	72.16	83.61	8	32.00
11484.	K (sunfalls)	25	101.90	116.00	13	52.00
11485.	suaad (suaad)	25	46.91	56.53	2	8.00
11486.	Ana (sturmshatten)	25	41.16	52.14	3	12.00
11487.	Azee (speedy65)	25	64.68	70.93	9	36.00
11488.	sophia (sophiacav)	25	100.69	111.74	7	28.00
11489.	Praveen (solvedbiscuit71)	25	38.54	51.04	1	4.00
11490.	BLURB (snowq)	25	100.56	117.44	12	48.00
11491.	VaporSZN (vaporszn)	25	90.61	107.33	12	48.00
11492.	Ellie (sluis9_halmak)	25	27.04	36.21	10	40.00
11493.	gianni (slowasf99)	25	107.02	131.46	10	40.00
11494.	siddharth (siddharthr)	25	66.61	79.20	6	24.00
11495.	Ty (sick_wubs)	25	47.24	67.32	2	8.00
11496.	Ahnaf (shahriarme)	25	42.73	52.76	1	4.00
11497.	shahmeer (shahmeernoob)	25	54.24	62.93	3	12.00
11498.	Setons (setonsgrandpa)	25	73.31	87.43	9	36.00
11499.	Arjun (arjun_0004)	25	104.28	116.76	11	44.00
11500.	Austin (apollo2020)	25	60.14	69.22	4	16.00
11501.	Satis (angpogikotalaga123)	25	138.05	156.29	15	60.00
11502.	Albert (aneuck)	25	84.75	110.62	11	44.00
11503.	Andrei (andreibanc)	25	80.59	96.47	5	20.00
11504.	Amin (amin_eatemad)	25	74.12	87.59	4	16.00
11505.	Amelia (amelia03)	25	89.41	109.75	10	40.00
11506.	Alfred (alfredsando)	25	88.44	103.26	9	36.00
11507.	Alex (alex_ryan)	25	67.31	88.67	2	8.00
11508.	alexjr977 (alexjr977)	25	51.37	64.88	1	4.00
11509.	Akshat (akshatsingh1_)	25	76.95	99.84	6	24.00
11510.	A Owadud (akash655)	25	56.93	69.73	1	4.00
11511.	Aaron (ajmoore0351)	25	65.43	79.31	5	20.00
11512.	Augusto (ahidalgob)	25	81.34	91.01	15	60.00
11513.	André (agdf)	25	70.93	78.58	6	24.00
11514.	Adrian (adrianmonaghan)	25	90.21	110.85	6	24.00
11515.	Adam (adamcoch)	25	84.99	95.52	7	28.00
11516.	Dvorak Klaas (acheron)	25	69.85	83.20	5	20.00
11517.	ableable (ableford)	25	96.05	109.43	14	56.00
11518.	Adarsh (aadi_2301)	25	38.40	48.22	0	0.00
11519.	Temuun (moon50)	25	64.95	81.59	3	12.00
11520.	Brendan (brendanr)	25	75.24	85.28	4	16.00
11521.	Max (jhared06)	25	63.84	74.12	12	48.00
11522.	mowglie (mowgliegaming)	25	67.79	79.36	8	32.00
11523.	Luke (lukecooper)	25	87.38	102.40	9	36.00
11524.	gregge (gregge_v2)	25	42.14	52.87	1	4.00
11525.	Lane (lane2295)	25	83.52	103.31	7	28.00
11526.	cameron (souregs)	25	57.07	67.18	3	12.00
11527.	DonFinn (fegermitn)	25	65.19	81.12	3	12.00
11528.	tteessssaa (tteessssaa)	25	62.16	78.64	8	32.00
11529.	Angel (aggel333)	25	87.88	103.73	12	48.00
11530.	Link (drainn)	25	60.64	75.79	7	28.00
11531.	Jooshua (me_no_good_at_typing)	25	75.94	89.06	3	12.00
11532.	AllCrumpledUp (stableigloo)	25	107.53	117.58	9	36.00
11533.	Herrah (neiljmth)	25	100.27	117.54	11	44.00
11534.	Cobi (cobidortch)	25	82.34	98.09	9	36.00
11535.	Fang (fangphire)	25	59.11	67.86	4	16.00
11536.	ItsAleq (itsaleq)	25	47.21	62.04	3	12.00
11537.	J (nordar)	25	60.99	68.09	4	16.00
11538.	Mayowa (paitin)	25	82.62	89.72	3	12.00
11539.	Bořek (tvojesestra)	25	89.94	113.59	10	40.00
11540.	William (siaomai1030)	25	39.91	44.43	4	16.00
11541.	Turtle (turtdagon)	25	88.00	107.77	6	24.00
11542.	Jose (rotaryjoey)	25	65.89	83.14	7	28.00
11543.	Arnoud (arnoud)	25	61.12	75.40	5	20.00
11544.	Umbra (umbra69)	25	67.43	77.82	0	0.00
11545.	Rubén (ryn_0)	25	39.83	47.49	4	16.00
11546.	Halo (hxlox)	25	71.85	89.71	16	64.00
11547.	t11h (t111h)	25	42.95	52.12	2	8.00
11548.	bau (padam21)	25	78.17	94.10	6	24.00
11549.	Idontknow (practice420)	25	65.77	77.10	4	16.00
11550.	Mobin (nibomilad)	25	42.51	52.34	2	8.00
11551.	Pulkit (the_tratios)	25	41.28	52.97	4	16.00
11552.	C (re4gd)	25	66.24	93.09	3	12.00
11553.	poopoo (nofaceman_mp4)	25	69.14	93.77	7	28.00
11554.	Sikais (sikais)	25	48.36	57.17	24	96.00
11555.	Fighter (fighter23)	25	33.26	40.15	7	28.00
11556.	DragonKingCosmos (dragonkin...	25	59.75	79.11	8	32.00
11557.	Pasto (pasto_gris)	25	72.22	92.44	4	16.00
11558.	Shanto (hi_shanto)	25	49.13	64.05	3	12.00
11559.	Saumya (saumya69)	25	66.91	75.92	6	24.00
11560.	sasuke (sasukee)	25	51.40	64.01	1	4.00
11561.	Sarah Bisher (sarahbisher)	25	102.55	111.72	12	48.00
11562.	ara ara (sage_of_six_trees)	25	66.65	78.06	8	32.00
11563.	sabian (sabiansaige)	25	59.41	75.28	4	16.00
11564.	Rayleigh (r_chin)	25	93.42	115.14	8	32.00
11565.	James (ryyuu)	25	99.63	120.99	13	52.00
11566.	dark (rycae)	25	71.49	82.90	9	36.00
11567.	Saurabh (rustie_123)	25	67.77	76.88	5	20.00
11568.	I can't type!!! (roychan1)	25	100.59	129.92	12	48.00
11569.	Vignesh (rosvicky)	25	54.69	65.25	5	20.00
11570.	Ron (ronlaniado)	25	92.85	107.66	8	32.00
11571.	Brigid (riniti)	25	102.85	115.10	15	60.00
11572.	Bryce (ribit500)	25	52.83	65.53	2	8.00
11573.	s3Bz (reganisgod)	25	93.49	105.50	8	32.00
11574.	Gamer (reallyrandomname)	25	137.14	168.63	21	84.00
11575.	Radu (rdrnd)	25	61.68	71.44	7	28.00
11576.	Raiym (rayimbek)	25	74.23	89.30	7	28.00
11577.	Jebaited (raizzel)	25	81.70	94.99	8	32.00
11578.	sabir (rabugi)	25	25.10	34.92	4	16.00
11579.	Tran (qsang)	25	62.03	78.26	6	24.00
11580.	Kuaz (qaz855175b)	25	65.96	78.22	6	24.00
11581.	Helmut (psyonara_dvorak)	25	50.89	61.43	3	12.00
11582.	Priyanshu (psxuchiha)	25	59.44	72.99	1	4.00
11583.	Suven (psuv)	25	58.48	65.17	0	0.00
11584.	efthymios (poios_malphite)	25	66.34	77.36	5	20.00
11585.	Shivashis (plant99)	25	94.67	111.69	5	20.00
11586.	pastamath (pastalavista)	25	56.73	70.46	8	32.00
11587.	password (passworder)	25	66.56	73.09	4	16.00
11588.	Bella (papidiabolus)	25	60.79	74.82	3	12.00
11589.	PandoraOG (pandoraog)	25	56.30	62.92	2	8.00
11590.	Onionkreb (onionkreb)	25	116.04	130.43	15	60.00
11591.	zr (oilyfishball123)	25	73.68	81.96	7	28.00
11592.	Iwan (ocalukivan)	25	18.08	42.90	4	16.00
11593.	Say My Name (notreallyasteve)	25	104.38	138.14	10	40.00
11594.	Jason (nooneuknow)	25	75.22	85.66	5	20.00
11595.	nolan (nolwoods)	25	52.76	60.10	2	8.00
11596.	nlthebiebs (nlfthebiebs)	25	60.49	70.42	3	12.00
11597.	Faizaan (nitroblast)	25	89.17	133.07	15	60.00
11598.	nitrox (nitr0x)	25	99.06	117.44	14	56.00
11599.	Nishant (nishantdesai1306)	25	73.42	89.86	5	20.00
11600.	NHK (nhk451f)	25	61.34	74.11	8	32.00
11601.	Jan (natrix_)	25	49.58	61.04	12	48.00
11602.	bode (mywaifubestwaifu)	25	64.96	101.73	5	20.00
11603.	Jack Pascoe (mrprotyperman69)	25	71.09	90.59	18	72.00
11604.	Pickle (mrpicklebody)	25	56.86	68.81	2	8.00
11605.	Secret Animals December 15 ...	25	139.76	164.00	17	68.00
11606.	bryan (morenomust)	25	70.28	101.44	8	32.00
11607.	Kiyo (misterkiyo)	25	84.28	100.88	5	20.00
11608.	Edward (mistaek)	25	97.87	119.58	13	52.00
11609.	Michelle (minspire)	25	98.42	115.84	12	48.00
11610.	Michael Rostom (michaelrous...	25	58.80	65.85	3	12.00
11611.	tstats[meratanak] (meratanak)	25	59.81	74.00	8	32.00
11612.	Meditate (meditate)	25	94.75	113.63	6	24.00
11613.	Yassin (meddyassin)	25	62.70	77.10	7	28.00
11614.	ratbastard (mattbierwirth)	25	115.02	136.19	16	64.00
11615.	Jeevun (masterjeev)	25	55.88	71.86	5	20.00
11616.	mangya (mangya)	25	49.69	61.35	4	16.00
11617.	Alex (fluffehpander)	25	98.64	111.18	14	56.00
11618.	Jay (finikin)	25	86.19	99.98	6	24.00
11619.	Abtin (fada1)	25	98.99	116.54	13	52.00
11620.	Ezio (ezio129)	25	59.31	71.68	4	16.00
11621.	Eskah (eskah)	25	74.64	91.62	5	20.00
11622.	eril (eril)	25	108.69	119.51	11	44.00
11623.	Srinidhi (eren_eager)	25	54.48	66.73	3	12.00
11624.	Yaroslav (eloren)	25	70.91	90.81	3	12.00
11625.	Elliot (elliot_cooper)	25	58.17	72.73	5	20.00
11626.	Elahe (elldora)	25	44.24	58.61	1	4.00
11627.	Elias (eliasy7)	25	97.90	125.05	23	92.00
11628.	Edwin Salinas (edos4)	25	65.35	80.33	0	0.00
11629.	edna (ednanaanaa)	25	58.61	71.78	5	20.00
11630.	et (edcolemak)	25	115.35	130.77	12	48.00
11631.	Dat (dvorakprodigy)	25	120.86	137.28	12	48.00
11632.	Zed_Query_Base (duyanh3897)	25	51.52	78.80	0	0.00
11633.	Jess (dragonfire24)	25	82.42	103.42	12	48.00
11634.	Dominic (dominic2382)	25	53.00	64.69	5	20.00
11635.	DogHole (doghole)	25	132.23	176.60	14	56.00
11636.	Dillruba (dishadipa223)	25	37.03	48.39	7	28.00
11637.	Dan (diamond98)	25	49.10	56.25	2	8.00
11638.	Theo (dhm_learner)	25	21.33	36.47	3	12.00
11639.	Rob (destructo91)	25	97.81	115.21	7	28.00
11640.	Jay (destroyer1101)	25	60.86	73.96	6	24.00
11641.	David (davidjnovak)	25	81.34	102.99	5	20.00
11642.	dantheman27 (dantheman8529)	25	66.45	82.17	7	28.00
11643.	Daniel (dannybot)	25	78.42	89.23	6	24.00
11644.	damafps (damafps)	25	71.82	84.57	5	20.00
11645.	maap_yach (crstlgo09)	25	80.25	102.51	7	28.00
11646.	Crricket (crricket)	25	76.48	96.17	8	32.00
11647.	crocotyper (crocotyper)	25	130.29	154.74	17	68.00
11648.	ToTo (complexion)	25	87.61	106.21	9	36.00
11649.	Chris (chrischu)	25	61.28	76.66	5	20.00
11650.	Chris (chris979)	25	83.76	105.04	5	20.00
11651.	Christoffer (chrippa01)	25	71.44	81.61	3	12.00
11652.	Lucas (ceebzz)	25	107.69	118.37	10	40.00
11653.	Brian (brianyosua)	25	101.71	120.60	11	44.00
11654.	Brendon (brenster)	25	45.85	63.78	1	4.00
11655.	Bread (breadmonkey)	25	96.98	114.94	9	36.00
11656.	blob_mister (blob_mister)	25	105.08	122.74	9	36.00
11657.	Cloud (blackcloud010)	25	112.26	127.79	15	60.00
11658.	bino_ (bino_)	25	78.23	88.15	6	24.00
11659.	B (benfield)	25	59.79	70.46	1	4.00
11660.	Joshua (beastjg)	25	89.23	109.77	11	44.00
11661.	earlprotyper (beamerboyy)	25	112.58	127.01	13	52.00
11662.	Bala (balaboi)	25	69.10	79.88	8	32.00
11663.	Joseph (baggs33)	25	102.56	125.20	10	40.00
11664.	aerooo (babatunde_olatunji)	25	61.05	82.57	9	36.00
11665.	Avaxar (avaxar)	25	74.66	95.61	13	52.00
11666.	typing.bro26 (ashokkaji)	25	39.72	52.32	4	16.00
11667.	Artorias (artorias_)	25	84.85	101.15	0	0.00
11668.	mac☮✈ie← →k🥵 (ma...	25	88.49	98.01	9	36.00
11669.	Marius (m4ryu5)	25	60.92	69.66	5	20.00
11670.	jeakai (lolilo123)	25	100.46	125.39	7	28.00
11671.	Mia (lkortebe)	25	128.11	164.11	18	72.00
11672.	Sam (lingbing)	25	82.97	94.90	10	40.00
11673.	Lily (lilell)	25	110.29	123.69	6	24.00
11674.	btonkh (le_shindeplouf)	25	79.43	96.20	25	100.00
11675.	abel (lessthanthirtyfive)	25	101.02	110.57	10	40.00
11676.	lenux005 (lenux005)	25	65.03	88.56	5	20.00
11677.	Leah (leah_is_not_available)	25	89.52	103.68	9	36.00
11678.	❤❤❤ (lavenenoz)	25	118.75	133.57	4	16.00
11679.	Preston (lantzer)	25	95.67	127.84	7	28.00
11680.	Nun (lackingnight)	25	65.68	83.90	3	12.00
11681.	Kriss (kkright)	25	89.18	105.55	9	36.00
11682.	Victor (kingofdawn)	25	72.43	94.11	8	32.00
11683.	kingcokes (kingcokes)	25	75.22	89.36	3	12.00
11684.	susan (kf7hdw)	25	120.10	140.31	13	52.00
11685.	Keti (keti_hawk)	25	75.14	89.15	4	16.00
11686.	KaloiNa (kaloina)	25	19.83	31.05	7	28.00
11687.	Mohammed Julfikar Ali (julf...	25	70.57	89.74	9	36.00
11688.	Josh (joshmankey7)	25	112.32	142.50	15	60.00
11689.	Jose (josethomas)	25	97.40	111.38	11	44.00
11690.	joon (joonleey)	25	61.58	69.72	5	20.00
11691.	Joketts (joketts)	25	81.05	95.82	9	36.00
11692.	Joseph (jkc7)	25	101.39	113.25	5	20.00
11693.	jhairssteven (jhairssteven)	25	59.83	74.61	3	12.00
11694.	Super slow (jan_war)	25	70.49	85.51	6	24.00
11695.	Jakawat (jakawat)	25	73.41	88.08	6	24.00
11696.	space 65 (jacob1361)	25	84.17	111.16	8	32.00
11697.	Daniel (intangiblesniper)	25	135.94	167.94	18	72.00
11698.	Jonathan (imprettysaxy)	25	122.74	149.46	15	60.00
11699.	ikkyu (ikkyu)	25	40.75	49.04	3	12.00
11700.	jimy (iceposident)	25	79.00	97.71	8	32.00
11701.	joel (ibeatjoeleverytime)	25	100.83	123.26	7	28.00
11702.	Ian (ianduu)	25	58.07	68.37	7	28.00
11703.	Hen_r.y (h_enry)	25	47.75	55.20	3	12.00
11704.	Hossein (hosseinzafari)	25	52.22	60.81	9	36.00
11705.	Miles (hauskaz)	25	89.58	109.60	5	20.00
11706.	Haribo (haribooo)	25	80.99	94.75	4	16.00
11707.	hannah (hannahvilla)	25	98.00	118.17	15	60.00
11708.	Free Palestine (halemogpa)	25	57.01	72.54	3	12.00
11709.	Gevashkar (gevashkar)	25	67.25	80.89	10	40.00
11710.	gDan (gdan)	25	51.27	66.77	5	20.00
11711.	shravan (gammarays)	25	74.87	91.22	6	24.00
11712.	Arslan (malikarslan)	24	62.27	80.47	7	29.17
11713.	Bart (madhavgoyal)	24	70.52	85.06	4	16.67
11714.	Macklin (macklin123)	24	92.01	100.86	8	33.33
11715.	Lo_key (lo_key)	24	76.39	87.66	4	16.67
11716.	LLyn (llyn)	24	88.47	110.16	7	29.17
11717.	David (litening72)	24	68.07	78.79	4	16.67
11718.	Markus (lil_manila)	24	53.69	65.18	2	8.33
11719.	LiKeRoMaNiA (likeromania)	24	73.31	82.12	4	16.67
11720.	lexi (leximeow)	24	98.77	119.99	10	41.67
11721.	TinyTim (lavoiet)	24	72.46	84.98	4	16.67
11722.	Andre (lapp13slaf)	24	70.60	86.02	5	20.83
11723.	Laet (laet99)	24	108.03	124.61	12	50.00
11724.	Jen (ladyjen)	24	38.08	46.55	0	0.00
11725.	Kaiden (ksetay)	24	65.43	84.12	5	20.83
11726.	Pavan (kpavankotesh)	24	75.07	92.38	11	45.83
11727.	Deven (kikaliyo)	24	79.02	94.66	5	20.83
11728.	Kevin (kevink1844)	24	73.16	86.49	7	29.17
11729.	Kevin (kevchen0908)	24	77.57	90.92	4	16.67
11730.	D4Backdoor (keskin)	24	85.35	103.85	4	16.67
11731.	Kelvin (kelvinohhh)	24	64.30	78.99	6	25.00
11732.	Will (karl__marx)	24	109.94	144.74	18	75.00
11733.	Kaori (kaori13)	24	58.28	69.11	4	16.67
11734.	Junle (junlez)	24	82.91	99.31	10	41.67
11735.	Jeff (jschillr)	24	61.30	75.63	7	29.17
11736.	JN (jnnnn)	24	78.36	85.25	7	29.17
11737.	xX_WeiTpuXxy69!_Xx (jmsmnlpz)	24	51.51	67.69	5	20.83
11738.	Jay (jaydhanani36)	24	81.39	94.88	9	37.50
11739.	Stivang96 (janse122)	24	90.08	114.39	13	54.17
11740.	Jan (janpaint4221)	24	88.96	106.81	6	25.00
11741.	Jack (jacktheoven)	24	97.84	110.90	9	37.50
11742.	Will (iyeiye_captain_)	24	85.73	102.82	5	20.83
11743.	Ian (imatson9119)	24	89.60	102.90	8	33.33
11744.	ibizabroker (ibizabroker)	24	66.21	73.69	5	20.83
11745.	Heathe (hwhl)	24	101.06	119.39	9	37.50
11746.	Josh (hsoj1)	24	79.79	87.24	5	20.83
11747.	hrithik (hrithikmanoj)	24	58.52	66.37	5	20.83
11748.	Henry (hongquan448)	24	62.95	74.42	5	20.83
11749.	HiroM (hirom)	24	91.97	114.00	12	50.00
11750.	Unknown (hikaru0628)	24	42.50	55.08	5	20.83
11751.	HiHowIsYourDay (hihowisyour...	24	101.07	125.45	3	12.50
11752.	Tong (hiddenbanana)	24	80.24	94.25	5	20.83
11753.	Hendeen (hendeen)	24	55.76	68.23	3	12.50
11754.	Daniil (hate_machine)	24	56.57	66.83	13	54.17
11755.	Hasano (hasano14)	24	67.22	83.21	8	33.33
11756.	Harsh (harsh_dubey)	24	34.88	46.46	1	4.17
11757.	Hackai (hackai)	24	45.58	57.47	4	16.67
11758.	Yuji (gugox10)	24	120.92	139.53	16	66.67
11759.	Grzegorz (gorix)	24	74.15	88.36	3	12.50
11760.	Adel (goldfist10)	24	112.02	127.80	11	45.83
11761.	krabbygail (goldenxy)	24	81.19	97.59	12	50.00
11762.	nothing (galaxiedhomerow)	24	144.83	178.11	18	75.00
11763.	scor (scorbalope)	24	72.46	84.15	4	16.67
11764.	Ankit (savage_floppy)	24	56.70	68.18	18	75.00
11765.	abatt (sas_1100)	24	97.85	118.70	8	33.33
11766.	Santiago (santi_ooo)	24	60.99	73.81	8	33.33
11767.	Salzd (salzd)	24	73.24	85.12	4	16.67
11768.	salmonjerky (salmonjerky)	24	118.30	137.98	12	50.00
11769.	Ryo (ryonamba)	24	75.49	94.31	3	12.50
11770.	Morple (roubry)	24	52.71	61.83	5	20.83
11771.	vroom (rott3n)	24	101.95	118.48	11	45.83
11772.	Juan (robbyro10)	24	74.18	85.25	11	45.83
11773.	Red (redhood07)	24	91.05	104.71	8	33.33
11774.	Andy (realasianjesus)	24	97.65	109.93	7	29.17
11775.	Randhy (randhy456)	24	86.07	99.27	7	29.17
11776.	ibm model m (qpaper)	24	82.95	97.82	7	29.17
11777.	elvi (puddingbb)	24	66.92	74.43	6	25.00
11778.	poornoday (poornoday)	24	44.64	52.55	3	12.50
11779.	Babu (pinklamborghini)	24	97.58	120.02	17	70.83
11780.	Hoopty (phantommonk)	24	108.17	121.28	18	75.00
11781.	Zöri (pevisa)	24	66.81	82.21	8	33.33
11782.	Soumyadip (pelitza)	24	77.66	90.71	3	12.50
11783.	paul (paulb20071106)	24	85.52	99.95	8	33.33
11784.	PL (patrick_legrand)	24	67.67	81.32	7	29.17
11785.	Parker (parqr)	24	81.75	97.38	6	25.00
11786.	parasjeet (parasjeet_singh)	24	21.27	30.29	7	29.17
11787.	失败者 (palmtreeeee)	24	88.96	101.76	9	37.50
11788.	sausage fingers (otterrr)	24	99.90	127.01	11	45.83
11789.	Pj (orchrist)	24	85.37	106.57	2	8.33
11790.	Nicholas (omzero)	24	71.25	82.80	5	20.83
11791.	Chayton (omenop)	24	65.71	78.74	18	75.00
11792.	lol (nutmyballs)	24	88.76	96.67	10	41.67
11793.	Dave (nut4)	24	90.25	113.34	5	20.83
11794.	Not_Orious (not_computer)	24	111.36	132.76	10	41.67
11795.	Leung (noobie_markie)	24	77.87	92.11	4	16.67
11796.	Viet (noobaxereport)	24	70.63	82.37	5	20.83
11797.	Nono (nono11jp)	24	77.12	92.84	7	29.17
11798.	Noah (noaboston)	24	60.80	79.31	3	12.50
11799.	Nivekdood (nivekdood)	24	94.04	123.24	13	54.17
11800.	Ryan (ninjacowwizard)	24	67.95	86.75	6	25.00
11801.	MD Nasir Uddin (nasiruddin1...	24	33.33	45.11	1	4.17
11802.	Ruufa (narwhal_cream)	24	58.31	73.16	5	20.83
11803.	Nachito007 (nachito007)	24	51.58	67.15	4	16.67
11804.	wendy fan (nabong)	24	106.31	129.27	20	83.33
11805.	Muhammadsiddiq (muhammadsid...	24	46.34	54.97	4	16.67
11806.	MrFunk (mrfunkee_)	24	57.20	68.06	6	25.00
11807.	mags (moopymags)	24	113.50	143.99	21	87.50
11808.	Mohsen (mohsenbing)	24	37.57	44.22	2	8.33
11809.	Mohamed (mohamed5550)	24	52.12	64.16	2	8.33
11810.	Michael (mkelnei)	24	74.36	90.09	7	29.17
11811.	Michael (michaz)	24	61.09	68.34	4	16.67
11812.	Brandon (mibbrandon)	24	68.85	78.08	4	16.67
11813.	Matías (mendezmatias)	24	51.72	63.48	0	0.00
11814.	Michael (mddover)	24	62.01	72.46	6	25.00
11815.	Mariol (mcakalli)	24	60.04	70.31	5	20.83
11816.	mayo (mayo_tp01)	24	110.16	137.78	3	12.50
11817.	Matty (matty_b_raps)	24	71.53	86.84	3	12.50
11818.	Matěj (mates542cz)	24	57.76	71.58	3	12.50
11819.	M5 (mariahendrikx)	24	105.13	129.64	10	41.67
11820.	v33 (__v33__)	24	62.74	72.64	3	12.50
11821.	Zint (_zint_)	24	89.69	121.84	7	29.17
11822.	Irarref (_ofking)	24	59.97	73.49	4	16.67
11823.	Zockie (zockie)	24	74.27	85.32	7	29.17
11824.	Pretty Epic (zimbaycoleo)	24	98.80	125.18	11	45.83
11825.	Zhalgas (zhalgas_04)	24	40.88	46.99	12	50.00
11826.	Nicolas (yulkbbq)	24	101.20	113.42	7	29.17
11827.	leo (ytxqz)	24	59.45	71.56	3	12.50
11828.	Alex (your_pal_al)	24	88.58	111.47	11	45.83
11829.	Juan (yosohs)	24	73.30	88.23	4	16.67
11830.	haryson (xooflo)	24	121.89	140.19	8	33.33
11831.	akaxls (xlsbestplayer)	24	59.73	73.11	6	25.00
11832.	Wojciech (wpietron)	24	74.68	91.22	7	29.17
11833.	Wafles (waflebars)	24	73.07	89.73	6	25.00
11834.	whoam (w1ld13)	24	70.00	82.58	5	20.83
11835.	my fingers hurt (voltwitz)	24	134.71	151.91	18	75.00
11836.	Volta (vo1_ta)	24	92.59	110.97	15	62.50
11837.	Vishnu (vishnu_is_goated)	24	71.77	89.48	8	33.33
11838.	Vinne (vinne10)	24	98.93	127.85	6	25.00
11839.	viincent (viiincent)	24	89.27	119.39	7	29.17
11840.	V3RN0N (v3rn0n)	24	103.37	120.03	12	50.00
11841.	Utsah (utsah470)	24	42.68	56.65	2	8.33
11842.	tylgo (tylgo)	24	95.26	108.43	10	41.67
11843.	Joe (tormund)	24	67.48	79.33	7	29.17
11844.	Tommy (tommywiseau95)	24	32.91	39.18	1	4.17
11845.	Aditya (timmyaditya)	24	65.03	82.51	13	54.17
11846.	Tim (timhoxton)	24	41.53	49.70	1	4.17
11847.	Mig (timenextluck)	24	47.00	58.99	4	16.67
11848.	Thomas (thomasltran)	24	98.40	117.61	9	37.50
11849.	TheGreatYS (thegreatys)	24	69.28	79.06	8	33.33
11850.	megghraj (thegame365)	24	62.55	77.18	2	8.33
11851.	thecourtneyv (thecourtneyv)	24	89.47	105.28	12	50.00
11852.	Renata (thebluesavvy1)	24	71.63	87.25	3	12.50
11853.	Cocoa (thatclassykid)	24	76.79	88.95	6	25.00
11854.	Teh (tehtehteh)	24	121.91	135.93	16	66.67
11855.	Teen (teenunicorn)	24	101.42	122.26	9	37.50
11856.	Daniel (swampy28)	24	47.30	58.57	3	12.50
11857.	Surya (suryathoppae)	24	69.15	99.15	5	20.83
11858.	streamix (streamix)	24	76.62	89.62	9	37.50
11859.	tyler (ssjtyru)	24	95.53	114.39	5	20.83
11860.	Filip (sodic)	24	87.81	105.04	13	54.17
11861.	Cass (sneakyperryplat)	24	116.19	141.11	11	45.83
11862.	Blake (skidaddle)	24	96.82	125.39	6	25.00
11863.	sircle (sircle)	24	67.25	75.73	5	20.83
11864.	shot607 (shot607)	24	124.03	142.11	19	79.17
11865.	shoobb (shooby28)	24	85.54	102.51	7	29.17
11866.	Dankey Kang (shabooty)	24	120.61	137.05	14	58.33
11867.	Sean (sfeendog)	24	74.95	86.11	1	4.17
11868.	Sejer (sejert)	24	73.37	93.53	9	37.50
11869.	An (an_dtr)	24	47.38	58.87	1	4.17
11870.	Duy (anthonytom)	24	114.09	128.06	10	41.67
11871.	Andreas (andysave)	24	78.33	94.27	7	29.17
11872.	Alex (alex_ofl)	24	77.56	90.76	5	20.83
11873.	Basma (airiii)	24	43.66	59.14	4	16.67
11874.	icosaedru (achimia)	24	87.64	98.29	6	25.00
11875.	abyl (abyl_10)	24	56.01	65.69	4	16.67
11876.	Abrar Shah (abrar_shah)	24	40.80	52.55	4	16.67
11877.	abdul (abdullateef4u)	24	60.71	69.87	4	16.67
11878.	Dude (48023984)	24	102.90	113.97	14	58.33
11879.	root (1_root_1)	24	71.87	83.63	6	25.00
11880.	1938 (1938)	24	57.04	83.79	2	8.33
11881.	Saksham (0_lol_0)	24	97.92	109.86	17	70.83
11882.	senneres (senneres)	24	66.92	80.69	5	20.83
11883.	die (dot65436)	24	54.54	68.50	7	29.17
11884.	Brady (bradychen)	24	51.06	60.67	4	16.67
11885.	Jackson (yoshiproz)	24	70.82	89.09	7	29.17
11886.	Cyrusssss (cyrusysleung)	24	70.96	86.44	4	16.67
11887.	don't (silversnow468)	24	59.64	69.93	10	41.67
11888.	jonas (jonas889)	24	79.35	94.85	6	25.00
11889.	Winter (winterlem)	24	90.98	104.45	11	45.83
11890.	Usotsuki (usottsuki)	24	72.88	84.87	5	20.83
11891.	Arthur (s4kko_)	24	49.36	62.05	0	0.00
11892.	Smac (smacpats)	24	103.33	117.70	8	33.33
11893.	Sijiur (Rohingya) (sijiur)	24	33.21	41.04	4	16.67
11894.	Rachel (purplerhythm)	24	52.41	61.64	6	25.00
11895.	jodie (jodieodieodie)	24	45.87	64.38	0	0.00
11896.	Hell (killsohard)	24	65.79	82.02	13	54.17
11897.	Ananyobrata (ananyo141)	24	64.39	74.56	5	20.83
11898.	Gnomes (gnomes_)	24	59.54	71.97	3	12.50
11899.	Bolio (killerjimt)	24	38.29	47.48	1	4.17
11900.	Apperentice (kkfarhan23)	24	43.05	52.71	1	4.17
11901.	Nick (darknitexbl)	24	50.68	65.42	2	8.33
11902.	Haseeb (redhaseeb)	24	88.26	102.40	8	33.33
11903.	Khushank (khushsaini)	24	43.85	51.06	2	8.33
11904.	Daniel (danield3176)	24	82.83	98.83	7	29.17
11905.	Ghal (ghal_dj)	24	98.95	117.96	9	37.50
11906.	Diego (perroabuelo)	24	47.85	60.69	3	12.50
11907.	Kai (kai_phoenix)	24	52.54	65.05	4	16.67
11908.	ryxn (ryanwithax)	24	43.91	52.01	1	4.17
11909.	Pax (paxx94)	24	65.22	87.30	7	29.17
11910.	corny (cornyjacobie)	24	70.61	88.94	22	91.67
11911.	Jeremy (geekjeremy)	24	64.17	74.29	8	33.33
11912.	Sumreen (sumreenr)	24	93.18	138.72	7	29.17
11913.	Arunava (wizardio)	24	53.57	67.22	3	12.50
11914.	Paulo (paulobacelar)	24	79.11	91.28	7	29.17
11915.	Abhinav (kodeabhi)	24	49.37	62.23	1	4.17
11916.	Olivia (b00bs69)	24	56.95	68.26	6	25.00
11917.	ad (adex69)	24	53.69	63.42	3	12.50
11918.	Anupam (anupammajhi)	24	47.07	53.76	4	16.67
11919.	Cabbage (cabbage_)	24	82.65	101.08	8	33.33
11920.	fr33ak (fr33ak)	24	63.77	73.96	5	20.83
11921.	Chidum (flashstriker007)	24	58.61	79.08	4	16.67
11922.	Alan (fireslayer1090)	24	78.51	91.78	5	20.83
11923.	Filip (finicky_)	24	71.65	91.15	7	29.17
11924.	fiaz (fiazmahmud)	24	48.87	57.71	4	16.67
11925.	frank (fastfingersfrank)	24	116.56	137.60	12	50.00
11926.	Famesh (fampatel)	24	92.74	120.96	8	33.33
11927.	ExpensiveDinner (expensived...	24	113.72	131.93	8	33.33
11928.	Memes (ethanlee70)	24	93.51	114.12	9	37.50
11929.	Advait (epik_guy1)	24	95.25	113.41	7	29.17
11930.	Matts (emzee_a)	24	73.27	86.74	8	33.33
11931.	Aviv (el_duckino)	24	76.52	95.29	9	37.50
11932.	Ellis (ellismk123)	24	64.40	74.17	3	12.50
11933.	ELGstud (elg_stud)	24	46.02	58.15	2	8.33
11934.	dxriuz_dvorak (dxriuzdvorak)	24	43.47	51.24	4	16.67
11935.	dugnutt (dugnutt)	24	65.63	77.38	6	25.00
11936.	DTConks (dtconks)	24	75.96	93.58	6	25.00
11937.	aaron (doxxa)	24	125.72	140.91	12	50.00
11938.	Mangekyou (double_mangekyou)	24	108.04	131.85	13	54.17
11939.	Damn kid (dezzer_legend)	24	88.33	101.94	9	37.50
11940.	Dairy (derryne)	24	76.04	88.27	9	37.50
11941.	Alish (dek_u)	24	85.45	106.09	9	37.50
11942.	Beaster (deeznutshagotch)	24	113.57	132.84	14	58.33
11943.	Dave (davidneymar)	24	41.52	49.83	0	0.00
11944.	sourabh (datikas)	24	63.67	69.33	5	20.83
11945.	Darth (darthhideoustheugly)	24	74.28	82.49	6	25.00
11946.	sweet chili (darinoee)	24	119.17	137.10	20	83.33
11947.	Dan (danisoz12)	24	95.22	111.24	12	50.00
11948.	Cyrus (cyrusnthng)	24	45.46	59.36	2	8.33
11949.	Cyptre (cyptre)	24	59.10	77.64	6	25.00
11950.	Jonah (cuz_im_batman)	24	66.36	86.85	5	20.83
11951.	Controller Player (countarc...	24	69.97	88.66	7	29.17
11952.	voopx (coopnorth)	24	67.78	87.05	5	20.83
11953.	Azzy (clavanonoyes)	24	57.11	65.30	1	4.17
11954.	(っ◔◡◔)っ ♥ Tyoma...	24	86.54	93.48	7	29.17
11955.	Charlie (charlibre)	24	85.03	107.31	8	33.33
11956.	Celest (celestialpha)	24	46.69	61.26	3	12.50
11957.	Henry (ceeefore)	24	67.78	81.57	3	12.50
11958.	Christian (cbc2508)	24	93.72	113.33	12	50.00
11959.	Cau Be (caubelangthang)	24	93.49	111.02	10	41.67
11960.	Carlo (carlofernandez)	24	72.39	86.73	5	20.83
11961.	Christian (cardonacx)	24	73.01	88.45	10	41.67
11962.	cam (cam69)	24	80.98	100.23	13	54.17
11963.	Burr (burrasaurs)	24	76.29	97.72	10	41.67
11964.	Please use an appropriate n...	24	73.46	85.63	4	16.67
11965.	v0rtex- (bouraoui)	24	66.64	75.47	8	33.33
11966.	Sand (bizzarehuman)	24	58.16	70.20	3	12.50
11967.	bindyy (bindyy)	24	116.48	136.98	16	66.67
11968.	Bill (bill_slouch)	24	95.94	118.64	11	45.83
11969.	Lucky (bigowlyeyes)	24	100.16	112.93	7	29.17
11970.	Benjamin (ben_jam_in_franklin)	24	79.27	95.57	3	12.50
11971.	Bea (bearainbow)	24	84.38	100.32	6	25.00
11972.	Brandon (bandantran)	24	105.46	128.80	12	50.00
11973.	baha (bahakz)	24	89.98	101.85	9	37.50
11974.	Bacte (bacte73)	24	74.87	86.26	9	37.50
11975.	Aaron (ayildiztas)	24	60.19	77.03	2	8.33
11976.	(aus10_)	24	125.53	142.02	18	75.00
11977.	Ashraful (ashraful_alam)	24	54.63	65.51	3	12.50
11978.	Dark (arunabh_kalita)	24	48.40	57.61	4	16.67
11979.	Даниел (freewaydani)	23	99.22	122.03	13	56.52
11980.	Floixman (floixman)	23	90.17	110.65	11	47.83
11981.	James (fisher_man08)	23	36.10	41.98	2	8.70
11982.	Dan (fireliar)	23	72.18	79.24	3	13.04
11983.	Jimrey (filipinoboi)	23	82.78	108.07	8	34.78
11984.	Fiha (fiha16)	23	59.01	71.53	11	47.83
11985.	Mercapto (fast_typer10)	23	48.45	63.92	1	4.35
11986.	wuque pink (exanta)	23	95.57	122.83	7	30.43
11987.	Muhammad (exampz)	23	64.88	81.70	4	17.39
11988.	Danny (evolt)	23	66.52	79.73	6	26.09
11989.	Theodore (erodoeht)	23	93.59	111.28	8	34.78
11990.	Eragon (eragon_kaizen)	23	29.50	44.11	4	17.39
11991.	Yihoi (equation)	23	103.49	117.20	15	65.22
11992.	Alex (epintus)	23	95.87	112.67	12	52.17
11993.	KaoruLikesMakotoYukiTooMuch...	23	65.63	79.01	5	21.74
11994.	Eliana (elianaswagmama)	23	79.74	104.01	10	43.48
11995.	Michael (eilreivax)	23	101.20	117.91	4	17.39
11996.	fwEWE (edward3001)	23	101.29	134.56	18	78.26
11997.	D (d_4biden1)	23	95.58	107.47	4	17.39
11998.	Raghupati (double_toned)	23	65.79	76.35	8	34.78
11999.	kaatak_kataak (doggie0985)	23	75.82	97.69	7	30.43
12000.	DFA (dj2119)	23	102.69	123.25	9	39.13
12001.	Devin (distortedharmony)	23	97.36	125.34	11	47.83
12002.	Dimitar (dimitar2424)	23	93.64	111.23	12	52.17
12003.	Dillon (dillon147852)	23	67.18	80.28	7	30.43
12004.	no ring finger (denebaltair)	23	128.61	145.74	15	65.22
12005.	Lulu (def__init__)	23	84.24	101.67	6	26.09
12006.	Daryll (daryll_ko)	23	96.48	110.29	13	56.52
12007.	dawdad (darkschore)	23	102.26	116.38	12	52.17
12008.	lalit (daredevil_5859)	23	66.23	90.40	6	26.09
12009.	Dnyanendra (danyk_16)	23	68.47	80.39	6	26.09
12010.	Danger Guy (dangerguy)	23	95.11	116.06	9	39.13
12011.	Dan (danclevia)	23	65.70	70.93	4	17.39
12012.	cynthia (cynthiween)	23	58.19	69.99	6	26.09
12013.	cuong (cuongbt91)	23	84.24	92.52	8	34.78
12014.	Ari (cuda_)	23	90.43	105.57	10	43.48
12015.	jurc (cruj)	23	43.97	51.92	2	8.70
12016.	copter28 (copter28)	23	85.82	104.20	9	39.13
12017.	Rony (cleff)	23	102.14	125.57	22	95.65
12018.	CHi (chiyippi)	23	41.69	54.33	3	13.04
12019.	Chez (chezdude)	23	93.10	103.65	12	52.17
12020.	Char (char_meleon)	23	87.21	108.28	5	21.74
12021.	lixir (catjam)	23	42.68	57.23	2	8.70
12022.	cathating89-dvorak (cathati...	23	92.34	116.60	7	30.43
12023.	Obama (captnawesome)	23	73.34	84.29	6	26.09
12024.	capo (caporv)	23	95.06	108.50	9	39.13
12025.	Malupet si (bugret)	23	66.60	80.73	9	39.13
12026.	Bree (briannanimal)	23	68.89	87.37	11	47.83
12027.	Bread (bread_store)	23	85.55	102.27	5	21.74
12028.	Bodzio (boguslav)	23	73.43	84.22	9	39.13
12029.	bobaglow (boabglow)	23	75.24	94.87	3	13.04
12030.	Figo (bmfc4444)	23	72.57	88.64	6	26.09
12031.	Gaurav (blockcipherr)	23	50.47	62.49	1	4.35
12032.	blandfoodman (blandfoodman)	23	68.48	83.20	6	26.09
12033.	Blaku (blaku03)	23	64.26	75.66	10	43.48
12034.	type beats (blackjack245)	23	80.31	99.10	9	39.13
12035.	Sean (bigdinky)	23	123.94	145.59	13	56.52
12036.	BigBoiB (bigboib)	23	63.79	70.28	5	21.74
12037.	BrocK (bhagvat17)	23	47.46	55.63	0	0.00
12038.	BigDiqSix9 (bernazrei69)	23	89.05	105.44	10	43.48
12039.	Chicken (bbqsauceonmytitties)	23	86.85	103.33	9	39.13
12040.	TheGod (bboytheqt)	23	72.07	83.34	7	30.43
12041.	Rohan (barney564)	23	72.80	85.29	10	43.48
12042.	bambam (bambamshazam)	23	76.06	86.53	8	34.78
12043.	Grace (baddestbich69)	23	89.83	101.59	6	26.09
12044.	A.S.M.777 (a_s_m_777)	23	84.39	102.56	7	30.43
12045.	Ayera (ayera_04)	23	48.02	55.03	2	8.70
12046.	Aubrey (awbrey)	23	44.11	59.96	2	8.70
12047.	Andrew (awand0806)	23	111.45	129.11	13	56.52
12048.	fast_and_curious (asimali246)	23	94.99	109.94	7	30.43
12049.	asdf (asdfdsasdfdsasdf)	23	43.93	53.89	2	8.70
12050.	Toby (_toblerone_)	23	78.56	97.86	5	21.74
12051.	Yuudai (zilchdear)	23	46.84	54.53	2	8.70
12052.	maciek (zadtrie)	23	71.42	91.85	8	34.78
12053.	Yarnell (ytoei)	23	75.57	92.09	5	21.74
12054.	Yelnur (ye1nur)	23	48.54	56.06	4	17.39
12055.	craster (yaboiedgy)	23	82.44	96.16	11	47.83
12056.	Kevin (xertheon)	23	108.57	129.11	7	30.43
12057.	xCocoaCrazy (xcocoacrazy)	23	75.08	93.17	9	39.13
12058.	tstats[wimbleimble] (wimble...	23	94.55	122.00	5	21.74
12059.	Georgios (vlassonio)	23	53.59	64.12	5	21.74
12060.	BadTyper (very_really_bad_t...	23	43.56	50.40	3	13.04
12061.	Varun (varuns924)	23	82.79	105.18	6	26.09
12062.	uuind (uuind)	23	117.66	134.81	11	47.83
12063.	Aaron (unrealapex)	23	82.59	102.30	11	47.83
12064.	andrei (uncleandre)	23	88.08	119.52	8	34.78
12065.	speed420 (uhfees)	23	59.01	71.97	2	8.70
12066.	Jotaro (udetha)	23	86.48	106.69	6	26.09
12067.	Uddi (uddi_racer19)	23	49.63	63.28	2	8.70
12068.	Sorin (tur7le0010)	23	97.38	119.31	14	60.87
12069.	Tselmeg (tselmegkh)	23	101.67	126.54	15	65.22
12070.	Hao (truonganhhao)	23	87.45	107.82	8	34.78
12071.	Sheraz (toruowo)	23	87.39	109.15	8	34.78
12072.	Aj (toppingsplease)	23	99.22	107.59	11	47.83
12073.	tobia (tobiabig)	23	52.48	61.88	3	13.04
12074.	Stray (tiemevanderhoek)	23	50.18	67.84	6	26.09
12075.	bob (thot_slayer420)	23	90.78	107.58	3	13.04
12076.	Thor (thorthegodoflightning)	23	38.96	53.92	1	4.35
12077.	SenPIe (thesenpie)	23	75.24	88.77	5	21.74
12078.	Natapon (tetracarboxylic)	23	75.94	84.84	4	17.39
12079.	Tayyab (tayyabismail149)	23	50.60	65.69	7	30.43
12080.	Tandy (tandysu)	23	107.46	134.62	12	52.17
12081.	syswinh (syswinh)	23	89.95	103.65	9	39.13
12082.	Steve (stevocat)	23	68.55	80.20	12	52.17
12083.	Turtle (stevetheturtle)	23	76.32	86.07	5	21.74
12084.	Cássio (ssscassio)	23	80.70	91.47	3	13.04
12085.	Fite (squidderp)	23	90.35	107.36	7	30.43
12086.	devansh (speedcuber05)	23	45.27	54.06	4	17.39
12087.	spectrophobia (spectrophobia)	23	38.95	51.19	1	4.35
12088.	Slim (slimkevin)	23	60.00	67.03	4	17.39
12089.	Dkippy (sirdunklenutsiii)	23	92.39	108.47	6	26.09
12090.	Roi (sibo532)	23	86.54	102.02	6	26.09
12091.	shebaw (shebaw)	23	97.19	115.28	7	30.43
12092.	Justin (shaowen)	23	118.31	131.49	12	52.17
12093.	shanranran (shanranran)	23	93.91	111.23	7	30.43
12094.	Shamim (shamimiqram)	23	56.86	68.83	3	13.04
12095.	Mazze (shadyone)	23	74.35	86.87	10	43.48
12096.	oShado (shadowwalker15)	23	87.20	108.25	6	26.09
12097.	Sebastian (sfmiguez)	23	96.99	127.37	9	39.13
12098.	Ellie (senimoo)	23	116.68	150.67	11	47.83
12099.	Kayden (semitart)	23	49.19	59.08	4	17.39
12100.	John (seaofnonsense)	23	99.40	118.28	10	43.48
12101.	scsdawg (scsdawg)	23	77.75	102.55	5	21.74
12102.	Yuan (lydxlx)	23	123.54	130.87	4	17.39
12103.	lunarised (lunarised)	23	62.67	71.71	7	30.43
12104.	Lumberjack (lumberpython)	23	89.48	109.43	7	30.43
12105.	Lucas (lucasppestana)	23	66.77	83.21	5	21.74
12106.	Potato (lovlieice)	23	95.54	119.07	13	56.52
12107.	sarang (lovejoy)	23	54.30	63.10	1	4.35
12108.	Minwoo (lotuszero)	23	66.39	78.64	3	13.04
12109.	Carlos (lagoon_monster)	23	80.47	90.44	6	26.09
12110.	laamiya (laamiya)	23	43.11	49.09	2	8.70
12111.	Kyle (kyleoh)	23	90.19	106.11	9	39.13
12112.	krishna (krishnad)	23	74.14	86.54	2	8.70
12113.	Miko (kimonoso)	23	87.61	102.17	8	34.78
12114.	ye ye (kermatt3)	23	92.85	130.16	10	43.48
12115.	kalirocketdev (kalirocketdev)	23	64.26	83.78	5	21.74
12116.	Eman (kaido187)	23	48.47	60.13	3	13.04
12117.	Jem (j_enchev)	23	78.65	91.00	5	21.74
12118.	Justine (justine_02003)	23	47.42	61.22	1	4.35
12119.	Foolish (justashish4556)	23	59.28	66.86	8	34.78
12120.	Joel (jsandyt9)	23	91.17	111.29	5	21.74
12121.	Jon (jrowephoto)	23	94.38	125.48	7	30.43
12122.	Johanna (johanna9813)	23	81.65	91.67	8	34.78
12123.	Jiang (jghjianghan)	23	85.73	109.53	6	26.09
12124.	Jacobi (jevtrout)	23	64.82	77.03	5	21.74
12125.	CommanderJiJi (jeromealmogu...	23	54.93	67.14	3	13.04
12126.	McVitie’s (jdfjdghnjdjdf)	23	51.70	64.74	4	17.39
12127.	Jc (jcamp0)	23	66.42	79.00	7	30.43
12128.	Andre (jahraccoon69)	23	103.57	115.33	10	43.48
12129.	Jahir (jahir___)	23	58.31	72.42	6	26.09
12130.	Jerry (j27smith)	23	70.11	100.86	5	21.74
12131.	JoY (j0y_y)	23	73.14	86.50	4	17.39
12132.	ISeeRed (iseered)	23	62.59	73.92	5	21.74
12133.	IRDunno (irdunno)	23	57.91	70.18	7	30.43
12134.	ilman (ilmannafj)	23	35.49	40.97	1	4.35
12135.	Splitslayer Chill (ikramnisar)	23	50.39	68.04	5	21.74
12136.	Devanshu (iamdevanshu)	23	50.26	55.88	3	13.04
12137.	WiteLightningHWD (hwds1)	23	73.98	99.26	7	30.43
12138.	Michael (hulkmagnet)	23	87.96	99.42	6	26.09
12139.	asian (hugeterror)	23	72.38	88.52	5	21.74
12140.	Heino (hsirvio)	23	107.90	117.42	16	69.57
12141.	House (houses)	23	81.79	96.42	3	13.04
12142.	James (hot_panty_dropper)	23	94.74	104.77	5	21.74
12143.	stand with russia (hellofki...	23	71.58	82.20	9	39.13
12144.	heehee (heehee2)	23	55.06	70.12	2	8.70
12145.	hau (hau1228)	23	73.30	93.59	5	21.74
12146.	Hani (hanibchl)	23	73.52	88.05	9	39.13
12147.	HallowSamurai (hallowsamurai)	23	32.77	38.56	1	4.35
12148.	gog (guanquan)	23	80.07	96.45	12	52.17
12149.	Johnny (gonzales_x_dumpy)	23	114.43	131.08	11	47.83
12150.	geo (geomateyt)	23	55.13	68.85	20	86.96
12151.	Geirdriful (geirdriful)	23	81.63	99.21	4	17.39
12152.	GameChaos (game_chaos)	23	97.52	113.15	9	39.13
12153.	Gotcha (g0tcha)	23	90.51	116.77	7	30.43
12154.	G Dragon (g.w.l.griffiths@b...	23	63.08	76.97	5	21.74
12155.	F u r u y á (furuya)	23	110.67	129.36	10	43.48
12156.	santi (santimcc)	23	61.44	69.22	2	8.70
12157.	Sameer Gupta (sammyonswitch)	23	72.44	85.09	4	17.39
12158.	Chris (s3r4ph)	23	45.49	59.01	2	8.70
12159.	Lukas (s018296)	23	108.94	124.90	12	52.17
12160.	NotRyan (ryantheexiled)	23	98.57	123.41	11	47.83
12161.	justin (rold_jisas)	23	80.12	91.40	5	21.74
12162.	richardhead (richardhed)	23	123.35	148.55	13	56.52
12163.	Kyle (rexi_typed_you)	23	60.79	69.06	13	56.52
12164.	Remark (remark21)	23	76.50	86.85	8	34.78
12165.	Reflex1on (reflexion)	23	91.44	113.63	7	30.43
12166.	RedXIII (red_xiii)	23	81.95	94.40	7	30.43
12167.	¯\_(ツ)_/¯ (raredutchkil...	23	85.05	103.87	6	26.09
12168.	Rajesh (rajeshpanjiyar)	23	41.95	51.41	3	13.04
12169.	R4ven (r4ven)	23	80.73	94.83	4	17.39
12170.	Adrian (r3ko5)	23	81.20	98.50	4	17.39
12171.	Hayden (r1plee)	23	72.21	94.04	8	34.78
12172.	qtq🐇🍊🍰 (qtqtq)	23	91.16	103.48	5	21.74
12173.	Jacob (q2q1wwe)	23	82.98	96.92	6	26.09
12174.	Trent (priyank45)	23	83.09	109.37	14	60.87
12175.	Pritom (pritom_99)	23	56.53	67.80	4	17.39
12176.	Nobody (pengfire)	23	95.39	116.62	10	43.48
12177.	Peanut (peanutpocket)	23	119.70	135.69	8	34.78
12178.	paffy (paffy77)	23	87.75	103.31	8	34.78
12179.	Paddy (paddyclohessy12)	23	68.99	81.21	7	30.43
12180.	P00nsl4y3r (p00nsl4y3r)	23	64.39	76.17	4	17.39
12181.	hi lol (overdosednq)	23	126.70	158.63	17	73.91
12182.	Osfbro (osfbroofficial)	23	44.73	52.14	3	13.04
12183.	أُمنية (omnitypewriter)	23	86.42	105.44	6	26.09
12184.	Bakdauet (omir)	23	53.38	63.11	2	8.70
12185.	Ojal (ojhhhal)	23	96.26	105.89	6	26.09
12186.	Nicholas (nxcholas)	23	80.85	89.97	6	26.09
12187.	Nuboo (nuboo)	23	117.15	142.94	14	60.87
12188.	Kian (noob123af)	23	61.26	73.06	3	13.04
12189.	noob (nonquitburner)	23	125.11	146.23	10	43.48
12190.	Nesto (nesto2042)	23	72.44	91.45	2	8.70
12191.	Tijme (nemjit)	23	70.26	83.55	4	17.39
12192.	Neeraj (neeraj_kumar_coder)	23	77.32	93.18	4	17.39
12193.	Stephanie (naderly)	23	76.46	85.93	4	17.39
12194.	Murad (muradeliyev)	23	69.01	82.24	8	34.78
12195.	Hugh (mrpiface101)	23	109.38	124.66	11	47.83
12196.	Max (mpschorr)	23	94.86	111.25	2	8.70
12197.	Max (mpegasus)	23	97.94	107.43	8	34.78
12198.	Moy (moy231)	23	72.33	83.90	6	26.09
12199.	Anton (mojo98)	23	67.63	91.28	6	26.09
12200.	Tom (mlgplayer)	23	90.44	109.65	7	30.43
12201.	Mimsqueeze (mimsqueeze)	23	75.56	94.60	6	26.09
12202.	Mike (mike_shen)	23	96.70	115.75	10	43.48
12203.	Mike (micko34)	23	86.52	116.26	5	21.74
12204.	Barry Allan (messylingard)	23	69.75	80.82	3	13.04
12205.	amy (mesemi)	23	98.36	115.40	12	52.17
12206.	Caleb (meow4562)	23	88.75	106.76	5	21.74
12207.	Faruk (megaracer_faruk17)	23	89.42	106.35	10	43.48
12208.	Maestro (meessus)	23	104.19	131.62	20	86.96
12209.	MaxMul (maxmul)	23	83.22	106.89	11	47.83
12210.	Max (maxmeza)	23	80.63	99.01	6	26.09
12211.	Matthew (matthew_hall2)	23	95.93	119.11	6	26.09
12212.	Makhambet (markiz)	23	76.70	94.37	4	17.39
12213.	Marcus (marcus_t)	23	68.81	78.41	5	21.74
12214.	Manzood (manzood)	23	83.14	93.34	7	30.43
12215.	Mangopod (mangopod_)	23	62.49	75.50	6	26.09
12216.	Capricorn (mangosquirrel)	23	105.95	119.65	9	39.13
12217.	Arif (arif224)	23	67.57	78.65	7	30.43
12218.	Anduin (anduin2017)	23	85.75	97.34	6	26.09
12219.	an0ma1y (an0ma1y)	23	92.59	107.97	9	39.13
12220.	Asir Mosaddek (amsakib)	23	64.98	78.36	16	69.57
12221.	alieb (alieb)	23	122.95	151.74	14	60.87
12222.	Coolman (alibekesanov)	23	57.87	70.58	3	13.04
12223.	Aiman (aiman_a)	23	97.84	110.38	10	43.48
12224.	Ian (agenti23)	23	111.18	127.96	11	47.83
12225.	(accelerated)	23	132.06	150.16	18	78.26
12226.	Abhishek (abhi_bharti)	23	48.62	60.93	2	8.70
12227.	abelrobot (abelrobot)	23	86.72	104.85	7	30.43
12228.	Aarif (aarif_a)	23	85.94	99.37	5	21.74
12229.	Wolfie (aaradhya10)	23	80.37	95.30	15	65.22
12230.	Andrei (aandreixon)	23	81.18	95.37	6	26.09
12231.	I'm stuck (666769)	23	78.54	93.34	5	21.74
12232.	mm (613sadnesses)	23	143.84	171.05	15	65.22
12233.	Angelo (2teletabiez)	23	66.60	78.87	3	13.04
12234.	_ (2sloww)	23	62.41	72.21	4	17.39
12235.	Hugo (21039)	23	62.37	73.88	4	17.39
12236.	Kevin (1kevstahz)	23	98.55	118.09	16	69.57
12237.	10 (10thetypist)	23	78.44	88.28	4	17.39
12238.	Ben (01ben10)	23	89.98	108.67	6	26.09
12239.	Zakaria (zakariaarzoo)	23	54.60	63.85	5	21.74
12240.	musavir (musa_2020)	23	43.04	49.64	3	13.04
12241.	Geoffrey (cybrxt)	23	76.62	89.56	18	78.26
12242.	Kevin (aightwhoshitmyself)	23	77.16	92.51	6	26.09
12243.	Aldan (aldany)	23	73.83	89.01	7	30.43
12244.	samarth joel (samjrin)	23	47.88	57.97	3	13.04
12245.	Tommy (tomister99)	23	68.86	80.02	7	30.43
12246.	Kerele (kerele)	23	90.45	104.20	12	52.17
12247.	Abir (abir247)	23	57.84	79.82	4	17.39
12248.	Bas (bas_hoeflaak)	23	77.02	89.55	7	30.43
12249.	Jake (jake_craven)	23	57.35	69.82	4	17.39
12250.	Michael (zmjcb)	23	65.76	82.11	6	26.09
12251.	Spider (spidey13)	23	57.90	73.19	7	30.43
12252.	Dredd (dredd20)	23	67.39	87.32	9	39.13
12253.	Maltha (malthazen)	23	52.25	64.08	1	4.35
12254.	Lezzgo (romsky1)	23	42.12	50.02	2	8.70
12255.	Anudari (anuka01)	23	51.76	62.82	0	0.00
12256.	Lesley (powerchopper)	23	81.04	99.42	7	30.43
12257.	J D (2ralph2)	23	78.52	95.97	23	100.00
12258.	Parsa (pblague)	23	51.20	64.42	2	8.70
12259.	Mohanad (nogaf)	23	64.70	71.79	4	17.39
12260.	EATMYDUST (bwisus)	23	70.11	82.14	10	43.48
12261.	eren (eren_lee)	23	35.07	41.98	1	4.35
12262.	Christian (mista_chris)	23	38.46	52.53	14	60.87
12263.	JULIANA (siwon22)	23	60.90	73.96	4	17.39
12264.	fusekle2226 (fusekle2226)	23	36.18	43.43	0	0.00
12265.	Alex (alexkov)	23	48.89	57.33	4	17.39
12266.	Nik (nikb89)	23	35.02	47.09	2	8.70
12267.	geczy (barnageci)	23	98.68	124.85	9	39.13
12268.	Nay (naykuku228)	23	58.44	66.76	6	26.09
12269.	Kevin (klinklang)	23	76.06	87.19	7	30.43
12270.	munna (munna13)	23	48.82	59.04	1	4.35
12271.	Airidas (airisr)	23	75.65	87.57	4	17.39
12272.	anu (_anu)	23	33.59	41.23	0	0.00
12273.	No (jsonwg)	23	92.67	113.04	10	43.48
12274.	Armaan_Gill (armaan_gill)	22	66.14	77.47	4	18.18
12275.	FreeHongKong (aquaficial)	22	106.55	130.75	7	31.82
12276.	Antonio (antonio_blueballs)	22	64.85	77.25	6	27.27
12277.	Annabelle (annaballlzz)	22	84.39	96.57	4	18.18
12278.	Anas (anas023)	22	25.22	34.36	7	31.82
12279.	Ana Beatriz (anaporumtriz)	22	43.37	50.26	3	13.64
12280.	tstats[an1ma] (an1ma)	22	46.13	57.44	2	9.09
12281.	area_51 (amritspkt65)	22	62.35	76.13	5	22.73
12282.	poorjar (amgminequality)	22	113.26	133.05	9	40.91
12283.	slippedfinger (alpha_centauri)	22	68.02	78.73	4	18.18
12284.	Jack (alphamale28)	22	98.20	124.58	3	13.64
12285.	Jason (alfa871212)	22	47.86	57.44	5	22.73
12286.	Alex (alexrichardson)	22	51.75	62.18	3	13.64
12287.	Aleksa (aleksa55)	22	66.00	82.61	4	18.18
12288.	Arpit (ak_31loaded)	22	43.64	50.14	2	9.09
12289.	Aids (aids___)	22	98.46	107.91	5	22.73
12290.	Ahnta (ahnta)	22	68.10	80.16	3	13.64
12291.	MD ADNAN (adnantech17)	22	67.30	74.11	3	13.64
12292.	7tysins (acedragonheart)	22	85.62	99.25	9	40.91
12293.	ABHISHEK PATEL (abhi_0601)	22	40.97	54.76	3	13.64
12294.	Abhishek (abhishake12201)	22	40.09	56.72	3	13.64
12295.	Ballistic (8a11istic)	22	70.81	78.96	7	31.82
12296.	Juice (4804210474)	22	66.64	83.91	4	18.18
12297.	Emman (3mm4n)	22	59.78	69.58	6	27.27
12298.	Raggy (a11owed)	22	102.02	115.37	16	72.73
12299.	vi (vipandas)	22	83.37	103.00	10	45.45
12300.	tudgengthorf (tudgengthorf)	22	77.64	93.27	4	18.18
12301.	John (johnwenshoe)	22	95.93	117.96	13	59.09
12302.	Kuya JJ (kuya_jj)	22	48.12	59.97	3	13.64
12303.	Rene (reniaraq)	22	47.20	62.00	15	68.18
12304.	Bryce (bryce4)	22	87.38	105.41	9	40.91
12305.	Isaac (ilikepie3)	22	48.08	60.11	2	9.09
12306.	Cj (emperorblank)	22	48.69	60.44	1	4.55
12307.	Koeliga (koeliga)	22	68.26	78.50	7	31.82
12308.	yo (markus1012)	22	102.79	115.04	12	54.55
12309.	john (joahuaj)	22	35.83	44.18	1	4.55
12310.	wang (wangcai)	22	40.23	48.01	2	9.09
12311.	max (vezorack)	22	53.12	60.99	3	13.64
12312.	reiyashi (reiyashi)	22	108.18	119.89	9	40.91
12313.	Metal09 (metal09)	22	46.62	56.15	1	4.55
12314.	cring (cringeman10021)	22	62.72	76.35	6	27.27
12315.	jozz (danishbun)	22	39.63	53.02	2	9.09
12316.	Tobi (ohcibi)	22	84.85	105.80	8	36.36
12317.	inzemamul (inzi2004)	22	47.54	57.55	3	13.64
12318.	Joey (saria_calla)	22	31.74	38.45	1	4.55
12319.	Nick (envynav)	22	60.69	67.25	4	18.18
12320.	Madelaine (madelaineriddle)	22	54.14	61.95	11	50.00
12321.	cr1xzs (cr1xzs)	22	63.46	73.04	3	13.64
12322.	ali_mehdi (syedmehtab2125)	22	44.49	52.07	1	4.55
12323.	Kevin (kevinchangjk)	22	67.53	86.02	6	27.27
12324.	Dimitar (dnonov)	22	59.17	65.77	2	9.09
12325.	Gotta go (mattjl)	22	107.05	116.17	15	68.18
12326.	Abhishek (abhig)	22	57.18	67.46	4	18.18
12327.	Grandest (grandest)	22	112.13	130.53	12	54.55
12328.	Md (iamtheasad)	22	49.86	59.33	2	9.09
12329.	Arad (aradarbel10)	22	76.76	95.00	7	31.82
12330.	Matt (rapt0rinasuit)	22	48.11	61.72	2	9.09
12331.	Faizan (not_faizan)	22	57.96	77.08	7	31.82
12332.	saugat (typersaugat)	22	44.42	53.31	2	9.09
12333.	Var (varrenleandro)	22	80.37	93.89	9	40.91
12334.	stark16 (stark16)	22	42.26	51.00	1	4.55
12335.	jagraj (jagraj)	22	59.87	68.73	4	18.18
12336.	Zac (kingkapitolz)	22	56.49	70.61	5	22.73
12337.	Lohiek (lohiek)	22	79.66	91.31	22	100.00
12338.	Mahdi (mahdiranjbar)	22	74.88	86.31	1	4.55
12339.	chie (lotusimpact)	22	86.01	110.87	7	31.82
12340.	John (loki83jcg)	22	93.43	111.12	8	36.36
12341.	lokar (lokar123)	22	144.66	178.80	13	59.09
12342.	Tu Thien (logan1912)	22	64.47	77.71	3	13.64
12343.	llihcchill (llihcchill)	22	70.78	84.76	6	27.27
12344.	lulu (llaurenlouise)	22	54.21	64.12	3	13.64
12345.	Liz (lizfrizzle)	22	103.48	133.88	8	36.36
12346.	Light (lighteous_)	22	72.29	94.98	6	27.27
12347.	Licery (licery)	22	61.90	73.75	7	31.82
12348.	lgwk (lgwk)	22	51.89	58.73	0	0.00
12349.	Ryekane🖤 (lechepapu)	22	135.03	164.86	8	36.36
12350.	Lapis (lapis_pislapis)	22	125.74	176.13	15	68.18
12351.	Kumar (kumar_thapa1)	22	78.47	87.01	7	31.82
12352.	krupa (krups)	22	63.68	84.15	3	13.64
12353.	Daniel (korice)	22	92.92	124.00	5	22.73
12354.	Adam (koltaia30)	22	65.61	79.72	8	36.36
12355.	John (kobas)	22	48.14	56.56	1	4.55
12356.	Annabelle (kiwi_punk)	22	64.08	80.59	5	22.73
12357.	Kiki (kiki_)	22	39.86	46.78	0	0.00
12358.	Tushar (kensei22)	22	49.13	54.08	1	4.55
12359.	Kenewbi (kenewbi)	22	71.89	88.57	7	31.82
12360.	Yakhe (ken007)	22	76.50	91.59	10	45.45
12361.	(keegant)	22	152.27	180.56	4	18.18
12362.	Kartavya (kartavyajain)	22	96.75	112.59	11	50.00
12363.	James (karonar)	22	98.06	110.94	6	27.27
12364.	George (karmatimer)	22	73.88	83.44	7	31.82
12365.	Karlsen (karlsenlopez18)	22	90.34	108.98	6	27.27
12366.	Jacob (karagiannis1)	22	56.34	65.64	1	4.55
12367.	Kanzi (kanzi)	22	70.02	80.74	7	31.82
12368.	kage (kage_bigfoot)	22	61.78	74.47	7	31.82
12369.	j (jy22019)	22	55.02	63.28	0	0.00
12370.	Je (jxnnele)	22	56.42	72.57	17	77.27
12371.	jujufrost (jujufrost)	22	73.01	86.19	3	13.64
12372.	JTD845 (jtd845)	22	94.21	107.96	15	68.18
12373.	God (jpaul100)	22	71.94	86.02	6	27.27
12374.	Joy (joyyang810035)	22	87.99	118.20	8	36.36
12375.	Joshua (joshuamtinker)	22	62.31	87.21	3	13.64
12376.	Jordan (jordy2394)	22	41.80	49.40	2	9.09
12377.	Jeydin21 (jeydin21)	22	81.49	101.32	9	40.91
12378.	Jess (jessnixon94)	22	106.75	129.75	7	31.82
12379.	Jen (jenniferrocks07)	22	97.23	115.29	7	31.82
12380.	Jenbi (jenbi)	22	75.89	89.04	3	13.64
12381.	MrKK (jeldikk)	22	72.65	85.64	4	18.18
12382.	J (jduncanlee)	22	106.58	132.33	11	50.00
12383.	jazzy (jazzy_trojan)	22	85.39	102.61	8	36.36
12384.	jantheman (jantheman21)	22	81.99	119.73	21	95.45
12385.	Jack (jackripper9)	22	53.35	78.77	4	18.18
12386.	JackbroDaeGamer (jackbrothe...	22	63.65	75.57	7	31.82
12387.	izzy (izzyy2)	22	42.71	53.34	13	59.09
12388.	Izzy (izzypistilli)	22	78.55	92.93	10	45.45
12389.	kentei (itskentai)	22	67.43	80.27	7	31.82
12390.	Sigh (isigh)	22	93.48	110.71	11	50.00
12391.	InterLude (interlude)	22	101.61	145.49	10	45.45
12392.	ooo (inout)	22	85.69	105.84	7	31.82
12393.	Ignite (ignite777)	22	68.34	86.69	11	50.00
12394.	jay (icantfeel)	22	59.15	70.25	5	22.73
12395.	Abhijith (iabz)	22	56.09	71.82	3	13.64
12396.	Muhammad (hydra_assassin)	22	61.05	71.95	6	27.27
12397.	Josh (hoverdoge)	22	105.89	133.96	10	45.45
12398.	Kay (hothandj)	22	90.64	110.42	4	18.18
12399.	Jose (hosey_)	22	85.38	104.71	5	22.73
12400.	Stefan (hollownaoya)	22	82.09	99.06	4	18.18
12401.	Hekonii (hekonii)	22	82.12	95.63	2	9.09
12402.	Havenix (havenix)	22	74.14	87.97	4	18.18
12403.	Hasan (hasan95)	22	52.07	66.30	1	4.55
12404.	Товарищ (hamkor)	22	85.26	97.15	9	40.91
12405.	fun (haifiveywivey)	22	98.84	118.78	12	54.55
12406.	hack89 (hack89)	22	63.50	68.59	5	22.73
12407.	Michael (grumos)	22	83.06	92.24	5	22.73
12408.	DaTa (good_vibes)	22	73.22	86.49	8	36.36
12409.	Giorillium (goodguygio)	22	73.96	91.86	3	13.64
12410.	🇲🇳 Mazaalai (goodgodk...	22	97.66	117.30	8	36.36
12411.	Jordan (godlysharky)	22	54.19	68.49	1	4.55
12412.	ginteaa (ginteaa)	22	102.74	116.36	7	31.82
12413.	Gijs (gijs__g)	22	72.86	89.63	7	31.82
12414.	gela (gelacutie)	22	38.33	50.77	5	22.73
12415.	George (gbotev)	22	91.04	101.19	8	36.36
12416.	Jordi (gandalfdablack1)	22	69.90	85.23	5	22.73
12417.	Gabriel (gabrielbutu)	22	86.99	102.97	8	36.36
12418.	Ada (fumingadam)	22	93.98	112.64	10	45.45
12419.	Mary (frailmary)	22	83.21	94.18	6	27.27
12420.	Floriaan (floriaanvb)	22	51.10	58.94	1	4.55
12421.	Atticus crunch (fablesnfobb...	22	91.23	114.54	9	40.91
12422.	Elijah (e___)	22	49.63	68.96	1	4.55
12423.	Flusercluck (explocow)	22	78.65	99.84	6	27.27
12424.	Eslam (eslamalien)	22	45.43	54.72	2	9.09
12425.	erka (erkaboy)	22	76.66	92.59	5	22.73
12426.	eric (eric5000)	22	112.38	136.04	16	72.73
12427.	Olivia Scott Welch can run ...	22	108.28	122.26	6	27.27
12428.	Efgeen (efgeen)	22	100.36	129.99	10	45.45
12429.	Eeegh (eeegh)	22	54.61	69.70	2	9.09
12430.	Dustan (dustank)	22	47.99	57.80	1	4.55
12431.	Dullpig (dullpig)	22	70.11	85.49	4	18.18
12432.	Frederik (drlambogamer)	22	76.03	86.46	12	54.55
12433.	doubleplusgood (doubleplusg...	22	76.36	96.66	3	13.64
12434.	Drew (dmart)	22	73.10	88.84	2	9.09
12435.	A (djakl)	22	101.45	114.86	8	36.36
12436.	Terence (dijkstras)	22	94.42	105.52	5	22.73
12437.	Dev (devyadavv)	22	40.99	49.24	0	0.00
12438.	Suktinis (destrain)	22	71.99	85.13	4	18.18
12439.	Be (deathpulse)	22	113.14	133.46	9	40.91
12440.	Daniel (danielyawn)	22	76.46	94.10	2	9.09
12441.	Diego (daigo356)	22	60.75	69.67	6	27.27
12442.	David (d8vidherrera)	22	108.67	131.91	12	54.55
12443.	Could be you (cycosniper)	22	87.69	113.71	6	27.27
12444.	SJ (cwr_sej)	22	80.47	95.47	3	13.64
12445.	Electric (cuitcuit)	22	97.38	114.19	12	54.55
12446.	Stephanie (cuber155)	22	71.63	86.32	7	31.82
12447.	Crims0n (crimsonnn)	22	67.18	77.18	3	13.64
12448.	Martin (crimsonmartin)	22	76.09	86.37	4	18.18
12449.	Roman (cosmic_mythos)	22	51.49	65.98	4	18.18
12450.	a (coolguy73)	22	104.45	124.54	19	86.36
12451.	Nemanja (conemanija)	22	42.20	53.90	2	9.09
12452.	Clemens (cleminator)	22	59.68	66.31	5	22.73
12453.	Murtaza (chichawww)	22	44.95	57.21	1	4.55
12454.	Captain (captainalliance)	22	67.49	80.26	7	31.82
12455.	caesthetis (caesthetis)	22	107.79	128.13	11	50.00
12456.	John (caduke)	22	90.58	115.83	9	40.91
12457.	LUKAS (brabomclaren)	22	76.37	87.20	6	27.27
12458.	Bozsó (bozso)	22	61.75	77.13	5	22.73
12459.	Bolt7911 (bolt7911)	22	52.69	70.04	6	27.27
12460.	Sabba7 (bodynasser)	22	49.08	61.23	3	13.64
12461.	Inferendum (bloonchipper)	22	68.66	95.63	5	22.73
12462.	bo (biznessmun)	22	102.03	116.88	15	68.18
12463.	Adam (bezwzglednyadas)	22	67.91	81.29	6	27.27
12464.	bepis (bepis_pebis)	22	108.94	125.47	8	36.36
12465.	swagb0y (beckseamons)	22	81.17	99.60	6	27.27
12466.	Bailey (bbrusca98)	22	82.51	98.68	6	27.27
12467.	Austin (austinkg)	22	78.85	90.68	3	13.64
12468.	Kevin (ashret)	22	137.70	169.02	19	86.36
12469.	ashl5t (ashl5t)	22	52.80	80.22	18	81.82
12470.	w (artemisfowl3rd)	22	103.89	130.94	11	50.00
12471.	Yashi (_o_wobless)	22	50.47	64.30	2	9.09
12472.	KIRA (_arik_)	22	43.23	49.99	4	18.18
12473.	Ryley (zqroh)	22	59.68	71.13	4	18.18
12474.	Zerieox (zerieox)	22	84.21	105.14	5	22.73
12475.	That One Guy (zbomber21)	22	115.45	142.54	21	95.45
12476.	Eric (yuurrrrr)	22	85.86	95.75	5	22.73
12477.	Brody (yuumi)	22	109.20	135.14	14	63.64
12478.	maro (yenic)	22	64.08	74.52	3	13.64
12479.	Yegor (yegorshevchenko)	22	50.13	58.10	2	9.09
12480.	Yassine (yassinejedidi)	22	69.59	94.63	13	59.09
12481.	Yaroslav (yaros)	22	67.06	77.23	9	40.91
12482.	momo (yaomomo)	22	79.58	94.87	9	40.91
12483.	Xzereath (xzereath)	22	95.59	119.47	11	50.00
12484.	Wattery (xwattery)	22	43.75	53.56	0	0.00
12485.	willybear (willybear)	22	83.79	100.03	5	22.73
12486.	b (whylxve)	22	69.90	84.13	3	13.64
12487.	eqwt (whuhu)	22	113.08	136.02	17	77.27
12488.	Jonas (whatisupyou)	22	115.18	129.92	14	63.64
12489.	vyst (vystoric)	22	129.17	141.71	16	72.73
12490.	Vinit (vspundir)	22	45.68	55.23	1	4.55
12491.	vishnu (visshnu)	22	51.97	62.70	1	4.55
12492.	VibrantVanilla (vibrantvani...	22	78.16	97.13	6	27.27
12493.	Hiren (userhiren)	22	61.01	76.98	6	27.27
12494.	Samay (upadsamay387)	22	77.11	93.07	3	13.64
12495.	Umid (umid2000)	22	66.10	77.89	4	18.18
12496.	Umair (umairkhan)	22	77.96	86.52	7	31.82
12497.	typingboob (typingboob)	22	60.72	71.43	4	18.18
12498.	Sub-Par (typerslower)	22	111.13	121.25	12	54.55
12499.	Rajveer (typerfastboi27_)	22	62.39	85.13	5	22.73
12500.	Triloluc (triloluc)	22	91.05	105.85	11	50.00
12501.	Ohh (trappy24)	22	77.64	97.74	5	22.73
12502.	ucsd_kid (trainermax)	22	157.18	183.32	19	86.36
12503.	Theodor (thimius)	22	86.28	101.63	10	45.45
12504.	Phil (themonk)	22	98.42	118.35	7	31.82
12505.	Chris (themainchris)	22	78.30	90.84	9	40.91
12506.	(thebob2713)	22	60.75	77.24	6	27.27
12507.	temazh (temazh)	22	77.26	90.59	6	27.27
12508.	Caleb (syfulis)	22	91.14	105.63	5	22.73
12509.	Sumnerbean (sumnerbean)	22	60.39	80.14	6	27.27
12510.	Stranger (stranger_danger1224)	22	45.73	62.99	1	4.55
12511.	misty (sprainedartery)	22	95.02	113.58	9	40.91
12512.	Papa (solutional)	22	100.12	122.37	11	50.00
12513.	Alexander (solchild)	22	75.73	85.78	8	36.36
12514.	soda (sodafortwo)	22	72.59	81.35	7	31.82
12515.	RougeGod (socratic74)	22	64.73	71.35	6	27.27
12516.	ki (slutsupreme)	22	103.61	127.97	6	27.27
12517.	green (sleepingducksanddrag...	22	38.89	45.78	2	9.09
12518.	Leah (slanted_sunlight)	22	89.68	99.22	9	40.91
12519.	rai (siomaipusa)	22	83.64	109.85	12	54.55
12520.	simon (simonnoin)	22	64.99	78.06	8	36.36
12521.	Shunrai (shunrai1110)	22	95.27	123.25	9	40.91
12522.	shorty (shortygiant)	22	53.61	65.82	4	18.18
12523.	Shome (shmoe9806)	22	65.43	73.86	5	22.73
12524.	catboy (sheepando)	22	111.23	123.19	7	31.82
12525.	Sheel (sheel)	22	102.48	113.80	12	54.55
12526.	WAKing (shashashane)	22	35.66	43.85	1	4.55
12527.	Shannon (scthemonk)	22	64.65	76.23	5	22.73
12528.	for reckful (savioshadow)	22	95.53	107.49	8	36.36
12529.	SamSkey (samskey)	22	77.68	94.82	7	31.82
12530.	Shabylkhan (saken03)	22	43.80	53.67	3	13.64
12531.	saad (saad88)	22	63.69	69.51	4	18.18
12532.	Felmer (rustycookieee)	22	86.72	96.63	8	36.36
12533.	Vaccination (roughandtumble)	22	94.32	106.16	5	22.73
12534.	Matt (robertwill)	22	53.11	65.01	2	9.09
12535.	road to 100 (roadtoglobalmc)	22	89.47	110.66	6	27.27
12536.	ヤギ (ringtack)	22	107.46	124.21	13	59.09
12537.	Abdulla (rifah99)	22	79.42	89.28	2	9.09
12538.	Ricky (rictsa05)	22	53.00	62.20	2	9.09
12539.	Ricebowl (ricebowljohnson)	22	100.28	121.58	6	27.27
12540.	rg2005 (rg2005)	22	88.34	111.94	8	36.36
12541.	Dan (reddabbler)	22	63.83	83.12	4	18.18
12542.	Ryan (rdem)	22	54.17	65.22	0	0.00
12543.	Rare (rare_0001)	22	69.07	82.52	6	27.27
12544.	Vinchenzo (qwertyuiopps)	22	94.02	112.89	11	50.00
12545.	Qwerty (qwertyazerty)	22	81.74	94.82	7	31.82
12546.	Saumya (quinn_1)	22	42.57	52.66	3	13.64
12547.	Taksa-orn (proudpi)	22	73.44	96.63	3	13.64
12548.	Parsa (pr8222)	22	50.36	59.40	1	4.55
12549.	Alex (poop_guy)	22	85.08	98.32	3	13.64
12550.	Polar (polishpolarbear)	22	86.60	111.42	9	40.91
12551.	adr (poison_pwn)	22	74.34	86.87	2	9.09
12552.	Ross (pogchammp)	22	84.13	111.07	7	31.82
12553.	Pooh (po0h_)	22	35.91	41.97	1	4.55
12554.	pjja (pjja)	22	115.79	145.30	14	63.64
12555.	a1ways (pi___)	22	104.18	127.50	9	40.91
12556.	Silver (pixel47)	22	97.76	112.47	7	31.82
12557.	pinto (pintozza)	22	79.38	92.36	8	36.36
12558.	Pina (pinapelzx)	22	78.50	94.66	5	22.73
12559.	Pedro (pedroarcem)	22	70.23	81.52	1	4.55
12560.	pebble (pebblewebble)	22	85.22	100.32	7	31.82
12561.	Payu (payu_w)	22	82.76	91.26	1	4.55
12562.	Paul (paul1106)	22	66.93	75.52	5	22.73
12563.	Paksolek (paksolek)	22	54.11	67.12	3	13.64
12564.	V (p3rplexed)	22	89.59	109.39	7	31.82
12565.	Overlay1 (overlay1)	22	63.80	72.48	2	9.09
12566.	rotscatpill (orangetinman)	22	65.31	74.83	7	31.82
12567.	nuttendabutt (nuttendabutt)	22	33.31	37.26	2	9.09
12568.	Umidjon (nouser493)	22	56.52	68.89	17	77.27
12569.	wii (nobodylovesraymond)	22	85.19	98.52	7	31.82
12570.	Nischay (nitrospeed2709)	22	71.94	82.60	8	36.36
12571.	Nels (nels_senti)	22	74.17	91.68	9	40.91
12572.	naomi (naomii_)	22	59.94	71.03	5	22.73
12573.	L + (n1ckname152)	22	93.28	111.15	12	54.55
12574.	MrOkapus (mrokapus)	22	61.46	72.13	7	31.82
12575.	Moodrammer (moodrammer)	22	64.39	73.30	5	22.73
12576.	Md. Mojnu (mojnu20)	22	38.91	43.96	2	9.09
12577.	Jacquelyn (mobear06)	22	89.38	115.20	6	27.27
12578.	Matthew (mmeppelink20)	22	97.84	127.06	10	45.45
12579.	Maddy (mlong)	22	101.46	116.75	11	50.00
12580.	Jake (mjakecarlo)	22	72.60	88.75	9	40.91
12581.	Michael (michaelyang)	22	79.20	92.91	5	22.73
12582.	mercy (mercy_13)	22	64.44	77.52	4	18.18
12583.	carlos (mecsczek)	22	105.46	117.89	11	50.00
12584.	Zia (mechatronic_beast)	22	50.46	60.44	2	9.09
12585.	Paul (mcbain788)	22	95.12	111.41	18	81.82
12586.	Max (maxy_boi)	22	59.54	69.60	11	50.00
12587.	rohan (maverick_mind69)	22	77.67	100.86	4	18.18
12588.	Martin (maniacal_martin)	22	72.57	82.83	2	9.09
12589.	Leslie (mamaleslie81)	22	66.02	82.40	4	18.18
12590.	SaltyHobo (saltyhobo)	21	88.53	105.36	6	28.57
12591.	Sharif (sa524402)	21	26.89	37.95	5	23.81
12592.	Rylez (rylezyt)	21	65.98	78.13	7	33.33
12593.	Rory (roricus)	21	72.09	84.29	5	23.81
12594.	ron (ronk17)	21	66.36	73.32	4	19.05
12595.	Rodrigo (rodplaying)	21	47.12	53.06	1	4.76
12596.	Robert (robertgrylls)	21	70.34	83.67	8	38.10
12597.	Hans (retrovibes_11)	21	91.23	105.41	11	52.38
12598.	redhotdancer1821 (redhotdan...	21	97.62	114.59	6	28.57
12599.	Rebekah (rebekahtomski)	21	65.13	74.34	4	19.05
12600.	Rawat (rawat_shiv)	21	43.64	51.01	3	14.29
12601.	Rafail (raphaelpap)	21	68.92	82.57	20	95.24
12602.	Nick (rageemy)	21	102.59	114.32	14	66.67
12603.	Rae (rae149)	21	61.05	79.21	5	23.81
12604.	Zuko (rachet_22)	21	91.30	109.61	7	33.33
12605.	Sebastian (racermaster_)	21	59.55	72.22	2	9.52
12606.	quat (quat)	21	97.79	112.47	7	33.33
12607.	Hung (qhung312)	21	77.38	86.83	4	19.05
12608.	Kong (qbored)	21	47.35	53.83	1	4.76
12609.	Stuart (psephos)	21	93.41	114.47	6	28.57
12610.	Prashant (prashant_204)	21	70.85	92.45	4	19.05
12611.	ตาแดง (pitagorus)	21	88.42	99.17	5	23.81
12612.	Philip (philr12)	21	79.75	91.13	5	23.81
12613.	shea (pengu1927)	21	69.49	82.01	5	23.81
12614.	Peachbird (peachbird)	21	51.38	65.66	6	28.57
12615.	paxuy (paxuy)	21	68.62	80.51	3	14.29
12616.	Patrick (patrick_st4r)	21	65.61	75.66	9	42.86
12617.	boop (owiwchu)	21	63.21	72.16	2	9.52
12618.	FREE PALESTINE (os1506)	21	80.95	92.68	5	23.81
12619.	orangie (orangie_)	21	47.50	57.56	2	9.52
12620.	Adrian (orangebase)	21	131.34	147.57	15	71.43
12621.	Omsin (omsinkrissada)	21	83.00	96.80	8	38.10
12622.	S0R4 (omniores22)	21	94.80	110.64	8	38.10
12623.	Nazmus (nxbot)	21	53.66	64.11	2	9.52
12624.	number1 (number1racer)	21	45.99	54.31	2	9.52
12625.	Nully (nullly)	21	74.79	96.62	5	23.81
12626.	Noxellar (noxellar)	21	93.52	108.09	7	33.33
12627.	William (not_your_username)	21	67.34	92.22	4	19.05
12628.	notkailey (notkailey)	21	85.04	98.50	9	42.86
12629.	noob_master (noob_master_6_9)	21	65.01	74.86	5	23.81
12630.	Nicolai (nicolair222)	21	102.33	114.36	5	23.81
12631.	Nick (nickbanderson)	21	85.87	111.20	12	57.14
12632.	Blac (nice_tea)	21	72.50	93.12	6	28.57
12633.	Narayan (narayan2002)	21	58.85	73.49	16	76.19
12634.	AgniArse (n3ug13rd3)	21	79.67	89.44	5	23.81
12635.	Moataz (mizosoft)	21	77.89	88.08	7	33.33
12636.	Dominik (misiekwiev13)	21	56.79	66.42	2	9.52
12637.	Lior (miliday)	21	42.62	52.07	3	14.29
12638.	Outlaw (midnight_tuna)	21	77.79	97.52	3	14.29
12639.	Michael (michael9009)	21	91.74	126.82	6	28.57
12640.	Muhammad (mhasan01)	21	102.13	113.66	6	28.57
12641.	meme (mememem)	21	90.62	103.78	9	42.86
12642.	invader (megawutt)	21	64.37	75.30	8	38.10
12643.	MZ (mbzz)	21	83.43	99.29	8	38.10
12644.	Mateus (mateusmelo)	21	64.71	77.77	7	33.33
12645.	roee (masterroee3)	21	64.07	80.91	5	23.81
12646.	MasterlyHoney (masterlyhone...	21	48.50	59.55	0	0.00
12647.	Ammar (marsicus)	21	84.41	101.86	10	47.62
12648.	Marcki (marcki)	21	76.20	84.17	4	19.05
12649.	Markus (marcasrealaccount)	21	93.93	105.45	10	47.62
12650.	Mark (maolson97)	21	87.98	107.89	6	28.57
12651.	tstats[mannyblaze] (mannybl...	21	58.17	80.57	3	14.29
12652.	Frederik (freeder1k)	21	61.67	72.48	2	9.52
12653.	Frode (fr0so)	21	59.87	68.70	2	9.52
12654.	Kai Wei (fortissimo)	21	108.06	132.69	12	57.14
12655.	Foqsi (foqsi)	21	102.33	122.45	9	42.86
12656.	Speedy (flux2k)	21	113.14	134.10	12	57.14
12657.	Patty (flappypatty420)	21	66.47	89.11	5	23.81
12658.	Felipe (felipet)	21	85.93	98.76	4	19.05
12659.	Felipe (felipazo_06)	21	57.00	77.43	7	33.33
12660.	this is feimser (feimser)	21	67.78	76.21	8	38.10
12661.	Harry (feeshgang)	21	109.34	127.77	12	57.14
12662.	Ali (fanstic)	21	64.72	74.96	3	14.29
12663.	Fairyball (fairyballyt)	21	85.45	98.80	4	19.05
12664.	Junito (exter72)	21	75.70	97.03	6	28.57
12665.	Mohammed Waseemuddin (ertug...	21	57.08	67.66	5	23.81
12666.	Erie (eridu)	21	76.20	101.65	6	28.57
12667.	Muhammad (entamalomak)	21	69.92	79.60	7	33.33
12668.	emily (emily_chwn)	21	77.13	84.14	2	9.52
12669.	Elmer (elmerr)	21	95.24	105.94	7	33.33
12670.	Elijah (elijahp24)	21	62.44	75.71	5	23.81
12671.	Yaowee (eggyicecream)	21	70.21	82.18	6	28.57
12672.	D1FFeR (ec0426)	21	60.76	77.31	2	9.52
12673.	D1ck F1ngers (d_wratten18)	21	66.42	76.23	6	28.57
12674.	shylingg (dyingllama)	21	109.82	125.47	11	52.38
12675.	Nathanael James (dyemz)	21	87.71	98.70	7	33.33
12676.	Duschi (duschi)	21	93.96	108.30	8	38.10
12677.	K (duhhhhhhhhhhh)	21	87.14	106.22	8	38.10
12678.	Typing (drained_typist)	21	101.27	114.27	11	52.38
12679.	dq (dqmaniac)	21	123.44	139.80	14	66.67
12680.	. (doomslug5)	21	82.55	91.03	4	19.05
12681.	Sardar Taha (dice111)	21	107.66	123.58	9	42.86
12682.	Dexter (dexter2fast)	21	87.75	105.81	8	38.10
12683.	DENYS (denysesjs)	21	100.68	114.35	13	61.90
12684.	Nairi (demerton)	21	78.61	95.43	3	14.29
12685.	Deko (deko_moon)	21	88.57	105.54	8	38.10
12686.	Manye (davemanye)	21	60.32	81.18	8	38.10
12687.	Daulet (daukabase)	21	62.79	76.99	3	14.29
12688.	Chris (datapointchris)	21	85.61	102.99	5	23.81
12689.	balzac (dasbalzac)	21	31.63	38.12	3	14.29
12690.	DarkWinterFurry (darkwinter...	21	80.50	96.63	6	28.57
12691.	dannsy (dannsy)	21	101.54	115.13	8	38.10
12692.	Ryan (dandaflaff)	21	45.39	58.45	2	9.52
12693.	Damian (damianm8)	21	76.84	86.71	6	28.57
12694.	Aishiteru (daedalus__)	21	79.16	96.03	11	52.38
12695.	cuzimogni (cuzimogni)	21	67.42	76.32	1	4.76
12696.	cuppajoeman.com (cuppajoeman)	21	95.25	109.17	8	38.10
12697.	Clement (clement_ps)	21	107.44	129.20	6	28.57
12698.	Akhil (cheetahoo7)	21	85.04	95.98	7	33.33
12699.	joe (cbel3111)	21	79.73	98.67	5	23.81
12700.	Casual (casualhat)	21	53.11	59.52	4	19.05
12701.	Carl (carlalalala)	21	79.52	94.90	11	52.38
12702.	Captain M (captain254)	21	51.15	60.53	2	9.52
12703.	Mohamed (camposha)	21	63.23	73.53	3	14.29
12704.	byrtolet (byrtolet)	21	78.60	92.97	8	38.10
12705.	Dan (bupkisdaddy)	21	82.19	107.02	11	52.38
12706.	Bram (bramdk)	21	81.82	99.02	10	47.62
12707.	bok (bokk)	21	99.15	125.72	12	57.14
12708.	Blu (blu_0)	21	85.31	101.64	12	57.14
12709.	Zach (blurridge)	21	91.43	110.90	7	33.33
12710.	Jonathan (blue_blobfish)	21	88.11	104.88	5	23.81
12711.	jeff (blawalaw)	21	112.14	131.27	11	52.38
12712.	Kin (binbobum12s)	21	70.49	82.74	6	28.57
12713.	Petr (bigbang1112)	21	100.66	116.10	9	42.86
12714.	ben (bendoverr05)	21	65.60	84.34	3	14.29
12715.	You're not that slow (beast...	21	135.35	162.32	14	66.67
12716.	BearJere (bearjere)	21	101.88	112.78	12	57.14
12717.	KJ (barraclaw)	21	93.87	107.18	5	23.81
12718.	Michael (baomoichoi122)	21	51.18	66.99	1	4.76
12719.	Bis (b1s_qu1t)	21	67.11	82.41	3	14.29
12720.	Azerniiiic (azernic)	21	91.31	109.40	6	28.57
12721.	Typomaster (axioo123)	21	66.77	81.85	6	28.57
12722.	Jack (awesomekiwi23)	21	89.63	104.01	13	61.90
12723.	Avernu (avernu)	21	81.10	101.36	7	33.33
12724.	Josh (auto111032)	21	90.74	107.71	10	47.62
12725.	Chelsea (aurialing)	21	96.90	105.57	5	23.81
12726.	Anastasya (athh97)	21	64.27	81.22	5	23.81
12727.	Askhat (askhat0109)	21	35.38	45.87	0	0.00
12728.	Tala (another_ostrich)	21	84.40	95.69	7	33.33
12729.	Rijey (anilarq)	21	49.68	59.05	2	9.52
12730.	Aniket (aniketb97)	21	54.15	64.20	3	14.29
12731.	quitting = cringe (angeio)	21	164.89	183.93	19	90.48
12732.	no sweat (anduatm)	21	89.45	101.53	9	42.86
12733.	Ammar (ammarthetyper)	21	106.19	120.25	9	42.86
12734.	AmmarDab3an (ammardab3an)	21	72.75	84.14	5	23.81
12735.	al (allizer)	21	36.20	43.86	1	4.76
12736.	Aliff (aliffhakimi)	21	95.39	113.95	11	52.38
12737.	Alex (alextamago)	21	104.23	125.63	7	33.33
12738.	Alb (alb_themighty)	21	62.06	74.98	3	14.29
12739.	Alan (alan_hsiu)	21	25.65	34.38	0	0.00
12740.	Jean (akrinias)	21	111.10	126.87	11	52.38
12741.	Idas (aidasas)	21	97.95	117.92	10	47.62
12742.	Residential (agent_resident2)	21	91.97	102.54	8	38.10
12743.	ray (afrojelly)	21	91.32	105.36	8	38.10
12744.	Sam (advil)	21	115.56	128.76	12	57.14
12745.	Jannatul (adon22)	21	53.58	61.97	2	9.52
12746.	abhishek (abhisheksaxenasep)	21	57.13	65.40	4	19.05
12747.	A7med (a7med_1)	21	41.01	50.88	1	4.76
12748.	Enzo (60wpmwhat)	21	86.62	99.85	8	38.10
12749.	steve (21steven_)	21	83.54	111.00	3	14.29
12750.	InsertNameHere (1ns3rtn4m3h...	21	95.55	117.13	4	19.05
12751.	Subikshaa (subikshaa18)	21	63.54	79.94	8	38.10
12752.	Chatham (cala95)	21	89.46	105.39	10	47.62
12753.	Agno3317 (agno3317)	21	53.78	61.88	1	4.76
12754.	Marek (smudla)	21	54.96	63.53	4	19.05
12755.	sammy (whymehere)	21	31.88	43.83	3	14.29
12756.	Jezzer (60wpmbot)	21	91.29	108.98	9	42.86
12757.	Robert (r0bm4c)	21	70.76	82.45	8	38.10
12758.	Zaid (kaitania)	21	93.83	115.78	17	80.95
12759.	Angus (director7)	21	77.78	88.39	9	42.86
12760.	Quamtam (quamtam)	21	71.53	93.24	5	23.81
12761.	Dennis (deadmans_22)	21	63.59	74.99	6	28.57
12762.	qbit (qixotic)	21	96.52	105.57	7	33.33
12763.	go_ez_plz (go_ex_plz)	21	92.44	111.79	8	38.10
12764.	Mark (verysourfox)	21	62.66	78.69	7	33.33
12765.	Eminem (leonard_jose)	21	63.24	73.58	2	9.52
12766.	James (xiero)	21	75.69	84.36	3	14.29
12767.	Holden (hrmercer)	21	67.40	79.56	5	23.81
12768.	Hudodo (hudodo)	21	48.61	72.80	4	19.05
12769.	On the Go (rumasud99)	21	53.20	64.42	1	4.76
12770.	Bryan (gambino478)	21	77.32	92.18	6	28.57
12771.	Akmentop (akmentop)	21	68.98	84.26	6	28.57
12772.	V (usotsuki)	21	48.04	57.39	4	19.05
12773.	Carlos (cdrlao)	21	76.59	92.44	8	38.10
12774.	felixjack (felixjack)	21	37.35	49.17	1	4.76
12775.	Hunter (eidetic)	21	80.21	90.96	12	57.14
12776.	mel (merlynmanoj)	21	78.68	94.12	4	19.05
12777.	Jass (hsiehjason00)	21	50.68	56.36	4	19.05
12778.	Voda (vodatrash)	21	75.00	92.27	7	33.33
12779.	Brock (blobweadner)	21	44.06	53.83	6	28.57
12780.	Emerald (emeraldz05)	21	74.24	85.43	6	28.57
12781.	Lohith (mrbadattitude)	21	44.30	51.30	1	4.76
12782.	Isabella (himeenthusiast)	21	59.99	72.52	1	4.76
12783.	Dev (ananddev)	21	62.34	73.30	4	19.05
12784.	Abhinand (abhinandarun02)	21	37.74	51.23	1	4.76
12785.	360 (crankin90s)	21	57.11	77.35	3	14.29
12786.	Pip (pipsquik)	21	93.56	115.33	7	33.33
12787.	Dimitris (sussy_baka_jimbo)	21	52.97	62.66	1	4.76
12788.	Jason (supergjason)	21	105.47	125.60	10	47.62
12789.	Samuel (shironeko213)	21	80.02	94.73	10	47.62
12790.	Duc Anh (thoidithim2810)	21	51.23	58.96	1	4.76
12791.	ajmal (ajmalbinnizam)	21	44.74	49.04	5	23.81
12792.	Ian (mail_order_bride)	21	56.66	70.02	2	9.52
12793.	Roman (madness1st)	21	51.97	60.99	2	9.52
12794.	Luke (lukeatme)	21	67.55	80.97	12	57.14
12795.	Luis (luismiguelcopadiaz)	21	82.16	92.75	7	33.33
12796.	patrick (lucky_ninja3412)	21	69.47	92.00	5	23.81
12797.	Tekin (liggrod)	21	79.11	90.39	9	42.86
12798.	Leo (leo123457)	21	53.83	63.42	18	85.71
12799.	Lazer (lawins)	21	102.96	114.07	3	14.29
12800.	Lars (larzz_z)	21	82.13	100.31	10	47.62
12801.	Kshitij (kshitij21)	21	55.65	65.01	6	28.57
12802.	Sean (kokamell16_)	21	48.43	58.12	2	9.52
12803.	Koby (kobyhatton)	21	95.51	115.72	8	38.10
12804.	V (kiritoyang)	21	103.19	131.43	7	33.33
12805.	Kaylo (kaylo060)	21	80.92	97.99	6	28.57
12806.	Mouhamed (karlosalol)	21	64.83	79.28	5	23.81
12807.	Karen (karent_x3)	21	70.76	83.96	5	23.81
12808.	Katie (kantielope)	21	82.34	99.20	4	19.05
12809.	Kamrul (kamrul_ahsan)	21	29.52	34.13	1	4.76
12810.	Kai (kaitheguy_)	21	81.52	97.75	7	33.33
12811.	Aidyn (justaidyn)	21	95.87	105.53	6	28.57
12812.	vroom (junap)	21	96.56	116.70	8	38.10
12813.	Juan (juandz)	21	44.08	51.71	4	19.05
12814.	Jeffrey (jshen13)	21	88.89	101.22	8	38.10
12815.	Jono (jonodvorak)	21	128.40	142.72	13	61.90
12816.	Jon (jonbeka)	21	56.10	64.37	3	14.29
12817.	johnballs (johnballs)	21	92.20	101.38	6	28.57
12818.	Johan (johanapa)	21	97.34	117.48	19	90.48
12819.	my mango (joe_froggy)	21	72.93	90.93	1	4.76
12820.	Edward (jinsye)	21	96.48	115.18	6	28.57
12821.	Jason (jihoon222)	21	134.10	150.88	19	90.48
12822.	Jerry24562 (jerry24562)	21	82.38	92.03	0	0.00
12823.	Water (jeffersonjap)	21	106.89	117.84	14	66.67
12824.	Tobe (jeeko_pogi)	21	72.14	84.97	4	19.05
12825.	Jason (jasew)	21	62.75	91.63	4	19.05
12826.	Jamshidbek (jamshid_4510)	21	44.72	51.70	8	38.10
12827.	James (jamesks)	21	85.44	96.74	7	33.33
12828.	Jake (jakeypancakey)	21	108.93	129.44	11	52.38
12829.	Corey (i_dont_like_anime)	21	88.11	113.44	7	33.33
12830.	I type slow (itypeslowlol1)	21	99.73	117.98	9	42.86
12831.	Eric (isoh)	21	94.94	112.59	7	33.33
12832.	스티븐 (ishes)	21	101.48	109.94	9	42.86
12833.	Aleksandr Ippatev (ippatev)	21	71.96	95.75	9	42.86
12834.	Insulin (insulingaming)	21	74.91	85.61	7	33.33
12835.	Siddhant (indianracer385)	21	68.50	88.40	0	0.00
12836.	Benji (ijneb)	21	86.04	111.12	5	23.81
12837.	iCheese (icheese23)	21	101.81	117.49	10	47.62
12838.	Fez (iamsuperspeed)	21	101.79	110.26	9	42.86
12839.	xd (huskyyy)	21	102.85	122.23	12	57.14
12840.	Nate (hoopstrings)	21	105.36	118.88	9	42.86
12841.	Mike (hipsterdufus)	21	95.76	106.32	12	57.14
12842.	Ace (hiken_ace)	21	74.60	84.97	14	66.67
12843.	Hey (heythere0)	21	74.44	84.88	3	14.29
12844.	Ifat (helloitsifat)	21	76.45	89.41	4	19.05
12845.	Helena (helena_mp)	21	58.69	67.44	3	14.29
12846.	Hecks (hecksadecimal)	21	91.93	113.57	10	47.62
12847.	Egor (hawkeg)	21	55.80	66.58	6	28.57
12848.	Hahohe (hahohe3)	21	98.74	123.62	9	42.86
12849.	Karina (guyrina)	21	102.62	123.44	9	42.86
12850.	Grigory (gregkhan)	21	92.42	110.96	12	57.14
12851.	Miguel (gheed22)	21	85.91	98.79	8	38.10
12852.	Eddie (ger_eddie)	21	71.14	77.07	4	19.05
12853.	AtomicSkunk (georgel8314)	21	81.07	93.04	6	28.57
12854.	Evan (gemofevan)	21	117.78	145.51	8	38.10
12855.	Leo (geckuchicken)	21	68.23	85.15	7	33.33
12856.	elio! (gabspyz)	21	80.94	95.30	5	23.81
12857.	Charles (future965)	21	63.65	72.71	1	4.76
12858.	A (__a_)	21	84.75	101.27	6	28.57
12859.	Sourav (_sourav_)	21	29.80	34.69	1	4.76
12860.	beroo (_nwahz)	21	75.66	91.21	11	52.38
12861.	zlyxx (zlyxx)	21	84.70	110.47	6	28.57
12862.	Ziclue (ziclue)	21	90.25	109.52	8	38.10
12863.	Zemo (zemo77)	21	110.47	124.05	9	42.86
12864.	asdf (zainamjad)	21	80.37	89.28	5	23.81
12865.	wpm + x (x_wpm_more)	21	47.76	56.55	1	4.76
12866.	ximecat (ximecat)	21	113.44	133.08	14	66.67
12867.	wrentay (wrentay)	21	107.76	140.48	6	28.57
12868.	Denny (what_tf_is_up_kyle)	21	59.41	80.73	5	23.81
12869.	Whats (whatsderivative)	21	92.91	104.86	10	47.62
12870.	wayexzee (wayexzee)	21	71.16	80.68	5	23.81
12871.	Murka (wassupbuddy)	21	81.53	100.14	13	61.90
12872.	Gabriel (warbros123)	21	77.93	98.53	9	42.86
12873.	Velyro (velyro)	21	86.18	96.86	7	33.33
12874.	BESTYINA (vdud3)	21	146.90	165.68	17	80.95
12875.	Niko (varial)	21	132.33	154.77	17	80.95
12876.	nat (vanilla7)	21	75.71	94.08	9	42.86
12877.	Villan (v1llan)	21	47.54	54.75	2	9.52
12878.	Eli (uvafan)	21	105.73	123.51	11	52.38
12879.	David (usainturtle)	21	39.49	50.24	2	9.52
12880.	Unique (unique1402)	21	59.69	79.81	7	33.33
12881.	// (typist215)	21	83.10	97.00	10	47.62
12882.	reiden (typingreiden)	21	86.97	104.82	6	28.57
12883.	Asters (typer1typer)	21	101.69	117.57	9	42.86
12884.	Nabil (twin_n)	21	64.66	86.03	2	9.52
12885.	TrOn (tron_691)	21	44.46	50.92	1	4.76
12886.	Top (tophatjones)	21	100.70	114.45	21	100.00
12887.	Le Van (tlong900)	21	71.71	82.41	8	38.10
12888.	Tony (tjzhao)	21	56.87	70.88	4	19.05
12889.	tjk113 (tjk113)	21	89.35	105.58	6	28.57
12890.	Tim (timduh)	21	52.07	59.04	3	14.29
12891.	Matsvei (tictacfruit)	21	70.52	80.96	5	23.81
12892.	Thursday (thursdays)	21	106.69	123.77	9	42.86
12893.	Raymond (thiccthighs)	21	67.81	81.28	1	4.76
12894.	CJ (the_winner_is_here)	21	57.31	70.20	4	19.05
12895.	Hayden (the_dizzler)	21	85.35	99.55	8	38.10
12896.	Devids (theneo)	21	107.59	126.89	8	38.10
12897.	Albert (thehacker08)	21	63.84	73.19	3	14.29
12898.	budda (theblackeye)	21	102.05	120.58	9	42.86
12899.	th (thanasis2002)	21	93.79	112.30	12	57.14
12900.	Reanu (terrenceskill)	21	56.88	67.87	3	14.29
12901.	A (taffing)	21	71.01	82.13	0	0.00
12902.	Priyabrata (s_h_a_r_k)	21	47.76	53.66	2	9.52
12903.	sai (syrus_dhark)	21	49.02	61.33	1	4.76
12904.	sus99hant (sus99hant)	21	60.70	73.89	4	19.05
12905.	Avi (suppppp)	21	72.75	83.95	5	23.81
12906.	Demon (sun_voca)	21	101.55	116.09	5	23.81
12907.	Krystal (sunshinenmyeyes)	21	81.49	103.02	6	28.57
12908.	Subhaan (subhaan)	21	79.82	97.22	4	19.05
12909.	beiluo (beiluo)	21	64.29	74.29	9	42.86
12910.	Oakton (oakton)	21	42.68	60.95	2	9.52
12911.	squishyiop (squishyiop)	21	44.51	62.06	1	4.76
12912.	Speedwalker (speedwalker68)	21	63.56	74.65	2	9.52
12913.	Soulreaper (soulreaperdeath...	21	63.96	76.14	4	19.05
12914.	slow typer (slooowest_typer)	21	58.47	72.63	2	9.52
12915.	Sir (sirmaax)	21	72.55	103.30	6	28.57
12916.	Silvia (silvia_thenan)	21	75.10	95.89	6	28.57
12917.	Shikhar (shikhar_tyagi)	21	100.45	115.02	10	47.62
12918.	shau (shauwei_0510)	21	64.10	79.74	4	19.05
12919.	Indian_Lad (shashank5665)	21	52.83	60.74	2	9.52
12920.	shailendra (shailendraji)	21	53.33	61.89	1	4.76
12921.	Shahmir (shahmirishere)	21	93.70	115.57	10	47.62
12922.	Shaheer (shaheer49)	21	64.18	71.08	6	28.57
12923.	scqrch (scqrch)	21	60.65	66.30	4	19.05
12924.	wiz (_wiz_)	20	60.86	71.40	5	25.00
12925.	!! (zzzoodle)	20	83.14	103.95	3	15.00
12926.	Franky (zyrefe)	20	109.33	128.60	10	50.00
12927.	Zack (zqlimy)	20	77.58	90.06	4	20.00
12928.	yaotly (yaotli)	20	48.15	54.06	2	10.00
12929.	Yadira (yadirairiz)	20	97.01	118.74	7	35.00
12930.	XzXc (xzxc4444)	20	72.79	82.97	5	25.00
12931.	xtian (xtian91)	20	63.74	73.79	4	20.00
12932.	XpORPID (xporpid)	20	85.94	104.79	6	30.00
12933.	Xel (xelqqii)	20	77.42	93.35	6	30.00
12934.	matvei (xbabushka)	20	60.24	81.32	9	45.00
12935.	Bún bò Huế (wynos)	20	125.29	139.48	17	85.00
12936.	w0wdead (wowdead)	20	55.27	70.12	18	90.00
12937.	Lucas (wollmyth)	20	83.70	97.11	2	10.00
12938.	. (wheelzaboo)	20	79.70	90.70	4	20.00
12939.	Nathaniel (wetaketolong)	20	91.86	106.82	5	25.00
12940.	Wes (wespiard)	20	77.20	92.99	12	60.00
12941.	Erlend (weserl)	20	55.56	65.71	2	10.00
12942.	Jeff (websterjs)	20	84.00	94.12	3	15.00
12943.	Pat (wareem)	20	95.38	114.41	7	35.00
12944.	Cedric (vlako)	20	86.72	102.77	5	25.00
12945.	Visura (visuraprabod)	20	60.73	66.98	3	15.00
12946.	Kranite (vg_infernozz)	20	94.88	115.29	9	45.00
12947.	Varaug (varaug33)	20	100.85	110.33	11	55.00
12948.	Vaibhav (vaibhav974)	20	89.61	102.56	5	25.00
12949.	Sergei (unicrus)	20	63.47	70.86	4	20.00
12950.	Atichon (ultraballminorz)	20	74.81	85.55	4	20.00
12951.	Roman (tyronefromdetroit_7)	20	61.00	69.36	2	10.00
12952.	Sebas (typingtiran)	20	78.16	93.99	6	30.00
12953.	Brent (typer1987)	20	93.63	114.03	8	40.00
12954.	Tristan (typeinthebox)	20	69.22	89.57	4	20.00
12955.	Tycho (tychobroucke)	20	88.89	104.79	5	25.00
12956.	Tyler (tybow99)	20	108.39	117.49	6	30.00
12957.	Tanya (tyarbrough71)	20	75.22	89.96	4	20.00
12958.	bec (twentyonepotato)	20	81.34	94.81	4	20.00
12959.	Tunihorn (tunihorn)	20	100.40	131.37	11	55.00
12960.	tsds (tsds)	20	67.89	85.02	4	20.00
12961.	trut (trut)	20	87.60	100.61	4	20.00
12962.	trex (trexwithlasereyes)	20	72.57	82.78	11	55.00
12963.	Toktar (tokha)	20	35.94	42.32	0	0.00
12964.	Kocsis (tisq13)	20	55.78	67.66	4	20.00
12965.	DataDev (tinysingh)	20	52.91	68.36	2	10.00
12966.	Ian (tinysilverfish)	20	99.99	144.27	5	25.00
12967.	tiglas (tiglas)	20	71.32	80.57	4	20.00
12968.	TidyTurtle (tidyturtle)	20	98.79	125.67	6	30.00
12969.	Dan (themanisdan)	20	96.31	108.87	7	35.00
12970.	Drew (thecomedyne04)	20	90.00	115.35	7	35.00
12971.	nabileT (telibanalex)	20	94.33	108.61	9	45.00
12972.	ty (tbtbtbt)	20	121.15	154.58	13	65.00
12973.	Fabian (tay0w)	20	86.79	110.68	7	35.00
12974.	ee (tally_dvorak)	20	93.12	103.56	10	50.00
12975.	Jonas (superare)	20	78.39	103.63	3	15.00
12976.	Suddenly (suddenlynothing)	20	96.50	108.43	8	40.00
12977.	Squeeeeeps (squeeeeeps)	20	48.49	57.70	2	10.00
12978.	Spiren (spirenz)	20	113.89	134.49	10	50.00
12979.	Victoria (speedrun_dreamstyle)	20	79.33	95.19	16	80.00
12980.	snipe (snipe75)	20	50.42	67.45	1	5.00
12981.	Jacob (sl_jacob)	20	80.86	92.15	2	10.00
12982.	Devin (slinky88)	20	67.29	80.61	6	30.00
12983.	Skylos (skylos)	20	107.90	136.79	7	35.00
12984.	Manal (skullcicator)	20	91.26	117.20	5	25.00
12985.	sknny (sknny)	20	80.64	95.30	13	65.00
12986.	sk (skkk)	20	105.77	116.94	6	30.00
12987.	SIX (six_p)	20	60.11	66.78	3	15.00
12988.	Hmm (sironronron)	20	105.10	123.82	11	55.00
12989.	Shuraque (shuraque)	20	74.48	85.56	5	25.00
12990.	Shrimpo (shrimpo)	20	82.47	98.82	7	35.00
12991.	Shichibukai (shichibukai2002)	20	93.26	103.38	8	40.00
12992.	Shashanka (shashankanath)	20	49.04	61.21	13	65.00
12993.	Shadow (shadowrose01)	20	43.73	49.09	1	5.00
12994.	Themis Evangelinos (sellak)	20	50.86	60.79	2	10.00
12995.	nah id win (aragorn_the_snake)	20	125.75	136.98	1	5.00
12996.	AppleSnap (applesnap_1)	20	57.27	68.16	5	25.00
12997.	Eric (appleipad556)	20	132.93	147.26	17	85.00
12998.	anntaylor (anntaylorn)	20	134.77	172.29	17	85.00
12999.	Anita (anita0718)	20	99.20	119.83	8	40.00
13000.	anik akash (anikakash)	20	40.35	52.45	3	15.00
13001.	Wolfie (amrkhaled09)	20	98.61	127.33	10	50.00
13002.	Amin (amin_farzane)	20	73.55	80.67	4	20.00
13003.	Amelia (amelia_j_s)	20	56.88	64.06	7	35.00
13004.	Alper (alperiox)	20	108.08	129.26	7	35.00
13005.	Alon (alon276)	20	101.91	113.72	12	60.00
13006.	TSpin (all_type)	20	76.05	87.81	4	20.00
13007.	Jesse (alfonz)	20	68.70	80.89	5	25.00
13008.	Akbor (akbor_ab)	20	52.12	65.11	2	10.00
13009.	Eduardo (airplane_cakes)	20	84.07	109.36	5	25.00
13010.	Aimbot (aimbot2003)	20	66.96	77.90	7	35.00
13011.	Rasmis (ahtavarasmus)	20	54.82	67.23	6	30.00
13012.	Afzaal (afzaalahmad)	20	45.86	59.37	3	15.00
13013.	Muhammad (afi__afi)	20	43.13	52.91	1	5.00
13014.	affnah (affnah)	20	121.36	134.76	6	30.00
13015.	Achyut (achyut_india)	20	76.06	90.28	5	25.00
13016.	Alan (acfrost3)	20	50.89	60.32	2	10.00
13017.	Abqw112 (abqw112)	20	95.42	112.34	8	40.00
13018.	Syrus (abbys_sof)	20	80.23	91.80	7	35.00
13019.	AA Batteries (aa_batteries)	20	80.02	91.42	3	15.00
13020.	aarush_ (aarush_)	20	81.21	92.81	6	30.00
13021.	Aadhi (aadhi936)	20	56.19	60.15	1	5.00
13022.	Santhosh (54nth05h)	20	62.15	74.50	7	35.00
13023.	Suns (49suns)	20	70.75	80.14	2	10.00
13024.	Greedy (greedy_78)	20	72.90	89.27	5	25.00
13025.	ThPh (thph)	20	18.72	22.86	2	10.00
13026.	bence (stefler01)	20	70.94	83.37	6	30.00
13027.	Senvidu (galaxy_slayer_zed)	20	56.32	67.11	0	0.00
13028.	tstats[mirfattah] (mirfattah)	20	44.75	55.80	1	5.00
13029.	Unknown (__unkn0wn__)	20	85.15	102.98	5	25.00
13030.	Michael (mspain0729)	20	74.59	87.90	7	35.00
13031.	Alex (alexm11593)	20	54.27	64.97	6	30.00
13032.	Lulu (aztral)	20	58.75	68.38	6	30.00
13033.	Joshua (josh3000)	20	60.13	72.86	7	35.00
13034.	G (foad420)	20	74.76	97.59	6	30.00
13035.	Lucas (opoutinechooo)	20	76.31	86.61	6	30.00
13036.	Tony (generalbob1212)	20	90.57	109.99	8	40.00
13037.	Romain (romainl456)	20	65.46	80.79	6	30.00
13038.	Dana (cutie68176)	20	39.59	46.69	0	0.00
13039.	YellowyLOL (seojoon)	20	81.92	93.87	7	35.00
13040.	Di (qazydi)	20	64.67	75.44	13	65.00
13041.	Pytist (talentoncolemak)	20	79.13	88.80	8	40.00
13042.	Mike (mikechill_69)	20	56.41	70.86	4	20.00
13043.	rhi (okrhi)	20	75.01	87.64	2	10.00
13044.	Daniel (moixland)	20	100.34	116.07	12	60.00
13045.	jlang (jlang2)	20	65.60	83.25	4	20.00
13046.	Dave (dsolesvik)	20	102.24	122.71	14	70.00
13047.	Hunter (midorieon)	20	57.76	71.42	3	15.00
13048.	Haiku (mastahaiku)	20	82.88	96.08	9	45.00
13049.	Jonas (jonstep)	20	46.84	59.71	2	10.00
13050.	Nightkid (tatami_downshift)	20	45.61	54.24	3	15.00
13051.	Alan (autisticfish)	20	101.26	119.16	10	50.00
13052.	Mohammed (mohammed_m)	20	67.33	77.35	2	10.00
13053.	janina (janinaa)	20	43.62	53.94	3	15.00
13054.	KY (9v_lky)	20	62.25	80.85	4	20.00
13055.	Bob (bob192433)	20	98.66	108.57	8	40.00
13056.	K (keiarcy)	20	87.91	100.46	5	25.00
13057.	Blaire (sayurblaires)	20	64.60	76.24	7	35.00
13058.	Ben (2benn)	20	74.81	90.56	6	30.00
13059.	ja (bigfatpotato)	20	50.64	62.50	4	20.00
13060.	miguel (gonzalodtd)	20	76.54	94.75	8	40.00
13061.	mk (ekoam)	20	52.02	62.82	5	25.00
13062.	velano (velano)	20	64.27	80.93	5	25.00
13063.	Ero_Senin (typer_sensei)	20	33.72	39.60	4	20.00
13064.	John (minipax)	20	60.18	67.75	4	20.00
13065.	Amine (goshey)	20	57.81	67.21	6	30.00
13066.	Kenny (rexnihilo)	20	43.12	56.00	3	15.00
13067.	ohreo (ohreo)	20	92.78	119.83	8	40.00
13068.	Tristan (triscross)	20	67.53	74.03	5	25.00
13069.	Claywell (claywello)	20	45.55	52.47	2	10.00
13070.	Henry (shocksan)	20	35.03	45.15	0	0.00
13071.	mtmonk (vxnomous_)	20	53.55	62.73	8	40.00
13072.	Perry (plebeian7)	20	66.15	88.56	10	50.00
13073.	Yashwanth (csyashwanth)	20	35.81	44.47	2	10.00
13074.	Nguyễn Minh (shiftk)	20	65.08	102.86	5	25.00
13075.	rae (notraeign)	20	100.41	120.48	6	30.00
13076.	Penguin (penguin24562)	20	105.83	134.55	19	95.00
13077.	Eli (gokutypingwizard_)	20	23.72	31.93	7	35.00
13078.	Hopp (461am)	20	82.82	96.46	7	35.00
13079.	Lucas (sonic_car_lucas_ling)	20	68.18	90.03	3	15.00
13080.	james (minecraft001yt)	20	83.27	97.06	11	55.00
13081.	Andi (andih)	20	72.87	91.80	7	35.00
13082.	MoshuFingers (scotscottie)	20	73.67	85.55	7	35.00
13083.	︻デ═一▸ (santoshmsk)	20	61.65	74.72	7	35.00
13084.	Me (sandwichshop)	20	79.89	88.49	11	55.00
13085.	Saikiran (sai_kiran_07)	20	56.31	72.76	3	15.00
13086.	Sai Mani Raj (saimaniraj)	20	70.34	89.57	6	30.00
13087.	Roy (rwfeng72)	20	93.68	114.73	7	35.00
13088.	Ron (ronsar)	20	50.89	60.12	3	15.00
13089.	Blue (rodtypes)	20	79.79	99.27	8	40.00
13090.	student bored in school (ri...	20	62.09	69.34	4	20.00
13091.	Rikka (rikkaislife)	20	38.07	45.32	8	40.00
13092.	ric (ricman0)	20	70.38	89.12	3	15.00
13093.	ReklessDragon (reklessdragon)	20	95.34	113.22	9	45.00
13094.	Boris (redsnake07)	20	113.45	132.75	8	40.00
13095.	Eugene (rawners)	20	71.77	80.27	8	40.00
13096.	Randy (randonandoz)	20	93.58	107.02	12	60.00
13097.	Daniel (randomgamer1017)	20	106.39	132.92	10	50.00
13098.	Ricardo (rambolis)	20	66.25	75.78	2	10.00
13099.	deadass (rajteezy)	20	67.18	77.23	2	10.00
13100.	rain (rainnonquit)	20	154.92	178.95	18	90.00
13101.	Raghav (raghav8822)	20	74.29	84.35	4	20.00
13102.	Robbie (qweens)	20	76.86	89.79	8	40.00
13103.	Questt (questtlee)	20	93.01	111.73	9	45.00
13104.	qazaqyanke (qazaqyanke)	20	38.72	80.06	1	5.00
13105.	Jumpo (purplejumpo)	20	97.78	116.16	6	30.00
13106.	O]]!! (prvlg)	20	87.21	104.01	8	40.00
13107.	huge (postmortem)	20	97.50	122.23	10	50.00
13108.	Poochi (poochizoom)	20	125.91	153.61	13	65.00
13109.	poepmannetje (poepmannetje)	20	71.15	86.19	4	20.00
13110.	Pavel Kotsev (pkotsev)	20	71.31	78.87	3	15.00
13111.	stop quitting (phrosnite)	20	83.60	106.42	3	15.00
13112.	Peyush (peyush)	20	45.90	55.42	2	10.00
13113.	David (peacehf123)	20	92.64	102.68	0	0.00
13114.	The Write Tale (pchanbps1)	20	93.11	99.83	8	40.00
13115.	Gibby (papimonster69)	20	84.70	94.25	7	35.00
13116.	Ali (oorkade)	20	66.47	77.30	11	55.00
13117.	omar (omarkarboul)	20	50.59	56.75	1	5.00
13118.	Ohm (ohmstar123)	20	82.72	98.34	9	45.00
13119.	Nathan (nper4lta)	20	61.60	75.32	4	20.00
13120.	Not (not_cracked_)	20	104.60	120.01	6	30.00
13121.	salad (notyoursalad)	20	81.38	93.49	6	30.00
13122.	Molly (notevenhalf2000)	20	84.43	103.16	3	15.00
13123.	Kaat (norbertathedragon)	20	61.37	79.97	2	10.00
13124.	wayne (nonlimit)	20	85.64	98.87	4	20.00
13125.	Alex (nobrakes58)	20	90.92	107.22	7	35.00
13126.	Decent (nicokart)	20	76.29	92.04	3	15.00
13127.	troi lanh uoc dc nam tay e ...	20	59.95	98.35	9	45.00
13128.	luzy (neptunehoney)	20	98.27	121.70	8	40.00
13129.	Necdet Ali (necdetaliozdur)	20	79.65	87.68	7	35.00
13130.	Naveen Kumar (naveen_1729)	20	59.94	73.35	1	5.00
13131.	ᕕ༼ ; •̀︿•́༽�...	20	102.93	122.52	18	90.00
13132.	Adam (musterling)	20	103.03	119.91	16	80.00
13133.	mrw1 (mrw1)	20	76.95	91.52	7	35.00
13134.	Friden (mrtokke)	20	63.68	77.22	5	25.00
13135.	Andy (mrfoggz)	20	87.13	95.69	2	10.00
13136.	Mostafah (mosty295)	20	76.19	89.70	8	40.00
13137.	eric (mordor5555)	20	77.70	96.66	7	35.00
13138.	G.A.F (mochillavila)	20	56.37	69.29	2	10.00
13139.	mobo (mobo)	20	123.31	150.55	13	65.00
13140.	Eugene (mineugene)	20	85.82	95.65	9	45.00
13141.	millstypes (millstypes)	20	70.96	83.81	7	35.00
13142.	Zhikouan (mikelee543)	20	87.88	101.44	7	35.00
13143.	Hải (microwaveablepasta)	20	77.06	98.74	5	25.00
13144.	Mia (miajasmine)	20	76.56	93.78	5	25.00
13145.	mg (mgperson)	20	114.81	131.83	11	55.00
13146.	memmoman (memmo)	20	74.11	96.62	7	35.00
13147.	Tammy (mausaye)	20	79.29	91.70	5	25.00
13148.	Matin (matin_pasargad)	20	84.18	98.41	5	25.00
13149.	juzerr (markopokupecc)	20	95.93	125.79	5	25.00
13150.	Mark (markmango)	20	94.07	112.28	7	35.00
13151.	enrique (fugitivecloud)	20	105.59	121.62	9	45.00
13152.	nathanael (flyeroscer)	20	56.10	74.40	4	20.00
13153.	flourish (fl0urish)	20	81.39	112.48	8	40.00
13154.	Draco (fish0228)	20	71.91	88.72	18	90.00
13155.	LEB (fhgfl)	20	42.59	51.78	0	0.00
13156.	fbabylemon (fbabylemon)	20	85.22	96.15	7	35.00
13157.	Fvthy (fathyamer)	20	52.67	61.81	2	10.00
13158.	evaqate (evaqate)	20	64.63	77.87	3	15.00
13159.	Thav (epic_boyo_123)	20	56.04	66.75	2	10.00
13160.	EncodedTyper (encodedtyper)	20	89.79	106.48	6	30.00
13161.	Tyrell (elter)	20	53.90	73.70	6	30.00
13162.	Joe (elisouthworth)	20	113.89	143.88	13	65.00
13163.	Arslan (elbosynov)	20	26.40	30.86	14	70.00
13164.	g (eggwen)	20	64.09	73.29	6	30.00
13165.	Brian (eeyjnairb)	20	105.23	119.26	8	40.00
13166.	Maskedknight (edward5958)	20	94.62	117.06	7	35.00
13167.	Tajwar (dxadcircuit)	20	74.25	91.38	6	30.00
13168.	DUFOUR (dufour)	20	116.76	139.05	10	50.00
13169.	Drifter (drifter103)	20	120.66	133.80	8	40.00
13170.	Dhananjay (dk35840)	20	54.49	62.39	5	25.00
13171.	Justin (disney6)	20	106.59	136.70	13	65.00
13172.	DInokyd (dinokyd)	20	74.37	91.00	6	30.00
13173.	Devansh (devansh_dua)	20	39.48	47.96	2	10.00
13174.	Peeter (detectiveleht)	20	49.65	58.24	6	30.00
13175.	A (deoignition)	20	70.41	79.44	2	10.00
13176.	Demon (demon_hunter_bd)	20	48.45	55.67	1	5.00
13177.	Dicky (dcstormrage)	20	67.56	78.77	7	35.00
13178.	Darjinero (darjinero)	20	88.17	99.41	9	45.00
13179.	Alex (dangercomeswithalex)	20	70.14	87.26	9	45.00
13180.	fingers hurt (cxyym)	20	100.69	116.49	10	50.00
13181.	csAxer8 (csaxer)	20	101.94	126.48	9	45.00
13182.	CRISTO (cristomathew7)	20	69.41	83.53	4	20.00
13183.	Donkey (crazybraden)	20	82.69	97.28	4	20.00
13184.	Nero was here (correct_fing...	20	116.13	132.59	11	55.00
13185.	cana (cnry)	20	110.02	125.26	12	60.00
13186.	D (chubbieveggie)	20	84.59	96.01	5	25.00
13187.	Chris (christrilling)	20	115.70	128.49	15	75.00
13188.	Christian (chrillzen)	20	99.26	119.49	5	25.00
13189.	chez (chezzion)	20	81.38	96.16	2	10.00
13190.	Chad (chad87)	20	98.04	115.80	11	55.00
13191.	carpathian (carpathian)	20	83.72	103.11	5	25.00
13192.	Shaan (captainshaani)	20	47.06	59.55	5	25.00
13193.	Christopher (canorve)	20	53.80	63.70	1	5.00
13194.	sam (candle4)	20	93.93	116.23	6	30.00
13195.	Callow (callowblack)	20	56.60	67.29	4	20.00
13196.	Mohamed (byfarag)	20	122.98	144.18	12	60.00
13197.	Brady (bward62)	20	94.75	119.25	8	40.00
13198.	Bob (bushybrows)	20	97.90	118.49	9	45.00
13199.	Alicia Peas (bundt)	20	65.90	77.87	5	25.00
13200.	(bummered)	20	130.52	168.87	10	50.00
13201.	Brian (btong)	20	111.37	135.12	7	35.00
13202.	Bruh (bruhletuce)	20	63.19	72.75	6	30.00
13203.	hamger (broncos1388)	20	60.52	76.54	2	10.00
13204.	Sami (britishrifleman)	20	66.45	88.52	1	5.00
13205.	Random (bogdanmironov)	20	81.38	93.98	4	20.00
13206.	Gregory (bobren)	20	97.35	106.42	5	25.00
13207.	noms (bloopdaferd)	20	81.33	98.05	4	20.00
13208.	bloncing (bloncing)	20	66.40	77.28	4	20.00
13209.	Kana smurf (blackmind)	20	91.77	107.86	11	55.00
13210.	Matt (bigrocku)	20	73.50	87.94	6	30.00
13211.	Joe (bigboythrows)	20	100.06	113.95	9	45.00
13212.	bharat (bharatcoder007)	20	52.51	64.83	4	20.00
13213.	z (bazackk4)	20	79.21	97.12	9	45.00
13214.	Baran (baranomania)	20	84.62	101.33	5	25.00
13215.	Banun (banun)	20	55.99	68.91	2	10.00
13216.	Bangerzz (bangerzz)	20	65.31	86.98	2	10.00
13217.	Irsyad (azcat01)	20	66.51	77.53	4	20.00
13218.	Korbin (auvvia)	20	84.36	102.42	7	35.00
13219.	AUDEAMUS (audeamus)	20	61.90	79.57	1	5.00
13220.	Astra (astrame)	20	77.14	89.27	4	20.00
13221.	ASP00KY (aspooky)	20	57.49	77.33	8	40.00
13222.	revaN (ashun)	20	101.69	114.79	6	30.00
13223.	Piccolo (makankasappa)	20	67.83	79.11	6	30.00
13224.	Mahmudul (mahmudul_hhh)	20	44.95	56.64	3	15.00
13225.	Matthew (m1234d)	20	122.16	146.89	12	60.00
13226.	Luke (lukethepuke)	20	47.04	54.23	1	5.00
13227.	Lucy (lucyd266)	20	82.28	92.52	9	45.00
13228.	Louie John (loumexx12)	20	83.79	97.61	10	50.00
13229.	Lilah (livymud)	20	45.69	50.64	5	25.00
13230.	lex (lex_isamess)	20	103.73	134.40	12	60.00
13231.	lettuce (lettuceandahalf)	20	79.25	104.07	5	25.00
13232.	Artur (lepayo)	20	112.02	137.72	9	45.00
13233.	Leo (leo_typing)	20	80.10	97.05	3	15.00
13234.	leftmask35 (leftmask35)	20	46.51	54.27	2	10.00
13235.	Darrell (lastronus)	20	98.76	116.35	9	45.00
13236.	kRystal (krystal69)	20	67.95	88.79	13	65.00
13237.	Kevin (kevinu)	20	112.48	126.59	8	40.00
13238.	kp (kennethputra)	20	83.72	100.05	4	20.00
13239.	Kaybe (kaybnde)	20	101.70	117.87	8	40.00
13240.	Mr. lee's expository writin...	20	134.35	148.58	15	75.00
13241.	kauko (kaukokolka)	20	79.52	97.28	17	85.00
13242.	Kalash (kalz25)	20	86.18	101.63	2	10.00
13243.	salah (kaltab)	20	66.88	76.47	3	15.00
13244.	Leo (kakiu2000)	20	51.87	58.14	6	30.00
13245.	abdelrhman (kahraba92)	20	40.18	47.43	1	5.00
13246.	Eliza (kaeco_)	20	26.16	37.63	3	15.00
13247.	J (jyorange)	20	119.26	154.48	12	60.00
13248.	Jonathan (jyap042)	20	66.44	74.22	4	20.00
13249.	Joseph (jv33zy)	20	103.41	118.82	9	45.00
13250.	Joe (jqal)	20	90.32	105.39	6	30.00
13251.	Josh (joshmgeorge)	20	81.46	91.80	6	30.00
13252.	josh (joshahk)	20	88.90	121.58	7	35.00
13253.	Sweaty (josef_stylin)	20	127.95	151.37	11	55.00
13254.	23 (jorgexdlol)	20	70.41	82.16	6	30.00
13255.	Johan (joey67)	20	64.59	77.28	8	40.00
13256.	Joel (joel_w2)	20	101.62	112.56	5	25.00
13257.	jupiter (joaelis)	20	45.98	72.31	2	10.00
13258.	John (jjov17)	20	74.01	86.42	1	5.00
13259.	Jim (jim90247)	20	58.35	68.09	2	10.00
13260.	jesad (jesadilvan)	20	62.87	75.20	6	30.00
13261.	hmm (jerm_killer)	20	80.40	95.34	5	25.00
13262.	Dominik (jazzon)	20	98.48	122.81	7	35.00
13263.	Takoyaki (jayisloco)	20	51.65	59.88	2	10.00
13264.	jam_xd_ (jam_xd_)	20	91.14	104.90	3	15.00
13265.	Jake (jakepf00dvorak)	20	79.74	89.12	5	25.00
13266.	Rahul (jakatir)	20	87.08	106.50	7	35.00
13267.	Jaime (jaimeathedisco)	20	80.50	94.06	5	25.00
13268.	Jahid (jahidk9)	20	42.73	53.85	5	25.00
13269.	jackmaoff (jackmaoff)	20	68.53	81.63	6	30.00
13270.	Jack (jackcoleero)	20	73.96	87.48	7	35.00
13271.	isthislewz (isthislewz)	20	93.39	104.83	6	30.00
13272.	Isaac (ipohzw)	20	87.23	111.04	8	40.00
13273.	IpohGirl (ipohgirl8)	20	56.44	73.40	6	30.00
13274.	Kristijan (invisibleloki)	20	110.11	118.74	11	55.00
13275.	Stephen (installed)	20	126.09	167.79	9	45.00
13276.	Elskrim (important)	20	114.11	138.77	12	60.00
13277.	WhatIsLowkey (ihorsedyou)	20	126.67	144.83	12	60.00
13278.	Pickle (iceberger17)	20	74.39	95.44	5	25.00
13279.	iAmPardi (iampardi)	20	104.16	123.76	11	55.00
13280.	Hynoh (hynoh)	20	95.85	116.56	4	20.00
13281.	HoDaMoFoDor (hodamofodor)	20	97.57	119.63	11	55.00
13282.	hissi (hissi)	20	88.97	109.90	7	35.00
13283.	Hibird (hibird)	20	107.80	118.76	15	75.00
13284.	Hassan (hassanalmatar)	20	61.28	70.99	3	15.00
13285.	Hanica (hanicanii)	20	58.71	70.94	6	30.00
13286.	Hamzah (hamzaaho7722)	20	36.13	40.56	2	10.00
13287.	Erik (hadooo)	20	79.76	91.64	4	20.00
13288.	Guilherme (guilhaugusto)	20	57.68	67.00	2	10.00
13289.	tstats[guest_typists] (gues...	20	86.64	114.30	6	30.00
13290.	Kevin (gtwatt)	20	75.18	86.56	8	40.00
13291.	uhhhhhh (gtiff71)	20	94.16	106.93	9	45.00
13292.	Gr0undhog_x (gr0undhog)	20	104.70	125.68	10	50.00
13293.	GoKeWhO (gokewho)	20	130.52	150.37	12	60.00
13294.	Goal_100wpm (goal_200wpm)	20	53.24	62.40	3	15.00
13295.	Hugo (glaucon)	20	82.18	92.54	5	25.00
13296.	Yioryis (giorgis)	20	107.75	130.73	13	65.00
13297.	Utkarsh (gbuckets30)	20	92.45	101.73	4	20.00
13298.	Gabe (garff)	20	55.05	61.52	1	5.00
13299.	garetmi (gammex)	20	80.54	97.55	3	15.00
13300.	Gamer (gamer650xd)	20	91.00	110.73	9	45.00
13301.	Fyter (fyter)	20	75.44	87.74	2	10.00
13302.	Earl (furankuring)	20	86.90	98.00	9	45.00
13303.	Segs (mahrush)	19	56.47	68.10	9	47.37
13304.	Mahmoud (mahmoudalbadarin)	19	66.47	75.35	5	26.32
13305.	Mack (mackimations)	19	87.73	100.76	7	36.84
13306.	tomcr00se (lqszlo)	19	60.57	77.21	17	89.47
13307.	Lowie (lowie_987)	19	67.36	78.19	6	31.58
13308.	Jonathan (lone_lee)	19	93.49	113.93	7	36.84
13309.	Elisabeth (liz4liz5)	19	98.10	121.99	9	47.37
13310.	xhulio (lighting11)	19	65.47	79.97	5	26.32
13311.	leonardo (leonardouwu)	19	64.90	74.78	3	15.79
13312.	Lemons (lemonslmfao)	19	53.56	61.72	10	52.63
13313.	Lazyteam (lazyteam)	19	73.07	87.39	4	21.05
13314.	Lucas (larkluco)	19	55.97	63.86	4	21.05
13315.	Larisa (larisa402)	19	74.54	91.57	4	21.05
13316.	⠀ (lain_)	19	58.53	71.36	4	21.05
13317.	Solomann (kuttamma01)	19	108.22	127.85	10	52.63
13318.	Jakob (kroelle_korean)	19	94.39	107.52	10	52.63
13319.	Kristian (kristiandiana)	19	69.02	80.09	5	26.32
13320.	Kazoo (kosu_kat)	19	72.81	79.97	6	31.58
13321.	Purple (komnambongo)	19	111.67	143.82	8	42.11
13322.	Ebok (kobe5623)	19	94.26	109.34	10	52.63
13323.	Yesitsme (kingbee11)	19	49.49	62.49	3	15.79
13324.	Tony (kevinneeraj)	19	112.44	130.81	11	57.89
13325.	Kazuki (kazuki_kun)	19	88.60	99.76	6	31.58
13326.	Kažkas (kazkass)	19	70.76	77.12	5	26.32
13327.	Ayush (kanodiaayush)	19	93.33	111.13	5	26.32
13328.	Kanazaki (kanazaki)	19	81.14	95.68	7	36.84
13329.	Kagero (kagero_)	19	67.36	85.93	4	21.05
13330.	bruh (k3nny11)	19	67.54	85.28	4	21.05
13331.	Juniper (junipergd)	19	108.54	144.84	12	63.16
13332.	Julia (juliazc)	19	88.30	101.75	4	21.05
13333.	Jessica (jsilvers27)	19	74.73	85.84	5	26.32
13334.	Joseba (jouelcamper555)	19	56.97	73.52	2	10.53
13335.	Josiah (josiah_cw)	19	79.92	89.81	2	10.53
13336.	yerimiese (johwee)	19	94.59	108.88	7	36.84
13337.	Joel (joellimcy129)	19	94.11	111.97	15	78.95
13338.	Jxshify (jkbestgamer)	19	106.60	138.24	18	94.74
13339.	Thomas (jitensha03)	19	76.95	97.83	10	52.63
13340.	Jillian (jillianbonfoeyoops...	19	55.30	67.40	10	52.63
13341.	Jesse (jesser1440)	19	73.08	85.06	5	26.32
13342.	JerseySlums (jerseyslums)	19	84.12	113.47	7	36.84
13343.	Jerin (jerinjames)	19	54.29	63.63	5	26.32
13344.	J (jdizzla)	19	121.45	149.63	8	42.11
13345.	James (james_jjv)	19	72.61	87.24	7	36.84
13346.	James (jameshasconnected)	19	50.01	67.16	1	5.26
13347.	James (james0306)	19	79.21	95.95	2	10.53
13348.	Jam (jamelele)	19	125.27	145.60	13	68.42
13349.	Jax (jacksonn131)	19	84.58	107.12	4	21.05
13350.	Jack (iviagicjack)	19	97.65	113.23	7	36.84
13351.	ivan (ivanferraro)	19	74.57	86.42	3	15.79
13352.	Tact (itstact)	19	98.73	114.36	8	42.11
13353.	itsgohtime (itsgohtime)	19	125.10	134.80	13	68.42
13354.	Juan (isayuno)	19	100.88	114.53	10	52.63
13355.	Kylle (iomeotic)	19	73.44	91.31	6	31.58
13356.	amir (ioio)	19	88.30	113.80	13	68.42
13357.	Nicolas (insont)	19	78.22	90.78	7	36.84
13358.	Inox (inox)	19	85.37	97.25	6	31.58
13359.	alvarado (im_wilin)	19	81.86	95.99	5	26.32
13360.	Lawrence (imetsia)	19	106.25	116.13	8	42.11
13361.	Thomas (ilikebigtitties69)	19	67.31	74.40	7	36.84
13362.	Jim (ifeelhyper)	19	114.46	134.56	11	57.89
13363.	icening (icening)	19	40.88	45.93	4	21.05
13364.	Ian (iango23)	19	59.97	75.34	5	26.32
13365.	Skylar (iamskyhawk)	19	90.70	101.64	11	57.89
13366.	Ashish (iamprogrammar)	19	66.03	73.90	5	26.32
13367.	IAGamingWay (iagamingway)	19	74.86	87.68	14	73.68
13368.	Randy (hype_rion)	19	62.18	83.28	3	15.79
13369.	Brian (hydrobox)	19	85.30	96.46	2	10.53
13370.	Hoang (huyyyyyyyyyyyyyyyyy)	19	70.28	77.67	4	21.05
13371.	me (hseruslihkus)	19	49.88	59.32	2	10.53
13372.	Steven (hondasivakgaming)	19	77.87	104.50	6	31.58
13373.	Hol (holster)	19	92.42	107.00	9	47.37
13374.	HerrBlinkenlicht (herrblink...	19	64.46	80.41	1	5.26
13375.	ok (herbaltea)	19	97.80	121.03	9	47.37
13376.	Hazim (hazm)	19	98.60	116.91	13	68.42
13377.	Hari Chandan Das (harichand...	19	57.68	67.19	1	5.26
13378.	titty (happyfaceman)	19	67.64	81.72	5	26.32
13379.	IHnanah (hanahaoha)	19	134.92	176.36	16	84.21
13380.	Hamlet (hamabaya)	19	102.51	115.47	5	26.32
13381.	Nah (halo375)	19	58.54	69.88	5	26.32
13382.	LE ANH QUAN (hacbachmaquan)	19	82.20	97.58	8	42.11
13383.	Andy (gunwing54)	19	96.66	114.89	4	21.05
13384.	Nelson (guaxini)	19	53.11	61.88	1	5.26
13385.	Gavin (gt3ch1)	19	95.10	118.12	8	42.11
13386.	Geo (godex)	19	95.48	114.43	7	36.84
13387.	Daniel (gismo359)	19	82.93	92.81	8	42.11
13388.	Gabi (gabitzuxxl)	19	109.49	121.68	7	36.84
13389.	David (fuzzycheeks)	19	111.26	130.23	8	42.11
13390.	Caro :3 (scary_carrie)	19	59.25	70.82	3	15.79
13391.	Sc0rxh (sc0rxh)	19	107.95	123.16	6	31.58
13392.	based_hitler_69 (sav_ru)	19	47.90	54.69	1	5.26
13393.	Sapphire (sapphirexsky)	19	86.25	129.24	5	26.32
13394.	Sapient (sapient)	19	85.69	106.89	4	21.05
13395.	1337 (samseks)	19	89.91	104.82	9	47.37
13396.	Samantha (samantha_314)	19	99.96	117.69	10	52.63
13397.	SadRoad (sadroad)	19	90.78	123.10	6	31.58
13398.	Cherry (s9crs)	19	42.74	51.96	1	5.26
13399.	Robin (rxb1nn)	19	75.21	93.25	4	21.05
13400.	rpyx (rpyx)	19	115.39	131.24	13	68.42
13401.	RPUSam (rpusam)	19	151.38	160.44	18	94.74
13402.	rohit (rohitzerofour)	19	47.47	67.35	2	10.53
13403.	Rishit (rishitlogar)	19	74.12	89.84	2	10.53
13404.	fanatic (rijulbidhan)	19	81.07	91.36	8	42.11
13405.	Rick (rick_200wpm)	19	10.83	14.09	10	52.63
13406.	Themis (reitgg)	19	105.94	127.35	13	68.42
13407.	FreePalestine (reda6aboob)	19	24.83	31.11	5	26.32
13408.	ReconMarine (reconmarine117)	19	71.43	81.01	7	36.84
13409.	Nefritees (realnefritees)	19	69.79	82.82	6	31.58
13410.	rao (raonavdeep)	19	55.62	67.92	5	26.32
13411.	Roope (randommaster)	19	57.38	62.82	6	31.58
13412.	Rahma (rahhma)	19	69.86	78.92	10	52.63
13413.	Clare (radioclare)	19	83.53	102.79	5	26.32
13414.	Q3stor (q3stor)	19	35.65	44.80	3	15.79
13415.	043v897s (previouslol)	19	90.15	112.20	5	26.32
13416.	Pramit (pramittt)	19	51.40	64.18	1	5.26
13417.	Jason (pradogy)	19	79.73	102.33	2	10.53
13418.	Playboifarti (playboifarti)	19	62.54	77.96	3	15.79
13419.	PkRb21 (pkrb21)	19	65.05	73.09	5	26.32
13420.	PIXI (pixipixi)	19	136.43	176.90	11	57.89
13421.	PixelFog (pixelfog)	19	99.96	111.62	6	31.58
13422.	Speedy (pindakaaspot123)	19	85.70	109.01	6	31.58
13423.	Soós (pbaalt)	19	73.48	88.45	5	26.32
13424.	Paulie (paulie_)	19	107.96	126.80	7	36.84
13425.	Pasta_Devoured (pasta_devou...	19	45.44	52.68	17	89.47
13426.	Parnian (parnian)	19	47.70	56.28	0	0.00
13427.	Cael (paile)	19	95.51	117.19	7	36.84
13428.	Jo (oyangjo)	19	71.91	92.45	4	21.05
13429.	otve (otve)	19	64.41	85.98	6	31.58
13430.	OranH77 (oranh77)	19	78.88	94.08	6	31.58
13431.	Alex (omggitsalphaa)	19	92.06	106.80	5	26.32
13432.	Ollie (olijf)	19	81.75	95.49	8	42.11
13433.	Eldin (oktea)	19	100.29	118.98	8	42.11
13434.	Nathan (nzhang5075)	19	77.88	89.79	4	21.05
13435.	Nynnf (nynnf)	19	82.95	96.11	15	78.95
13436.	Nvzhnn (nvzhnn)	19	97.54	113.19	9	47.37
13437.	Youssef (nuggetdip)	19	68.20	77.01	4	21.05
13438.	NRC_131_G (nrc_131_g)	19	86.08	104.15	16	84.21
13439.	Nabin (npboss)	19	52.50	62.93	4	21.05
13440.	xuehua (noquitnrooom)	19	120.57	144.58	12	63.16
13441.	Daniel (nodasch)	19	64.90	81.91	4	21.05
13442.	Jason (njasow)	19	112.17	123.39	12	63.16
13443.	Jibon (ninja0x)	19	43.44	50.64	2	10.53
13444.	Nicolai (nicolaifeldthaus)	19	79.83	92.38	5	26.32
13445.	Jus (nicememe12)	19	97.18	111.32	9	47.37
13446.	Nefko (nefko)	19	90.98	108.20	5	26.32
13447.	Natan (nati_130)	19	38.97	46.37	0	0.00
13448.	Nabil (nabilhuda)	19	64.70	78.06	5	26.32
13449.	tstats[nabil365] (nabil365)	19	53.79	68.65	3	15.79
13450.	adam (n0tracist)	19	104.77	122.42	11	57.89
13451.	MUHAMMAD (m_haris676)	19	33.80	40.59	6	31.58
13452.	Mike (mxtinkxm)	19	41.09	60.87	2	10.53
13453.	mush (mushkatsu)	19	70.82	91.54	2	10.53
13454.	Addis (mryoungaddis)	19	62.78	74.75	2	10.53
13455.	lamok (mrgago)	19	96.36	123.72	13	68.42
13456.	Sompang (mplegato)	19	87.42	98.32	5	26.32
13457.	Mark (mose9634)	19	95.32	110.65	7	36.84
13458.	Dill (monkeyman1637)	19	77.97	91.81	8	42.11
13459.	Möhri (moehri)	19	72.55	88.80	15	78.95
13460.	Moe (moeb1us)	19	82.59	107.02	10	52.63
13461.	Nurul (mnislam)	19	86.08	93.35	8	42.11
13462.	Paloma (mmmmtype)	19	69.74	80.77	6	31.58
13463.	Micah (mjdomo)	19	88.72	101.04	8	42.11
13464.	Vãi Trí (minhtrihard)	19	82.37	96.02	3	15.79
13465.	Michael (mikenike52899)	19	94.50	110.55	6	31.58
13466.	Andrew (mhayes4701)	19	89.44	96.60	6	31.58
13467.	Michael (meowmeowmikey)	19	101.32	131.15	9	47.37
13468.	Melioninas (melioninas)	19	70.42	83.65	6	31.58
13469.	Manos (me1nos)	19	54.10	68.47	0	0.00
13470.	Matthew (mcluzar)	19	104.53	127.32	10	52.63
13471.	mcjohn_117 (mcjohn_117)	19	91.66	109.37	9	47.37
13472.	Son (mcc_sasuke)	19	60.50	75.08	5	26.32
13473.	MB (mb_the_lighting)	19	67.45	78.18	6	31.58
13474.	Matin (matinkh)	19	83.16	96.89	7	36.84
13475.	Martin (martinw89)	19	82.18	96.54	5	26.32
13476.	Martine (martine_338)	19	59.82	72.35	14	73.68
13477.	James (__james)	19	57.84	68.73	4	21.05
13478.	Hannah (_hannahxr)	19	66.24	76.41	5	26.32
13479.	Zakir (z_slayer)	19	68.14	78.35	8	42.11
13480.	Cyrus (zombie_kid_likes_tur...	19	87.32	114.42	5	26.32
13481.	Kevin (zenicide)	19	100.81	120.76	8	42.11
13482.	kushkus (zefirokouz)	19	81.89	96.51	6	31.58
13483.	Zamira (zamira89)	19	23.78	27.09	8	42.11
13484.	zahid (zahid_hasan_sahin)	19	58.92	70.72	5	26.32
13485.	Zach (zacuum)	19	85.34	105.06	5	26.32
13486.	Zack (zackjwilk)	19	102.83	122.54	9	47.37
13487.	Zach (zachattack8910)	19	75.23	92.82	2	10.53
13488.	Shian (ytxiang1997)	19	89.20	101.87	2	10.53
13489.	Liam (yourmotherguy)	19	94.60	110.55	10	52.63
13490.	Regin (yoloburgerking)	19	109.99	122.59	9	47.37
13491.	yaQvadrat (yaqvadrat)	19	61.05	72.86	4	21.05
13492.	yang (yangtyper)	19	79.14	87.49	5	26.32
13493.	Paul (yangaapaul)	19	125.98	149.66	13	68.42
13494.	Marc (xmarcxx)	19	77.53	95.11	3	15.79
13495.	Alex (xanderamb)	19	81.16	97.48	9	47.37
13496.	wiktor (wiktoroski1995)	19	27.70	36.44	4	21.05
13497.	Kevin (whatsyourtype)	19	111.75	131.84	8	42.11
13498.	Weegeepootis (weegeepootis)	19	118.44	135.06	8	42.11
13499.	Walter (walter1)	19	92.78	102.47	8	42.11
13500.	DybVv (vuong02011996)	19	54.00	63.71	4	21.05
13501.	Khoi Nguyen (vukhoinguyen8492)	19	105.47	117.36	8	42.11
13502.	vormin (vormin)	19	63.00	72.46	5	26.32
13503.	Vishishta (vishik_685)	19	71.83	81.02	7	36.84
13504.	Dan (videogamewarriortv)	19	114.21	144.77	11	57.89
13505.	Boris (vhoma)	19	55.52	60.80	1	5.26
13506.	Jun (vegetto1126)	19	112.07	129.66	12	63.16
13507.	Valtishqq (valti46)	19	78.93	90.25	5	26.32
13508.	Michael (valibukk)	19	66.87	75.21	7	36.84
13509.	Utku (utkumaden)	19	75.71	89.14	5	26.32
13510.	U (uqs1)	19	63.83	74.67	2	10.53
13511.	ungabunga (ungabungaoobunga)	19	87.27	110.66	4	21.05
13512.	Obama (underi7)	19	92.26	105.67	10	52.63
13513.	Alan (typing_alan)	19	65.28	76.68	5	26.32
13514.	Turningworld (turningworld)	19	59.80	70.52	8	42.11
13515.	Trey (trxtier)	19	54.21	75.98	2	10.53
13516.	Truvius (truvius)	19	86.68	107.89	4	21.05
13517.	Josh (tributedajerk)	19	103.69	128.82	10	52.63
13518.	Tomasz (toumash)	19	71.55	84.89	8	42.11
13519.	Toshi (totora)	19	42.01	54.13	1	5.26
13520.	Tobias (tospon)	19	28.73	33.56	6	31.58
13521.	tontin (tontinvicinta)	19	92.70	111.85	5	26.32
13522.	Tibnel (tonels)	19	115.23	141.30	10	52.63
13523.	chalantorn (tonchalantron)	19	71.00	86.51	14	73.68
13524.	TapTapTappy (tomcolemak)	19	115.63	136.22	9	47.37
13525.	Tej (tjoshi12)	19	94.71	108.84	7	36.84
13526.	Faustino (tinoriffic)	19	102.15	112.77	7	36.84
13527.	Tan (tim0909)	19	124.53	140.79	12	63.16
13528.	Thuong (thuongle19)	19	66.45	76.38	4	21.05
13529.	Ryan (thoughtpotato)	19	96.32	112.43	5	26.32
13530.	pogchamp (the_frog_champ)	19	119.92	164.12	11	57.89
13531.	Radu Codescu (the_eagle)	19	53.19	59.77	4	21.05
13532.	Coconut (the_coconut)	19	97.09	107.15	6	31.58
13533.	Anson (the_chill_templar)	19	90.32	109.31	10	52.63
13534.	Luc (theshadowcuber)	19	92.31	111.84	4	21.05
13535.	Aaron (theredspartan)	19	86.84	101.98	5	26.32
13536.	theonesomebodey (theonesome...	19	67.52	98.84	3	15.79
13537.	daniiar (thedoni)	19	43.04	55.14	1	5.26
13538.	the1stpsycho (the1stpsycho)	19	76.71	93.81	6	31.58
13539.	Maddy (teruteru2116)	19	113.98	152.51	12	63.16
13540.	Iftakhar (tanvir021)	19	45.74	51.75	1	5.26
13541.	Tan (tang_)	19	65.52	77.88	7	36.84
13542.	Danny (taipmaster)	19	97.55	120.38	10	52.63
13543.	Alan (taialan)	19	87.07	99.83	17	89.47
13544.	Sumit (sysoutme)	19	65.32	71.25	3	15.79
13545.	Maxi (swimincircles)	19	85.15	104.47	8	42.11
13546.	MadsFuldGas (swaax)	19	139.32	160.32	17	89.47
13547.	सुरेन्द्र...	19	56.55	69.09	1	5.26
13548.	Joe (suqmadiqmann)	19	98.70	115.94	10	52.63
13549.	Landon (sugamalia)	19	98.88	132.34	6	31.58
13550.	Sue (suevang)	19	62.24	78.76	2	10.53
13551.	Styo (styofox)	19	53.50	61.59	2	10.53
13552.	strange (strangeeggs)	19	133.86	165.74	8	42.11
13553.	stormchaserwhienne (stormch...	19	78.75	102.54	6	31.58
13554.	Stevey (steveaiva)	19	56.87	67.42	2	10.53
13555.	Kasey (kaseykasey)	19	48.02	56.88	3	15.79
13556.	Miguel (spiritdesire)	19	79.50	88.61	5	26.32
13557.	Aria (spaceface32)	19	82.59	98.42	3	15.79
13558.	Tomislav (sovageng)	19	76.39	85.69	6	31.58
13559.	Ler (soospooky)	19	97.67	107.05	7	36.84
13560.	SoopaKhell (soopakhell)	19	109.73	129.87	14	73.68
13561.	Somanos (somanos)	19	96.13	109.36	8	42.11
13562.	brad (soccerboyy)	19	91.25	120.56	8	42.11
13563.	Daan (skunki)	19	81.70	91.72	7	36.84
13564.	tstats[sivert_ivert] (siver...	19	87.85	112.44	5	26.32
13565.	Sisi (sisiamor)	19	121.49	141.02	13	68.42
13566.	(sirreinz)	19	94.13	106.21	8	42.11
13567.	Daniel (siichotic)	19	103.64	121.78	3	15.79
13568.	Bertie (shkablameo)	19	54.91	64.61	2	10.53
13569.	Shawn (shawtyper)	19	57.59	73.79	4	21.05
13570.	SeldRiyo (seldriyo)	19	56.16	63.31	3	15.79
13571.	blooks (aprinter)	19	98.46	115.85	12	63.16
13572.	Ansh (ansh_001)	19	66.84	82.44	7	36.84
13573.	Guillermo (andragoner)	19	100.61	128.04	3	15.79
13574.	Amfomy (amfomy)	19	73.15	89.66	7	36.84
13575.	Amal (amalsan)	19	57.59	65.26	5	26.32
13576.	Guest (alvinaruto)	19	66.27	81.23	7	36.84
13577.	curious (allodic)	19	100.67	116.07	11	57.89
13578.	al2qx (al2qx)	19	78.54	92.57	6	31.58
13579.	tstats[aisultan] (aisultan)	19	75.30	92.89	4	21.05
13580.	Aidan (aidandapenguin)	19	58.65	66.71	1	5.26
13581.	lemonade (agolemonade)	19	90.24	115.86	6	31.58
13582.	Atanas (aginev)	19	47.08	56.07	3	15.79
13583.	Eaton (adgray09)	19	68.29	85.27	4	21.05
13584.	Jacob (addthenine)	19	85.79	98.73	5	26.32
13585.	blackjeseos (actuallyfadhli)	19	69.89	86.93	4	21.05
13586.	Rabia (abdessalam)	19	62.27	68.83	1	5.26
13587.	Aafeef (aafeef25)	19	60.20	78.86	17	89.47
13588.	Nick (aaaywhatup)	19	83.55	98.76	4	21.05
13589.	Eduardo (4lc1d3)	19	78.90	91.53	2	10.53
13590.	rome (1ensh1)	19	80.62	92.22	4	21.05
13591.	Barteritus (barteritus)	19	67.59	88.04	1	5.26
13592.	saktisudarsono (saktisudars...	19	80.68	92.68	3	15.79
13593.	Yusome (yusomeli)	19	59.07	71.83	5	26.32
13594.	Rustyrare (rustyrare)	19	69.16	82.51	6	31.58
13595.	Fábio (thefabio8000)	19	61.92	76.33	6	31.58
13596.	Scimza (scimza)	19	87.58	103.41	7	36.84
13597.	Bob (iamaninja66)	19	69.86	86.19	5	26.32
13598.	Hawk (hawkeye7662)	19	75.08	82.96	18	94.74
13599.	Ivan (boringspookycoolivan)	19	74.38	89.60	5	26.32
13600.	viktor (killingnexus)	19	58.76	69.70	3	15.79
13601.	Noah (trumpybear)	19	76.18	87.17	6	31.58
13602.	Z40Abanob (z40abanob)	19	70.87	88.73	12	63.16
13603.	hteraG (hterag)	19	78.70	100.74	5	26.32
13604.	Hao (hao1110)	19	44.45	61.51	2	10.53
13605.	Penguin (itsgirlgamer49)	19	36.04	46.35	0	0.00
13606.	kenzo (k3nx0)	19	58.49	68.41	1	5.26
13607.	shacha (shacha)	19	36.05	41.56	0	0.00
13608.	leo (enrage411)	19	59.02	73.47	7	36.84
13609.	Mengkuda (rakaoii)	19	46.14	50.82	1	5.26
13610.	John (john_willy)	19	64.61	78.33	10	52.63
13611.	Logan (18logsar)	19	68.54	78.74	8	42.11
13612.	TOAN (huytoan99z)	19	82.52	112.36	7	36.84
13613.	Henry (akarieon)	19	79.78	100.58	13	68.42
13614.	Pedro (tishi091)	19	68.56	76.72	5	26.32
13615.	ydna (smilez_)	19	81.50	103.37	3	15.79
13616.	Mango (monthly_mango)	19	88.42	102.65	10	52.63
13617.	Nawaf (equin)	19	77.15	96.13	2	10.53
13618.	Prince (pri_royal)	19	45.84	57.45	2	10.53
13619.	Ekku (ekkusi)	19	83.45	98.23	4	21.05
13620.	Harrison (nonotharry)	19	73.61	87.94	6	31.58
13621.	D (numzberouz)	19	82.96	99.67	9	47.37
13622.	Charles-John (geetarcharlie17)	19	87.52	111.03	4	21.05
13623.	sopology (sopology)	19	73.47	85.28	5	26.32
13624.	Kevin (kevinnarvaez)	19	51.29	60.05	17	89.47
13625.	David (davrand11)	19	66.01	84.54	6	31.58
13626.	Ling (penguinobeano)	19	113.94	138.27	13	68.42
13627.	Dieter (c4ntel0pe)	19	75.35	88.16	4	21.05
13628.	Edonis (edoedi15)	19	51.06	59.22	2	10.53
13629.	Joris (percyjw)	19	49.59	55.07	4	21.05
13630.	ilovelolipops (sad_hobbit)	19	55.22	64.34	1	5.26
13631.	enigmaticpixels (enigmaticp...	19	85.44	99.79	3	15.79
13632.	Aromasin (aromasin)	19	59.89	76.33	2	10.53
13633.	Alex (alexey1995)	19	26.27	31.29	2	10.53
13634.	Victor (unmighty)	19	98.58	115.54	9	47.37
13635.	Rare (neno20022)	19	47.19	57.88	2	10.53
13636.	Sckroob (sckroob)	19	113.23	125.38	6	31.58
13637.	aaa (adric96)	19	88.28	101.28	7	36.84
13638.	CuriousChild (curiouschild)	19	86.81	98.91	6	31.58
13639.	blaine (frikker)	19	118.12	151.78	15	78.95
13640.	Erika (frenzymania)	19	84.77	101.64	3	15.79
13641.	Lewis (fr0stbites)	19	77.75	90.89	8	42.11
13642.	fosty (fostyfog)	19	46.57	62.62	5	26.32
13643.	Sakura (foreheady)	19	75.64	84.72	1	5.26
13644.	fred (foop1)	19	112.20	128.19	10	52.63
13645.	Ray (flexray)	19	86.94	108.85	7	36.84
13646.	FlaTrix (flatrix)	19	312.06	448.52	19	100.00
13647.	Filip (fifi_wilk)	19	81.60	94.37	6	31.58
13648.	fergisson (fergiss)	19	65.88	76.47	6	31.58
13649.	Aidan (fastflangies)	19	67.29	78.57	8	42.11
13650.	Ian (fadedrobin)	19	72.78	100.95	6	31.58
13651.	eyeliddy (eyeliddy)	19	99.32	119.86	11	57.89
13652.	Leon (extremegamer116)	19	100.29	125.96	5	26.32
13653.	Evan (evang_dvorak)	19	103.15	120.28	12	63.16
13654.	EthKrae (ethkrae)	19	72.66	82.02	5	26.32
13655.	equations (equationslayer12)	19	74.67	94.70	4	21.05
13656.	Ahmad (eqbalshekib)	19	65.64	81.49	7	36.84
13657.	Epik Dino (epikdinosaur)	19	66.22	76.67	4	21.05
13658.	RIP Byron (enriquecollin)	19	131.24	155.19	11	57.89
13659.	visily (enlive3)	19	72.63	96.60	6	31.58
13660.	Prawny (enderduck247)	19	88.71	119.22	17	89.47
13661.	eman borham (ema_burham)	19	42.77	47.67	1	5.26
13662.	Emateos (emateos)	19	59.98	67.63	9	47.37
13663.	Ella (ellavampyrella)	19	49.53	57.56	2	10.53
13664.	elif (eliff)	19	66.57	80.99	7	36.84
13665.	Elias (eliasmarcelin0)	19	80.00	103.45	6	31.58
13666.	David (electro2020)	19	119.63	143.48	9	47.37
13667.	ekupro (ekupro)	19	44.68	51.89	2	10.53
13668.	Eifie (eifietheward)	19	62.29	88.50	2	10.53
13669.	Satyam (echosatyam)	19	57.48	68.85	3	15.79
13670.	Mazeppa (dynozawa)	19	93.63	103.35	4	21.05
13671.	Slow Slow Slow Slow (dukka_)	19	106.81	121.46	7	36.84
13672.	RIP yomps (dtfps)	19	103.24	122.17	18	94.74
13673.	Sascha (dsm716)	19	39.51	45.26	2	10.53
13674.	Downsouthspy (drax_)	19	78.01	92.76	7	36.84
13675.	jin (dragon51221)	19	86.29	94.76	6	31.58
13676.	Dookie Shoes (dookie_shoes)	19	100.54	124.57	6	31.58
13677.	Arrogant (dkaocka)	19	102.68	120.91	6	31.58
13678.	Steven (df1337)	19	112.93	138.38	9	47.37
13679.	desa (desa7645)	19	38.31	45.86	0	0.00
13680.	Guest (dbluedb)	19	68.37	92.87	1	5.26
13681.	Kike (darkskyflow)	19	51.76	59.51	9	47.37
13682.	Darkcryed (darkcryed)	19	90.33	106.41	5	26.32
13683.	Lee (cytokid101)	19	136.80	159.07	13	68.42
13684.	Cryp_ted (crypted06)	19	106.54	121.42	19	100.00
13685.	Ethan (crissps)	19	74.18	92.35	5	26.32
13686.	Dumby (cooh)	19	89.01	100.38	5	26.32
13687.	Iamthebest (console0)	19	38.00	45.35	1	5.26
13688.	Blackmooer (colinluca)	19	76.86	89.94	7	36.84
13689.	Jesse (cliev)	19	126.82	150.33	13	68.42
13690.	Clark (clark_d)	19	52.95	70.41	1	5.26
13691.	Vlad (ciorap88)	19	67.21	84.01	4	21.05
13692.	mark (chuahuonga)	19	62.88	76.36	3	15.79
13693.	Devon (cheeky_sneakster)	19	86.39	101.79	8	42.11
13694.	Ccucumber12 (ccucumber12)	19	72.80	84.56	5	26.32
13695.	Chris (cccxxxl)	19	103.73	116.44	19	100.00
13696.	CarrotyLemons (carrotylemons)	19	69.48	84.49	7	36.84
13697.	Carlz (carlz19)	19	89.85	105.36	5	26.32
13698.	Josh (capitanwalrus)	19	74.44	91.59	3	15.79
13699.	Ceramic (caleb_2000)	19	82.75	92.77	5	26.32
13700.	bvk (bvkv)	19	64.11	72.09	1	5.26
13701.	Arie (buenobonsai)	19	90.77	105.44	5	26.32
13702.	Bede (breadstickx)	19	90.85	99.44	4	21.05
13703.	Oleg (braga01)	19	83.28	92.31	7	36.84
13704.	Brady (bradymoller)	19	77.12	91.29	3	15.79
13705.	HUN (botyi22)	19	42.17	51.32	0	0.00
13706.	boocoo (boocoo)	19	77.92	94.32	3	15.79
13707.	Robert (bonsai_aus)	19	105.08	132.89	7	36.84
13708.	Nolan (blerz)	19	103.84	117.38	16	84.21
13709.	Blablle (blablle)	19	89.49	107.16	19	100.00
13710.	bigpotato24 (bigpotato24)	19	61.94	76.92	5	26.32
13711.	tirehtööri (benracer)	19	81.62	102.58	4	21.05
13712.	Stefaan (befferdw)	19	92.93	140.75	10	52.63
13713.	Brandon (bduick)	19	67.75	79.33	4	21.05
13714.	Andy (batt)	19	88.93	100.20	5	26.32
13715.	Basti (bastigga_)	19	70.35	83.16	5	26.32
13716.	Bakushou (bakushou)	19	56.45	67.79	2	10.53
13717.	Hoshi (b1ink)	19	75.47	90.90	6	31.58
13718.	Avinash (avinash625)	19	81.68	95.29	2	10.53
13719.	AuroraSpirix (auroraspirit)	19	101.08	130.84	8	42.11
13720.	Haany (asterp01)	19	61.94	77.11	2	10.53
13721.	Oliver (arscenic)	19	77.17	93.89	8	42.11
13722.	(´▽`ʃ♡ƪ) (froggy_y)	18	106.42	128.90	10	55.56
13723.	James (frodobaggins_)	18	63.42	75.84	5	27.78
13724.	twitch.tv/empyr1cal (fritte...	18	97.30	116.42	9	50.00
13725.	fr00t_l00ps (fr00t_l00ps)	18	91.61	99.37	8	44.44
13726.	Franklin (fpstone)	18	79.97	96.83	3	16.67
13727.	Alex (foxtail8000)	18	72.58	93.46	5	27.78
13728.	Sadge (forebe)	18	61.81	70.05	17	94.44
13729.	Bryce (flipno)	18	75.45	84.72	3	16.67
13730.	Finuz (finuz)	18	51.38	59.80	1	5.56
13731.	Filip (fichomaster)	18	85.08	100.42	14	77.78
13732.	Jordan (feelingsreal)	18	112.95	131.82	9	50.00
13733.	Jáchym (fastfingerrs)	18	74.02	82.90	7	38.89
13734.	E dog (evan819)	18	95.84	118.82	8	44.44
13735.	Tim (euclid221)	18	90.43	100.35	9	50.00
13736.	ethan (ethanwander83)	18	75.96	97.64	3	16.67
13737.	Ethan (ethanluu)	18	56.92	64.89	6	33.33
13738.	Erza (erzaskill)	18	101.95	112.74	8	44.44
13739.	eri :) (eri0002)	18	89.58	113.44	8	44.44
13740.	Erdem (erdemhalil)	18	98.65	109.20	9	50.00
13741.	epicsyrian (epicsyrian)	18	56.40	63.46	1	5.56
13742.	Abraham (emptypilot)	18	90.67	102.38	3	16.67
13743.	Empress Irisu (empress_irisu)	18	104.34	124.87	8	44.44
13744.	elijah (elijahtheracecar)	18	72.82	90.55	2	11.11
13745.	Dzlandis (dzlandis)	18	106.22	138.61	15	83.33
13746.	rob (dydtaylor)	18	115.09	129.40	10	55.56
13747.	Dyanel (dyanel)	18	61.59	73.40	4	22.22
13748.	Draunzer (draunzer23)	18	37.72	44.38	2	11.11
13749.	Drama (dramajr)	18	76.67	98.62	5	27.78
13750.	Jordan (donkeywhistle)	18	90.42	101.17	7	38.89
13751.	Doggo (doggocz)	18	100.17	116.20	5	27.78
13752.	Dan (dncn)	18	55.56	71.74	5	27.78
13753.	Ellis (disphing)	18	101.05	117.95	8	44.44
13754.	DirtJohnson (dirtjohnson)	18	61.34	69.49	4	22.22
13755.	dever (deverart)	18	112.96	129.98	9	50.00
13756.	Deactrals (deactralsyt)	18	107.45	138.29	6	33.33
13757.	dax (daxwastaken)	18	74.65	89.39	6	33.33
13758.	Darijuan (darijuan)	18	70.80	83.48	7	38.89
13759.	Daniel (dannyxrpm)	18	59.63	74.23	9	50.00
13760.	Dan (danmurf)	18	73.27	92.78	8	44.44
13761.	Daniel (dani3lju777)	18	113.84	141.89	9	50.00
13762.	d (dafeiji)	18	105.68	132.57	8	44.44
13763.	Danny (cyicro75366)	18	85.68	111.10	2	11.11
13764.	Cade (ctw_)	18	97.27	119.72	8	44.44
13765.	Kyi Phyu (crystal_emerson)	18	84.78	95.34	6	33.33
13766.	Jorge (crovas)	18	72.78	80.38	3	16.67
13767.	Christopher (cprice4124)	18	103.04	122.15	4	22.22
13768.	Taufiq Dhanial (conradchill)	18	43.44	47.60	2	11.11
13769.	Conrad (conrad7)	18	100.80	117.00	8	44.44
13770.	comkichi (comkichi)	18	42.61	50.88	2	11.11
13771.	(cnremilia55)	18	129.67	140.93	11	61.11
13772.	CD (chris_keum_9)	18	83.13	94.41	7	38.89
13773.	Christina (christinacitta)	18	60.19	67.70	2	11.11
13774.	Cecil (cecilw)	18	92.63	109.10	6	33.33
13775.	Sam (cattheory)	18	82.59	99.87	4	22.22
13776.	Captain (captainbravo579)	18	34.02	37.16	0	0.00
13777.	cantfindname (cantfindname)	18	73.21	93.60	3	16.67
13778.	Cammyy_ (cammyy_)	18	71.63	85.80	4	22.22
13779.	Gabriel (bultaqi)	18	30.07	38.05	0	0.00
13780.	Jens (bullercool)	18	91.52	108.83	8	44.44
13781.	Bugz (bugzmoney)	18	68.84	98.65	16	88.89
13782.	Bryce (bryceweedz)	18	91.21	102.25	9	50.00
13783.	The Rainbow Dragon (broadwa...	18	89.40	97.72	4	22.22
13784.	jan Mase (brasidas422)	18	104.44	114.84	7	38.89
13785.	Glen Ford (boyroader)	18	35.48	42.58	1	5.56
13786.	Bong (bongman48)	18	45.89	58.47	2	11.11
13787.	David (bomely)	18	98.12	122.89	2	11.11
13788.	bobby (bobbyo)	18	85.59	99.06	4	22.22
13789.	Baba (bobabo)	18	118.76	135.94	7	38.89
13790.	twitch.tv/darkmatterv4 (blo...	18	112.61	132.11	6	33.33
13791.	Samyak (blk_ht_hk_r)	18	57.80	67.76	7	38.89
13792.	Manny (blimps)	18	56.08	68.05	3	16.67
13793.	Arman (blazzer1yr)	18	57.84	62.58	0	0.00
13794.	Firefingers (birthdaykids)	18	211.50	234.71	17	94.44
13795.	Bintang (bintung)	18	103.25	116.43	6	33.33
13796.	Julen (bi0hazard_jck)	18	67.67	79.32	3	16.67
13797.	Lemons (bhan1115)	18	106.84	122.40	10	55.56
13798.	XDXDXD (benskrrt)	18	95.32	114.70	9	50.00
13799.	Benjamin (benjaminjam)	18	94.68	118.51	5	27.78
13800.	Lizbeth (belthiz)	18	55.18	67.98	0	0.00
13801.	Beebit (beebit)	18	72.60	84.62	4	22.22
13802.	Ethaan (bambamarama)	18	63.99	74.84	4	22.22
13803.	BaldricLinus (baldriclinus)	18	88.29	119.02	9	50.00
13804.	Victoria (azureale)	18	85.67	108.98	6	33.33
13805.	Ayush (ayush08)	18	61.71	73.77	5	27.78
13806.	Avery (avidavi)	18	106.16	125.54	6	33.33
13807.	Tim (auticons)	18	69.14	85.22	3	16.67
13808.	Atzac (atzac)	18	44.10	54.99	1	5.56
13809.	Aryan (aryandeore)	18	76.97	99.81	6	33.33
13810.	Austin (artannenbaum)	18	117.09	145.07	10	55.56
13811.	Adam (armen32cz)	18	70.69	84.31	0	0.00
13812.	v3 (_v3_)	18	166.98	187.28	16	88.89
13813.	supreme (_supremes)	18	98.94	109.30	6	33.33
13814.	Ionut (ztonaz)	18	61.09	69.98	4	22.22
13815.	bob (zirx2)	18	87.33	100.02	3	16.67
13816.	Ziffit (ziffit)	18	35.15	42.01	2	11.11
13817.	Zachary (zacmanman)	18	99.24	114.50	3	16.67
13818.	Josh (yummy4skin)	18	83.54	112.40	5	27.78
13819.	Mike (yoshyosh)	18	55.98	66.75	0	0.00
13820.	Jan (yentzeg)	18	90.92	107.46	8	44.44
13821.	Yasunobu (yasunobu)	18	47.80	54.12	4	22.22
13822.	Yaman (yamyoume)	18	69.51	77.42	4	22.22
13823.	yabsira sisay (yabsira)	18	49.29	57.04	1	5.56
13824.	I AM SPEED (xelestis)	18	96.99	114.84	6	33.33
13825.	Xantrum (xantrum1)	18	77.28	96.73	7	38.89
13826.	Dan (writfate)	18	68.97	89.26	4	22.22
13827.	Work (worklife)	18	71.03	78.05	1	5.56
13828.	a (waahello)	18	102.64	119.21	5	27.78
13829.	Viniter (viniter_)	18	63.69	76.00	4	22.22
13830.	vilo (viloo)	18	94.19	114.46	9	50.00
13831.	valeriu (valeriu)	18	46.95	52.89	1	5.56
13832.	Emmanuel (ugochuku2000)	18	87.97	105.64	9	50.00
13833.	YW (tywee)	18	96.59	106.43	10	55.56
13834.	meo (typowriter16)	18	114.41	135.36	11	61.11
13835.	Dan (typefffast)	18	76.31	86.86	5	27.78
13836.	Joran (turkeyman)	18	107.78	126.42	9	50.00
13837.	n8 (ttensu)	18	98.30	113.83	7	38.89
13838.	Tomasz (tserbinowski)	18	47.16	53.88	1	5.56
13839.	truecoatcrew (truecoatcrew)	18	102.73	118.66	12	66.67
13840.	Tripp (tripptypes)	18	52.49	67.36	5	27.78
13841.	Travis (travisxball)	18	99.10	115.34	10	55.56
13842.	TotalTao (totaltao)	18	69.25	80.99	3	16.67
13843.	TornaxO7 (tornax)	18	53.46	58.04	1	5.56
13844.	tony (toeknee0)	18	82.54	95.32	4	22.22
13845.	tan (tnttant)	18	85.15	98.13	8	44.44
13846.	Tir8 (tir8)	18	74.90	88.75	5	27.78
13847.	cookie (timecookie)	18	84.91	95.48	8	44.44
13848.	Tia (tiaaakayyy)	18	114.93	131.27	9	50.00
13849.	Lynan (thonlynan)	18	52.44	67.20	4	22.22
13850.	thomas (thoarell)	18	90.68	107.78	1	5.56
13851.	Wing (thewing_)	18	83.08	114.78	2	11.11
13852.	TheUnder (theunderdoge)	18	78.67	94.26	4	22.22
13853.	Stefan (thebeaver5)	18	82.57	93.64	3	16.67
13854.	Thai (thaiph244)	18	90.87	108.55	7	38.89
13855.	??? (teslacia)	18	100.05	110.46	10	55.56
13856.	Tean (tean)	18	110.64	141.60	17	94.44
13857.	Tangguh (tangguh_)	18	76.17	95.25	5	27.78
13858.	Thomas (taimeru)	18	55.01	67.73	1	5.56
13859.	Tobi (t0b5)	18	74.66	86.43	1	5.56
13860.	Surajit (surajit)	18	58.21	69.77	1	5.56
13861.	J (superuby5)	18	95.09	107.52	7	38.89
13862.	SuperGion915 (supergion915)	18	70.45	82.41	4	22.22
13863.	Andy (superchickeneat)	18	88.49	109.20	11	61.11
13864.	saku (sukasa)	18	127.08	148.34	10	55.56
13865.	anne (strawberrybannenana)	18	82.78	104.31	10	55.56
13866.	Alyssa (stewalyssa)	18	76.37	90.75	6	33.33
13867.	Mr. (stealthykoalaber)	18	104.44	125.68	7	38.89
13868.	stealthevan (stealthevan)	18	109.78	140.70	9	50.00
13869.	Stan (stan3999)	18	71.35	84.71	3	16.67
13870.	Sticky (st1ckyman)	18	67.50	78.03	4	22.22
13871.	ssiKY (ssiky)	18	71.33	83.25	3	16.67
13872.	Tom (spicersoanner)	18	73.36	85.77	3	16.67
13873.	Soul (soulisgarb)	18	89.09	99.44	3	16.67
13874.	vivi (soulace)	18	125.25	153.26	8	44.44
13875.	Leonardo (sonoleo)	18	71.24	80.80	4	22.22
13876.	jenga (smokythunder)	18	108.06	137.08	5	27.78
13877.	jules! (smeme)	18	95.24	117.46	13	72.22
13878.	meher (smc181002)	18	53.86	72.15	3	16.67
13879.	Subid (slowth_369)	18	55.21	68.55	2	11.11
13880.	Simon (simonlee2216)	18	93.89	118.66	11	61.11
13881.	Shivam (shivam543)	18	83.79	98.69	5	27.78
13882.	Davit (shartavadavit0)	18	73.61	84.05	4	22.22
13883.	Sienna (sfdragon)	18	111.31	136.81	9	50.00
13884.	S (sestevens)	18	117.88	131.73	6	33.33
13885.	Parker (seriousnewt8)	18	71.07	87.01	4	22.22
13886.	sendiri (sendiri)	18	79.90	96.20	5	27.78
13887.	Seforius (seforius)	18	106.48	129.41	11	61.11
13888.	SeeJay (seejay_ferraro)	18	65.57	71.64	4	22.22
13889.	Matthais (maciejosas2012)	18	100.67	116.74	5	27.78
13890.	Ted (macfan)	18	105.20	115.53	9	50.00
13891.	Luke (lukeov)	18	80.24	99.87	5	27.78
13892.	Johnathan Walter (luciferin)	18	97.01	108.78	5	27.78
13893.	Lukasz (lpodolski)	18	72.92	84.84	1	5.56
13894.	lodo4ka (lodo4ka)	18	70.45	83.82	3	16.67
13895.	Mr (littyzm)	18	107.27	125.48	4	22.22
13896.	Rein (lilpotatopop)	18	89.48	112.50	13	72.22
13897.	Klunky (liamrob)	18	85.92	107.44	11	61.11
13898.	Ante (ld77)	18	91.04	104.80	9	50.00
13899.	Jacob (krucinskij)	18	75.40	87.78	4	22.22
13900.	Kelly (kile07)	18	49.27	65.65	2	11.11
13901.	Khuslen (khyl)	18	58.41	69.39	3	16.67
13902.	Tofumaster (khenglon)	18	68.35	78.49	3	16.67
13903.	Kayak (kayakcanoe)	18	60.02	71.41	2	11.11
13904.	Kathy (kathy_starfire)	18	72.24	96.57	3	16.67
13905.	Kareem (kareemshehata)	18	42.48	53.48	0	0.00
13906.	KamilJan (kamil_jan)	18	90.05	100.97	7	38.89
13907.	Kacper (kacperpro)	18	99.21	124.38	13	72.22
13908.	James (justjames)	18	79.43	96.08	6	33.33
13909.	Julio (julio7125)	18	77.04	94.08	2	11.11
13910.	jude (judepls)	18	131.14	147.02	11	61.11
13911.	JSKE25 (jske25)	18	96.79	119.19	10	55.56
13912.	tstats[jpatrocinio5436] (jp...	18	83.14	94.87	9	50.00
13913.	JoYo (joyojo)	18	88.70	101.13	11	61.11
13914.	Joshua (joshuasymes)	18	87.33	105.68	8	44.44
13915.	Jonathan (jonc2002)	18	117.48	136.88	9	50.00
13916.	Jonas (jonasv888)	18	74.00	83.99	7	38.89
13917.	Mathew (johnnyio)	18	92.73	107.68	7	38.89
13918.	Johnny (johneeeee)	18	55.39	70.04	2	11.11
13919.	JKJ123 (jkj123)	18	67.18	83.98	1	5.56
13920.	J (jiffan)	18	84.86	96.30	4	22.22
13921.	snb (jftsnb)	18	60.11	69.69	5	27.78
13922.	jewels (jewelsboyfriend)	18	123.81	139.71	11	61.11
13923.	Clippy (jesspacito)	18	96.26	117.05	17	94.44
13924.	Jeremy (jerms716)	18	77.93	92.87	4	22.22
13925.	iquee (jeptha)	18	83.32	94.27	5	27.78
13926.	jaycuaa (jaycuaa)	18	77.30	92.44	1	5.56
13927.	Jawad (jawadwahmed)	18	73.44	90.04	5	27.78
13928.	James (jamesjamesjamesjames...	18	77.48	89.76	6	33.33
13929.	Harikrishnan R (ismashmykey...	18	52.40	59.77	4	22.22
13930.	Isabelle (isabook)	18	87.44	100.53	7	38.89
13931.	IntangiblePri (intangible_pri)	18	86.94	101.21	4	22.22
13932.	Ba (injuredninjaz)	18	89.44	108.61	6	33.33
13933.	INDO EUROPEAN (indo_europea...	18	70.24	86.45	9	50.00
13934.	ImTrash (imreallytrash)	18	91.24	105.19	5	27.78
13935.	SirAlhelm (iliur)	18	90.56	114.23	13	72.22
13936.	KaRMa (ikillyou22)	18	73.30	84.79	9	50.00
13937.	Ian (ianharold99)	18	78.32	98.71	2	11.11
13938.	Yato_Gami (hrittik_brittik)	18	37.96	48.22	1	5.56
13939.	Ishu (holistic_karma)	18	57.62	67.72	5	27.78
13940.	Holden (holden_ford)	18	28.20	36.15	3	16.67
13941.	HEMANTA (hemantahazariraipu...	18	61.05	75.25	7	38.89
13942.	hello (hello_people123)	18	48.72	58.75	4	22.22
13943.	Miyoko (heena_rawat)	18	42.67	49.28	1	5.56
13944.	Hari (hari191197)	18	77.64	98.67	6	33.33
13945.	Hola (harebrained)	18	89.31	101.28	8	44.44
13946.	hannah (hannahq)	18	99.10	120.85	6	33.33
13947.	Halo (halo1)	18	69.05	87.71	4	22.22
13948.	Manuel (haiyaaa)	18	53.79	66.55	2	11.11
13949.	Hmmm2100 (hahha2100)	18	79.96	91.86	8	44.44
13950.	Nandika (gzxccalibur)	18	47.87	53.21	3	16.67
13951.	no accuracy. can't type (gr...	18	122.34	158.63	9	50.00
13952.	Goushique (goushique)	18	80.01	96.97	7	38.89
13953.	Goop (goooop)	18	57.61	80.47	3	16.67
13954.	Eric (godhand4826)	18	70.34	81.88	3	16.67
13955.	gleen (gleenryan)	18	60.79	76.00	5	27.78
13956.	Przemysław (girenkol)	18	67.55	81.69	2	11.11
13957.	Makar (gatimoro)	18	71.30	81.28	8	44.44
13958.	Garrett (garrettchu)	18	128.28	164.03	14	77.78
13959.	Gabriel (gabrielfr2001)	18	88.76	102.17	5	27.78
13960.	gabral (gabral123)	18	76.12	92.11	4	22.22
13961.	Sahil (sahilb7)	18	47.37	60.08	3	16.67
13962.	sahani prasad (sahani)	18	47.05	53.19	2	11.11
13963.	Victor (sadlad)	18	67.29	77.58	4	22.22
13964.	Russell (russellsapphire)	18	99.54	117.19	7	38.89
13965.	Russell (rtx420)	18	58.05	65.91	4	22.22
13966.	Rodrigo (rodgodkiller)	18	63.97	78.87	4	22.22
13967.	Assey (rockae)	18	89.31	109.10	9	50.00
13968.	Robbie (roadcasted)	18	101.80	129.76	6	33.33
13969.	Ruan (rmontelo)	18	92.65	106.50	7	38.89
13970.	rmbench (rmbench)	18	94.06	107.27	5	27.78
13971.	Ji (rk42745417)	18	66.00	77.48	1	5.56
13972.	Riley (rileygramlich)	18	77.27	91.31	6	33.33
13973.	Riley (riela_)	18	75.02	92.74	6	33.33
13974.	Richard (rgoulterbm40dsk)	18	85.57	98.34	6	33.33
13975.	KOCHENGOREN (renasha)	18	84.10	97.67	7	38.89
13976.	Riley (rbogren)	18	76.05	91.37	2	11.11
13977.	ray (raytrace)	18	55.59	69.30	0	0.00
13978.	R0L3eX (r0l3ex)	18	83.72	109.01	4	22.22
13979.	So Slow (quantum1)	18	117.22	137.54	9	50.00
13980.	qria (qria)	18	84.67	97.91	5	27.78
13981.	Qazz (qazztheqazz)	18	90.05	104.07	8	44.44
13982.	Kantapat (pyro_x)	18	55.39	88.02	12	66.67
13983.	pvx123 (pvx123)	18	33.37	38.19	0	0.00
13984.	presto (presto3000)	18	83.02	94.49	4	22.22
13985.	powerofmooogiza (powerofmoo...	18	107.83	125.10	7	38.89
13986.	popsickles (popsickles)	18	90.41	102.77	12	66.67
13987.	W8 4ME (pmarci9810)	18	86.43	98.50	3	16.67
13988.	Jakob Kammerlander (plssnipe)	18	64.45	76.75	3	16.67
13989.	paschalis (platoon132002)	18	45.08	48.92	4	22.22
13990.	Piggie (piggiepoop)	18	112.59	136.34	8	44.44
13991.	Peter (pieter_post)	18	95.00	116.17	14	77.78
13992.	hollow knight (phoenixwleft)	18	66.78	78.17	4	22.22
13993.	Pho (phobreze)	18	85.01	104.16	2	11.11
13994.	Pawan (pawanmsr)	18	55.40	62.03	3	16.67
13995.	Parsa (parsal)	18	81.76	92.77	5	27.78
13996.	Victor (paralisity)	18	65.04	76.57	3	16.67
13997.	Ozymandias (ozymandias_qc)	18	67.96	79.21	5	27.78
13998.	Fauzan (ozaenzenzen)	18	109.59	122.36	6	33.33
13999.	Owen (owenl131)	18	101.44	113.32	10	55.56
14000.	annette (owannette)	18	96.24	109.07	9	50.00
14001.	Johnny (onireves)	18	101.36	126.07	10	55.56
14002.	om (om0305)	18	65.61	76.69	5	27.78
14003.	Omar (oamrelhorbity)	18	55.58	61.77	3	16.67
14004.	Nuteee (nutee)	18	47.97	61.56	0	0.00
14005.	brayn (nmchanab)	18	80.46	86.34	8	44.44
14006.	Nathan (nlaha)	18	78.45	85.88	7	38.89
14007.	Nilacake (nilacake)	18	79.41	96.53	5	27.78
14008.	niko (nikoooo)	18	58.33	75.13	3	16.67
14009.	Nikhil (nikhil142)	18	90.02	106.58	6	33.33
14010.	you (nigamot)	18	63.86	84.68	3	16.67
14011.	Pratyaksh (nickpratyaksh)	18	76.30	92.12	18	100.00
14012.	Bruh (nicesuu)	18	86.33	95.84	5	27.78
14013.	God (nicechop)	18	63.11	71.61	2	11.11
14014.	Tran (newstrung)	18	82.28	91.04	2	11.11
14015.	nara (naraaa)	18	83.73	97.27	3	16.67
14016.	Nafre (nafre)	18	105.55	118.92	10	55.56
14017.	Jose (m_jose)	18	77.88	92.10	4	22.22
14018.	Mymumswims (mymumswims)	18	88.81	106.97	6	33.33
14019.	Mudmai (mudmai)	18	31.76	41.09	1	5.56
14020.	Moukim (moukim)	18	74.01	83.56	2	11.11
14021.	pup (mkpup)	18	73.19	86.67	5	27.78
14022.	Edward (minecrafterman)	18	47.79	57.55	0	0.00
14023.	Mariyan (mimo200be)	18	90.87	97.98	8	44.44
14024.	mike (mikeyfromqueens)	18	94.60	106.78	9	50.00
14025.	José Miguel (mikel2077)	18	84.93	101.22	6	33.33
14026.	mikaelawashere (mikaelawash...	18	73.08	89.02	5	27.78
14027.	midnightsimon (midnightsimon)	18	83.28	104.80	0	0.00
14028.	Martin (mewix)	18	87.07	101.44	1	5.56
14029.	Naisargi (mehtaphysicalfool)	18	87.11	99.48	5	27.78
14030.	Mathijs (mathijsmaes)	18	92.72	108.10	7	38.89
14031.	urmom (mars3000)	18	78.86	86.55	3	16.67
14032.	Mari (maribun)	18	94.53	116.26	16	88.89
14033.	josiah (mangofeline)	18	85.25	113.55	7	38.89
14034.	Manfred (manfredxu99)	18	152.20	179.09	17	94.44
14035.	Ryan (arkephonic)	18	89.59	111.57	5	27.78
14036.	archer (archerlkm)	18	45.06	54.93	3	16.67
14037.	Abdelghani (aogino)	18	59.70	78.53	5	27.78
14038.	Anthony (antoniotheslwotyper)	18	97.60	110.07	6	33.33
14039.	Aniket (aniket__sharma_)	18	43.69	55.91	3	16.67
14040.	anfun (anfun)	18	69.55	86.50	7	38.89
14041.	Carl (andrecar002)	18	57.18	67.48	1	5.56
14042.	AMG F1 (amg_gts)	18	67.59	79.05	4	22.22
14043.	205g0 (alpacav2)	18	112.35	127.06	9	50.00
14044.	moon11111 (aliyuhaidaru)	18	34.91	40.32	1	5.56
14045.	Alexis (alexxxisk)	18	81.64	97.19	4	22.22
14046.	LDVBC (alexouou136)	18	105.73	130.03	9	50.00
14047.	Alex (alexaaaaa)	18	74.89	88.16	3	16.67
14048.	Alex (alex1124)	18	107.36	134.69	10	55.56
14049.	akshat (akxs)	18	113.73	127.28	8	44.44
14050.	Amanda (aj1111)	18	58.92	79.24	3	16.67
14051.	AI (ailinda)	18	40.51	48.88	1	5.56
14052.	Ahmer (ahmergondal)	18	112.79	142.58	6	33.33
14053.	Killuminati (ahmedali25jan)	18	61.17	68.86	3	16.67
14054.	Ahmad (ahmad770)	18	45.87	59.17	2	11.11
14055.	aha (aha_aha2)	18	62.09	71.71	3	16.67
14056.	AgogFox (agogfox)	18	68.10	75.90	6	33.33
14057.	Justin (agent_jl)	18	135.69	149.06	11	61.11
14058.	Afroz (afroz23)	18	47.50	55.85	2	11.11
14059.	Aniket (aero81101)	18	63.15	75.15	2	11.11
14060.	Aditya (aditya_sharma)	18	74.24	87.80	5	27.78
14061.	Bruce Wayne (abhirupdas400)	18	70.20	78.77	2	11.11
14062.	abfh7002 (abfh)	18	51.63	67.52	4	22.22
14063.	Aidan (88its_dvorak)	18	64.19	73.41	7	38.89
14064.	Wong (60484916)	18	61.17	75.15	2	11.11
14065.	yooko (0ctagon)	18	55.79	62.50	3	16.67
14066.	Prince (03000066106)	18	69.35	82.75	8	44.44
14067.	CY Tan (slowest_typer_lol)	18	45.04	55.39	12	66.67
14068.	Lydia (lydia245)	18	50.70	61.08	4	22.22
14069.	Nick (propuzoficj)	18	96.80	117.09	6	33.33
14070.	Zakir (drea041455)	18	76.75	95.08	9	50.00
14071.	Sourabh (100rab)	18	58.86	64.80	3	16.67
14072.	Max (mad_man_max11)	18	57.86	73.78	6	33.33
14073.	David (hongduc1312)	18	45.38	58.41	10	55.56
14074.	ABDULSALLAM (med905040)	18	19.22	22.98	3	16.67
14075.	Abid (abidcsedu)	18	49.37	58.60	1	5.56
14076.	Kartlez (kartlez)	18	35.77	45.78	1	5.56
14077.	Rajat (rajat_2203)	18	52.39	64.52	16	88.89
14078.	Charlie Crossman (iimdrowni...	18	52.78	66.72	1	5.56
14079.	Jequiz (jequiz)	18	89.97	113.55	10	55.56
14080.	TD (tmd33643)	18	83.02	94.73	4	22.22
14081.	Angela (angie361)	18	59.43	67.54	2	11.11
14082.	Araxes (boneyflesh)	18	43.12	55.09	2	11.11
14083.	Gab (pawsthegabe)	18	75.78	91.84	12	66.67
14084.	Manish (manish_84)	18	41.02	47.83	17	94.44
14085.	ahmad (shexahmad)	18	70.11	73.85	4	22.22
14086.	Unaib Syed (unaibsyed)	18	53.48	64.67	3	16.67
14087.	Daniel (danrodbar)	18	42.00	48.57	3	16.67
14088.	Viet (cm3rp)	18	100.75	125.81	15	83.33
14089.	Keenan (keenanpanda)	18	39.76	49.04	2	11.11
14090.	No you (gino455)	18	55.19	66.68	1	5.56
14091.	Colby (iamzcolbz)	18	57.01	62.90	10	55.56
14092.	Miha (mihabala)	18	22.70	26.22	2	11.11
14093.	aialtyn (aialtyn)	18	18.11	21.33	3	16.67
14094.	Sima (sima814)	18	50.02	62.97	1	5.56
14095.	Ludvig (ludvig_tydanus)	18	47.74	57.11	1	5.56
14096.	rob (mortal_)	18	69.61	85.66	7	38.89
14097.	eyeris (eyerisheehee)	18	59.77	75.45	2	11.11
14098.	Kayna (kayna16)	18	58.10	71.74	5	27.78
14099.	Killer (killerswitch)	18	50.55	61.05	8	44.44
14100.	Alan (liquidalanzhu39)	18	108.48	131.77	8	44.44
14101.	bingo (tobingoiscool)	18	97.51	110.67	4	22.22
14102.	Galactipod (galactipod)	18	80.85	93.74	6	33.33
14103.	brody (kingbroseidon)	18	47.46	62.57	4	22.22
14104.	Thai (thaidollasign)	18	74.53	88.46	5	27.78
14105.	Zakary (zakaryatyping)	18	37.43	44.54	2	11.11
14106.	Chris (usan3xus)	18	85.57	100.06	7	38.89
14107.	Refep (refep123)	18	80.00	102.20	7	38.89
14108.	Hephaestus (zeeeekkkeeee)	18	79.05	98.75	4	22.22
14109.	joe (xanthic)	18	120.57	151.28	7	38.89
14110.	Justinas (justasss)	18	69.57	77.20	4	22.22
14111.	Magisplash (magisplash)	18	82.24	103.27	10	55.56
14112.	Will (frostyflakes155)	18	94.85	111.90	9	50.00
14113.	Shivend (shivend)	18	34.20	42.40	1	5.56
14114.	Aiden (smusky72)	18	66.71	81.35	7	38.89
14115.	Sandis (cejayz)	18	75.08	94.68	6	33.33
14116.	Some (typerbetyping)	18	70.98	96.08	4	22.22
14117.	David (davidg0d)	18	85.77	98.91	5	27.78
14118.	𝐼𝓉𝓈𝑀𝑒_ (itsm...	18	34.76	40.95	2	11.11
14119.	Alex M (killawritter)	18	53.25	60.58	7	38.89
14120.	Jay (jayinnn)	18	64.40	70.74	4	22.22
14121.	Dilli (dillisharma)	18	29.83	34.97	3	16.67
14122.	Milan (hwsx)	18	76.50	93.09	7	38.89
14123.	Ikin (ikin_ari)	18	102.38	122.34	9	50.00
14124.	Crescens (crescent0001)	18	60.25	67.59	7	38.89
14125.	J (jeremieshaker)	18	92.99	113.31	6	33.33
14126.	Ekar (argetlam1)	17	92.62	101.56	4	23.53
14127.	Gui (apollovx)	17	65.25	81.25	3	17.65
14128.	Janindu (aokiesan)	17	88.90	104.16	6	35.29
14129.	Ana (anophoo)	17	79.04	89.13	4	23.53
14130.	Annie (anniesshl)	17	66.78	80.13	7	41.18
14131.	ami (amisupreme)	17	110.70	130.11	9	52.94
14132.	amirhossein (amirho)	17	66.81	80.25	3	17.65
14133.	Ashley Harrison (amharrison15)	17	67.76	81.64	2	11.76
14134.	Eric (almiightyeric)	17	57.12	69.75	2	11.76
14135.	Alkinoos (alkonline66)	17	50.96	56.16	0	0.00
14136.	alisha (alishalovesyou)	17	80.12	95.88	2	11.76
14137.	Alinferno (alinferno)	17	70.05	87.93	15	88.24
14138.	Alex (alexhell)	17	82.23	96.30	3	17.65
14139.	Alexandar (alexandargrav)	17	66.77	83.11	4	23.53
14140.	Tobias (akwhideki)	17	89.55	102.03	11	64.71
14141.	Akela (akela123)	17	103.41	118.51	9	52.94
14142.	aibek (aibek210603)	17	43.19	49.76	2	11.76
14143.	ahmed (ahmed98)	17	63.36	76.22	2	11.76
14144.	Ahmad (ahmad4)	17	74.78	92.88	8	47.06
14145.	Louis (advguy)	17	99.00	111.28	9	52.94
14146.	Jack (adc6768)	17	97.37	114.43	7	41.18
14147.	ace (aceguarde)	17	99.80	118.14	16	94.12
14148.	Aboxgwer (aboxthetyper)	17	73.66	89.12	2	11.76
14149.	Abhijeet17o (abhijeet17o)	17	54.02	65.45	6	35.29
14150.	ABe (abenms92)	17	94.98	120.62	3	17.65
14151.	Iam (aaaallleen)	17	71.21	85.18	3	17.65
14152.	aaaaaaaaaaaaaa (aaaaaaaaooo...	17	64.27	76.32	6	35.29
14153.	962 Pixels (962pixels)	17	79.05	90.33	8	47.06
14154.	Jasper (7essek)	17	90.46	98.08	4	23.53
14155.	dd (6768695865)	17	51.17	57.76	1	5.88
14156.	David (2mill)	17	108.17	131.18	7	41.18
14157.	Li Han (1774li)	17	35.66	48.17	1	5.88
14158.	Lime (limabean60923)	17	67.94	77.78	5	29.41
14159.	Mariana (marianafa)	17	54.77	68.06	6	35.29
14160.	Araina (discobroccoli)	17	80.41	96.60	5	29.41
14161.	Jonah (yuuya_hori)	17	71.56	86.24	10	58.82
14162.	Joshua (tjosher)	17	96.19	106.61	7	41.18
14163.	Kanye (viprin_6749)	17	64.20	78.43	3	17.65
14164.	NICK ILARIDIS (nilaridis)	17	30.41	34.37	0	0.00
14165.	Ajax (ajaxdavis)	17	83.20	109.64	10	58.82
14166.	Pratyush (_darkcrow_)	17	55.39	63.39	4	23.53
14167.	Gustav (rexdk123)	17	47.23	55.56	4	23.53
14168.	3Cow (kendogplayz)	17	62.13	82.51	3	17.65
14169.	Mike (munduss)	17	121.36	146.77	9	52.94
14170.	noyoudweeb (noyoudweeb)	17	68.53	81.11	7	41.18
14171.	joe seph (loer)	17	86.40	103.74	6	35.29
14172.	Havinastroke (saltyhavin)	17	61.21	80.11	4	23.53
14173.	Afraaj (afraj)	17	63.31	74.28	4	23.53
14174.	Akshat (nothingness_)	17	55.98	65.54	5	29.41
14175.	Degeu (darius_primarul)	17	48.99	55.69	2	11.76
14176.	tmurtle123 (whenindan)	17	89.89	113.02	5	29.41
14177.	Cole (mechanicalmac)	17	60.26	69.60	4	23.53
14178.	AbeerOP (jazztoofast)	17	65.69	75.06	2	11.76
14179.	Kazu (kazu_0321)	17	43.23	50.99	4	23.53
14180.	Riu (yung_sushi)	17	51.81	64.27	9	52.94
14181.	jaoo (joaocunhajeronimo)	17	80.71	105.40	4	23.53
14182.	Cooper (cooperskat)	17	96.60	112.28	9	52.94
14183.	Sizzles (sizzlessnake)	17	31.79	36.43	2	11.76
14184.	Lukas (jabo_o)	17	30.85	36.77	5	29.41
14185.	ming (conphusion)	17	85.78	99.34	9	52.94
14186.	Eddie (edlebo)	17	77.36	91.51	4	23.53
14187.	jfjjrmfjg (jfjjrmfjg)	17	84.53	97.31	5	29.41
14188.	Joel (tellurican)	17	77.71	86.57	9	52.94
14189.	Daniel (serthh)	17	44.98	51.86	1	5.88
14190.	Stan (st4n)	17	72.93	82.01	1	5.88
14191.	Galeona (galeona)	17	68.17	77.92	4	23.53
14192.	Eats Their Veggies (eatsthe...	17	82.43	99.71	7	41.18
14193.	Thomas (tommytunes)	17	54.22	62.65	4	23.53
14194.	hoan (hoah_)	17	96.03	123.40	7	41.18
14195.	mav (mavx)	17	55.30	65.69	1	5.88
14196.	Appu (notappu)	17	46.44	59.45	3	17.65
14197.	cal (calcife)	17	94.53	136.45	5	29.41
14198.	Ben (crispr)	17	65.52	74.94	4	23.53
14199.	Ikhwan (khxirules)	17	43.08	55.99	3	17.65
14200.	Jack (jaxk45)	17	76.06	91.98	12	70.59
14201.	xc (bighmann)	17	73.15	100.95	4	23.53
14202.	Thomas (thetrain)	17	57.09	79.30	1	5.88
14203.	Sotoray (sotothecomedian)	17	54.46	67.40	1	5.88
14204.	sweatings (sweatings)	17	76.33	90.39	5	29.41
14205.	ainchester (razorcluster)	17	59.21	71.12	3	17.65
14206.	David (david2026)	17	58.21	66.28	4	23.53
14207.	Philippos (exterminator1000)	17	52.71	67.80	5	29.41
14208.	Ariz (arizb)	17	70.35	81.60	9	52.94
14209.	viDoppio (vidoppio)	17	72.85	91.02	4	23.53
14210.	Abdullah (toooi)	17	40.70	45.84	3	17.65
14211.	jmarttinen (jmarttinen)	17	76.61	86.78	6	35.29
14212.	Mlon Eusk (al2698)	17	75.52	92.28	3	17.65
14213.	Jonathan (swatjkon)	17	80.58	95.90	5	29.41
14214.	Wise Intelligent (wise_inte...	17	64.59	73.89	5	29.41
14215.	Mahboob (mahboob56)	17	86.41	100.48	9	52.94
14216.	Ripper (anikettheripper)	17	44.69	54.09	2	11.76
14217.	anAVGtyper (mallunahi)	17	58.24	73.19	0	0.00
14218.	mads (madsor)	17	57.51	73.27	7	41.18
14219.	Skafi (madps)	17	53.77	64.22	2	11.76
14220.	Mack (mack49)	17	59.92	83.06	4	23.53
14221.	Aiden (maccraker)	17	77.27	92.27	6	35.29
14222.	m3hdi (m3hdi_v1)	17	37.18	42.78	1	5.88
14223.	luiz (lzcr)	17	64.82	75.95	7	41.18
14224.	jonson (lyfissht)	17	78.28	98.03	5	29.41
14225.	Luis (luwec)	17	88.71	103.76	6	35.29
14226.	Luminer (luminerr)	17	71.46	82.06	7	41.18
14227.	sky (lumihime)	17	116.36	130.91	9	52.94
14228.	Lukas (lukaas506)	17	48.97	58.62	2	11.76
14229.	Lucifer (lucifer179)	17	98.82	116.88	10	58.82
14230.	Lucid (lucideous)	17	57.64	71.20	4	23.53
14231.	LoyalPotato (loyalpotato)	17	75.54	86.17	4	23.53
14232.	Lock'd (lockd)	17	88.38	102.83	6	35.29
14233.	Frederick (liquidfyre)	17	84.21	100.27	5	29.41
14234.	John (linkstart15)	17	75.06	98.57	3	17.65
14235.	Linh (linhbo5369)	17	57.95	70.03	5	29.41
14236.	YEET (lemonstate)	17	95.20	105.68	7	41.18
14237.	Endy (legaljeans)	17	76.52	90.58	6	35.29
14238.	Lee-Andria (leelo135)	17	52.29	67.67	0	0.00
14239.	Aidan (leankirito)	17	54.66	61.51	4	23.53
14240.	Dosnt (laxrpy)	17	64.49	74.15	2	11.76
14241.	Lavish (lavish10)	17	62.55	75.12	3	17.65
14242.	Lasey (lasey)	17	95.22	109.65	9	52.94
14243.	Landon (landonthull)	17	73.54	88.77	7	41.18
14244.	Gay Toyholi (l3hargav)	17	88.30	98.37	4	23.53
14245.	Kypster (kypster)	17	90.86	111.69	5	29.41
14246.	kx_167 (kx_167)	17	46.96	58.80	2	11.76
14247.	ItsKevin (kwilz)	17	91.42	103.59	10	58.82
14248.	Vipin (kumarvipin)	17	46.43	54.09	1	5.88
14249.	Kristjan (krissimoney)	17	112.19	128.37	5	29.41
14250.	krishna (krishnatallani)	17	32.11	37.24	0	0.00
14251.	Alex (krim19)	17	108.07	120.27	11	64.71
14252.	ren (krenz)	17	72.64	87.66	5	29.41
14253.	codingmickey (kj_mickey)	17	54.12	66.00	3	17.65
14254.	kinderblack (kinderblack)	17	95.66	106.97	2	11.76
14255.	Rolf (key_fingerer)	17	38.32	44.42	0	0.00
14256.	Kevin (kevinstark10)	17	87.33	103.82	5	29.41
14257.	Kevin (kevgod48)	17	115.50	126.71	9	52.94
14258.	brandon (kbseah)	17	118.52	133.97	7	41.18
14259.	Kathryn (kathrynida)	17	94.40	104.98	8	47.06
14260.	Karston (karstonjim)	17	84.02	93.11	17	100.00
14261.	n (kantotoro)	17	42.98	64.59	2	11.76
14262.	Niko (kale_bog_vremena)	17	51.31	68.39	0	0.00
14263.	Avery (jythonscript)	17	90.03	99.44	5	29.41
14264.	JustMonotone (justmonotone)	17	117.77	131.15	12	70.59
14265.	Juprai (juprai)	17	126.78	155.21	10	58.82
14266.	Julien (julien123)	17	38.91	44.81	1	5.88
14267.	Jacob (jq231)	17	116.54	138.78	9	52.94
14268.	Jonathan (john_ee)	17	58.73	66.67	4	23.53
14269.	John (johnnymauser)	17	80.34	96.58	3	17.65
14270.	Joe (joemama17)	17	92.86	113.57	5	29.41
14271.	bryan (joebidens_son)	17	70.88	92.65	12	70.59
14272.	Jorgle (jmgcito)	17	65.78	83.65	5	29.41
14273.	Jimmy (jimmyceballos)	17	74.20	97.68	3	17.65
14274.	The Dank Duck (jephjeff)	17	73.05	83.54	4	23.53
14275.	Jacky (jclau299)	17	94.01	110.55	10	58.82
14276.	jazon (jazonandes)	17	121.24	160.25	7	41.18
14277.	Jaxson (jaxxxson)	17	110.79	123.81	7	41.18
14278.	javoscript (javoscript)	17	83.73	90.36	6	35.29
14279.	Jason (jasonliang19)	17	88.47	111.54	5	29.41
14280.	Jakob (jagebuuu)	17	52.96	62.75	2	11.76
14281.	Jordan (j0rdanb)	17	85.97	99.53	9	52.94
14282.	Farrel (i_i_c_h_e_n_i_i)	17	95.63	115.35	5	29.41
14283.	Brandon (ivantt)	17	105.62	125.86	9	52.94
14284.	ITSPUJIS (itspujis)	17	67.51	89.04	2	11.76
14285.	Iris (irxs_q)	17	145.02	168.48	14	82.35
14286.	DooDoo (ininjashadows)	17	78.53	106.89	3	17.65
14287.	Nolan (ilovebluecars_13)	17	13.71	17.01	5	29.41
14288.	Iliya (iliyacloud)	17	53.99	71.22	2	11.76
14289.	Imad (ikhan9059)	17	46.81	55.83	2	11.76
14290.	IDK (iimarch)	17	36.66	47.60	1	5.88
14291.	stef (ihasstuff)	17	71.84	80.29	7	41.18
14292.	Ivan (ichauster)	17	109.09	137.19	7	41.18
14293.	hwalters360 (hwalters360)	17	108.32	133.34	10	58.82
14294.	jib (huwakiin)	17	71.00	79.33	10	58.82
14295.	Ante (houci)	17	111.93	131.37	7	41.18
14296.	tenzin (hopeful_engineer)	17	83.35	95.89	4	23.53
14297.	hubbe (hoffiis)	17	68.92	75.32	4	23.53
14298.	hksgiroro (hksgiroro)	17	56.15	67.76	4	23.53
14299.	Gaurav (hisdudeness)	17	111.21	124.07	4	23.53
14300.	Thebe (hikwon)	17	86.68	98.31	5	29.41
14301.	Vinz (hexxel7)	17	105.75	115.95	8	47.06
14302.	Hexishu (hexishu)	17	105.70	119.66	17	100.00
14303.	Jerry (heatsflamesman)	17	128.45	149.57	14	82.35
14304.	haykalive (haykalive)	17	54.97	64.35	7	41.18
14305.	tstats[harveycoolestkid69] ...	17	103.34	125.94	5	29.41
14306.	Hans (hansyu7)	17	85.19	92.18	6	35.29
14307.	Hamza (hamzayt577)	17	66.34	77.24	1	5.88
14308.	The Legend of Jones (hadgeo...	17	128.08	166.42	7	41.18
14309.	Davey (gujin)	17	113.45	139.35	5	29.41
14310.	GpJay (gpjay)	17	56.54	63.60	3	17.65
14311.	Lukas (gotorono)	17	80.12	91.94	5	29.41
14312.	Connor (gothorpe)	17	65.03	75.03	7	41.18
14313.	jack (golduckz)	17	110.21	131.92	8	47.06
14314.	knowagh (gnoweagh)	17	96.14	105.33	2	11.76
14315.	GitGawd (gitgawd)	17	88.77	104.30	10	58.82
14316.	Shimon (gastronom)	17	69.22	82.66	5	29.41
14317.	AttackKing (garypop)	17	47.29	53.59	3	17.65
14318.	Felix (ganc56141)	17	106.79	130.87	8	47.06
14319.	Gabriel (gabrielot)	17	44.63	52.55	7	41.18
14320.	gabe (gabersnake)	17	84.44	92.84	4	23.53
14321.	IAmAtomicツ (from_phlol)	17	93.28	111.95	9	52.94
14322.	Jakub (frogixd)	17	69.94	80.54	2	11.76
14323.	trapinch_ (fortissim2)	17	123.57	138.15	10	58.82
14324.	Typo (foop101)	17	76.48	92.59	5	29.41
14325.	Flash (flashlegion)	17	53.52	67.42	2	11.76
14326.	Yeeet (flamestar21)	17	45.24	56.30	4	23.53
14327.	Firzan (firzanarmani)	17	68.53	78.11	3	17.65
14328.	Jared (filmman2k3)	17	77.38	104.35	7	41.18
14329.	Francisco (fanaya2001)	17	50.65	69.94	1	5.88
14330.	faf (faf222)	17	48.46	60.26	1	5.88
14331.	Eshan (e_khan)	17	89.68	105.35	8	47.06
14332.	Eustion (eustion)	17	89.91	103.00	7	41.18
14333.	Ethan (ethankramer)	17	68.82	83.58	11	64.71
14334.	Ben (essequattro)	17	101.90	116.36	12	70.59
14335.	mb3awi (emptybox34)	17	100.50	111.41	7	41.18
14336.	wizz (empathetic_orange)	17	48.45	57.81	2	11.76
14337.	emma (emmmmmmmaaaaa)	17	75.12	86.68	1	5.88
14338.	Emil (emle10)	17	98.94	118.12	3	17.65
14339.	Mark (emessdoubleyou)	17	70.10	79.20	4	23.53
14340.	Liz (elizabethl3_13)	17	76.68	100.50	5	29.41
14341.	Someone (elderpotato)	17	88.42	104.55	6	35.29
14342.	Connor (edgeburn)	17	88.67	102.77	5	29.41
14343.	e (eddyhack)	17	89.46	105.81	8	47.06
14344.	Benjamin (echobox)	17	54.84	65.52	1	5.88
14345.	yes (easytoremember1)	17	104.41	116.65	3	17.65
14346.	Luuk (dutchprojects)	17	88.76	108.99	7	41.18
14347.	Megan (durvish)	17	71.83	89.24	3	17.65
14348.	Huy (duchuynguyen94)	17	89.31	97.36	8	47.06
14349.	Benjamin (drwumboo)	17	70.79	85.34	5	29.41
14350.	Andrew JK Brown (droid2)	17	53.90	62.49	2	11.76
14351.	Ghost (djinxkay)	17	116.93	146.25	10	58.82
14352.	Đình (dinhhhaii51)	17	75.18	91.60	2	11.76
14353.	epic gamer (dianalin2)	17	93.35	104.16	5	29.41
14354.	CZ (derpiestme)	17	97.74	111.47	7	41.18
14355.	Niels (dekleinekabouter)	17	83.80	99.35	2	11.76
14356.	Andres (defmaxer)	17	93.33	110.14	3	17.65
14357.	Deepanshu (deepanshu9)	17	66.77	79.33	7	41.18
14358.	Amir (dead_developer)	17	44.15	49.57	2	11.76
14359.	Cedric (ddeadz)	17	85.48	112.35	10	58.82
14360.	David Roberts (davidrobertsla)	17	78.99	99.30	15	88.24
14361.	Darren Goh (darrengoh_23)	17	86.72	104.44	7	41.18
14362.	Bhavya (dark_knight_2914)	17	58.60	70.67	10	58.82
14363.	Patrick (darkpatrick00)	17	99.30	107.26	5	29.41
14364.	Dany (danypeter)	17	75.03	93.78	11	64.71
14365.	nuzzlebuddy (danieldan937)	17	83.76	97.71	3	17.65
14366.	Dana (dana_cardinal)	17	125.09	141.84	13	76.47
14367.	dak (dakn)	17	90.48	104.13	6	35.29
14368.	Dauren (d0ka)	17	52.73	65.05	1	5.88
14369.	Cyrush (cyrus_h)	17	115.97	134.19	11	64.71
14370.	David (cuber988)	17	93.76	100.80	11	64.71
14371.	Crestyn (crestyn)	17	96.97	110.80	8	47.06
14372.	C (cpandar)	17	86.06	101.40	3	17.65
14373.	Rod (compangit)	17	93.66	106.37	6	35.29
14374.	Cole (coleb117)	17	105.78	114.90	0	0.00
14375.	SAM (clencod)	17	65.47	84.76	3	17.65
14376.	Matt (choofkoof)	17	100.69	112.59	10	58.82
14377.	Chessy (chescahi)	17	96.34	111.00	7	41.18
14378.	cheryl (cherylkaiser)	17	66.00	72.71	4	23.53
14379.	chepchombir (chepchombir)	17	68.82	77.37	6	35.29
14380.	Nieves (cheezy_butter)	17	86.10	104.35	4	23.53
14381.	Matija (ch4p0)	17	64.83	74.47	4	23.53
14382.	Casper (casperwang)	17	68.55	82.58	4	23.53
14383.	Isaac (carokann09)	17	100.58	113.60	1	5.88
14384.	mickey (c2sulli)	17	105.74	116.05	9	52.94
14385.	Semih (byshadow93)	17	66.88	78.09	6	35.29
14386.	DeStuert (bully_hunter)	17	59.79	68.60	2	11.76
14387.	deji the tank (bulgewarden)	17	66.92	83.63	7	41.18
14388.	Bogart (bogartii)	17	79.90	87.55	5	29.41
14389.	bobva (bobva)	17	107.02	128.74	9	52.94
14390.	boris (bobi412)	17	54.01	61.83	1	5.88
14391.	Bren (bnern)	17	75.34	89.60	4	23.53
14392.	Ben (blob1010)	17	47.67	59.97	2	11.76
14393.	Björn (bjornboss)	17	69.66	78.60	6	35.29
14394.	Zicheng (bin_laggin)	17	90.06	111.93	8	47.06
14395.	Finnnnnnn (bigfinsfananza)	17	84.61	101.64	6	35.29
14396.	Isabella (bfbubblegum)	17	90.83	103.65	4	23.53
14397.	Robert (bertazz)	17	51.27	59.81	1	5.88
14398.	Ava (berry_blue)	17	77.04	97.01	3	17.65
14399.	Bensie (bensie1)	17	105.05	124.32	14	82.35
14400.	bstridr (bellie__)	17	78.19	93.57	5	29.41
14401.	Phil (beastfromthe_east)	17	57.01	71.19	3	17.65
14402.	Baizak (baizak)	17	43.26	50.86	2	11.76
14403.	Austin (auzzyauger)	17	46.83	56.19	0	0.00
14404.	Alex Grace (attttyila)	17	91.88	101.88	7	41.18
14405.	Dre (atarez)	17	127.68	151.29	16	94.12
14406.	3 (astoria2213)	17	60.56	70.47	6	35.29
14407.	Ashveck (ashveck)	17	64.06	75.90	3	17.65
14408.	Muahmmad (arul2101)	17	64.09	87.76	5	29.41
14409.	ArticSeries (articseries)	17	97.85	106.92	6	35.29
14410.	army (armygirl123)	17	44.48	54.38	1	5.88
14411.	Paul (___paul___)	17	87.84	102.23	5	29.41
14412.	Gagik (_the_wind)	17	68.69	78.15	4	23.53
14413.	Medi (_medi)	17	109.87	127.94	6	35.29
14414.	Kyle (_dukz)	17	79.33	88.09	8	47.06
14415.	Zaid (zzzaid)	17	112.17	146.06	10	58.82
14416.	Winston (zywinston)	17	118.41	138.79	10	58.82
14417.	Free Palestine (zobad)	17	114.84	139.60	10	58.82
14418.	Znypr (znypr)	17	76.17	89.49	4	23.53
14419.	Oscar (zeropuu)	17	72.74	87.67	5	29.41
14420.	Zenyth (zenyth)	17	70.74	74.32	3	17.65
14421.	Kalap (zenithorigin)	17	135.99	160.74	14	82.35
14422.	Mohammad (zargar91)	17	53.91	67.82	2	11.76
14423.	Dan (yugurtz)	17	98.76	133.29	7	41.18
14424.	Yuelia (yuelia)	17	110.42	126.50	13	76.47
14425.	Yousuf Ali (yousuf_97)	17	47.92	55.94	5	29.41
14426.	Jo/yf (yousseff)	17	74.90	86.04	7	41.18
14427.	youcef (youcef_kehal011)	17	35.10	43.25	0	0.00
14428.	Eddie (yogurtdan)	17	83.07	121.00	1	5.88
14429.	JRD (yesjrd)	17	107.88	123.19	7	41.18
14430.	Suken (x_suken_x)	17	87.69	102.04	4	23.53
14431.	Sean (xslslx)	17	79.03	96.98	3	17.65
14432.	Grzegorz (xreere)	17	61.36	75.94	0	0.00
14433.	Justin (xpirep)	17	101.26	119.19	6	35.29
14434.	Nepotism (xjqm_z)	17	89.79	107.80	3	17.65
14435.	William (xenosaints)	17	108.43	125.59	7	41.18
14436.	Louis (xchampionx)	17	128.38	152.00	14	82.35
14437.	Riley (wulfmane)	17	86.16	122.06	5	29.41
14438.	Olivier (whiskyforagrownman)	17	93.70	116.56	6	35.29
14439.	Joakim (wakakins)	17	61.08	81.68	1	5.88
14440.	VyPah (vypah)	17	99.03	113.82	12	70.59
14441.	can't type :) (void7750)	17	112.49	126.53	10	58.82
14442.	ViktorT (vitr_88)	17	76.87	85.70	7	41.18
14443.	Erik (virumdreng)	17	89.55	102.66	11	64.71
14444.	Vincent (vincback)	17	104.67	117.42	5	29.41
14445.	Raiko (vilo1)	17	46.57	53.96	3	17.65
14446.	hallelujah (veil)	17	123.66	153.37	6	35.29
14447.	Vavro (vavro)	17	51.20	64.38	0	0.00
14448.	Valian (valian)	17	64.98	72.90	2	11.76
14449.	Vanessa (v4nv4n)	17	104.42	123.82	9	52.94
14450.	yooooooongi (utlyoongs)	17	88.80	107.74	5	29.41
14451.	Unicorn017 (unicorn017)	17	50.81	61.68	4	23.53
14452.	Ulises (umoreno)	17	62.52	69.77	3	17.65
14453.	Tyler47 (tytycrewz)	17	49.20	60.67	5	29.41
14454.	tiramisu (typist786)	17	77.91	86.36	5	29.41
14455.	typing chad (typing_chad)	17	74.68	97.67	0	0.00
14456.	Gerald (tycholoko)	17	74.87	98.40	4	23.53
14457.	Lucas (twinbros)	17	39.66	55.29	14	82.35
14458.	NIETian (tushgaurav)	17	44.84	54.75	10	58.82
14459.	Ryan (turtleboy1017)	17	103.35	112.65	6	35.29
14460.	ttvnaaya786 (ttvnaaya786)	17	89.65	101.20	4	23.53
14461.	Truong (truong_huy)	17	42.26	46.26	0	0.00
14462.	Ralph (triathreat)	17	96.80	124.46	9	52.94
14463.	trer10 (trer10)	17	89.57	102.86	6	35.29
14464.	Benjamin Netanyahu (tp0d)	17	99.35	122.33	7	41.18
14465.	Torron (torronlester)	17	48.16	57.63	1	5.88
14466.	Pratik (torpido99)	17	52.94	67.84	4	23.53
14467.	ㅤ (toptied)	17	101.98	133.73	7	41.18
14468.	Tulaib (toolayb)	17	79.16	94.43	9	52.94
14469.	tippy (tippytypo)	17	109.14	122.69	10	58.82
14470.	Timothy (timothyp823)	17	82.56	89.56	2	11.76
14471.	Nana (tianananana)	17	67.88	75.34	2	11.76
14472.	The (the_omnivert)	17	72.91	84.03	5	29.41
14473.	Theo (the_o)	17	71.89	85.31	4	23.53
14474.	Jon Bob (thejonbob)	17	52.27	66.06	4	23.53
14475.	Ky (thaediir)	17	82.28	98.11	6	35.29
14476.	Alexandro (terribletyper0)	17	78.24	93.75	5	29.41
14477.	Terra (terranavis)	17	98.86	116.53	8	47.06
14478.	Carson (terminator2424)	17	81.16	105.42	5	29.41
14479.	Teho (tehoo)	17	111.31	129.74	12	70.59
14480.	Md. Tahsinul Anwar (tahsinu...	17	63.84	76.47	4	23.53
14481.	john (tacozmanz)	17	81.98	94.05	1	5.88
14482.	emily (swimmerpenguin)	17	101.22	118.35	10	58.82
14483.	John (supercriticalco2)	17	43.84	57.04	4	23.53
14484.	kobus (supercatspeed)	17	26.67	32.50	1	5.88
14485.	hafit (streekytyper)	17	64.80	76.06	4	23.53
14486.	Stefan (stephen27)	17	78.90	86.31	3	17.65
14487.	spiderman (spiderman943)	17	41.35	54.61	2	11.76
14488.	Rice (speedtoggled)	17	81.54	93.88	7	41.18
14489.	Jeel (speedracers_brother)	17	54.72	62.20	0	0.00
14490.	Tommy (sparkxd)	17	75.57	97.13	3	17.65
14491.	Spanchsan (spanchsan)	17	49.59	60.26	2	11.76
14492.	Young (so_many_errors)	17	92.80	112.55	7	41.18
14493.	Soren (sorentypes)	17	79.31	95.54	5	29.41
14494.	Soham (soham_grover)	17	46.72	60.57	3	17.65
14495.	Slowpoke (slowpoketypo)	17	61.07	70.17	2	11.76
14496.	Marie (slowestone)	17	31.30	39.41	1	5.88
14497.	Slicky (slickyslide)	17	59.60	66.31	4	23.53
14498.	Sam (sirgalahad7)	17	71.70	80.23	2	11.76
14499.	Katappa (sim007)	17	92.69	123.35	13	76.47
14500.	Spencer (silentfoe9)	17	63.00	71.16	7	41.18
14501.	Sid (sidd31)	17	51.94	57.05	1	5.88
14502.	shcal (shcal)	17	119.96	135.41	7	41.18
14503.	Shane (shane_umayanga)	17	53.64	60.22	1	5.88
14504.	shmz (shamyob)	17	60.58	70.22	2	11.76
14505.	Serhii (sergomashina)	17	58.36	63.57	5	29.41
14506.	Sepia (sepiadrunfada)	17	54.78	60.78	1	5.88
14507.	SeniorMomo (seniormomo)	17	105.68	131.57	8	47.06
14508.	Nathaniel (scryo)	17	70.46	94.65	3	17.65
14509.	schru (schru)	17	83.37	90.75	8	47.06
14510.	SantiX (santix1225)	17	71.92	91.77	7	41.18
14511.	Sammy (sammykiller)	17	82.93	97.08	4	23.53
14512.	Sujith (sai_sujith)	17	42.87	51.31	2	11.76
14513.	Said (saidahror_2021)	17	85.73	97.57	8	47.06
14514.	Leonardo (saborfaze)	17	67.84	80.34	3	17.65
14515.	R (ryanteebag)	17	116.09	129.02	12	70.59
14516.	Tom (rusteze)	17	66.59	76.41	3	17.65
14517.	Ruslan (ruslancik97)	17	58.07	73.76	3	17.65
14518.	Jessica (runningfox)	17	35.45	43.28	1	5.88
14519.	T (rumikasa)	17	140.68	168.01	17	100.00
14520.	Michael (rucc)	17	87.40	109.99	9	52.94
14521.	Kuy (rou168)	17	98.49	111.79	9	52.94
14522.	Leimondu (roshia)	17	95.37	104.80	7	41.18
14523.	tstats[roselaflesh] (rosela...	17	90.70	108.84	6	35.29
14524.	Roboute (robosote)	17	85.61	96.18	8	47.06
14525.	Ryan (rloftus)	17	65.17	70.70	2	11.76
14526.	I'm bad at this :( (rl27)	17	115.27	125.03	12	70.59
14527.	spi (ririnasandasimp)	17	68.90	87.88	16	94.12
14528.	Tuna (rippleshark)	17	55.76	66.02	3	17.65
14529.	Rick (rickssbm)	17	89.08	96.75	6	35.29
14530.	daydreamer (rhebbar)	17	29.72	37.49	2	11.76
14531.	Rey (reycuadrado)	17	115.20	147.96	8	47.06
14532.	Jake (relaxing)	17	57.41	68.16	3	17.65
14533.	rehsur (rehsur)	17	76.30	88.43	5	29.41
14534.	Regz (regz84)	17	84.70	99.49	8	47.06
14535.	Josh (raybanned)	17	84.02	108.86	3	17.65
14536.	forrest (rares9110)	17	50.47	57.78	3	17.65
14537.	rakushun (rakushun)	17	35.72	43.52	2	11.76
14538.	Rae (raedog)	17	119.09	138.95	6	35.29
14539.	Joses (radcaly)	17	71.27	86.41	3	17.65
14540.	Road to 90 wpm (qimichanga)	17	70.22	82.54	5	29.41
14541.	Rahil (prplplay)	17	58.46	67.38	2	11.76
14542.	Pradip (pradipg)	17	75.60	109.39	13	76.47
14543.	พงษ์ปกรจ์...	17	32.88	40.70	11	64.71
14544.	Scott (pogogunner)	17	85.28	103.09	9	52.94
14545.	Punch (pognick)	17	100.03	111.93	6	35.29
14546.	PNBLVN (pnblvn)	17	87.49	101.95	5	29.41
14547.	Plohka (plohka)	17	75.36	89.86	6	35.29
14548.	Renaldi (plbu)	17	74.46	92.40	3	17.65
14549.	mati (pitoloco)	17	49.98	64.89	1	5.88
14550.	PeterParker20 (piter11116)	17	78.75	94.08	6	35.29
14551.	Bryan (pinkypoo)	17	69.07	77.41	3	17.65
14552.	Myron (piececontrol_inq)	17	47.13	53.19	3	17.65
14553.	Hans (phindy)	17	99.50	124.79	3	17.65
14554.	Philluminati (philluminati)	17	81.99	95.35	5	29.41
14555.	Vidu (pererav)	17	60.13	68.97	3	17.65
14556.	Pelli (pellikan)	17	89.82	104.26	4	23.53
14557.	Rohith (pebblepot)	17	56.35	72.16	3	17.65
14558.	Paul (paultot)	17	32.80	39.35	2	11.76
14559.	🐌 (paultippt)	17	69.84	80.51	4	23.53
14560.	Patryk (patryk5361)	17	73.27	86.85	5	29.41
14561.	PapaCologne (papacologne1)	17	59.90	70.44	2	11.76
14562.	owlsoup (owlsoup)	17	93.34	115.70	8	47.06
14563.	OP (owenpatch)	17	99.21	115.02	6	35.29
14564.	Otakranio (otakranio)	17	63.91	83.28	4	23.53
14565.	piglet (orangepig111)	17	84.93	100.29	6	35.29
14566.	Onur (onur0591)	17	83.66	99.52	8	47.06
14567.	Omer (omersudo)	17	71.85	81.97	2	11.76
14568.	Ascend (obaht)	17	49.44	56.41	1	5.88
14569.	Nuwaisir (nuwaisir)	17	70.61	79.55	2	11.76
14570.	Tom (noviamagna)	17	104.82	123.16	5	29.41
14571.	noctnight (noctnight)	17	107.00	128.26	13	76.47
14572.	nkunder (nkunder16)	17	50.73	60.35	2	11.76
14573.	Do people have computers in...	17	75.83	91.35	1	5.88
14574.	nilebr (nilebr)	17	96.69	108.73	2	11.76
14575.	nikola (nikininja13)	17	63.47	79.07	4	23.53
14576.	ning (niing)	17	74.38	89.55	7	41.18
14577.	Nicholas (nicholaspatrick)	17	88.73	105.12	2	11.76
14578.	nam (ngxnam)	17	73.31	86.36	4	23.53
14579.	neville (neville_dnbh)	17	55.15	69.03	4	23.53
14580.	Natalia (natalia153)	17	55.91	65.61	4	23.53
14581.	MehproPlayz (mythicfx)	17	44.32	56.04	7	41.18
14582.	Michael (mwik)	17	108.25	122.23	8	47.06
14583.	Peter Paul "Paulie Walnuts"...	17	106.88	117.44	12	70.59
14584.	Munkhzorig (munkhzorig_0918)	17	42.33	48.37	1	5.88
14585.	Multi (multibala)	17	24.67	31.46	5	29.41
14586.	k1p (muggz)	17	77.21	100.70	3	17.65
14587.	moschisch (moschisch)	17	51.67	62.87	1	5.88
14588.	Monica (moni1101)	17	63.74	73.62	4	23.53
14589.	Moe (mohannd_h)	17	61.03	69.28	5	29.41
14590.	Timotej (mistimmo)	17	53.38	67.53	1	5.88
14591.	. (mioumioumiou)	17	53.25	62.40	2	11.76
14592.	Jiarui (mike9557)	17	70.50	87.09	4	23.53
14593.	mieszko (mieszkomieszko)	17	102.39	114.73	11	64.71
14594.	Michael (mhmadhatter)	17	72.11	83.46	3	17.65
14595.	Abdulmohsin (mhasen)	17	59.73	68.65	2	11.76
14596.	Janssen (mentalpower_ada)	17	67.17	76.86	7	41.18
14597.	tobias (memebigboyisbig)	17	62.00	68.54	5	29.41
14598.	Maximal (maximalelder)	17	79.06	93.36	7	41.18
14599.	Romping (max61090)	17	95.33	107.19	9	52.94
14600.	Matthew (matthewb83)	17	91.10	106.01	9	52.94
14601.	b lmao (matt16861)	17	129.39	144.72	12	70.59
14602.	Tahj (mathpunsaresin)	17	73.46	84.85	5	29.41
14603.	Max (marvelnoodles)	17	67.18	81.76	5	29.41
14604.	Martina (martinaon)	17	115.70	140.90	12	70.59
14605.	Cody (marshmink)	17	88.68	102.61	5	29.41
14606.	Aleksa (mandorinaa)	17	68.88	78.70	5	29.41
14607.	Baibars (sazin_me)	16	62.84	70.92	7	43.75
14608.	Jason (samuraishinobi)	16	63.49	72.14	3	18.75
14609.	siri (sag339)	16	102.81	135.23	5	31.25
14610.	karrar (saffa990)	16	60.90	72.01	5	31.25
14611.	Ryan (rya_nly)	16	119.87	145.86	11	68.75
14612.	Ryan (ryantam279)	16	68.86	80.26	7	43.75
14613.	Rustem (rus101)	16	108.82	125.69	6	37.50
14614.	Abdurrachman (rrachman)	16	68.11	81.75	6	37.50
14615.	Herve Tran (royale81)	16	77.70	90.70	8	50.00
14616.	Andrew (ronioz)	16	79.58	91.93	6	37.50
14617.	রিফাত (rifat_072)	16	74.52	89.88	6	37.50
14618.	LacticMilk (richardios275)	16	73.43	87.53	2	12.50
14619.	Yah (reveri)	16	80.23	91.94	5	31.25
14620.	OREO (reocraft)	16	108.15	138.98	9	56.25
14621.	Shaggy (remrem0)	16	84.97	100.30	3	18.75
14622.	Morris (reinheart)	16	114.51	124.60	7	43.75
14623.	Robertas (rebutis)	16	69.91	76.43	6	37.50
14624.	Preet (rahal)	16	58.80	71.89	4	25.00
14625.	My (qwertytheuiop)	16	53.65	61.79	5	31.25
14626.	Kim (qwerko)	16	78.77	95.21	6	37.50
14627.	Harry (qqwwddvv852)	16	63.13	75.62	3	18.75
14628.	Qianxu Guo (qianxug)	16	94.44	112.39	10	62.50
14629.	Puppet (puppetsfingers)	16	90.39	114.61	6	37.50
14630.	Xingyu (pumpkinlighter)	16	56.79	67.13	3	18.75
14631.	PraWin (praveenapk)	16	56.47	63.73	3	18.75
14632.	Murphy (pouyacr72)	16	60.05	75.64	2	12.50
14633.	PotatoMike (potatomike)	16	89.41	111.48	4	25.00
14634.	21337R (poptart128)	16	109.92	131.56	10	62.50
14635.	ahmed (ponochio_)	16	52.92	60.51	4	25.00
14636.	PizzaPortal (pizzaportal)	16	77.76	107.24	7	43.75
14637.	chimp (phucktyping)	16	106.31	131.82	7	43.75
14638.	ph (phmi)	16	85.22	103.23	6	37.50
14639.	peppy (peppersteaku)	16	96.22	120.21	4	25.00
14640.	Philip (pengzz)	16	81.91	95.23	5	31.25
14641.	Farm (pandamkii)	16	99.82	115.63	9	56.25
14642.	Polly (pajberman)	16	114.12	134.28	8	50.00
14643.	Pablo (pablurp)	16	104.04	133.30	10	62.50
14644.	p055am (p055am)	16	55.41	70.01	6	37.50
14645.	oriom (orionrw)	16	119.99	138.57	11	68.75
14646.	OobertsTyping (oobertstyping)	16	106.38	124.11	7	43.75
14647.	Apple (omnipotential_magic)	16	70.82	80.22	1	6.25
14648.	Christopher (omicronexe)	16	77.04	94.87	7	43.75
14649.	Omar (omarkhair)	16	62.14	70.09	3	18.75
14650.	Olan (olan10001)	16	71.05	87.13	4	25.00
14651.	Noam (okahama)	16	71.53	86.41	3	18.75
14652.	Oink (oinklmao)	16	67.30	80.08	5	31.25
14653.	David (nunyobusiness)	16	123.26	142.17	9	56.25
14654.	vignesh (noob_typer16)	16	50.62	57.65	2	12.50
14655.	noob_slayer (noob_slayer)	16	98.83	111.37	7	43.75
14656.	tstats[n0body] (nobody01)	16	108.31	122.11	7	43.75
14657.	🇵🇸Musashi (noble_addi...	16	75.62	94.11	5	31.25
14658.	nitesh (nkpcpr)	16	37.46	42.75	1	6.25
14659.	Fluoride Action Network (nize)	16	112.69	146.74	6	37.50
14660.	me (ninjagamer0060)	16	61.12	72.74	2	12.50
14661.	Nikki (niksta95)	16	124.62	154.84	13	81.25
14662.	marc (nightowl)	16	86.57	102.19	5	31.25
14663.	Desmond (night9sky)	16	65.19	76.91	4	25.00
14664.	nico yes nico (nic_o_nic)	16	103.02	140.12	5	31.25
14665.	Nick (nick1347)	16	89.42	102.84	8	50.00
14666.	Lucy (nemurinemuri)	16	103.52	112.55	8	50.00
14667.	Nathan (nayteo)	16	71.17	84.45	0	0.00
14668.	naviman (naviman)	16	94.98	114.02	7	43.75
14669.	natc (natc2)	16	84.99	97.86	7	43.75
14670.	tuffghost (namtap)	16	106.84	117.14	7	43.75
14671.	Milan (nalim)	16	72.90	78.94	2	12.50
14672.	Amila (n0wtype)	16	84.01	90.37	8	50.00
14673.	MyNameIsGodzLol (mynameisgo...	16	81.97	97.31	7	43.75
14674.	Joseph (mwita7)	16	59.88	73.55	0	0.00
14675.	Joshua (mr_mushroom_stew)	16	93.18	101.28	2	12.50
14676.	Mon (monmcgt)	16	73.29	86.12	3	18.75
14677.	Bryce (molohov)	16	90.77	116.36	5	31.25
14678.	medham (mohemedham)	16	51.81	61.48	0	0.00
14679.	youknow (moelesteronyakids)	16	24.12	28.38	4	25.00
14680.	Edwin (minsil)	16	87.72	104.94	8	50.00
14681.	◯__ MAX __◯ (minilaytr)	16	79.55	94.68	4	25.00
14682.	TheCuber (mine_star2046)	16	54.56	65.77	5	31.25
14683.	WhySoSlow (milktea_1999)	16	70.41	77.77	3	18.75
14684.	DaturdMig (migueldathird)	16	82.16	91.11	5	31.25
14685.	Emily (miffily)	16	98.22	109.64	12	75.00
14686.	Michał (michal_miszcz_123)	16	52.51	62.38	3	18.75
14687.	Kael (michael_deleon)	16	69.61	80.45	3	18.75
14688.	Garry (megatroop)	16	102.09	108.94	5	31.25
14689.	MD Imran (md_imran_hosen)	16	37.36	44.03	2	12.50
14690.	Boltedツ (mchackerz)	16	89.86	102.58	6	37.50
14691.	matuush (matuush)	16	61.49	70.01	12	75.00
14692.	mathemage (mathemage)	16	78.84	86.38	3	18.75
14693.	Lindsay (math314)	16	108.54	125.96	14	87.50
14694.	tstats[massive_man4] (massi...	16	113.21	144.84	6	37.50
14695.	e (freshcabbage)	16	65.33	80.76	5	31.25
14696.	Alonne (freeman_1337)	16	87.63	95.44	8	50.00
14697.	Connor (frantelle)	16	71.23	87.40	6	37.50
14698.	🔱 (frankzzzzzzz)	16	82.54	89.60	1	6.25
14699.	Andrew (foruforu)	16	92.09	104.81	3	18.75
14700.	Snow (forgotmypassword)	16	103.51	116.87	11	68.75
14701.	Flaze07 (flaze07)	16	113.46	136.79	7	43.75
14702.	Ryan (flamepopo)	16	110.56	130.41	7	43.75
14703.	c4c (firewolfrain)	16	159.90	217.71	14	87.50
14704.	firealpaca1 (firealpaca1)	16	74.71	93.12	7	43.75
14705.	frog (fijixt)	16	92.60	117.46	12	75.00
14706.	Tyler Spruill (fightingox)	16	107.91	125.09	6	37.50
14707.	gonçalo (figados)	16	95.78	106.59	3	18.75
14708.	Abdullah (fe4rlesscloak)	16	100.09	119.65	8	50.00
14709.	FatPanduh (fatpanduh)	16	125.40	136.50	9	56.25
14710.	Vikram (fast_life)	16	44.39	51.31	2	12.50
14711.	Chimaera (excalibur4212)	16	114.09	143.13	9	56.25
14712.	Evelyn (evelyn_mh)	16	75.60	100.92	4	25.00
14713.	EternalTempest (eternaltemp...	16	54.68	63.88	2	12.50
14714.	Eren (eren_ackerman)	16	91.53	108.29	7	43.75
14715.	Epoch (epochisepic)	16	87.89	104.51	4	25.00
14716.	Epic (epic_gamer2834)	16	107.87	133.62	9	56.25
14717.	CJ (entrity_screamr)	16	113.60	136.53	7	43.75
14718.	Enea (enea)	16	66.83	79.51	1	6.25
14719.	Emre (emre0)	16	75.08	85.62	3	18.75
14720.	Elias (eliasjr)	16	72.43	86.45	5	31.25
14721.	Eesa (eesa10)	16	75.80	88.29	4	25.00
14722.	Edwin (edweezy)	16	104.95	120.12	4	25.00
14723.	Edvaize (edvaize)	16	61.02	67.72	4	25.00
14724.	Dennis (dwiebe)	16	45.22	55.19	3	18.75
14725.	MaskDuck (duongmt)	16	51.09	61.14	6	37.50
14726.	Lukas (dundis3000)	16	79.28	90.02	3	18.75
14727.	Aj (drome)	16	65.78	74.61	3	18.75
14728.	peace in byron (driveroncall)	16	120.53	156.84	9	56.25
14729.	Drew (drewsmithworkman)	16	95.09	107.22	5	31.25
14730.	Carson (dramagirl82)	16	71.62	80.60	5	31.25
14731.	Dvorak Keyboard (douglasawe...	16	61.03	75.64	5	31.25
14732.	not a race (donut_gublor)	16	97.77	120.02	5	31.25
14733.	Dongo (dongodm)	16	91.25	129.99	5	31.25
14734.	Spidget finger (djurancigan)	16	87.26	104.95	3	18.75
14735.	Djordje (djo666)	16	97.31	110.20	7	43.75
14736.	DiscoOrc (discoorc)	16	123.47	138.08	6	37.50
14737.	Alex (dippyshere)	16	86.41	108.72	12	75.00
14738.	DJ (dino_dj)	16	60.17	68.01	4	25.00
14739.	Dhruv (dhruvs301)	16	83.65	91.16	5	31.25
14740.	dewy (dewydh)	16	101.67	121.07	6	37.50
14741.	deon (deontan)	16	111.90	124.47	9	56.25
14742.	Parth (demolisher_1209)	16	79.74	97.31	7	43.75
14743.	Debojoti Das (debojoti_soumya)	16	88.24	98.70	7	43.75
14744.	Death (deathexploit)	16	100.79	116.71	16	100.00
14745.	dayqpi (dayqpi)	16	110.50	130.36	8	50.00
14746.	Davx_d (davx_d)	16	122.41	152.13	12	75.00
14747.	Rooster (darkjdm)	16	118.33	142.83	11	68.75
14748.	Nick (darapidninja)	16	76.47	88.79	16	100.00
14749.	Justin (dainese)	16	70.69	83.07	4	25.00
14750.	Christopher X Wu (cw86459)	16	85.75	112.41	1	6.25
14751.	Tim (cupboard)	16	62.47	92.64	0	0.00
14752.	aoxiang (cuiaoxiang)	16	82.16	98.00	6	37.50
14753.	Sid (criptonate)	16	71.87	79.86	6	37.50
14754.	Creepy (creepyreapy)	16	68.85	90.06	1	6.25
14755.	Come (cosmeec)	16	73.23	89.68	6	37.50
14756.	Mason (contourflyer2)	16	55.73	65.17	0	0.00
14757.	lucho (colombimbo)	16	61.15	69.48	3	18.75
14758.	Cocospeed (cocospeedy)	16	47.58	53.45	1	6.25
14759.	clausrogisch (clausrogisch)	16	48.61	54.54	1	6.25
14760.	Alex (chucky9022_)	16	67.69	85.49	3	18.75
14761.	Christian (chrixsi)	16	80.44	95.55	6	37.50
14762.	Joe (chogpamp)	16	64.80	74.06	4	25.00
14763.	Chris (chink344)	16	95.09	110.21	5	31.25
14764.	Mert (chineeswall)	16	61.15	75.71	3	18.75
14765.	Charles (charles0420)	16	49.65	60.40	2	12.50
14766.	Cesar (cesarloachamin)	16	64.28	69.29	2	12.50
14767.	Tomlynn (carriganth)	16	47.15	51.63	2	12.50
14768.	Carlo (carlofletcher)	16	100.51	121.99	8	50.00
14769.	The Milkman (captain_noodle)	16	108.14	125.59	8	50.00
14770.	Lachlan (cancer88)	16	66.24	83.27	3	18.75
14771.	billy (bzmq)	16	117.24	131.02	12	75.00
14772.	Bytes (bytesandbots)	16	77.07	94.58	5	31.25
14773.	Mapko (buffi)	16	73.46	85.72	1	6.25
14774.	budjetti (budgettypo)	16	85.44	102.27	3	18.75
14775.	Kamalesh (brrrr_007)	16	85.12	105.84	4	25.00
14776.	Bronze (bronzefrakk)	16	85.08	94.34	5	31.25
14777.	Breadman (breadman0123)	16	85.39	96.55	5	31.25
14778.	Bosco (boscorj)	16	48.18	61.48	7	43.75
14779.	ahmed (borr3y)	16	52.45	59.20	2	12.50
14780.	Blue._. (bluewaves54)	16	83.91	98.85	6	37.50
14781.	carl (blackhole24)	16	64.15	74.82	5	31.25
14782.	Matthew (binko)	16	84.44	95.56	4	25.00
14783.	yuh (billbrown86)	16	53.08	64.54	2	12.50
14784.	Ben Asam (bemarc)	16	91.14	107.64	6	37.50
14785.	Beluga (belugabetter)	16	94.35	105.86	3	18.75
14786.	Abijith (believertn)	16	53.43	64.48	2	12.50
14787.	Jon (bdnoj618)	16	83.91	96.67	2	12.50
14788.	Sebastian (badwine)	16	55.73	71.77	2	12.50
14789.	Brian (a_job_well_done)	16	132.07	141.19	12	75.00
14790.	Ayush (ayushgandhi)	16	55.93	61.41	4	25.00
14791.	ayrus (ayrus01)	16	56.52	64.17	3	18.75
14792.	leonidas (awsomaw)	16	166.65	190.62	5	31.25
14793.	ava (ava_er)	16	41.40	56.37	2	12.50
14794.	kuan-Yu (austin737)	16	73.26	91.99	4	25.00
14795.	tobias (atomstodin)	16	65.68	82.78	5	31.25
14796.	Askur (askur00)	16	81.14	89.99	7	43.75
14797.	Aridia (aridia)	16	88.39	98.26	7	43.75
14798.	arichnad (arichnad)	16	80.51	103.64	2	12.50
14799.	aorer (aorer)	16	110.01	133.44	9	56.25
14800.	Ritu (anritu)	16	63.79	75.69	4	25.00
14801.	Luke (angelsfan)	16	89.83	105.57	15	93.75
14802.	candyyyyyyy (andewa_05)	16	103.22	121.01	13	81.25
14803.	Anderson (andarson)	16	85.84	96.60	5	31.25
14804.	Anaru (anaru797)	16	82.56	92.37	2	12.50
14805.	Amir (amirtrex)	16	58.06	70.86	3	18.75
14806.	Amir (amirb101)	16	88.71	110.71	13	81.25
14807.	Maccy (amaccy)	16	66.22	74.11	6	37.50
14808.	Ariel :) (alyas94)	16	71.71	85.48	4	25.00
14809.	Alles (allesboem)	16	100.14	118.53	6	37.50
14810.	alex (alexjimma)	16	26.42	31.45	3	18.75
14811.	Karibas (albiones)	16	76.44	89.10	4	25.00
14812.	Mohammad (alamin_typist)	16	84.51	98.83	6	37.50
14813.	Akribes (akribes)	16	92.33	106.94	6	37.50
14814.	Aidan (aidsiskindagoated)	16	67.68	78.03	2	12.50
14815.	ahmed saif (ahmedsaif)	16	69.46	76.54	2	12.50
14816.	ahmed (ahmedfoad246)	16	63.20	73.12	3	18.75
14817.	Harlis (ahk_master)	16	57.41	69.80	1	6.25
14818.	Aviram (adsherun)	16	87.78	107.68	4	25.00
14819.	Adrian (adrian4k_)	16	74.72	83.52	5	31.25
14820.	Karol (adobonimama)	16	83.48	99.08	3	18.75
14821.	Adil (adilmamed0v)	16	86.08	101.23	6	37.50
14822.	Adham2024 (adham2002)	16	60.57	78.39	3	18.75
14823.	Adamowich (adamowich)	16	84.31	102.65	3	18.75
14824.	æ (ac343)	16	100.47	118.13	7	43.75
14825.	Abhinav (abhinav28061)	16	38.97	44.36	2	12.50
14826.	Antoni (aachh)	16	108.91	128.50	8	50.00
14827.	Hisham (7ommus)	16	59.68	75.97	3	18.75
14828.	Brenda (6renda)	16	72.21	88.25	4	25.00
14829.	Mat (3nlist)	16	91.67	108.45	9	56.25
14830.	Donovan (24aad)	16	70.55	81.63	2	12.50
14831.	Haley (21stcenturyasian)	16	47.40	57.95	0	0.00
14832.	ray (rayearly2)	16	74.97	82.07	7	43.75
14833.	Anish (anish592)	16	54.62	63.52	1	6.25
14834.	Delphin (delmasgdp7)	16	45.59	55.31	0	0.00
14835.	Kian (kianhidayat)	16	70.86	84.41	5	31.25
14836.	Lucy (moca_lucy)	16	52.37	61.12	3	18.75
14837.	Adriane (cordzingerr)	16	73.83	94.23	7	43.75
14838.	Bemin (bemin)	16	44.76	63.04	1	6.25
14839.	Matthew (matt5671110)	16	93.68	101.01	5	31.25
14840.	Alijah (user_504)	16	49.78	57.01	2	12.50
14841.	GoldenKoopa (goldenkoopa)	16	60.10	70.79	4	25.00
14842.	toshi (toshi2135)	16	79.67	92.03	3	18.75
14843.	nicholas (xxxtexascion)	16	45.19	54.30	0	0.00
14844.	Sakibul (sakib62)	16	46.27	52.72	5	31.25
14845.	Alden (bibbedtoaster)	16	61.61	77.25	6	37.50
14846.	Julle (aikarauta)	16	94.85	108.73	10	62.50
14847.	tushar mathpal (tmathpal25)	16	49.48	54.69	2	12.50
14848.	NatanTopKek (abrn200)	16	48.25	56.98	1	6.25
14849.	sys3 (neporian)	16	91.34	118.82	4	25.00
14850.	Strattuss (strattuss)	16	101.80	117.40	8	50.00
14851.	Lemon (raymond_p21)	16	86.64	132.09	6	37.50
14852.	James (jfjames101)	16	85.19	95.55	9	56.25
14853.	aspyse (aspyse)	16	85.59	101.37	1	6.25
14854.	Taylor (tparr_05)	16	86.69	99.34	12	75.00
14855.	Shane (oo123654789)	16	67.84	75.93	5	31.25
14856.	quang (lequang89lk)	16	55.82	64.08	4	25.00
14857.	somethhing_324 (somethhing_...	16	30.55	45.01	4	25.00
14858.	LAvi (getoodasuals)	16	79.34	95.10	7	43.75
14859.	OyBer (oyber)	16	51.68	57.41	2	12.50
14860.	Andrew (andyroop18)	16	98.43	120.97	6	37.50
14861.	LISEK (jeneeczek)	16	25.65	33.33	3	18.75
14862.	Anthony (gently162)	16	86.26	108.14	6	37.50
14863.	Virgil (baron_red)	16	57.60	69.87	0	0.00
14864.	Audge (audge9)	16	101.70	111.51	4	25.00
14865.	Tonho (t0nhou)	16	63.07	68.53	1	6.25
14866.	One Handed (samilz92)	16	21.90	27.58	2	12.50
14867.	Vidun (vidunvj)	16	101.92	120.31	7	43.75
14868.	Player5k (player5k)	16	29.65	46.36	3	18.75
14869.	Enrique (enriquejh97)	16	58.66	72.20	2	12.50
14870.	Kári (volcanic_eruption)	16	65.26	74.05	2	12.50
14871.	wiwi (wiwi08)	16	49.40	54.98	2	12.50
14872.	Paul (00000000)	16	70.58	87.89	4	25.00
14873.	private (awwi)	16	54.33	60.04	0	0.00
14874.	xiugaze (xiugaze)	16	76.96	95.82	4	25.00
14875.	ashik (ashikmaximus)	16	27.69	35.08	1	6.25
14876.	Jeffrey (jeffmoore4815)	16	42.65	51.53	1	6.25
14877.	Terrific (samsoft)	16	69.15	82.42	6	37.50
14878.	strideisnot (strideisnot_po...	16	52.69	63.06	10	62.50
14879.	Mikiroow (mikiroow)	16	120.18	128.84	11	68.75
14880.	Stephen (sda370)	16	115.33	133.73	11	68.75
14881.	shawn (tesu23)	16	56.09	62.84	4	25.00
14882.	Orange (imorange)	16	62.94	79.15	6	37.50
14883.	Creamy Poo (mintbreezeplus)	16	55.36	64.02	6	37.50
14884.	Przemysław Węglik (weglik)	16	53.27	66.30	1	6.25
14885.	Chino (chino_mama)	16	102.18	118.06	7	43.75
14886.	nicatiau (nicole_mendes13)	16	50.80	57.69	12	75.00
14887.	Zach (malkyie)	16	87.34	110.30	6	37.50
14888.	maher (maherbmf)	16	46.49	59.05	2	12.50
14889.	Lord (mafiosnik)	16	48.29	55.35	2	12.50
14890.	Macrene (macrene)	16	102.56	118.82	8	50.00
14891.	Mike (m1kep)	16	74.17	97.26	6	37.50
14892.	karen (lvl100karen)	16	101.10	111.96	9	56.25
14893.	Val (luv2swimv)	16	118.93	148.05	10	62.50
14894.	Konstantine (luke_erdman)	16	88.27	96.56	5	31.25
14895.	Louis (lodero)	16	95.86	115.19	10	62.50
14896.	Abdallah (lno_namel)	16	27.39	32.21	1	6.25
14897.	Leo (ljrobispado)	16	68.40	75.88	4	25.00
14898.	Rosen (littlepero)	16	43.70	51.18	2	12.50
14899.	Zhen Qing (lim0721lim)	16	85.62	98.34	3	18.75
14900.	Leon (likarii)	16	88.75	108.00	6	37.50
14901.	Liam (liamc2)	16	62.42	74.73	2	12.50
14902.	lency (lencyb21)	16	47.68	55.06	2	12.50
14903.	Lecailloux (lecailloux)	16	66.49	78.15	5	31.25
14904.	Joash (lastassassin1)	16	77.57	91.54	5	31.25
14905.	Kate (larleek)	16	78.59	92.43	6	37.50
14906.	Kirito (laksh_4uh)	16	65.78	85.19	1	6.25
14907.	Kūfuku (kufuku)	16	68.56	83.08	7	43.75
14908.	Krzyś (kszysio)	16	85.07	103.15	6	37.50
14909.	YAS62kbdfans5 (ksydry6)	16	108.70	119.22	11	68.75
14910.	Kraven (kraven_lupei)	16	125.64	143.02	6	37.50
14911.	Artur (korfey)	16	35.42	40.43	0	0.00
14912.	nick (koot)	16	66.08	82.26	4	25.00
14913.	grace (koald)	16	90.13	103.63	4	25.00
14914.	Koala (koalazoo)	16	125.71	145.49	12	75.00
14915.	(klaritix)	16	137.58	167.33	12	75.00
14916.	Kitkat (kitkatt77)	16	64.25	77.33	2	12.50
14917.	kit (kitkatpaddywack)	16	97.24	110.89	5	31.25
14918.	KimsterH (kimsterh)	16	90.16	110.11	3	18.75
14919.	Lazar (kh00m4)	16	57.35	66.84	3	18.75
14920.	Ken (kgnishere)	16	83.76	92.33	7	43.75
14921.	Kevin (keviniskevy)	16	84.76	101.07	4	25.00
14922.	Keihlan (keihlan)	16	45.00	52.82	0	0.00
14923.	muhammed (katsh)	16	63.40	80.33	4	25.00
14924.	katrina mae (katrinamae_cru...	16	53.87	67.65	11	68.75
14925.	Oscar (karos_uchiha)	16	90.11	105.00	4	25.00
14926.	Karim Alaswad (karim_alaswa...	16	73.42	88.89	5	31.25
14927.	Johan (kankertypen)	16	114.65	137.40	7	43.75
14928.	KachoriJalebi (kachori_jalebi)	16	55.87	68.90	3	18.75
14929.	Kentaro (k3n74r0)	16	116.04	127.59	6	37.50
14930.	Saso McDaso (justtypefast)	16	137.64	161.47	13	81.25
14931.	Im slow (justmecha)	16	63.65	84.48	6	37.50
14932.	Justin (justbh)	16	97.19	110.95	3	18.75
14933.	tesseractive (jupyter)	16	73.73	87.07	2	12.50
14934.	Beilvert (jubeilvert)	16	72.48	87.99	1	6.25
14935.	Kimchi (jrhee)	16	100.39	125.25	6	37.50
14936.	Josh (joshuazhu516)	16	136.50	165.95	6	37.50
14937.	Joshua (joshuac_47)	16	67.77	92.72	8	50.00
14938.	GoneRogue (josephlee)	16	71.10	82.98	5	31.25
14939.	Jordan (jorjorg11)	16	53.27	59.14	3	18.75
14940.	Jordi (jordityper)	16	110.42	126.60	9	56.25
14941.	john mat (john_mat)	16	44.92	57.52	0	0.00
14942.	TypeRacerKid (johnsonbongo)	16	70.46	85.42	4	25.00
14943.	Johir (johir)	16	120.30	133.41	10	62.50
14944.	Johnny (jnguyen732)	16	90.84	101.61	7	43.75
14945.	faster (jjzxc1)	16	75.52	81.13	3	18.75
14946.	B (jixlimmy)	16	112.16	133.80	12	75.00
14947.	TeddY (jirayut)	16	60.03	70.89	6	37.50
14948.	Jezrael (jezjwv)	16	51.63	61.91	5	31.25
14949.	jfiewogh (jfiewogh)	16	92.22	121.19	12	75.00
14950.	jfkdlsaeng (jfkdlsaeng)	16	81.21	103.47	3	18.75
14951.	Mike (jewunit)	16	105.06	131.60	4	25.00
14952.	Jesus (jesus08)	16	62.52	72.14	5	31.25
14953.	Jaffri (jeffli2000)	16	90.71	103.54	9	56.25
14954.	Joseph (jdog_ld)	16	77.35	93.51	5	31.25
14955.	Jay Jo (jay20051209)	16	91.83	112.33	6	37.50
14956.	Jimbo (jarrydschray)	16	49.73	56.49	1	6.25
14957.	Jake (jakesk)	16	97.20	112.21	4	25.00
14958.	G (jaden)	16	83.65	93.91	6	37.50
14959.	Jack_potta (jack_potta)	16	68.36	79.53	4	25.00
14960.	Joerg (jabra11)	16	103.99	115.17	5	31.25
14961.	Parker (i_hunger101)	16	58.21	64.72	3	18.75
14962.	Victor (its_shadow)	16	108.82	127.36	10	62.50
14963.	YT (inverxted)	16	93.56	125.60	9	56.25
14964.	huessy (independencyy)	16	129.82	149.98	10	62.50
14965.	Jason (illumathottie)	16	97.00	116.33	12	75.00
14966.	abdulkhakim (ihkim)	16	65.30	80.25	3	18.75
14967.	wakolabot (idc_0306)	16	40.42	45.20	4	25.00
14968.	Ian (iancook)	16	95.30	112.66	5	31.25
14969.	AlexiaWasFound (iam_selc)	16	52.99	66.04	0	0.00
14970.	Raju (iamrajukhan)	16	52.36	60.58	1	6.25
14971.	David (hybridlikesrice)	16	124.72	133.70	7	43.75
14972.	Hania (hrychania)	16	43.57	54.40	0	0.00
14973.	Hrm_710 (hrmmm)	16	69.46	82.29	2	12.50
14974.	No one (howardog0707)	16	110.57	132.96	4	25.00
14975.	HJ (hjteq)	16	51.91	58.80	1	6.25
14976.	Henry (henry2)	16	107.74	116.29	9	56.25
14977.	hahah (hahahahahahaaaaa)	16	141.12	156.61	15	93.75
14978.	The killer (haaassan)	16	57.46	69.64	2	12.50
14979.	guhard (guhardos)	16	71.70	79.95	3	18.75
14980.	Chris (guffar)	16	103.57	120.70	5	31.25
14981.	Gnany (gnanickky1)	16	53.45	70.07	3	18.75
14982.	grace (girlalmighty)	16	80.18	95.98	1	6.25
14983.	Christian (gergoss)	16	95.94	117.24	11	68.75
14984.	Gavin (gavtoaster)	16	92.89	107.49	5	31.25
14985.	Garv (garv1908)	16	66.80	75.57	3	18.75
14986.	Galil (galil35)	16	90.16	111.41	7	43.75
14987.	Faaris (fxzz)	16	53.56	66.41	0	0.00
14988.	Swarnim (futuretonystark)	16	55.82	68.88	4	25.00
14989.	Prad (_rad0n_)	16	39.93	52.75	1	6.25
14990.	Itai (zytell)	16	73.08	91.76	3	18.75
14991.	Zond (zohend)	16	55.77	64.33	4	25.00
14992.	Zogurt (zogurt)	16	69.67	84.55	0	0.00
14993.	Jonte (zitrex)	16	91.17	108.37	3	18.75
14994.	Alex (zimbo21003)	16	70.73	83.78	2	12.50
14995.	Zai (zaibeez)	16	86.44	97.38	12	75.00
14996.	Zach (zach_htet)	16	82.76	94.64	3	18.75
14997.	yuts (yts1999)	16	76.51	86.39	0	0.00
14998.	yourrrfattt (yourrrfattt)	16	66.24	79.56	6	37.50
14999.	vaughn (youmomgae)	16	93.91	99.56	6	37.50
15000.	Roy (yoruio)	16	96.73	114.35	4	25.00
15001.	YoloPlayz (yoloplayz10)	16	61.52	76.33	4	25.00
15002.	(yewk)	16	85.31	101.39	8	50.00
15003.	yikes (yeknom)	16	96.03	110.54	7	43.75
15004.	Y (ydelirious)	16	87.42	106.82	4	25.00
15005.	AloneStranger (yasdf007)	16	73.77	79.56	7	43.75
15006.	xnfra (xnfra)	16	65.00	77.21	1	6.25
15007.	winterml3on (winterm3lon)	16	116.90	131.08	7	43.75
15008.	John (wilde1)	16	87.49	107.82	6	37.50
15009.	Mike (wikemazowski)	16	109.51	139.65	6	37.50
15010.	Wexxort (wexxort)	16	64.73	75.85	3	18.75
15011.	Khalid (weebsensation)	16	89.02	96.86	7	43.75
15012.	Teddy (wazazaby)	16	86.59	96.98	1	6.25
15013.	Schakrin (wavezzx)	16	66.25	78.39	4	25.00
15014.	Allison (vllisunshine)	16	72.42	85.96	3	18.75
15015.	Vlad (vlasuo)	16	111.14	138.59	8	50.00
15016.	Pavel (vladmrovich)	16	61.76	70.99	3	18.75
15017.	GargoyleG (vitalstatistixg)	16	91.80	102.09	6	37.50
15018.	viRo (virosnes)	16	116.21	143.24	7	43.75
15019.	vineel (vineel)	16	87.71	102.11	4	25.00
15020.	Vicente (vincetroid)	16	54.12	62.49	1	6.25
15021.	Thanasis (vidani)	16	57.18	68.22	3	18.75
15022.	Shawn (vglunatic)	16	79.72	98.14	6	37.50
15023.	Velonik (velonik_12)	16	60.67	66.60	4	25.00
15024.	Vaibhav (vaibhavvyas)	16	78.67	99.57	5	31.25
15025.	Doomguy (vader_)	16	76.03	92.64	6	37.50
15026.	Anoos (ushagaming)	16	77.63	97.08	4	25.00
15027.	user1458 (user1458)	16	65.39	70.68	4	25.00
15028.	alax (urlonglostdog)	16	65.43	74.34	2	12.50
15029.	Abdullah Al (uniquesociety)	16	56.84	65.49	10	62.50
15030.	YoloSwag (unicornbronie)	16	103.20	117.87	7	43.75
15031.	rycechckn (ultimategammer)	16	106.09	120.29	10	62.50
15032.	UberTraffic (ubertraffic)	16	73.59	85.85	3	18.75
15033.	Typhoid (typhoid)	16	124.08	147.07	10	62.50
15034.	Tyler (tyler3143)	16	94.82	115.82	6	37.50
15035.	TuffTofu (tufftofu)	16	97.17	115.19	9	56.25
15036.	Noemi (tsunommi)	16	87.94	119.76	0	0.00
15037.	Traviz (traviz)	16	78.95	102.56	10	62.50
15038.	Zelymm (toxicmyles)	16	84.46	124.71	14	87.50
15039.	nevergiveup (touristlevelis...	16	80.13	97.26	4	25.00
15040.	Tohru (tohruu)	16	71.43	90.78	3	18.75
15041.	tochidoh (tochidoh)	16	77.87	85.93	3	18.75
15042.	Jump (toadjump)	16	95.57	107.51	5	31.25
15043.	querty (thisiscamelcase)	16	65.51	79.53	2	12.50
15044.	Semanta (the_who)	16	73.73	90.55	4	25.00
15045.	The (theking2007)	16	28.21	32.89	4	25.00
15046.	hal (theemak)	16	49.10	59.67	1	6.25
15047.	teyedix (teyedix)	16	50.69	56.15	2	12.50
15048.	tenxone (tenxone)	16	34.52	45.02	2	12.50
15049.	Collin (temposchool)	16	91.12	113.20	6	37.50
15050.	Balazs (templomos51)	16	72.33	87.23	5	31.25
15051.	Julien (taxes_)	16	60.00	72.28	6	37.50
15052.	Taran (tarankloty)	16	128.87	148.23	7	43.75
15053.	tamjid (tamjid_hasnat)	16	48.73	52.93	1	6.25
15054.	V (tall_in_spirit)	16	141.07	158.97	12	75.00
15055.	Nicholas (swissbanklord)	16	59.33	76.21	3	18.75
15056.	ahmed (sw7ezztyper)	16	72.66	85.21	8	50.00
15057.	Marco (superquack10)	16	52.25	65.21	3	18.75
15058.	Sumona (sumona)	16	38.57	43.68	3	18.75
15059.	Sultan (sultanbro)	16	45.50	52.54	2	12.50
15060.	Hopeless (styrix358)	16	78.40	97.33	2	12.50
15061.	vikas (steady_tortoise)	16	42.35	53.68	1	6.25
15062.	Mirage (starry_mirage)	16	93.48	104.99	6	37.50
15063.	stacie (stackieeeee)	16	77.54	91.73	4	25.00
15064.	Srinivas (srini_iitkgp)	16	99.61	114.28	8	50.00
15065.	sretsaM (sretsam)	16	106.40	126.97	5	31.25
15066.	T-Bird (spartakick)	16	111.51	125.07	6	37.50
15067.	Spadger (spadgerr)	16	115.49	128.23	15	93.75
15068.	Space (spacedandy)	16	95.02	111.90	7	43.75
15069.	Anthony (sp333dy)	16	93.87	115.64	9	56.25
15070.	Sora (sosora)	16	43.03	51.62	3	18.75
15071.	Josh (sorry_typeracer)	16	75.54	94.59	5	31.25
15072.	Hafma (somaliangirl)	16	153.60	169.53	14	87.50
15073.	Ben (softaco)	16	126.34	142.89	4	25.00
15074.	fea (sofea_m)	16	41.50	52.66	2	12.50
15075.	Michal (snowykey)	16	60.76	74.55	4	25.00
15076.	Snouto (snoutowo)	16	98.90	116.57	10	62.50
15077.	Sergey (snich)	16	108.92	116.17	8	50.00
15078.	smowat (smowat)	16	65.26	78.31	2	12.50
15079.	Ernesto (smoking_kills)	16	64.87	80.72	2	12.50
15080.	SmiIe (smiie)	16	104.22	115.28	6	37.50
15081.	Kriss (smashingpinkey)	16	46.87	56.34	2	12.50
15082.	Slok (slokregmi___)	16	47.44	53.82	4	25.00
15083.	Simon (slimsonkysreformed)	16	78.62	92.41	5	31.25
15084.	TianHao (skydrag0n)	16	88.70	99.27	11	68.75
15085.	SIlvester (silvesterfake)	16	81.10	92.59	2	12.50
15086.	Pitt@_____ (shubhamshinde)	16	26.75	32.72	1	6.25
15087.	Shub (shub01)	16	79.50	90.94	2	12.50
15088.	Lee (shriveledegg)	16	94.68	116.48	6	37.50
15089.	Cheg (sheedipants)	16	57.82	66.81	5	31.25
15090.	shumkar (shbarpiev)	16	75.16	92.56	2	12.50
15091.	Severin (sevo4a)	16	106.49	132.97	6	37.50
15092.	Daniel (semashe)	16	90.03	114.73	8	50.00
15093.	segun (segun99)	16	46.65	54.38	1	6.25
15094.	Reggie (_fast_car_noises_)	15	48.77	55.87	1	6.67
15095.	Zozvo (zozvo)	15	45.95	60.35	1	6.67
15096.	Ugnius (zorgas)	15	77.30	91.65	5	33.33
15097.	Zzzzzz (zokey)	15	82.88	90.68	4	26.67
15098.	Varyemez✍️ (ziperz_the_...	15	94.23	103.40	5	33.33
15099.	Kaiden (zentacle)	15	86.56	97.07	4	26.67
15100.	Secre (zenmt)	15	69.98	84.90	7	46.67
15101.	Zane (za_schu)	15	65.66	81.82	3	20.00
15102.	Javin (zakurukito)	15	67.24	77.60	3	20.00
15103.	z1lo (z1lo)	15	62.05	71.65	2	13.33
15104.	( ͡° ͜ʖ ͡°)🖕 (your...	15	95.15	111.89	4	26.67
15105.	yogesh (yogipapu15)	15	60.72	69.48	3	20.00
15106.	Yellow (yellowleaf)	15	78.82	106.30	6	40.00
15107.	Emmett (yamaicewing)	15	68.57	75.73	3	20.00
15108.	Xyhop (xyhop)	15	78.29	92.72	8	53.33
15109.	JJ (xvitrix)	15	98.06	115.40	6	40.00
15110.	Ricards (xricheeh)	15	50.12	57.84	0	0.00
15111.	jie (xonjiex)	15	98.62	113.71	5	33.33
15112.	xcz (xcz05)	15	99.82	109.62	4	26.67
15113.	enfonius (wssh)	15	136.68	162.85	0	0.00
15114.	Mateusz (wirelesss)	15	53.15	60.94	4	26.67
15115.	William (will_exe)	15	48.98	55.17	2	13.33
15116.	WooshWoosh (wiertsmenator)	15	60.79	71.51	4	26.67
15117.	whaterman (whaterman)	15	63.47	78.50	8	53.33
15118.	Mikel (wellthatwasfun)	15	98.00	114.07	11	73.33
15119.	anousa (weebwithadog67)	15	108.00	123.71	9	60.00
15120.	Mark (waybeyondhope)	15	39.29	52.66	2	13.33
15121.	ivanchrome (watonearth)	15	103.96	119.73	7	46.67
15122.	Ken (waterlemon48)	15	88.79	106.11	7	46.67
15123.	Waseem (was11)	15	49.47	52.75	2	13.33
15124.	aleX (waisa)	15	67.31	88.72	3	20.00
15125.	w8 (w8lkinusa)	15	72.48	82.39	4	26.67
15126.	Vodon (vodon)	15	80.56	90.56	2	13.33
15127.	Vito (vito_t)	15	44.09	54.98	3	20.00
15128.	vioco (vioco)	15	74.96	85.06	1	6.67
15129.	Vasi (vasi1333)	15	85.74	95.75	6	40.00
15130.	Utkarsh (utkarsh_n)	15	58.91	70.75	3	20.00
15131.	Usmon (usmon_h)	15	56.38	61.23	13	86.67
15132.	Usman (usmanayubkhan)	15	63.55	76.46	1	6.67
15133.	user (user199012)	15	139.21	190.97	11	73.33
15134.	Gustav (ultragurkatv)	15	61.38	71.73	2	13.33
15135.	uggs (ugo_alo)	15	58.29	71.36	1	6.67
15136.	Brennen (uglyer)	15	108.96	120.27	7	46.67
15137.	uday (uday12381)	15	84.07	99.02	2	13.33
15138.	t_lea (t_lea)	15	87.01	104.62	3	20.00
15139.	Hamlet (typing__words)	15	103.07	130.29	9	60.00
15140.	Mayank (typingbadal)	15	39.53	47.50	1	6.67
15141.	Type (typespeed2020_)	15	87.00	107.07	5	33.33
15142.	Jacqueline (typegozoom)	15	44.36	52.21	1	6.67
15143.	Krzysztof (tygryz)	15	85.18	102.49	4	26.67
15144.	Harry (txharry)	15	96.09	106.71	3	20.00
15145.	Rachel (tweetybirdbird)	15	50.92	64.90	2	13.33
15146.	Tuan (tuan)	15	71.38	79.85	2	13.33
15147.	TryingToBeHooman (tryingtob...	15	63.71	79.15	5	33.33
15148.	trip (triphereon)	15	75.97	84.35	6	40.00
15149.	trailmix (trialtest)	15	103.85	117.29	10	66.67
15150.	Logan (toast_scrubber)	15	87.34	104.49	4	26.67
15151.	try (tipewriter123)	15	85.53	103.31	7	46.67
15152.	Tristan (timmychikin)	15	103.87	115.71	7	46.67
15153.	Justin (thisjustinj)	15	38.93	47.26	0	0.00
15154.	dakshesh (the_teslafan)	15	59.18	78.72	9	60.00
15155.	theunnoticable (theunnotica...	15	116.34	138.53	8	53.33
15156.	Brian (thepinkelephantcar)	15	96.82	124.73	3	20.00
15157.	Jeandre (theopgamer)	15	70.39	84.66	15	100.00
15158.	TGX20 (thegamerx20)	15	103.16	116.81	7	46.67
15159.	the (thebaneet)	15	89.89	108.47	5	33.33
15160.	sash (thatguysash)	15	102.39	118.86	7	46.67
15161.	TGNYC (tgnyc)	15	118.51	128.45	7	46.67
15162.	Temur (temurmannonov)	15	67.20	73.33	4	26.67
15163.	𝕃𝕦𝕗𝕗𝕪 (techon)	15	101.77	113.52	8	53.33
15164.	Tarun (tarun6119)	15	45.85	53.58	2	13.33
15165.	Dreeows (tanziomee)	15	58.72	72.73	3	20.00
15166.	Tanner (tannercraytor)	15	56.64	66.81	5	33.33
15167.	Alex (t3dr)	15	73.01	83.83	3	20.00
15168.	edyn (sylvyn)	15	51.02	60.10	1	6.67
15169.	Alex (swobe)	15	69.50	78.23	4	26.67
15170.	Suttikoon (suttikoonpp)	15	62.90	78.18	3	20.00
15171.	Surya (suryasunkari)	15	99.11	122.52	15	100.00
15172.	Mehmet (superfasttyper_0102)	15	60.94	76.74	3	20.00
15173.	Nuts (sumguy69)	15	112.53	125.23	8	53.33
15174.	dvorshark 🦈 (strongly_ty...	15	114.06	140.93	4	26.67
15175.	StantheAsian90 (stantheasia...	15	84.79	99.35	4	26.67
15176.	Stalking (stalkingdog)	15	86.30	103.51	1	6.67
15177.	Jeff (st1m)	15	50.93	56.63	1	6.67
15178.	George (ssbatch)	15	122.52	136.55	8	53.33
15179.	Chris (splixerr)	15	68.78	83.10	4	26.67
15180.	Brayden (soygoblin)	15	42.23	49.86	0	0.00
15181.	Soxi (soxi_colemak)	15	80.97	101.82	5	33.33
15182.	Toasty (somewhat_toasty)	15	67.88	80.30	3	20.00
15183.	Some1uknow (some1uknow)	15	58.38	66.62	2	13.33
15184.	Sofia (sofia_anical)	15	51.15	58.12	3	20.00
15185.	kowi (smoothfingers)	15	57.00	63.71	1	6.67
15186.	Prasanta (skyline049)	15	47.84	56.81	3	20.00
15187.	Isra-to-Hell (skyarchbeast)	15	101.89	113.33	7	46.67
15188.	Dastan (skitllz)	15	40.02	44.09	0	0.00
15189.	sk (skdreams)	15	87.24	97.31	5	33.33
15190.	simmi (simmi999777)	15	55.73	68.89	3	20.00
15191.	TruffleJr (silvqrfrost)	15	44.40	49.69	1	6.67
15192.	Nedi (silencion)	15	43.44	49.61	2	13.33
15193.	Siddharth (siddharthrajpal)	15	71.55	78.09	4	26.67
15194.	Shrubber (shrubber)	15	67.92	77.28	3	20.00
15195.	Shriram (shri_baj)	15	37.43	44.14	1	6.67
15196.	Zachary (showmanthemoney)	15	82.93	89.94	3	20.00
15197.	Shashank (shashniq)	15	77.51	83.58	6	40.00
15198.	Senin (senin8pagi)	15	102.48	110.91	7	46.67
15199.	Aria (aria_3_)	15	51.16	65.06	3	20.00
15200.	Arian (ariankazemi)	15	35.99	40.97	0	0.00
15201.	arachnodactyly (arachnodact...	15	72.91	82.82	0	0.00
15202.	Chris (angoril)	15	56.82	67.46	4	26.67
15203.	Ele (anemoia)	15	105.68	119.62	5	33.33
15204.	Anel (anelbeads)	15	87.26	104.19	6	40.00
15205.	André (andrepascoa)	15	102.35	111.19	8	53.33
15206.	Anna (ana2007)	15	49.25	60.41	2	13.33
15207.	Amr (amrstien)	15	63.08	74.55	3	20.00
15208.	Ameen (ameen_a21)	15	66.31	80.24	2	13.33
15209.	LolipopAlexx (amazingskep_1)	15	63.89	75.35	3	20.00
15210.	AL1 (al1_16)	15	93.96	109.87	5	33.33
15211.	Akshy (akshy)	15	67.30	81.54	5	33.33
15212.	AjTopper (ajtopper)	15	40.19	47.31	0	0.00
15213.	AJamal31 (ajamal31)	15	79.43	107.30	5	33.33
15214.	austin (aiven)	15	72.52	79.62	5	33.33
15215.	Aidan (aidanmccomsey)	15	108.00	129.23	6	40.00
15216.	joe (aidanbbm)	15	59.08	72.05	0	0.00
15217.	yan (ahugedistraction)	15	88.51	104.30	7	46.67
15218.	Aeiphera (aeiphera)	15	107.33	120.90	6	40.00
15219.	Adam (adamrocks21)	15	56.67	62.33	2	13.33
15220.	Abu (abushakeeb)	15	93.99	108.19	5	33.33
15221.	Abe (abefqy)	15	83.74	116.82	6	40.00
15222.	Abdul Rafay (abdulpak)	15	39.64	47.44	2	13.33
15223.	Eric (20wpmboi)	15	63.31	74.55	3	20.00
15224.	Free Israel (1ocaltechsuppor1)	15	44.28	50.02	2	13.33
15225.	Gabe (115162382)	15	91.64	105.36	7	46.67
15226.	LilJabari (yesitsngo)	15	54.56	65.41	2	13.33
15227.	Sorrow (sorrow_da)	15	45.86	57.47	3	20.00
15228.	Julius (jus_kidding)	15	57.31	73.38	2	13.33
15229.	Brian (brianprs)	15	85.49	98.13	4	26.67
15230.	Gandalf (gandalfthefast)	15	58.89	68.53	2	13.33
15231.	Loan (loanvx)	15	96.33	120.43	5	33.33
15232.	Adam (ska_)	15	81.42	92.89	3	20.00
15233.	Nymeria (nymeria37)	15	93.15	114.05	4	26.67
15234.	David (completedark)	15	84.33	95.74	9	60.00
15235.	Zalabany (zalabany)	15	41.47	51.35	1	6.67
15236.	Yo (yo111)	15	60.15	75.55	4	26.67
15237.	Sam (samr7x7)	15	83.72	95.19	8	53.33
15238.	Rohit (roohitdagar)	15	40.60	48.06	1	6.67
15239.	近平 (trash_game)	15	34.56	40.11	0	0.00
15240.	Jul (happypig2)	15	87.95	104.04	5	33.33
15241.	Dr.Gliscor (drgliscor)	15	56.98	70.53	13	86.67
15242.	ketchup (rawmeatball)	15	104.41	128.96	8	53.33
15243.	captain (fegit)	15	82.87	93.20	3	20.00
15244.	VixenxD (vixenxd)	15	77.80	96.27	5	33.33
15245.	David (chopstick88)	15	73.01	96.13	2	13.33
15246.	josef (cthulhuz)	15	83.08	100.72	7	46.67
15247.	Matthew (mattscabrera)	15	106.64	129.01	9	60.00
15248.	irfan (irfankia)	15	44.50	59.88	7	46.67
15249.	Maddie (massivetrash)	15	73.08	91.05	7	46.67
15250.	Abass (abassali092)	15	52.64	62.25	3	20.00
15251.	Ollie (sherwoodoj)	15	77.47	96.15	3	20.00
15252.	Wenexx (wenexx)	15	75.70	100.13	5	33.33
15253.	Kipen (kipenjago)	15	68.28	78.18	7	46.67
15254.	Dhia (dhiadbh)	15	43.25	57.90	1	6.67
15255.	jlordo (jlordo)	15	91.36	105.98	5	33.33
15256.	Oscar (kull)	15	49.25	58.74	2	13.33
15257.	Laurence (beala_)	15	40.10	51.53	0	0.00
15258.	Andrew (andrew_00)	15	76.24	89.18	4	26.67
15259.	Hanan (sourc)	15	76.75	87.11	5	33.33
15260.	tstats[blosh] (blosh)	15	65.98	76.73	5	33.33
15261.	Adam (secondbesttyper)	15	70.73	83.60	6	40.00
15262.	Neil (bruvm8)	15	46.67	59.07	1	6.67
15263.	Hadouken (hadouken37)	15	94.57	110.70	7	46.67
15264.	Johnnyphan2009 (johnnyphan)	15	89.22	104.70	1	6.67
15265.	Vaibhav (kabir4991)	15	75.90	85.32	2	13.33
15266.	karim (karim32ar3)	15	67.61	80.26	0	0.00
15267.	Christopher (chubbzlyfe)	15	64.43	84.13	1	6.67
15268.	Mika (69ftlongshlong)	15	44.10	52.01	0	0.00
15269.	Rajat (rajat_maurya)	15	87.12	99.11	6	40.00
15270.	Hưng (whathe)	15	46.55	58.50	2	13.33
15271.	Louis (puggichu)	15	78.40	91.69	5	33.33
15272.	friggy (friggy0000)	15	49.48	63.96	1	6.67
15273.	David (tracreed)	15	71.92	88.55	6	40.00
15274.	Samuel (sgpthomas)	15	90.99	111.34	1	6.67
15275.	cmc (codemastercpp)	15	76.92	91.39	4	26.67
15276.	Aryaman (typist1027)	15	82.26	93.37	8	53.33
15277.	Samuel (sammm274)	15	71.21	87.09	1	6.67
15278.	Azim (khalilovdev)	15	35.10	39.14	9	60.00
15279.	Vincenzo (_a_j_)	15	38.26	45.20	3	20.00
15280.	bassic (sakshambassi)	15	48.62	58.19	3	20.00
15281.	demonphase (ebullience)	15	68.29	82.12	1	6.67
15282.	.-. (peoplemaypee)	15	46.37	54.10	6	40.00
15283.	char (wormgirl)	15	80.66	98.03	6	40.00
15284.	D (derniee)	15	85.10	93.35	5	33.33
15285.	Thuuuuuun (thundertsun1)	15	89.71	109.70	4	26.67
15286.	Spect (spect3d)	15	81.93	101.63	6	40.00
15287.	Raven (raven_wong)	15	44.67	52.78	2	13.33
15288.	No (lexblaster)	15	30.53	34.76	1	6.67
15289.	Bhavita Pareshbhai Nakum (b...	15	60.77	84.95	3	20.00
15290.	Betsy (tiddy8bricks)	15	56.51	65.37	3	20.00
15291.	Mike (plane_crash)	15	52.82	62.14	0	0.00
15292.	poli team! (politeam)	15	49.32	60.31	0	0.00
15293.	sdmlkdasm (kilcklack)	15	45.60	49.95	0	0.00
15294.	Daryl (lyradd)	15	69.91	94.68	4	26.67
15295.	Davide Antonio (tamah11)	15	77.11	88.61	6	40.00
15296.	Syed Ashfaq (satmath)	15	41.45	46.08	2	13.33
15297.	Michael (sano459)	15	89.37	95.06	3	20.00
15298.	samsolt (samsolt)	15	51.36	62.87	3	20.00
15299.	Anuar (sagidollaev_)	15	49.29	57.08	13	86.67
15300.	Sagar (sagarcool)	15	48.35	56.00	2	13.33
15301.	George (ryallanrya)	15	108.64	127.06	9	60.00
15302.	Ruff (roofy2004)	15	81.38	92.97	4	26.67
15303.	ROAD TO 100!!! (ronkoe)	15	43.20	49.68	2	13.33
15304.	romo (romokom)	15	30.55	36.19	1	6.67
15305.	Rod_Regus (rod_regus)	15	78.47	87.83	1	6.67
15306.	Rick (rickthetyper)	15	107.66	141.38	4	26.67
15307.	Yuzu (rice_senpai)	15	89.77	102.46	4	26.67
15308.	RiceBOI111 (riceboi111)	15	103.98	128.26	9	60.00
15309.	Ren (renrob13)	15	115.47	132.15	12	80.00
15310.	Rashad (rashad19)	15	64.22	76.51	4	26.67
15311.	wy (randumbtyper)	15	141.49	160.75	13	86.67
15312.	Ryan (raisonfire)	15	97.84	112.90	9	60.00
15313.	nic (rainbowarsenal)	15	104.51	130.97	6	40.00
15314.	Type (racer4587)	15	62.05	92.43	4	26.67
15315.	Cute (rabbit4549)	15	82.22	99.80	4	26.67
15316.	R1ng (r1ng)	15	85.23	103.94	4	26.67
15317.	一向 (quan72io)	15	90.39	99.81	7	46.67
15318.	Fadhil (qazsxdcfv)	15	89.52	111.85	7	46.67
15319.	Pustinek (pustinek)	15	44.39	50.07	1	6.67
15320.	punished buster (punishedbu...	15	78.65	89.42	4	26.67
15321.	pemba (pttpemba)	15	51.69	65.83	2	13.33
15322.	Psychism (psychism)	15	95.19	128.84	7	46.67
15323.	Gregory (prosher)	15	52.33	57.16	1	6.67
15324.	Yut (poominb)	15	83.04	94.71	3	20.00
15325.	Doug (pontiacbandit)	15	73.75	83.23	3	20.00
15326.	Pomochko (pomochko)	15	66.75	83.92	1	6.67
15327.	Tommy (pnkflwrs)	15	88.32	102.25	6	40.00
15328.	Phillip (pjeong3120)	15	96.52	108.72	5	33.33
15329.	Pirapat (pirapatqwe)	15	95.03	114.25	5	33.33
15330.	pintoa (pintoa)	15	85.29	98.73	5	33.33
15331.	Arjun (pikabell)	15	61.46	80.30	3	20.00
15332.	Pieces (pieces08)	15	70.49	76.77	7	46.67
15333.	Hugo (phudgestuff)	15	61.95	72.18	3	20.00
15334.	Phoebo (phooboo)	15	69.57	88.31	4	26.67
15335.	Pearl (pearlescent)	15	121.59	137.60	10	66.67
15336.	patztablook22 (patztablook22)	15	83.83	95.97	5	33.33
15337.	panacotta (panacotta)	15	101.58	114.35	6	40.00
15338.	Olaf (p1stachiofurioso)	15	124.79	137.77	7	46.67
15339.	B (p1geonkid)	15	49.35	56.50	2	13.33
15340.	Krisjanis (overcastace332)	15	88.50	104.05	5	33.33
15341.	fastboi (ooofooo)	15	85.07	96.79	3	20.00
15342.	Isla (oodley)	15	64.83	75.61	5	33.33
15343.	Muhammad Omar (omar_farooq)	15	68.40	80.53	3	20.00
15344.	Omar El-Farouk (omarelfarou...	15	51.00	60.30	4	26.67
15345.	ollir (ollir)	15	99.70	107.53	9	60.00
15346.	Oleg (oleg20111511)	15	77.84	91.21	3	20.00
15347.	m (ogtong)	15	92.81	101.85	4	26.67
15348.	Ogatinasu (ogatinasu)	15	56.73	71.25	5	33.33
15349.	obsidianical (obsidianical)	15	70.17	95.54	3	20.00
15350.	Tobi (obiaas)	15	96.46	108.49	6	40.00
15351.	Zoya (noximy)	15	37.44	49.61	1	6.67
15352.	Nini (notthedestroyer)	15	58.39	69.36	2	13.33
15353.	(nonquit)	15	148.28	166.20	13	86.67
15354.	noman (noman121)	15	39.03	52.42	5	33.33
15355.	Ashraful (noid621376)	15	70.79	86.65	5	33.33
15356.	Noah (noahc3)	15	108.36	119.54	4	26.67
15357.	Nift (niviman)	15	107.36	120.40	7	46.67
15358.	Vinh (ninjapro)	15	75.90	92.57	7	46.67
15359.	Nicolas (nick4652)	15	97.41	113.93	10	66.67
15360.	Zoran (newslowkeyboard)	15	129.48	148.30	11	73.33
15361.	Neko (nekonekokneecaps)	15	93.31	104.32	9	60.00
15362.	Nathan (nathanv)	15	96.62	113.67	4	26.67
15363.	Miracle- (nakatsumiuchiha)	15	70.62	83.42	2	13.33
15364.	Nabil (nabilmuafa)	15	71.26	84.26	4	26.67
15365.	MusicSounds (musicsounds)	15	103.96	125.62	5	33.33
15366.	Mubashar (mubashar_javed)	15	69.37	85.27	5	33.33
15367.	Kirill (mr_beer)	15	46.95	49.72	0	0.00
15368.	פלסטין חופשית (...	15	102.60	114.75	6	40.00
15369.	Marc (mrives)	15	49.99	56.43	2	13.33
15370.	Mr. (mrdayton)	15	61.91	72.87	11	73.33
15371.	Gaurav (moodcode)	15	56.17	68.33	3	20.00
15372.	mt. (monthon993)	15	64.41	70.75	4	26.67
15373.	Justin (moneybagg)	15	67.48	76.20	4	26.67
15374.	Joshua (mochi0607)	15	94.64	121.34	8	53.33
15375.	foenem (mkmares_qwerty)	15	80.99	96.05	3	20.00
15376.	Mistey (mistey)	15	124.86	145.31	14	93.33
15377.	mir (mir_rahat)	15	43.79	50.13	3	20.00
15378.	mirlan (mirlanbek)	15	23.89	30.07	1	6.67
15379.	James (mirdan)	15	81.78	101.64	3	20.00
15380.	Mipow (mipow_kun)	15	62.09	70.62	6	40.00
15381.	Pisser (minsuk7)	15	98.01	110.97	7	46.67
15382.	Deepta (mind_palace)	15	73.12	82.66	2	13.33
15383.	miles (milesgreensmith)	15	82.69	92.83	3	20.00
15384.	Miles (milesgendreau)	15	87.38	108.00	5	33.33
15385.	milan (milansep27)	15	100.59	115.28	14	93.33
15386.	lou (mikubeez)	15	108.65	120.68	3	20.00
15387.	Miguel (miguelkristian)	15	92.78	101.84	3	20.00
15388.	Melvin (melvinmelgar)	15	53.84	60.90	0	0.00
15389.	Erik (mcmanerik)	15	53.63	60.87	1	6.67
15390.	Mateusz (matusz019)	15	67.05	80.46	6	40.00
15391.	tstats[mattinaglass] (matti...	15	68.19	89.61	4	26.67
15392.	Marshall (marshallmaofr)	15	108.39	127.06	8	53.33
15393.	Zheng_Dao (marmot0814)	15	87.22	104.07	5	33.33
15394.	Marlon (marlondestroyer)	15	92.44	101.71	4	26.67
15395.	Marley (marley)	15	99.27	105.63	6	40.00
15396.	Fudl (fudl)	15	53.11	65.49	2	13.33
15397.	veryfatman (frankknight23)	15	84.06	101.27	5	33.33
15398.	Forehead (foreheadq)	15	81.56	96.02	7	46.67
15399.	flashy (flashy1996)	15	80.60	90.19	6	40.00
15400.	J (fingerbanger96)	15	64.86	75.83	6	40.00
15401.	Matyi (filepmatyi)	15	71.40	83.46	3	20.00
15402.	Madi (fastcoder05)	15	47.12	53.16	0	0.00
15403.	farzi (farzi)	15	27.95	33.76	0	0.00
15404.	J (falsekrakk808)	15	101.84	119.18	7	46.67
15405.	sasd (fallenlarry)	15	84.76	104.10	7	46.67
15406.	Faizan Ali (faizanii)	15	45.20	58.41	2	13.33
15407.	facenne (facenne)	15	92.64	110.25	7	46.67
15408.	Ezektor (ezecktor)	15	91.70	110.60	4	26.67
15409.	Exab (exab)	15	54.28	65.26	6	40.00
15410.	Evan (evang12)	15	108.35	127.03	6	40.00
15411.	Juhair (error6251)	15	58.40	64.62	0	0.00
15412.	Erekle (erekle7)	15	53.75	63.12	1	6.67
15413.	Tran (envyriviere)	15	83.63	91.60	3	20.00
15414.	ben (enivre)	15	57.54	73.46	2	13.33
15415.	Paula (ems1324)	15	51.61	59.01	4	26.67
15416.	emre (emrevlog)	15	72.35	82.38	4	26.67
15417.	Matthew (emen_)	15	79.66	96.68	14	93.33
15418.	ElVash (elvash)	15	72.27	86.84	6	40.00
15419.	good (elquines4)	15	104.31	127.97	7	46.67
15420.	Ellie (ellie_mp3)	15	57.09	65.26	1	6.67
15421.	Lise (elishevah)	15	91.86	104.53	9	60.00
15422.	Eli (elijahbu)	15	86.67	97.68	5	33.33
15423.	Elgrekost (elgrekost)	15	68.17	81.63	13	86.67
15424.	elaine (elainezhu)	15	117.72	130.56	10	66.67
15425.	Ethan (ecannoy)	15	105.65	115.28	8	53.33
15426.	aurora (e4monn)	15	114.26	132.85	11	73.33
15427.	drew (drewg2009)	15	87.41	103.29	5	33.33
15428.	DreamCat04 (dreamcat04)	15	43.47	50.37	3	20.00
15429.	dbarr (drbarr)	15	44.04	52.90	2	13.33
15430.	Vincent (doogley)	15	56.90	64.03	5	33.33
15431.	Ali (donlafi)	15	57.18	62.64	3	20.00
15432.	I really like lettuce (domi...	15	99.42	117.13	8	53.33
15433.	dom (domaniquepham)	15	79.52	96.00	6	40.00
15434.	Eddie (diettea)	15	93.84	122.22	4	26.67
15435.	Geraldine (dendenmuushi)	15	40.23	49.05	1	6.67
15436.	Dankman (dedankman)	15	99.76	112.53	5	33.33
15437.	Davis (davis10)	15	61.09	76.07	4	26.67
15438.	David (davidliu323)	15	117.62	135.93	7	46.67
15439.	tstats[darkhat13] (darkhat13)	15	91.96	114.60	6	40.00
15440.	dapho (dapho)	15	73.07	98.05	12	80.00
15441.	Daniel (danrike22)	15	58.88	70.13	0	0.00
15442.	Dan (dankarnus)	15	67.82	79.85	2	13.33
15443.	Dawid (dadik)	15	64.35	75.96	5	33.33
15444.	Daniel (d4mage2k)	15	94.12	108.68	9	60.00
15445.	Ethan (creamycanoli)	15	98.92	126.26	6	40.00
15446.	Peter (crazynumnums)	15	95.17	109.38	9	60.00
15447.	Chris (craastad)	15	82.01	93.16	4	26.67
15448.	Konrad (cornyflakez)	15	93.88	105.85	8	53.33
15449.	Matías (colocolo91)	15	85.24	94.37	4	26.67
15450.	Thomas (coasterman)	15	86.46	100.56	5	33.33
15451.	sheik (clubs_)	15	82.29	104.20	7	46.67
15452.	Alex (citricdolphin)	15	102.34	115.84	7	46.67
15453.	christian (chriz411)	15	85.72	97.46	6	40.00
15454.	Christian (christian_oudard)	15	98.57	117.46	6	40.00
15455.	Chinsetgel (chinsetgel_mgl_3)	15	62.89	72.51	1	6.67
15456.	Chili (chilichonga)	15	63.67	73.30	2	13.33
15457.	Caine (cainegt)	15	78.83	88.48	3	20.00
15458.	Ivan (cactus9800)	15	47.98	53.65	0	0.00
15459.	Meme Page (butsuky)	15	106.06	117.46	11	73.33
15460.	B (btype123)	15	121.53	135.16	10	66.67
15461.	Bryan (bryan675)	15	123.99	145.33	12	80.00
15462.	Bruno (brunokoppel)	15	76.52	94.22	5	33.33
15463.	Bruh (bruh432)	15	104.37	117.80	9	60.00
15464.	brainuser5705 (brainuser5705)	15	89.72	101.72	4	26.67
15465.	Ash (boyfromindia)	15	69.88	88.55	7	46.67
15466.	E (boxofpaints)	15	68.84	73.20	6	40.00
15467.	Joe (bot_joe)	15	85.22	92.19	4	26.67
15468.	BobTuring (bobturing)	15	81.43	106.07	10	66.67
15469.	Bob (bobtyping)	15	78.09	83.84	2	13.33
15470.	Black (blackt)	15	63.33	69.68	7	46.67
15471.	chan (blackstarnova)	15	119.99	136.45	11	73.33
15472.	Krissz (bish1k)	15	91.64	102.81	5	33.33
15473.	Bean (benchen123)	15	91.31	101.10	7	46.67
15474.	bella (beliss08)	15	55.47	63.96	1	6.67
15475.	bee (bee0)	15	112.76	138.95	14	93.33
15476.	bart (bartfart)	15	84.88	92.08	3	20.00
15477.	bantan (bantan)	15	94.79	103.12	9	60.00
15478.	AJ (bacon_is_life)	15	89.07	102.50	6	40.00
15479.	Jacob (a_cheesy_wotsit)	15	85.86	114.16	5	33.33
15480.	Aztixz (aztix)	15	71.04	79.30	4	26.67
15481.	ayumu (ayumuxe)	15	82.22	94.62	12	80.00
15482.	Alex (aymlus)	15	91.36	105.05	6	40.00
15483.	Sean (axelsandrods)	15	64.69	78.91	4	26.67
15484.	awalvie (awalvie)	15	80.32	94.93	4	26.67
15485.	Asif ur rahman (asif_ur_rah...	15	44.83	56.60	2	13.33
15486.	Rimuru (ashborn_tempest)	15	75.66	88.56	3	20.00
15487.	Chris (aschlar)	15	88.09	119.53	3	20.00
15488.	Arzenith (arzou)	15	75.16	91.02	9	60.00
15489.	Malik (madx)	15	71.33	78.46	5	33.33
15490.	MrDiRamio (madiramio)	15	97.27	108.46	9	60.00
15491.	racemaster (madcodez)	15	47.42	53.74	0	0.00
15492.	Jose (lupi1)	15	64.95	72.81	2	13.33
15493.	RJ (lufulu)	15	105.81	130.68	8	53.33
15494.	lucktale (lucktale)	15	92.04	127.67	3	20.00
15495.	Good Vibe Tribe (lucas_lm)	15	86.30	101.09	7	46.67
15496.	_l.y.m.y_ (loyehmoyeh)	15	64.09	75.44	4	26.67
15497.	loow (loowt)	15	59.47	72.54	2	13.33
15498.	lorenzo (lolloz98)	15	69.51	77.39	3	20.00
15499.	Shan (liushanen)	15	87.38	97.44	4	26.67
15500.	Lisa (lissandra)	15	72.39	88.48	11	73.33
15501.	andrey (linus01)	15	33.48	42.38	0	0.00
15502.	Joel (lil_wheeelz)	15	65.85	78.92	15	100.00
15503.	Isaac (libstwo)	15	60.30	73.62	3	20.00
15504.	Liam (liamzammit)	15	56.40	66.78	0	0.00
15505.	Leith (leith_)	15	75.38	95.65	12	80.00
15506.	Kai (leavelux)	15	88.23	99.67	8	53.33
15507.	Dylan (lavafxlx)	15	61.52	80.05	12	80.00
15508.	♠️ lastofspades (lastof...	15	137.26	150.45	11	73.33
15509.	Wade (larrage)	15	95.06	114.71	4	26.67
15510.	kym (kym2006)	15	104.97	123.81	12	80.00
15511.	kward937 (kward937)	15	80.34	95.99	4	26.67
15512.	Kellan (krusher7)	15	62.41	71.72	2	13.33
15513.	Kris (kris_z)	15	119.57	141.02	6	40.00
15514.	kostasss (kostasss)	15	43.12	54.86	2	13.33
15515.	KOOKOWACKYDUCK (kookowackyd...	15	83.86	101.48	6	40.00
15516.	Keziah (kookiru)	15	100.89	116.46	7	46.67
15517.	Honda (konradowtf)	15	63.08	72.29	3	20.00
15518.	Katherine (kleesaunders)	15	101.41	127.75	3	20.00
15519.	Chris (kiousaras13)	15	73.83	92.21	6	40.00
15520.	Phillip (kinkking123)	15	70.99	92.41	6	40.00
15521.	Wil (kingwilyn)	15	56.33	68.50	3	20.00
15522.	Dominik (killersshark)	15	57.29	65.49	4	26.67
15523.	bc (kilk3)	15	88.52	105.55	4	26.67
15524.	Ian (kfcdonutsandwich)	15	93.61	112.84	4	26.67
15525.	Edwin (keyhem_)	15	65.48	75.19	4	26.67
15526.	Kevin (kev011701)	15	110.86	126.85	10	66.67
15527.	Ken (keni98)	15	84.82	99.92	5	33.33
15528.	Kelsey (kelseysd)	15	82.21	111.16	7	46.67
15529.	kelian (kekelian)	15	62.25	68.11	3	20.00
15530.	Justin (keehyu)	15	102.20	113.59	9	60.00
15531.	kynght (kd1157)	15	83.49	102.90	4	26.67
15532.	kchou (kchou0907)	15	73.20	87.02	0	0.00
15533.	grace (katrvey)	15	81.41	95.61	2	13.33
15534.	John (karmetier)	15	89.03	108.25	5	33.33
15535.	Weeee (k1ngsman)	15	104.67	123.31	6	40.00
15536.	Jão (jumamjir)	15	42.56	50.04	1	6.67
15537.	jserv23 (jserv23)	15	106.71	115.91	9	60.00
15538.	poopy (joyuri)	15	99.23	125.37	7	46.67
15539.	Josh (joshcantypefast)	15	112.65	140.89	13	86.67
15540.	qqingcheng! 3 (jorjoresp)	15	95.56	109.29	5	33.33
15541.	josh (jojothebear03)	15	52.98	62.29	4	26.67
15542.	Joe (joe_1)	15	114.15	128.02	9	60.00
15543.	Joel (joelthesuperior)	15	128.21	150.94	6	40.00
15544.	jlsyber (jlsyber)	15	84.90	98.26	6	40.00
15545.	James (jlightning)	15	91.11	100.22	5	33.33
15546.	Joshua (jkm711)	15	70.66	86.53	3	20.00
15547.	Jim (jimvang8790)	15	72.70	79.05	4	26.67
15548.	Logan (jimmybiscuit39)	15	56.25	68.32	3	20.00
15549.	Jiezlin (jiezlin)	15	61.00	68.52	3	20.00
15550.	jeshen (jeshencx)	15	78.43	93.04	4	26.67
15551.	Jelmer (jelmerevers)	15	92.79	107.77	5	33.33
15552.	Jamie (jelly_jam_pudding)	15	75.75	94.00	4	26.67
15553.	Jeff (jeff_1107)	15	70.32	84.71	2	13.33
15554.	Jay (jayl2303)	15	103.23	122.89	6	40.00
15555.	BigJuicySlimy (javewave)	15	79.12	89.09	4	26.67
15556.	Jason (jasonpike)	15	90.26	98.80	1	6.67
15557.	poon (jamiepoon2003)	15	78.25	85.76	5	33.33
15558.	James (jamesmz_101)	15	28.16	35.49	0	0.00
15559.	JKerb (jakerb19)	15	77.43	97.77	5	33.33
15560.	`jakeeee_ (jakee_)	15	99.94	123.41	7	46.67
15561.	Long Double E.T. (jackje)	15	96.31	116.62	6	40.00
15562.	not (j097)	15	70.68	86.55	3	20.00
15563.	iStealCatNips (i_steal_cat_...	15	64.24	84.66	1	6.67
15564.	Joey (itzjoeyz)	15	93.56	114.66	5	33.33
15565.	Its (itslexemic)	15	61.72	75.78	10	66.67
15566.	justin (itsjustinz)	15	81.80	94.75	6	40.00
15567.	Brandon (itsbarn)	15	74.66	90.19	1	6.67
15568.	John (ionas22)	15	33.56	38.67	2	13.33
15569.	banana (intrepid_banana)	15	101.12	119.10	8	53.33
15570.	Laughing Fox (inkeet)	15	73.61	82.93	6	40.00
15571.	Its Me (infinityyt)	15	87.35	107.34	8	53.33
15572.	Inactiv (inactivak)	15	93.55	105.06	4	26.67
15573.	[SCC] Ignis (ignis_sphaera)	15	108.78	120.83	7	46.67
15574.	Robby (icybot)	15	92.04	106.11	7	46.67
15575.	Salvador (ick1salvado)	15	61.88	71.80	3	20.00
15576.	iamyellowhead (iamyellowhead)	15	65.68	81.44	8	53.33
15577.	H_24 (h_24)	15	81.80	105.70	3	20.00
15578.	uy (hygienic)	15	74.20	81.17	1	6.67
15579.	Howard (hwd15508)	15	113.25	134.39	11	73.33
15580.	Nothing (humblepikachu)	15	76.59	94.32	7	46.67
15581.	ben (hobomojo)	15	70.42	82.91	5	33.33
15582.	d (hirundinidae)	15	122.08	138.62	12	80.00
15583.	Abood (hirotto)	15	49.40	59.27	1	6.67
15584.	Henry (henry88k)	15	67.03	76.77	3	20.00
15585.	Henrricos (henrricos)	15	88.67	102.35	3	20.00
15586.	henlojav (henlojav)	15	93.97	111.40	8	53.33
15587.	Harrisandman (harrisandman)	15	66.27	81.69	8	53.33
15588.	Hannah (hann5h)	15	138.88	157.75	10	66.67
15589.	Jack (handsomejam)	15	100.79	114.51	6	40.00
15590.	Haley (halllw)	15	59.10	72.13	6	40.00
15591.	Habib (habibjajawie)	15	105.94	125.85	9	60.00
15592.	h1b80xwl0g1c (h1b80xwl0g1c)	15	47.64	51.18	1	6.67
15593.	Gustavo da Cruz (gustavodac...	15	94.93	123.27	6	40.00
15594.	s (gurub)	15	78.41	109.93	5	33.33
15595.	typingmonster (greenmonster...	15	95.78	107.97	8	53.33
15596.	Vitor (graysheep)	15	54.52	69.52	1	6.67
15597.	Jake (gooserman)	15	73.54	86.44	3	20.00
15598.	Sishir (goon72)	15	83.65	88.36	4	26.67
15599.	Cameron (goldenpenguin)	15	65.77	77.11	3	20.00
15600.	giann (giannperez123)	15	115.00	124.24	7	46.67
15601.	Bahador (ghostnod)	15	104.65	115.18	8	53.33
15602.	Aasish (ghisingo)	15	48.12	56.37	6	40.00
15603.	Siegward (ghin)	15	91.20	112.18	13	86.67
15604.	Marius (ghebu)	15	107.31	131.63	9	60.00
15605.	Genius (genius0teacher)	15	49.32	63.60	12	80.00
15606.	Meagan (gazzoo)	15	103.96	129.02	8	53.33
15607.	peepee (gamerlegion)	15	97.55	112.48	8	53.33
15608.	Gabriel (gabrielvi111)	15	69.87	80.28	1	6.67
15609.	Xuan Thong (fxcvs)	15	59.27	71.21	6	40.00
15610.	funss (funss)	15	71.61	85.11	1	6.67
15611.	Funday (funday11best)	15	71.79	87.42	12	80.00
15612.	Mahmoud (mahmoud_12)	14	38.67	42.95	3	21.43
15613.	Mahbub (mahbubdev)	14	44.72	54.29	0	0.00
15614.	Mystik (magic_mystik)	14	64.77	77.07	6	42.86
15615.	mafia (mafia207)	14	59.16	74.02	3	21.43
15616.	Mac (macthemountain)	14	91.45	115.08	8	57.14
15617.	Μάξιμε (macmo)	14	117.70	129.27	8	57.14
15618.	Luminious (luminious)	14	81.70	95.13	2	14.29
15619.	Luke (lukechevy)	14	74.96	84.94	2	14.29
15620.	j (luckyslayer)	14	73.99	88.54	3	21.43
15621.	LubO_o (lub0_o)	14	69.39	84.07	6	42.86
15622.	Lokyin (lqkii)	14	109.93	138.81	4	28.57
15623.	Aryan (lost_arrow)	14	72.18	85.15	1	7.14
15624.	JR (lordjoshyy)	14	95.84	103.61	4	28.57
15625.	Cookrieme (lonarexiz)	14	80.97	93.41	5	35.71
15626.	Slobky (lmaoxdlolrofl)	14	101.04	121.76	5	35.71
15627.	decadent movement (lkmatter)	14	58.77	64.66	1	7.14
15628.	Sticky (littletea)	14	48.50	56.36	3	21.43
15629.	lil_lobster (lil_lobster)	14	67.79	75.32	2	14.29
15630.	Likkon (likkon_maddik)	14	71.25	84.31	6	42.86
15631.	Lik (lik007)	14	60.87	76.98	5	35.71
15632.	levani (levanacixo)	14	91.47	105.73	7	50.00
15633.	Eric (leftlaneeric)	14	88.77	100.43	12	85.71
15634.	jonathon (laptoptouchpad)	14	67.78	82.46	0	0.00
15635.	Landi (landiepileptic)	14	54.14	71.27	1	7.14
15636.	Cait (lamby17_)	14	76.32	85.02	4	28.57
15637.	Jake (lakejund)	14	105.65	126.08	6	42.86
15638.	Jatin (kumar_jatin)	14	67.55	80.78	3	21.43
15639.	Krish (krish2882005)	14	63.16	81.51	4	28.57
15640.	David (koreanboy)	14	93.21	115.90	3	21.43
15641.	Kirtaph (kirtaph)	14	88.96	115.18	4	28.57
15642.	Ryan (kingdr)	14	59.28	75.19	4	28.57
15643.	Alec (killjoy722)	14	78.62	93.61	4	28.57
15644.	Kifah (kifahthespartan)	14	62.14	78.34	2	14.29
15645.	Eric (keywe)	14	79.62	89.57	5	35.71
15646.	Tomek (kemor)	14	86.48	105.26	4	28.57
15647.	Keks (keksfromnextdoor)	14	61.15	67.80	4	28.57
15648.	. (keelanlambert)	14	57.97	69.44	5	35.71
15649.	Rai (kaythox)	14	108.80	125.70	5	35.71
15650.	nunya (karlremarks)	14	72.62	83.55	5	35.71
15651.	Johnny (k5kk)	14	108.05	142.62	9	64.29
15652.	Bektas (k1ngst0ne)	14	59.36	75.37	3	21.43
15653.	Samuel (justanotherasianont...	14	80.28	96.12	5	35.71
15654.	junior (junior2000)	14	55.89	67.02	4	28.57
15655.	jono (jonohubbard)	14	76.53	95.38	5	35.71
15656.	Jon (jonnylauws)	14	97.47	104.53	4	28.57
15657.	Jon (jon56)	14	82.22	98.58	7	50.00
15658.	John (johnphan05)	14	125.54	144.56	8	57.14
15659.	joe (joe_mam101)	14	59.72	72.27	3	21.43
15660.	Joe (joe_exotic6969)	14	63.03	72.57	1	7.14
15661.	Joey (joeykuo)	14	57.56	70.30	6	42.86
15662.	Jman (jkarlik22)	14	55.97	81.36	3	21.43
15663.	jjpjimmy (jjpjimmy)	14	81.21	98.59	6	42.86
15664.	jithin (jithinjoseph)	14	58.77	69.50	0	0.00
15665.	Jim (jimnguyen)	14	82.57	97.80	5	35.71
15666.	Rohith (jikki)	14	55.79	67.63	4	28.57
15667.	Jerwin (jherwynne)	14	72.08	87.29	3	21.43
15668.	JD (jhaaydee)	14	49.85	62.89	1	7.14
15669.	Imponed (jg814867)	14	74.24	88.90	3	21.43
15670.	JeiJei (jemjem09)	14	62.75	77.99	4	28.57
15671.	Jeffrey (jeffreyfeng)	14	95.86	115.79	5	35.71
15672.	Harry (jeeeerrrpop)	14	75.51	87.90	8	57.14
15673.	joshua (jawwshuaa)	14	99.68	116.47	6	42.86
15674.	Daniel (jansson)	14	93.31	105.69	6	42.86
15675.	James (jamessmurray)	14	53.53	60.11	1	7.14
15676.	James (james494)	14	101.46	112.99	8	57.14
15677.	Jakaria (jakaria_sami)	14	56.63	67.65	5	35.71
15678.	Barrett (jahspp)	14	70.88	81.45	4	28.57
15679.	Jacob (jacob643)	14	81.61	90.57	4	28.57
15680.	Isak (izzeww)	14	92.16	108.62	5	35.71
15681.	Elias (itzner)	14	45.04	59.21	3	21.43
15682.	deydey (iskalaberkberk0427)	14	76.94	88.34	4	28.57
15683.	iron (iron_pickaxe)	14	75.68	90.47	3	21.43
15684.	Nhaatj (iopaosi)	14	50.82	77.90	2	14.29
15685.	qwq (iomeow)	14	47.47	51.77	0	0.00
15686.	Simon (imp4l3r)	14	94.41	121.23	7	50.00
15687.	kian (imkian)	14	56.82	63.34	0	0.00
15688.	impostor (ilikepotatoesixty...	14	92.50	103.50	3	21.43
15689.	Igor (ikarus9393)	14	88.52	100.84	5	35.71
15690.	ignatius (ig_gy)	14	57.48	66.97	1	7.14
15691.	Hugi (hugi97)	14	89.28	100.07	5	35.71
15692.	Kai (htplayz2107)	14	82.83	93.69	1	7.14
15693.	jburd (htimseiluj)	14	78.32	90.79	5	35.71
15694.	Jacob (horenzo)	14	102.72	117.13	7	50.00
15695.	Hisham (hisham_m)	14	53.06	67.24	4	28.57
15696.	.zyf (hinglect)	14	96.64	110.43	6	42.86
15697.	Rohit Singh (himynameisrohi...	14	136.08	156.85	10	71.43
15698.	himanshu (himanshu_giri)	14	56.50	68.15	4	28.57
15699.	hieser (hieser)	14	32.33	36.57	2	14.29
15700.	David (hiddenpants10)	14	94.03	104.33	4	28.57
15701.	SomeGuy (hexadecimal101)	14	95.51	118.05	7	50.00
15702.	Henry Ruggs (henryruggs)	14	171.65	188.95	13	92.86
15703.	hegde_atri (hegde_atri)	14	74.49	89.64	2	14.29
15704.	Harsh (harsh1924)	14	55.06	63.78	2	14.29
15705.	Andrew (harris75098)	14	68.54	87.73	5	35.71
15706.	Bruh (hannibanani)	14	63.64	77.28	3	21.43
15707.	Teuku (hahasrul)	14	75.33	91.06	4	28.57
15708.	Habib (habib7777)	14	57.22	65.14	2	14.29
15709.	gummy (gummysheep)	14	105.34	116.97	7	50.00
15710.	tek it (guidryy)	14	37.99	53.19	0	0.00
15711.	mikey (grenadejumper)	14	65.86	84.01	3	21.43
15712.	Gourav (gourav001)	14	54.81	59.37	1	7.14
15713.	kiwiwi (gothickiwi)	14	49.28	61.10	1	7.14
15714.	Alh (gotank)	14	49.93	58.71	2	14.29
15715.	Maidul (goal100wpm)	14	36.26	43.79	2	14.29
15716.	Glen (glennnnn)	14	62.99	69.32	1	7.14
15717.	Anonymous (ghajik)	14	84.93	101.58	13	92.86
15718.	Last (galya_88)	14	68.43	77.39	3	21.43
15719.	Colin (galaxyytr)	14	81.99	94.31	4	28.57
15720.	Inic (gadomane)	14	73.08	89.15	4	28.57
15721.	. (scorae)	14	70.57	82.44	2	14.29
15722.	gamig (schleepy_boye)	14	68.88	82.06	2	14.29
15723.	Savv (savvey)	14	64.75	70.45	2	14.29
15724.	samy (samy_)	14	63.38	70.66	2	14.29
15725.	Salad (saladspoon)	14	90.99	102.84	6	42.86
15726.	Sajed (saji652)	14	74.08	88.00	2	14.29
15727.	Safwan (safwanislam111)	14	73.17	80.91	3	21.43
15728.	saba (saba_on_mentos)	14	51.83	66.27	1	7.14
15729.	Saad (saad_mohammed7)	14	67.24	81.95	4	28.57
15730.	Saad Ahmed (saadahmed12858)	14	55.57	63.93	2	14.29
15731.	Will (r_u_sure)	14	101.49	113.88	5	35.71
15732.	Ryusei (ryu_525)	14	52.54	63.11	2	14.29
15733.	SheLuvRui (rushabh161)	14	109.39	118.57	7	50.00
15734.	rachel (rsimonton94)	14	97.15	114.78	4	28.57
15735.	rozetina (rozetina)	14	108.46	139.41	7	50.00
15736.	Roman (romaje_)	14	97.81	116.62	7	50.00
15737.	Roi (roi1255)	14	62.42	69.74	3	21.43
15738.	Robin (robaxtom)	14	74.03	86.61	5	35.71
15739.	RIJU (rijuthetyper)	14	65.82	74.91	4	28.57
15740.	Ryan (ricenoodles01)	14	88.75	125.63	4	28.57
15741.	Rexoblob (rexoblob)	14	76.75	85.95	2	14.29
15742.	rengmain (rengmain)	14	111.67	129.03	13	92.86
15743.	itypeforbyron (remez)	14	82.84	95.44	2	14.29
15744.	Reigina (reiginayari)	14	88.49	105.06	4	28.57
15745.	Redsteel (redsteel87)	14	83.25	105.24	2	14.29
15746.	Alex (rednaxt)	14	114.07	129.29	4	28.57
15747.	Caal (recumbent)	14	84.11	97.48	2	14.29
15748.	rdx (rdxx)	14	78.69	89.55	5	35.71
15749.	Raphael (razmataz99)	14	125.46	168.56	6	42.86
15750.	raymond (raymondrazer)	14	88.26	107.88	3	21.43
15751.	ray16k (ray16k)	14	133.09	146.29	10	71.43
15752.	Jona (ravioli_cheesecake12)	14	59.96	72.73	0	0.00
15753.	Rany (rany_games)	14	61.27	76.12	6	42.86
15754.	ramennoodles924 (ramennoodl...	14	87.19	108.40	3	21.43
15755.	reactor2 (rakesh_singh)	14	89.36	105.61	6	42.86
15756.	tstats[rajendra_thakur] (ra...	14	51.62	60.27	0	0.00
15757.	rk2699 (radhu)	14	74.04	87.00	2	14.29
15758.	Michael (raczcar)	14	92.98	110.39	6	42.86
15759.	Yeji (racket_21)	14	58.69	68.31	4	28.57
15760.	Patrick (pzuknome)	14	123.80	140.23	6	42.86
15761.	Puymieyches (puymieyches)	14	82.23	94.20	3	21.43
15762.	Iliyan (proto0o)	14	82.64	93.69	3	21.43
15763.	praxZ (praxz)	14	114.30	131.11	6	42.86
15764.	Mae (practice_type)	14	60.75	71.19	2	14.29
15765.	ptt (potatodogg)	14	111.20	126.51	8	57.14
15766.	Logan (postlogan)	14	90.57	109.04	6	42.86
15767.	Nameless (plot_da_pro)	14	56.55	66.67	8	57.14
15768.	Phle (plegethas)	14	67.05	73.91	1	7.14
15769.	Mike (pit820)	14	81.30	101.90	7	50.00
15770.	Pidguit (pidguit)	14	97.23	112.03	5	35.71
15771.	TypeBot (phycer)	14	96.91	110.97	5	35.71
15772.	Martynas (peepeeman42069)	14	81.81	94.51	10	71.43
15773.	Pana (pana_miguel)	14	83.27	100.01	5	35.71
15774.	paco (pacowaco)	14	73.40	80.99	8	57.14
15775.	i cant type (o_o_f)	14	110.28	136.86	8	57.14
15776.	Clicky (ottoble)	14	66.75	77.79	1	7.14
15777.	James (otes10)	14	63.36	71.53	1	7.14
15778.	Will (orketscience)	14	40.16	45.21	0	0.00
15779.	Justin (orccrusher99)	14	75.25	91.81	1	7.14
15780.	hayde (oofba)	14	101.40	118.87	8	57.14
15781.	Omkar (omkardalvi001)	14	67.06	77.26	1	7.14
15782.	hi (notarock)	14	115.21	130.38	8	57.14
15783.	ammu (notammu)	14	47.38	57.88	3	21.43
15784.	Josh (nocase)	14	113.17	139.80	11	78.57
15785.	Njord (njord19)	14	78.34	95.75	4	28.57
15786.	Nithin (nithinsanjey)	14	50.56	64.28	1	7.14
15787.	Jaynul A (nishatme)	14	61.26	70.82	2	14.29
15788.	Lightning (nirajp)	14	100.45	109.62	5	35.71
15789.	Nina (nina_lopes)	14	52.60	60.17	6	42.86
15790.	skye (nilumi)	14	39.38	47.23	1	7.14
15791.	Luffy (niloy2k76)	14	78.09	88.07	5	35.71
15792.	Nicholas (nikorosu)	14	55.40	62.39	2	14.29
15793.	Niftski (niftski)	14	88.78	109.74	9	64.29
15794.	neromantic (neromantic)	14	77.85	89.09	4	28.57
15795.	Mukhtar (nejaiski)	14	55.15	66.18	3	21.43
15796.	Sophia (need_to_run)	14	59.29	64.64	0	0.00
15797.	Rupesh (nedlog_rupesh)	14	79.13	94.25	5	35.71
15798.	Antonin (nebula__)	14	58.78	70.98	6	42.86
15799.	nazmush (nazmushsayadat)	14	58.33	70.14	0	0.00
15800.	Mew (mw46)	14	117.57	137.64	6	42.86
15801.	Muhsin (muhsinaldoori)	14	59.73	73.30	3	21.43
15802.	Muffin™ (muffintm)	14	77.50	100.88	7	50.00
15803.	Tristan (muffinheadtris)	14	40.88	51.95	1	7.14
15804.	mt (mtutunchi)	14	83.66	93.01	6	42.86
15805.	Guus (mr_leepel_)	14	92.55	102.57	7	50.00
15806.	david (mrriceeater)	14	104.43	123.95	5	35.71
15807.	Shahaf (mrpoopydoopy)	14	64.61	77.15	5	35.71
15808.	Mr.John (mrjohnwick)	14	55.90	67.63	5	35.71
15809.	Moulik (morocks)	14	98.58	116.77	2	14.29
15810.	Mooles (mooles)	14	125.42	139.39	10	71.43
15811.	Mohit Justin (mohitjustintudu)	14	39.29	51.02	2	14.29
15812.	Jeremy (mlgquikscopebruh)	14	92.87	127.49	6	42.86
15813.	Victor (mlad)	14	50.85	56.38	0	0.00
15814.	Mihai (mizaqe)	14	54.08	62.61	1	7.14
15815.	Mitchel (mitchthebaker)	14	99.07	116.95	7	50.00
15816.	Mipsy (mipsytheblue)	14	88.80	122.57	11	78.57
15817.	Miguel (miguel_leadersarena)	14	60.34	71.96	0	0.00
15818.	midayis (midayis)	14	56.77	80.76	4	28.57
15819.	Matthew Froehlick (mfro)	14	61.93	75.36	4	28.57
15820.	Meysam (meysam1231)	14	65.09	77.31	3	21.43
15821.	McNeal (mcnealgwapo)	14	68.96	76.62	3	21.43
15822.	Max (maxshaw2411)	14	90.36	102.70	12	85.71
15823.	Matt (mattsmouse)	14	93.27	118.31	4	28.57
15824.	Matthew (matthewarous)	14	129.84	147.29	14	100.00
15825.	Massimo (massir)	14	86.64	95.87	2	14.29
15826.	Blade_s0567 (mar_s)	14	63.03	77.25	3	21.43
15827.	1ntellectualL10n (martinledl)	14	79.86	88.19	6	42.86
15828.	Fardin (manzif)	14	89.81	102.34	8	57.14
15829.	manstick (manstick)	14	90.01	107.53	5	35.71
15830.	Maluck (maluck)	14	72.39	83.91	3	21.43
15831.	Tren (_tren)	14	76.78	89.28	4	28.57
15832.	Rishi (_slow_typer)	14	72.26	87.07	3	21.43
15833.	zreem (zreem)	14	57.46	90.96	0	0.00
15834.	Zoe (zoi77)	14	79.36	98.83	4	28.57
15835.	slow stinky balls (znerwill...	14	118.18	127.84	4	28.57
15836.	Zhavokhir (zhav0kh1r)	14	59.14	74.62	8	57.14
15837.	Zeraphim (zeraphim)	14	97.74	109.31	3	21.43
15838.	Zephyr (zephyrkai)	14	111.48	121.24	8	57.14
15839.	Zachary (zachary3352)	14	102.65	119.61	9	64.29
15840.	yal (yyal)	14	95.71	118.89	6	42.86
15841.	Yousef (yusopro)	14	64.35	69.72	7	50.00
15842.	PeteJai (yupuiho)	14	47.47	57.47	0	0.00
15843.	Justin (yummy_spin05)	14	58.51	67.48	2	14.29
15844.	*You're (yourmumlikesmytyping)	14	49.49	57.54	0	0.00
15845.	Nikki (yip14)	14	47.61	52.15	2	14.29
15846.	QLONA 🥵 (yeyas)	14	100.86	126.92	5	35.71
15847.	Jordan White (yepple_)	14	67.86	86.94	4	28.57
15848.	Ossi (xyeet)	14	123.84	138.78	8	57.14
15849.	Charles (xx_white_racer_xx)	14	102.21	117.92	6	42.86
15850.	Adam (xuxiym)	14	134.62	158.63	12	85.71
15851.	juicebox (xsolstice)	14	93.83	111.36	4	28.57
15852.	xinhui (xinhuixu)	14	46.69	50.57	4	28.57
15853.	bigman (xdbigman)	14	73.82	86.91	7	50.00
15854.	Jast (xcess0000)	14	34.88	44.40	3	21.43
15855.	Kael (wshuwshuwshi)	14	87.19	97.01	4	28.57
15856.	wRadion (wradion)	14	109.63	129.61	6	42.86
15857.	Wonder (wonderjaxe)	14	49.60	60.57	1	7.14
15858.	XOR_ (wisetoad)	14	96.52	114.87	7	50.00
15859.	willy (willywongker69)	14	86.17	99.23	3	21.43
15860.	WIll (wiillikeer)	14	62.54	70.44	12	85.71
15861.	whuwxl (whuwxl)	14	55.27	60.98	2	14.29
15862.	wantingpawer (wantingpawer)	14	100.81	120.30	8	57.14
15863.	vylnf (vylnf213)	14	48.07	53.60	0	0.00
15864.	Cary Zhang (vrozone)	14	99.06	120.67	8	57.14
15865.	Hasibuan (voyager28)	14	63.01	75.61	4	28.57
15866.	Ray (viruz789)	14	110.02	125.55	7	50.00
15867.	Virgin (virginchimp)	14	114.37	147.02	7	50.00
15868.	Vidhu Shikhar (vidhu_joshi)	14	61.65	76.79	3	21.43
15869.	Jodye (vice_pat)	14	63.09	73.20	3	21.43
15870.	vincentius (vgpabm)	14	71.35	83.20	11	78.57
15871.	Vernnamae (vernnamae03)	14	50.54	54.91	1	7.14
15872.	Allergic to (vanillahamster)	14	86.93	111.93	7	50.00
15873.	Van (vanberen)	14	71.18	81.55	6	42.86
15874.	kevin (uwupork)	14	96.23	113.88	8	57.14
15875.	typist (typist149)	14	53.22	64.25	1	7.14
15876.	Diana (typinglover1023)	14	102.98	116.39	8	57.14
15877.	Tom (twrig144)	14	89.38	106.46	5	35.71
15878.	Two (two_toned_69)	14	50.63	57.31	1	7.14
15879.	Trent (twesley20)	14	75.89	82.77	3	21.43
15880.	Charlotte (truest)	14	86.75	101.72	5	35.71
15881.	TripleMean (triplemean)	14	86.48	101.66	8	57.14
15882.	12Ethan! (towelette)	14	93.09	110.14	4	28.57
15883.	Heh (tophatheh)	14	76.65	85.82	3	21.43
15884.	Tom (tomshilling)	14	76.63	100.33	3	21.43
15885.	Tommy (tom441)	14	95.61	107.77	5	35.71
15886.	cock and (tmolls312)	14	83.03	94.81	8	57.14
15887.	Timothy (timothylee)	14	99.48	112.05	5	35.71
15888.	Tilly (tilly14)	14	72.96	88.14	2	14.29
15889.	Karta (thundermoon_911)	14	73.09	85.37	3	21.43
15890.	Ron (thtguyovrthr)	14	104.14	115.39	7	50.00
15891.	Cody (thoutravesty)	14	68.71	78.42	3	21.43
15892.	Thomas (thms_andrsn)	14	56.36	66.63	3	21.43
15893.	NongKao (thisiskao09)	14	44.60	51.80	2	14.29
15894.	the ayo (the_one_and_only_l...	14	64.11	77.97	5	35.71
15895.	Simo (thespeedoflight)	14	106.75	121.83	8	57.14
15896.	David (thedaveed)	14	102.28	124.43	10	71.43
15897.	Alberto (thearod5)	14	78.16	93.92	4	28.57
15898.	Kai (testphylean)	14	100.26	115.06	6	42.86
15899.	Nikolaus (testingcolemak)	14	66.27	78.24	3	21.43
15900.	bob (termina_112)	14	68.97	84.76	8	57.14
15901.	Terence (terence1234567)	14	91.78	104.61	6	42.86
15902.	John (tempocount)	14	110.37	126.93	6	42.86
15903.	Technetium (technetium_)	14	80.34	91.89	5	35.71
15904.	Harry (taytayalldaytay)	14	77.81	88.24	4	28.57
15905.	Taxx (taxx)	14	114.07	133.41	5	35.71
15906.	Tahbro (tahbro)	14	86.22	100.23	5	35.71
15907.	Taco Master (taco989)	14	61.70	69.95	5	35.71
15908.	Jasper (t3sted)	14	78.18	99.78	6	42.86
15909.	t2fast4u (t2fast4u)	14	97.10	122.86	4	28.57
15910.	Shynggyskhan (s_bazarbay)	14	70.05	77.31	4	28.57
15911.	syrianii (syrianii)	14	67.35	77.07	2	14.29
15912.	Sung (sungsangthesong)	14	106.71	125.27	14	100.00
15913.	guy (submer)	14	111.35	133.03	5	35.71
15914.	Kirk (lil_laker)	14	48.06	61.15	3	21.43
15915.	gautam (stupendous_man)	14	38.02	41.02	0	0.00
15916.	stuff423 (stuff423)	14	112.26	126.77	4	28.57
15917.	Sawyer (stmcpherso)	14	68.11	73.44	6	42.86
15918.	G (squasy)	14	92.04	106.02	3	21.43
15919.	Ava (spyder_)	14	56.80	71.70	1	7.14
15920.	Speeder (speeder99)	14	37.87	52.96	0	0.00
15921.	A (spectre_zero)	14	61.60	70.94	2	14.29
15922.	SPACE (spacegamer428)	14	44.58	54.05	2	14.29
15923.	Sour (sourbar)	14	55.71	64.40	2	14.29
15924.	Mitheelesh (sophomania2803)	14	80.41	91.65	7	50.00
15925.	cheruiyot (son_of_man)	14	106.46	122.63	3	21.43
15926.	Burger (somental)	14	63.74	75.80	2	14.29
15927.	Solo (solohan)	14	68.50	78.24	6	42.86
15928.	Simon (soinom)	14	67.45	75.51	7	50.00
15929.	Rahul (snickrdodle)	14	60.65	76.71	1	7.14
15930.	Lenni (smoldepressedboi)	14	61.48	68.65	1	7.14
15931.	Typing (slow_seizure_man)	14	55.44	70.04	3	21.43
15932.	Ben (slouchingstork)	14	60.58	65.30	2	14.29
15933.	chillin (slekap)	14	177.62	218.43	10	71.43
15934.	sleepy (sleeeepy_)	14	62.11	67.65	3	21.43
15935.	Slavic (slavicfedora)	14	102.69	124.13	3	21.43
15936.	A (sir_riot)	14	84.64	97.03	11	78.57
15937.	Isabella (sinnamonroll21)	14	92.31	106.18	6	42.86
15938.	Harpreet (singh_is_king)	14	31.42	38.05	1	7.14
15939.	Smaran (simpilly05)	14	67.30	83.22	3	21.43
15940.	真好玩 (simonhre)	14	69.57	81.40	3	21.43
15941.	David (sidrid)	14	50.50	58.78	1	7.14
15942.	shubham (shubham0007)	14	82.99	97.02	2	14.29
15943.	Shubhi (shoebee)	14	65.59	79.00	6	42.86
15944.	deadend (shiroku)	14	118.13	133.33	9	64.29
15945.	Mister (shiriou)	14	109.13	138.23	9	64.29
15946.	Mouse (shenx)	14	102.50	113.12	8	57.14
15947.	harold (sha_man)	14	47.99	53.10	1	7.14
15948.	Shannen (shannen_04)	14	95.97	107.94	6	42.86
15949.	shakk (shakk612)	14	79.95	97.70	5	35.71
15950.	Slow мΘşħΞ alt (shadow...	14	113.60	133.21	9	64.29
15951.	Donn (seabase)	14	39.38	50.03	0	0.00
15952.	Dustin (sdustink)	14	87.17	100.05	7	50.00
15953.	sdatta (sdatta)	14	73.40	86.28	3	21.43
15954.	Ashvik (ardude566)	14	76.86	99.77	5	35.71
15955.	ArcticWoof (arcticwoof)	14	57.84	63.12	2	14.29
15956.	Tabs (aptex)	14	94.83	106.69	5	35.71
15957.	Mario (applie_turnover)	14	42.31	54.34	2	14.29
15958.	Alperen (apleren)	14	55.64	63.54	2	14.29
15959.	ibayanto (antichronic)	14	86.39	111.40	8	57.14
15960.	qwerty (anoop208)	14	112.74	131.85	11	78.57
15961.	Anh Khoa (anhkhoa218)	14	49.40	57.38	2	14.29
15962.	Nate (angularblade)	14	71.83	91.98	4	28.57
15963.	Andy (andykim18)	14	95.99	110.08	4	28.57
15964.	Andrew (andrewlllee)	14	83.17	100.21	4	28.57
15965.	Andrew (andrewlwm)	14	78.87	96.84	5	35.71
15966.	_Nasta_ (anas_hamrouni)	14	65.87	80.54	7	50.00
15967.	Amar (amardhaliwal7)	14	54.40	69.89	1	7.14
15968.	Alec (alxiang)	14	100.43	123.94	2	14.29
15969.	Alexandros (ale_pouroulllis)	14	93.88	111.88	9	64.29
15970.	Alexa (alexa72)	14	105.24	126.98	6	42.86
15971.	Alex (alex7r360)	14	111.24	133.00	8	57.14
15972.	Aldreich (aldreich)	14	99.77	121.66	8	57.14
15973.	Arrtea (akrx)	14	39.53	46.25	0	0.00
15974.	asgfd (akjghaf)	14	70.23	77.97	2	14.29
15975.	bbbbbbbbbbbbbbbbbbbbbbbbbbb...	14	71.88	83.14	3	21.43
15976.	Eddie (agzastrgath)	14	91.20	101.75	5	35.71
15977.	Fluff (afluffyflamingo)	14	102.64	133.27	5	35.71
15978.	Julio (aero_jb)	14	61.86	70.74	4	28.57
15979.	Adnan (adnanasn)	14	51.39	55.75	0	0.00
15980.	Lavell (adenda2)	14	68.14	77.63	1	7.14
15981.	costin (acostin643)	14	102.24	116.31	3	21.43
15982.	Acke (ackehjarn)	14	89.07	104.37	3	21.43
15983.	Alyssa (abm10)	14	44.04	57.29	0	0.00
15984.	Abdullahi (abdullahi_samiir)	14	77.08	86.44	2	14.29
15985.	AK (a2526)	14	77.85	90.30	4	28.57
15986.	Andy (6arb)	14	101.36	115.57	7	50.00
15987.	白起小哥哥 (45989871)	14	46.41	60.91	2	14.29
15988.	Rebecca (221btimelord)	14	88.30	102.26	4	28.57
15989.	Camden (1848910)	14	69.80	86.76	5	35.71
15990.	Mohammad (11osos11)	14	78.57	93.47	6	42.86
15991.	shudawg (1122)	14	78.18	87.79	3	21.43
15992.	Angelo (ruly_2002)	14	76.98	95.23	2	14.29
15993.	Euan (euansuba)	14	69.84	82.51	14	100.00
15994.	Aaran (ninjatai)	14	43.44	51.46	0	0.00
15995.	Nathan (rockthecraft)	14	85.21	91.12	4	28.57
15996.	Ian (sirbossk)	14	82.16	93.60	2	14.29
15997.	Aniket (ani_ket_kmr)	14	89.37	104.55	5	35.71
15998.	ethan (1epyt)	14	76.45	87.98	5	35.71
15999.	Saheb (iamsahebgiri)	14	42.47	57.92	1	7.14
16000.	Josiah (instantnoodlez)	14	82.75	116.34	6	42.86
16001.	John (lilrecci3)	14	40.95	47.73	2	14.29
16002.	robin (mountainburger)	14	102.51	120.86	4	28.57
16003.	ahmed (ahmedraslan28)	14	43.75	52.31	3	21.43
16004.	Toad (toad2six)	14	95.97	127.50	6	42.86
16005.	Daniel (iskrowy)	14	74.35	87.58	5	35.71
16006.	Abdul Rafay (rafay_angle)	14	43.70	49.19	2	14.29
16007.	Prabesh (itsprabesh)	14	60.57	75.14	2	14.29
16008.	Victoria (victoria_05)	14	48.52	59.87	1	7.14
16009.	rome (zombielols)	14	98.23	114.30	4	28.57
16010.	TerrorLlama (terrorllama)	14	73.48	85.14	2	14.29
16011.	John (john19221)	14	49.80	53.70	0	0.00
16012.	Mohammed (_police_)	14	75.37	87.68	3	21.43
16013.	John (omnirabbit)	14	103.23	115.30	8	57.14
16014.	Bob (didwin)	14	87.69	103.40	5	35.71
16015.	Aniket (theaniketdas)	14	89.04	121.75	5	35.71
16016.	Aaron (hertzzy)	14	51.27	55.29	3	21.43
16017.	Lee (dinotrooper)	14	78.22	111.69	4	28.57
16018.	wes (fckhomerow)	14	117.00	133.45	10	71.43
16019.	Bethany (thelegendarybethboii)	14	95.64	106.29	6	42.86
16020.	PLUTO (p1luto)	14	66.34	80.72	9	64.29
16021.	Anthony (adenn915)	14	76.82	102.05	2	14.29
16022.	Tag (terataj)	14	74.57	97.34	6	42.86
16023.	. (thediamond_35)	14	82.35	94.66	2	14.29
16024.	Emir (kasubukuro)	14	52.58	65.27	2	14.29
16025.	iverybadattyping (iverybada...	14	91.50	103.10	4	28.57
16026.	sky (forgottensky)	14	60.21	71.42	1	7.14
16027.	Arian (alatus_arian)	14	77.25	98.32	2	14.29
16028.	Md Abu Torab (torab_0123)	14	47.18	57.90	4	28.57
16029.	John (john8999)	14	49.52	57.65	0	0.00
16030.	Septrev (septrev)	14	50.28	56.15	1	7.14
16031.	Brian (britchkid)	14	103.73	124.69	10	71.43
16032.	atharv (xdbotsmaster)	14	52.36	61.92	0	0.00
16033.	heidi (emmalouise05)	14	62.96	73.66	3	21.43
16034.	Sal (saltypes)	14	51.01	56.83	3	21.43
16035.	Namura (namura)	14	83.81	92.80	8	57.14
16036.	Cameron (cameron_j)	14	83.59	93.01	6	42.86
16037.	thenu (lcfrmrngstr)	14	58.01	70.67	3	21.43
16038.	Andrii (shkroba)	14	71.82	86.86	3	21.43
16039.	Ahmed Ittihad (andy_dufresn...	14	65.38	72.19	3	21.43
16040.	Waldo (glibg10b)	14	64.84	71.99	4	28.57
16041.	Quan (quan_lad)	14	70.92	83.38	11	78.57
16042.	Gisela (gis99)	14	48.65	56.40	2	14.29
16043.	ethonk (ethonk)	14	88.75	96.38	6	42.86
16044.	Awesome Name Man (awesomena...	14	71.83	79.43	6	42.86
16045.	Esther (phamjam)	14	68.78	75.81	4	28.57
16046.	killua (alphaidgaf)	14	59.88	69.16	8	57.14
16047.	Dyllan (blockmaniac48)	14	68.76	85.40	3	21.43
16048.	Conor (crc1200)	14	70.15	88.18	6	42.86
16049.	Chizz (cheezeychizz)	14	82.94	93.17	6	42.86
16050.	Sudhir (sudhih)	14	60.37	75.82	4	28.57
16051.	Chris (pokedog27)	14	75.48	93.26	4	28.57
16052.	nekron35 (nekron35)	14	56.16	61.71	3	21.43
16053.	jamhood007 (jamhood007)	14	56.44	62.56	5	35.71
16054.	Thom (squiddy32)	14	92.01	124.26	4	28.57
16055.	Tyler (loltylerdowney)	14	82.26	93.66	1	7.14
16056.	gnat (gnatblue)	14	62.85	73.97	5	35.71
16057.	ZhiHan (flinzan)	14	47.62	53.34	1	7.14
16058.	samsam (samsamlol)	14	93.70	112.54	11	78.57
16059.	Athacal (athacal)	14	46.34	58.80	4	28.57
16060.	Rasheed (sheedywonder)	14	68.15	79.03	4	28.57
16061.	Waleed (waleed_saleh)	14	51.81	58.58	5	35.71
16062.	joni (rozygcf)	14	48.09	54.67	2	14.29
16063.	racernumberseven (racernumb...	14	56.34	63.19	1	7.14
16064.	Ben (tachibanaben)	14	91.11	110.48	4	28.57
16065.	Rosechilde (rosechilde)	14	47.61	56.75	1	7.14
16066.	Nick (frogd)	14	88.66	105.54	2	14.29
16067.	Bob (frenchburrito)	14	78.28	93.62	4	28.57
16068.	William (freewille)	14	96.82	115.99	6	42.86
16069.	fred777i (fred777i)	14	71.22	98.19	2	14.29
16070.	fongof (fongof)	14	89.35	100.03	3	21.43
16071.	Flowless (flowlessrusher)	14	64.25	71.24	14	100.00
16072.	Landon (floont)	14	120.00	127.79	6	42.86
16073.	Fineson (fineson)	14	107.40	138.13	7	50.00
16074.	ronan (fibbit)	14	82.26	94.06	3	21.43
16075.	Fesak10Fingers (fesak8)	14	60.77	73.05	7	50.00
16076.	Fathan (fathanpathurijal)	14	70.47	80.28	4	28.57
16077.	Farhan Osman (farhan16)	14	40.28	44.01	0	0.00
16078.	Fanturn (fanturn)	14	31.25	44.00	1	7.14
16079.	Thomas (f0x169)	14	78.84	90.96	3	21.43
16080.	Lucas (excorpse)	14	96.53	115.83	5	35.71
16081.	Esophose (esophose)	14	135.36	157.28	9	64.29
16082.	Esketitutu (esketitutu)	14	65.80	81.17	8	57.14
16083.	Derpy Stingray (ernchenghoo)	14	109.72	131.73	8	57.14
16084.	Khanh (erile)	14	59.01	66.74	0	0.00
16085.	Enzoo (enderboyx200)	14	131.27	140.68	11	78.57
16086.	Emily (emerrin)	14	98.60	106.09	5	35.71
16087.	aa (elk111)	14	75.54	91.55	3	21.43
16088.	luca (einsluca)	14	83.65	97.07	1	7.14
16089.	ⓔⓓⓐⓝⓘ (edaniguy90)	14	75.50	90.57	7	50.00
16090.	Lewis (eatass123)	14	68.66	76.87	2	14.29
16091.	ear (earmold)	14	108.52	121.65	7	50.00
16092.	Dylan (dylearn)	14	63.38	72.86	0	0.00
16093.	dylan52528 (dylan52528)	14	70.59	85.89	4	28.57
16094.	Drizzy (dreazy)	14	83.16	104.71	5	35.71
16095.	dree (dre3)	14	76.85	92.75	3	21.43
16096.	Goomba (dragoomba)	14	148.16	166.18	7	50.00
16097.	Marcus Armstrong (down_with...	14	87.76	101.08	2	14.29
16098.	Daniel (dninja96)	14	102.13	116.79	4	28.57
16099.	Dylan (dkonquerer)	14	104.98	118.53	2	14.29
16100.	Hafizuddin (dinios_)	14	30.00	34.26	0	0.00
16101.	Dikshit (dikshitupadhya)	14	60.55	68.94	1	7.14
16102.	DerpVos (derpvos)	14	83.57	103.12	6	42.86
16103.	Nicholas (denicholas)	14	62.17	73.16	5	35.71
16104.	Radioactive (denharsh)	14	115.05	134.52	11	78.57
16105.	Dele (delenit0r)	14	77.00	88.65	2	14.29
16106.	Deiru (deiru)	14	101.76	121.54	3	21.43
16107.	Bob (deinosor)	14	105.69	123.84	5	35.71
16108.	Jody (deekif)	14	89.15	102.81	8	57.14
16109.	Deamon (deamontyper)	14	67.73	81.94	4	28.57
16110.	David (davecoolkid)	14	112.21	135.94	7	50.00
16111.	Dan (danwest124)	14	60.62	69.92	1	7.14
16112.	Dave (dachalco)	14	90.06	99.40	2	14.29
16113.	tstats[daball] (daball)	14	104.87	127.48	6	42.86
16114.	Czar (czarlol)	14	107.77	124.78	6	42.86
16115.	cython (cython)	14	63.72	74.83	2	14.29
16116.	Cavit Mert (cvtmrt)	14	64.91	77.65	13	92.86
16117.	abidlao07 (crystalrep)	14	55.95	77.32	14	100.00
16118.	John (cryptx_)	14	93.73	117.81	8	57.14
16119.	kj (crioyri)	14	99.47	115.05	8	57.14
16120.	coolror (coolroru)	14	84.30	105.01	4	28.57
16121.	Josh (complex_j)	14	48.99	56.83	1	7.14
16122.	Jon (coltirl)	14	67.32	88.69	1	7.14
16123.	Jordan (coffeeaddict99)	14	79.28	87.97	5	35.71
16124.	coen (coencidence)	14	106.92	132.61	3	21.43
16125.	Michael (clutch69master69)	14	122.41	135.03	11	78.57
16126.	Aicez (cluelessbruh)	14	48.86	57.72	0	0.00
16127.	Cloudios (cloudios)	14	68.34	84.57	4	28.57
16128.	Clfong (clfong)	14	60.46	74.27	1	7.14
16129.	CHT (cht64)	14	114.91	139.55	11	78.57
16130.	Chocorion (chocorion)	14	67.29	79.93	3	21.43
16131.	Timothy (chicken174)	14	21.46	27.87	3	21.43
16132.	I don't know (chessbro)	14	43.65	59.57	0	0.00
16133.	andygreg (chelloh)	14	62.09	77.69	4	28.57
16134.	Cheesetoast (cheesetoastman)	14	57.95	75.78	2	14.29
16135.	cha (chachu007)	14	73.51	87.04	2	14.29
16136.	celes (celescastro)	14	82.34	97.53	5	35.71
16137.	Ceb (cebq)	14	72.34	94.40	4	28.57
16138.	Chase (ccummins)	14	85.21	103.73	4	28.57
16139.	Talon (cclaww)	14	64.45	81.97	3	21.43
16140.	Matty (cannotdivideby0)	14	96.92	115.27	7	50.00
16141.	Cancyr (cancyr)	14	96.84	105.98	5	35.71
16142.	luis (bumfuzzled)	14	69.27	84.14	4	28.57
16143.	Mario (bujmar)	14	60.20	68.93	0	0.00
16144.	Anton (bujjaa)	14	68.24	75.23	1	7.14
16145.	Bruce (bruceboy1985)	14	116.16	131.86	8	57.14
16146.	David (bpsccheney)	14	78.61	86.04	5	35.71
16147.	jom (borezu)	14	128.89	145.31	11	78.57
16148.	Yoda (booya51)	14	98.63	114.33	5	35.71
16149.	Andrew (bonusducky)	14	99.70	115.36	1	7.14
16150.	Bob (bobjesus)	14	68.48	80.73	7	50.00
16151.	Blub (blub0)	14	86.45	106.36	8	57.14
16152.	Ramen (blazingramen)	14	99.84	110.32	6	42.86
16153.	Christler (blastydog)	14	120.86	140.91	10	71.43
16154.	Valk (blankfox)	14	80.06	94.68	4	28.57
16155.	Asma Azim (blackpanther_1)	14	63.35	70.42	4	28.57
16156.	Long (bizkidngo)	14	104.14	133.86	10	71.43
16157.	Trilo (bishh_27)	14	41.87	45.67	0	0.00
16158.	Brandon (birdysofly)	14	108.91	134.94	11	78.57
16159.	Bill (billsquare)	14	62.09	71.04	3	21.43
16160.	biady (biadyy)	14	96.04	101.54	5	35.71
16161.	bhuvi (bhuvi1606)	14	58.77	69.81	3	21.43
16162.	beepbeep (beep__beep)	14	71.38	83.19	2	14.29
16163.	beehah (beehahem)	14	100.96	115.92	7	50.00
16164.	beebooboop (beebooboop)	14	96.23	107.43	3	21.43
16165.	Big (beanbeanbean123)	14	44.41	50.10	0	0.00
16166.	Kutay (batselot)	14	62.80	72.14	3	21.43
16167.	Bailey (baileyeet)	14	73.37	101.71	2	14.29
16168.	badfaith (badfaith)	14	81.57	95.22	3	21.43
16169.	Gaus (azamku09)	14	57.20	64.60	2	14.29
16170.	Axurio (axurio)	14	68.36	80.57	6	42.86
16171.	Axel (axei)	14	60.30	71.97	0	0.00
16172.	avg (avgr)	14	16.78	22.67	1	7.14
16173.	Griffin (avalanchovy)	14	55.03	61.97	1	7.14
16174.	Aurel (aurelganteng)	14	79.21	94.24	6	42.86
16175.	Ath (athuu)	14	92.00	109.48	5	35.71
16176.	Yu (astridjin)	14	50.82	59.93	3	21.43
16177.	Adam (assassinbred)	14	97.46	105.67	2	14.29
16178.	Ibnu (asqallani)	14	56.91	69.74	3	21.43
16179.	Aiden (asiangarlic)	14	64.58	76.07	9	64.29
16180.	ashley (ashleyybbae)	14	101.27	113.53	10	71.43
16181.	asdf (asdf3)	14	84.44	92.33	2	14.29
16182.	Ascyt (ascyt)	14	60.80	75.36	4	28.57
16183.	Aruji (aruji)	14	77.30	86.27	0	0.00
16184.	uwos (artuist)	14	97.03	107.13	7	50.00
16185.	ArthasEdit (arthasedit)	14	44.50	55.99	0	0.00
16186.	arryacc (arryacc)	14	45.17	49.87	2	14.29
16187.	Albert (frequentflyer123)	13	100.18	108.17	5	38.46
16188.	jurj (fredkag)	13	98.63	115.99	3	23.08
16189.	Fedrick (freddybofte)	13	65.10	83.39	0	0.00
16190.	Saleh (foxtheonly)	13	50.91	65.86	1	7.69
16191.	foveacapitus (foveacapitus)	13	26.63	54.50	8	61.54
16192.	Ford Mustang (ford_mustang)	13	38.68	48.34	1	7.69
16193.	Dante (flukierclient)	13	70.92	84.30	4	30.77
16194.	Ivan (floki12_)	13	62.13	78.83	6	46.15
16195.	m (flashyyy)	13	104.09	123.15	13	100.00
16196.	fishy15 (fishy15)	13	115.48	138.64	6	46.15
16197.	Filipo (filipomarcel)	13	98.07	109.76	8	61.54
16198.	Fernando (fer_8888)	13	56.44	67.73	2	15.38
16199.	Luao (fencerperson)	13	76.13	88.62	3	23.08
16200.	Femosis (femosis)	13	103.45	123.63	6	46.15
16201.	Tim (fast_but_not_the_fastest)	13	101.62	117.33	6	46.15
16202.	Basil (falaedor)	13	85.00	95.00	4	30.77
16203.	m3dou_ (faheemmeharaj123)	13	46.49	84.24	6	46.15
16204.	Eva (evyrose2008)	13	55.97	70.18	1	7.69
16205.	Ethan (ethanxiaoful)	13	98.08	108.49	5	38.46
16206.	Eskooty (eskooty)	13	94.93	105.58	4	30.77
16207.	LilCup (epoli0319)	13	60.30	70.53	3	23.08
16208.	Epic (epicgamesceo)	13	85.18	102.89	5	38.46
16209.	Emilyyyy (emilyyyy26)	13	46.53	58.56	2	15.38
16210.	mle (emilyliz)	13	129.23	150.17	8	61.54
16211.	Elxius (elxius)	13	81.83	103.07	2	15.38
16212.	El (elnotelanor)	13	55.15	61.23	1	7.69
16213.	elay (elaytyping)	13	32.59	36.44	1	7.69
16214.	Elandaleb (elandaleb)	13	37.08	43.84	0	0.00
16215.	Glooberson (eifersucht)	13	82.02	93.90	3	23.08
16216.	efradagod (efradagod)	13	86.53	101.75	11	84.62
16217.	matu (eepilinemangur1)	13	128.77	174.03	5	38.46
16218.	zvgz (eclfppcmommarsuwof)	13	76.38	83.94	5	38.46
16219.	Ronnie (ebedebeds)	13	118.51	128.10	6	46.15
16220.	Drei (dy539)	13	78.64	85.29	2	15.38
16221.	darius (dxriuzs)	13	96.03	107.46	8	61.54
16222.	Chuck (dvorakmrcharles)	13	58.20	66.18	1	7.69
16223.	Anthony (duragsensei)	13	103.93	117.66	6	46.15
16224.	Martin (drudi1902)	13	64.32	73.50	3	23.08
16225.	DrPoppyseed (drpoppyseed)	13	81.84	90.50	3	23.08
16226.	Nikola (dropndrag)	13	61.55	72.51	2	15.38
16227.	Carrot (dreamsode)	13	108.17	116.62	6	46.15
16228.	Dream (dreamsnake)	13	96.93	125.37	5	38.46
16229.	DrDynamic (drdynamic)	13	82.69	100.98	1	7.69
16230.	dqwlol (dqwlol)	13	77.75	89.56	4	30.77
16231.	Perfection (doxxx)	13	133.28	159.55	11	84.62
16232.	Austin (dorrzun)	13	107.37	135.05	5	38.46
16233.	doodezpz (doodezpz)	13	93.59	111.47	5	38.46
16234.	Donnkey (donnkey)	13	103.55	119.67	5	38.46
16235.	nhentai (dongpo_pork)	13	98.81	113.21	7	53.85
16236.	Xian (doggy2021)	13	88.85	100.31	3	23.08
16237.	Troy (dogepowers)	13	89.80	102.53	2	15.38
16238.	Pisti (doctorstave)	13	100.31	110.87	8	61.54
16239.	DoctorN0gloff (doctorn0gloff)	13	134.38	156.19	9	69.23
16240.	David (dlefarth)	13	60.31	68.44	2	15.38
16241.	Do-Hyun (dkim00)	13	89.30	101.32	6	46.15
16242.	dirtydan (dirtyjdan)	13	67.19	71.63	4	30.77
16243.	Digo (digocorbellini)	13	81.62	94.34	4	30.77
16244.	Nash (digitalnash)	13	127.34	144.25	10	76.92
16245.	Diego (diego190401)	13	68.92	84.56	2	15.38
16246.	Diaa (diaa001)	13	55.58	73.80	2	15.38
16247.	Jacob (destroyer183)	13	75.06	90.90	4	30.77
16248.	Delviurge (delviurge)	13	102.58	110.24	7	53.85
16249.	JR (deltav)	13	98.75	112.00	4	30.77
16250.	Bang (dbgt0008)	13	91.03	106.12	8	61.54
16251.	Jepps (dazzle919)	13	117.86	149.79	6	46.15
16252.	david (davtet1)	13	88.39	109.42	6	46.15
16253.	Bebo (dark__knight_pro)	13	51.52	59.49	3	23.08
16254.	DarkLight (darklight17)	13	76.79	89.70	1	7.69
16255.	SWAPAN (dapana610)	13	45.30	53.35	1	7.69
16256.	Dan (danslaps)	13	84.49	98.58	3	23.08
16257.	Daniel (danielstep65)	13	93.19	108.37	3	23.08
16258.	Eric (dango499)	13	121.65	136.25	8	61.54
16259.	Adam (damadamadamm)	13	76.45	81.23	3	23.08
16260.	Matthew (d3f1n3d)	13	113.96	132.83	6	46.15
16261.	Nana (cypher404)	13	87.61	109.59	4	30.77
16262.	Cynthia (cynthiaparkk)	13	74.68	93.23	5	38.46
16263.	ethxn (cxntrxl)	13	88.01	99.79	4	30.77
16264.	cupnode (cupnode)	13	51.74	69.65	1	7.69
16265.	ymdsji (crostovik)	13	86.58	95.24	5	38.46
16266.	Himanshu (crestfalln)	13	54.40	58.65	2	15.38
16267.	Craig (craigo76)	13	60.95	72.70	1	7.69
16268.	coolslowboy (coolslowboy)	13	67.69	75.14	4	30.77
16269.	CoolGuyConnor (coolguyconnor)	13	81.76	91.61	3	23.08
16270.	Abrar (computernerdgenius)	13	64.70	75.47	4	30.77
16271.	RIP Zyzz (codecub)	13	159.43	187.60	10	76.92
16272.	Mike Oxlong (cmc_05)	13	43.77	50.10	4	30.77
16273.	Claire (claire_t_bear)	13	75.06	95.21	4	30.77
16274.	Mike (chomeror)	13	64.00	74.22	0	0.00
16275.	Chirag (chirag2907)	13	49.44	54.35	2	15.38
16276.	chipotle06 (chipotle06)	13	96.94	106.80	8	61.54
16277.	Chewing (chewing_bever)	13	98.84	118.01	7	53.85
16278.	slow typer (chessbobble)	13	85.40	104.26	6	46.15
16279.	Charles (charlesdickson1)	13	124.84	136.88	11	84.62
16280.	Charlie (chardlz)	13	100.54	118.24	6	46.15
16281.	Chandler (chandlerbing123)	13	72.93	82.38	4	30.77
16282.	chander (chanderpal)	13	49.40	54.75	0	0.00
16283.	Yuri (ceaseless_melon)	13	88.00	104.21	6	46.15
16284.	Charlie (cdicey)	13	85.15	103.93	4	30.77
16285.	Ententente (carousell)	13	88.43	99.89	6	46.15
16286.	Captain (captainrich)	13	69.88	83.92	4	30.77
16287.	canwithbeans (canikomaniko1)	13	59.28	72.87	2	15.38
16288.	cake (cake0)	13	142.24	163.49	13	100.00
16289.	Busky (buskyhusk)	13	94.03	105.56	7	53.85
16290.	Minh Kiet (buimonkey)	13	102.66	124.55	4	30.77
16291.	Bucky (buhcky)	13	96.70	123.39	5	38.46
16292.	Jacky (bubberducky209)	13	94.65	109.74	5	38.46
16293.	Ali (bronzor16)	13	95.10	105.99	1	7.69
16294.	Brecken (breckenmueller)	13	63.55	72.29	3	23.08
16295.	Bosco (bqscopog)	13	93.62	109.18	6	46.15
16296.	Borislav (borko_panterata)	13	73.10	85.99	3	23.08
16297.	boom (boompotato123)	13	79.20	93.78	3	23.08
16298.	serg (bobanuts)	13	81.39	93.33	7	53.85
16299.	Bernard's (bmadayag)	13	100.66	118.59	6	46.15
16300.	Mary (bloody_mary)	13	69.99	85.40	3	23.08
16301.	🤠👌🏿 (blackclaw)	13	96.85	108.05	6	46.15
16302.	bl731mang (bl731mang)	13	93.63	125.60	6	46.15
16303.	Hassan (bipedalfrog)	13	39.21	48.49	1	7.69
16304.	ed (bigponpon)	13	88.15	102.64	1	7.69
16305.	Slobodan (bekca)	13	96.48	111.74	4	30.77
16306.	Matthew (befurl)	13	75.52	97.63	5	38.46
16307.	Bedilbek (bedilbek)	13	58.52	66.75	4	30.77
16308.	Quang (baoquanggogreen)	13	58.03	73.96	2	15.38
16309.	NeverLucky (bambooaxe)	13	83.34	94.10	4	30.77
16310.	Balka (balka)	13	77.83	91.39	1	7.69
16311.	Dulguun (b180950039)	13	52.50	56.00	2	15.38
16312.	Aziz (azizxushvaqtov07)	13	53.68	66.45	4	30.77
16313.	John (avantegarden)	13	81.53	102.73	4	30.77
16314.	Ast (astrxse)	13	85.37	107.56	3	23.08
16315.	Ashish (ashish_m)	13	45.45	49.79	3	23.08
16316.	B A L O CH (ashfaq4730)	13	100.40	124.31	5	38.46
16317.	Arti (artifictional)	13	117.14	129.05	6	46.15
16318.	Jeronimo (_slowmotion_)	13	113.70	125.63	5	38.46
16319.	Paka (_paka)	13	92.48	100.89	3	23.08
16320.	falling down (_nirvana)	13	118.74	124.74	6	46.15
16321.	Zakk (z_boi)	13	103.28	119.10	4	30.77
16322.	amer (zx_iii)	13	54.09	60.29	1	7.69
16323.	ଘ(੭ˊᵕˋ)੭* ੈ✩�...	13	120.96	133.01	12	92.31
16324.	Zero (zerolelouch)	13	54.07	65.77	2	15.38
16325.	logan (zelo_0348)	13	37.63	43.08	0	0.00
16326.	Lawrence (zekaeski)	13	52.26	67.67	3	23.08
16327.	Yan (zeezyy)	13	48.62	56.88	12	92.31
16328.	Yuuto (yuutofood)	13	77.91	95.80	4	30.77
16329.	Yohan (yoyo65)	13	32.47	35.84	0	0.00
16330.	Lenny (yourboylenny)	13	78.30	92.04	9	69.23
16331.	Markus (yoshicp)	13	75.52	92.36	6	46.15
16332.	Yoav (yoav24681)	13	63.22	71.62	2	15.38
16333.	yjuk (yjuk)	13	79.05	90.37	6	46.15
16334.	yinlor (yinlor)	13	75.14	99.66	5	38.46
16335.	V (xgerr)	13	76.04	87.99	6	46.15
16336.	Darren (xdeclipseee)	13	93.43	114.22	5	38.46
16337.	Mintful (worst_typist11)	13	65.97	74.52	2	15.38
16338.	Jeff (witlessbox)	13	88.24	94.78	0	0.00
16339.	Wil$on (wilsonlee123)	13	103.74	123.18	4	30.77
16340.	NotAn0boe (whackygrub)	13	113.79	129.09	9	69.23
16341.	wenxers (wenxers)	13	94.46	102.06	1	7.69
16342.	weddies (weddies)	13	85.55	95.84	3	23.08
16343.	Daniel (weabutakku)	13	64.48	82.18	4	30.77
16344.	Tony (watery_tony)	13	40.97	49.03	0	0.00
16345.	Nathan (watameelon)	13	38.81	45.78	1	7.69
16346.	waryburger (waryburger)	13	81.41	94.80	4	30.77
16347.	Waleed (waleedminer)	13	113.72	138.81	4	30.77
16348.	WaFik (wafik)	13	66.06	78.01	3	23.08
16349.	Nazariy (vyleet)	13	73.37	90.29	6	46.15
16350.	AJ (vvatti@gmail.com)	13	82.79	92.11	1	7.69
16351.	Casper (volvoracer87)	13	44.21	51.63	1	7.69
16352.	Daniel (voiss)	13	94.49	109.50	7	53.85
16353.	vocal (vocal)	13	72.84	97.74	3	23.08
16354.	Vanellope (vio_melancholy)	13	69.70	84.53	2	15.38
16355.	Vikram (vikram031)	13	104.44	120.78	5	38.46
16356.	Viggi (viggi_002)	13	39.79	47.24	0	0.00
16357.	vibhu (vibhuviv)	13	37.24	44.36	0	0.00
16358.	Liny (veronasie)	13	64.79	76.08	3	23.08
16359.	Blaise (veresb14)	13	91.06	112.12	6	46.15
16360.	ℑ𝔫𝔢𝔵𝔢𝔠𝔯...	13	71.40	78.73	4	30.77
16361.	Alex (veifario)	13	29.09	35.68	3	23.08
16362.	Marcin (vaster_then_you)	13	69.74	79.24	0	0.00
16363.	Vasil (vasito123)	13	86.99	99.08	2	15.38
16364.	André (valp)	13	77.09	87.81	3	23.08
16365.	randall (valleyy)	13	90.09	103.65	5	38.46
16366.	Valdo (valdo_)	13	79.37	93.09	0	0.00
16367.	vid (usernem)	13	94.74	117.45	4	30.77
16368.	Samuel (upgraded_skilly)	13	72.48	83.88	3	23.08
16369.	cooler (unpluged)	13	85.33	95.68	3	23.08
16370.	umer (umer901)	13	74.07	96.04	2	15.38
16371.	Umbi (umbe10)	13	75.32	87.85	7	53.85
16372.	Bat-Ulzii (ulziibox)	13	66.22	79.15	12	92.31
16373.	Uno (typesmacker)	13	69.70	80.69	5	38.46
16374.	bob (typemaster512)	13	87.10	99.29	4	30.77
16375.	Tukanoo (tukano)	13	62.60	71.68	2	15.38
16376.	Petros (trakis_pe)	13	53.00	69.23	6	46.15
16377.	Noob (touchhyper)	13	87.13	120.50	5	38.46
16378.	byronze (toqoz)	13	107.54	115.32	4	30.77
16379.	J (tooeasyeh)	13	122.87	139.71	5	38.46
16380.	Race (tomatoripper)	13	45.31	50.79	4	30.77
16381.	Tree (tmoh)	13	100.73	121.31	12	92.31
16382.	Tippy (tippytaptyper)	13	100.41	126.30	3	23.08
16383.	nht- (tiny20061)	13	112.21	149.77	4	30.77
16384.	Martin (the_martin)	13	86.27	115.21	8	61.54
16385.	maple (the_maple_syrup)	13	107.03	118.56	5	38.46
16386.	Marlo (the_law_ph)	13	73.30	84.36	3	23.08
16387.	Brian (the_bc)	13	70.75	80.04	5	38.46
16388.	Evan (thewhailure)	13	75.16	85.95	3	23.08
16389.	Bryan (thesilican)	13	93.33	107.78	6	46.15
16390.	Nobody (therealtrudeau)	13	113.63	135.05	6	46.15
16391.	Talos (therealtalos21)	13	83.21	93.99	3	23.08
16392.	TheProperAsian (theproperas...	13	74.01	86.30	7	53.85
16393.	- (thegoldentiger)	13	96.32	110.06	4	30.77
16394.	Jack (theboakey)	13	72.48	82.02	3	23.08
16395.	Iason (thebabo)	13	66.00	76.03	7	53.85
16396.	Fox (that_fox)	13	90.40	104.25	2	15.38
16397.	Davis (thatrednismo)	13	100.59	118.93	4	30.77
16398.	Th3Frog (th3frog)	13	48.68	55.40	3	23.08
16399.	tempo (tempoxyz)	13	88.39	109.89	6	46.15
16400.	Tehb (tehbb)	13	41.60	51.87	1	7.69
16401.	Calvin (teddycom1)	13	66.22	73.30	3	23.08
16402.	Ted (ted3x)	13	62.58	71.51	6	46.15
16403.	Yếm Hồng (tdinh33)	13	64.78	76.37	1	7.69
16404.	Ryan (tazayuki)	13	108.42	117.02	7	53.85
16405.	na (syncix)	13	91.64	111.96	9	69.23
16406.	sriram (svb1)	13	68.66	74.00	3	23.08
16407.	tstats[suraj_hs] (suraj_hs)	13	54.41	66.78	0	0.00
16408.	slowpoke (wpm4life)	13	46.29	55.27	2	15.38
16409.	Ethan (summerpizza5508)	13	90.03	107.47	7	53.85
16410.	Suhan (suhan_pradhan)	13	71.27	85.49	2	15.38
16411.	Duirky (sublollipop)	13	64.45	73.22	4	30.77
16412.	Rapunzel (subash_)	13	67.85	74.34	2	15.38
16413.	Scott (stxiii)	13	79.21	88.43	5	38.46
16414.	fries (spotifries)	13	80.11	89.57	3	23.08
16415.	Alvin M. (spoderman2100)	13	55.37	65.27	3	23.08
16416.	spiros (spiros_gal)	13	91.33	109.29	3	23.08
16417.	William (speier70)	13	78.76	84.82	3	23.08
16418.	Riyad (spectrumftw)	13	89.78	107.24	8	61.54
16419.	ellie (spaghellie)	13	112.65	136.50	8	61.54
16420.	Jacob (spacelamar)	13	84.87	96.05	3	23.08
16421.	Pavel (sonaru)	13	65.96	72.84	7	53.85
16422.	Mevious (someguy)	13	119.00	129.41	5	38.46
16423.	GG (smrndmgy)	13	80.99	100.57	9	69.23
16424.	stinkass (smitopot)	13	113.33	142.50	6	46.15
16425.	pingu (slowpokeboy)	13	104.14	122.03	5	38.46
16426.	skydoi (skydoi)	13	69.10	87.80	3	23.08
16427.	Hien (skrubtical)	13	115.88	129.87	8	61.54
16428.	P (skoop8)	13	104.09	117.68	7	53.85
16429.	Kareememe (skerolt)	13	78.60	95.62	7	53.85
16430.	Loser (sisyphus_69)	13	84.26	92.56	3	23.08
16431.	JIS filco stingray (sigel)	13	149.07	171.38	12	92.31
16432.	eden (shoutynubs)	13	83.51	91.18	4	30.77
16433.	Hamster (shmex_hamster)	13	89.93	99.81	8	61.54
16434.	かりつた (shizuyoru)	13	67.01	73.74	2	15.38
16435.	Shirito (shirito)	13	70.54	79.82	2	15.38
16436.	Top (sheilsarda)	13	89.10	102.88	6	46.15
16437.	Sheenu (sheenz)	13	113.38	130.83	7	53.85
16438.	Bauyrzhan (shaykan)	13	61.17	77.26	7	53.85
16439.	Shawn (shawnyw)	13	93.42	105.36	4	30.77
16440.	shamol (shamolali)	13	47.96	56.89	3	23.08
16441.	Shafy (shafy)	13	71.49	83.43	2	15.38
16442.	Petar (sevihasanidjos)	13	42.60	50.92	1	7.69
16443.	iza (servoracc)	13	117.48	143.33	6	46.15
16444.	se (secw)	13	90.24	107.21	5	38.46
16445.	[Bl4nk] (mahneymchef)	13	84.37	90.18	6	46.15
16446.	Mahir (mahirafnan)	13	46.45	52.94	2	15.38
16447.	Mad Lad (madlad1)	13	61.12	75.27	0	0.00
16448.	Migs (m1gs)	13	50.56	57.45	3	23.08
16449.	JA (l_ja)	13	54.87	70.36	11	84.62
16450.	lyu (lyurisu)	13	100.09	117.94	9	69.23
16451.	Larry (lunchspecial)	13	81.38	100.32	5	38.46
16452.	luca (luc_vr_04)	13	98.91	128.97	7	53.85
16453.	Buddy (lucedes27)	13	109.34	122.13	8	61.54
16454.	Vijay S (lord_viju)	13	45.66	53.24	1	7.69
16455.	Logiq (logiqq)	13	61.61	73.55	1	7.69
16456.	Joshua Peirce (lodgevirus)	13	90.67	110.87	8	61.54
16457.	Ajeje (locreee)	13	56.22	75.48	4	30.77
16458.	Andres (lobosolitario)	13	82.84	108.57	8	61.54
16459.	Liz (lizard117)	13	69.01	82.68	2	15.38
16460.	Joe (littlejoeward)	13	67.41	78.05	2	15.38
16461.	Kacper (lilfridge69)	13	60.87	71.86	2	15.38
16462.	Travis (lightningslow)	13	68.12	95.23	3	23.08
16463.	Liban (liban711)	13	91.91	102.89	6	46.15
16464.	Marco (leungtc20001124)	13	87.91	96.30	3	23.08
16465.	Lestro-+) (lestroboy)	13	28.98	36.85	1	7.69
16466.	Leonard (lentan)	13	119.61	135.15	7	53.85
16467.	Barel (lenshom)	13	64.99	79.09	9	69.23
16468.	Laxman (laxman_)	13	72.15	80.25	8	61.54
16469.	Jake (kyrien)	13	115.71	127.15	9	69.23
16470.	Kyle (kyles0610)	13	113.04	124.22	4	30.77
16471.	James (kuznecoff)	13	76.69	90.62	2	15.38
16472.	Kuba (kubzas)	13	42.00	46.55	3	23.08
16473.	guest (ks3rr)	13	76.17	83.50	4	30.77
16474.	Kristin (krisis7)	13	65.81	73.89	2	15.38
16475.	Justin (krakken858)	13	106.82	121.39	5	38.46
16476.	Stephen (korankye)	13	98.29	119.89	11	84.62
16477.	Dakota (kodaworms)	13	97.72	110.10	8	61.54
16478.	Kritim (kkr_)	13	77.52	87.83	5	38.46
16479.	Kanha (kjewels)	13	69.85	83.96	1	7.69
16480.	kit (kitsinc11)	13	94.17	116.47	2	15.38
16481.	Brando (kingozymandias2)	13	88.31	98.78	6	46.15
16482.	Kif (kifm)	13	51.03	57.81	0	0.00
16483.	Khoa (khoa1811)	13	96.24	107.19	3	23.08
16484.	Raven (kfaulk1216)	13	96.45	107.78	6	46.15
16485.	Quick Fox (key_of_boards)	13	79.21	90.87	1	7.69
16486.	Kenley (kenfunky32)	13	93.55	109.17	4	30.77
16487.	kenestrophic (kenestrophic)	13	63.66	78.12	3	23.08
16488.	kevin (kelvinscale)	13	51.94	60.85	3	23.08
16489.	kelonline (kelonline)	13	55.38	60.60	0	0.00
16490.	Kedolind (kedolind)	13	82.14	93.92	4	30.77
16491.	Kamron (kbegmatov96)	13	67.10	76.24	5	38.46
16492.	Luna (kavuko_)	13	56.40	65.72	3	23.08
16493.	James (kasprovy)	13	56.47	62.01	0	0.00
16494.	Karcinogen (karsenj05)	13	73.55	82.67	3	23.08
16495.	Kalybay (kalybai)	13	54.54	59.02	2	15.38
16496.	Kaleeyse (kaleeysem)	13	61.67	70.94	2	15.38
16497.	Eyrton (kalaxee)	13	98.63	112.90	7	53.85
16498.	Khadija (kaijaaa)	13	34.63	42.90	3	23.08
16499.	kadyn (kadynnn)	13	52.38	62.29	4	30.77
16500.	Angel (kablockacha)	13	48.79	59.98	2	15.38
16501.	K4_keyChan_ (k4_keychan_)	13	89.51	112.89	6	46.15
16502.	Justin (justintam556)	13	85.70	106.00	5	38.46
16503.	justinhylee (justinhylee)	13	109.09	130.57	13	100.00
16504.	Julio Jose (julioisdaman)	13	68.18	94.06	3	23.08
16505.	JudgementCole (judgementcole)	13	48.40	55.99	2	15.38
16506.	juan (juanjaho)	13	75.70	91.69	2	15.38
16507.	KookyMonster🍪🍪🍪 (j...	13	111.41	131.48	9	69.23
16508.	Jellybean (jojo00vvv)	13	104.51	121.24	6	46.15
16509.	Joe (joejoeparen)	13	70.60	95.76	9	69.23
16510.	James (jimmyt50)	13	79.84	95.11	1	7.69
16511.	Dim (jimmylei)	13	88.89	104.80	3	23.08
16512.	jim (jimmyl02)	13	113.91	129.08	9	69.23
16513.	Alex (jigglytophat)	13	55.92	64.94	2	15.38
16514.	patoo (jiahao8)	13	104.55	116.42	6	46.15
16515.	JCGP (jgcp)	13	79.09	88.83	5	38.46
16516.	Jeritens (jensrichter)	13	82.35	94.34	3	23.08
16517.	JDSpark (jdspark)	13	87.89	111.01	4	30.77
16518.	Jamie (jcpopp)	13	111.26	125.91	7	53.85
16519.	JayGMZ (jaygmz)	13	39.08	47.93	2	15.38
16520.	Javla (javlafan)	13	87.76	106.19	5	38.46
16521.	Chukwuka (javalon007)	13	71.43	85.21	5	38.46
16522.	Jaunty (jaunty_jalopy)	13	88.70	96.64	5	38.46
16523.	Jared (jarbarw)	13	96.07	111.62	7	53.85
16524.	Sayauriee (japanese_maple_l...	13	93.01	103.02	6	46.15
16525.	Jandre (jandre1028)	13	122.32	152.23	8	61.54
16526.	Jan (jan3112)	13	61.52	71.74	3	23.08
16527.	Jafer (jafer2000)	13	62.85	78.09	1	7.69
16528.	Jack (jackwhitten238)	13	82.05	96.47	3	23.08
16529.	JJJ (jaakko1)	13	106.64	127.78	8	61.54
16530.	Vraj (i_type_really_slow_ok)	13	97.31	107.09	3	23.08
16531.	Timothy (iyamdeanser)	13	78.88	90.54	4	30.77
16532.	Apithat Sombatsiri (itsmek4nz)	13	92.91	109.05	4	30.77
16533.	Itscol (itscol)	13	69.43	82.14	4	30.77
16534.	ok nerd (irumpelstiltskin)	13	78.28	91.59	6	46.15
16535.	Ronan (ironan)	13	140.55	179.95	11	84.62
16536.	Im kinda cute (im_kinda_cut...	13	89.65	103.64	3	23.08
16537.	Nawaf (iinkz)	13	76.24	83.79	3	23.08
16538.	Shino (id_acey)	13	81.84	107.06	1	7.69
16539.	Samuel (ichigancs)	13	85.51	98.51	5	38.46
16540.	IBRAIM5URFER (ibrahimpro)	13	86.44	103.27	4	30.77
16541.	Robert (hypersnitch)	13	75.28	95.13	2	15.38
16542.	Huy (huygtran123)	13	76.23	81.73	5	38.46
16543.	Nguyen (hungnguyen2912)	13	36.37	43.03	1	7.69
16544.	Hugh (hughmarch)	13	103.59	134.62	7	53.85
16545.	David (hugger69)	13	80.71	87.96	3	23.08
16546.	Putra (hoodedproxy)	13	71.01	81.07	4	30.77
16547.	Lingxun (hommieinuw)	13	91.32	101.85	5	38.46
16548.	Eduard (holykill)	13	102.17	120.24	5	38.46
16549.	Holden (holdcop)	13	91.32	105.67	7	53.85
16550.	Muhamed (hjewdjsdjsdjs)	13	45.66	50.38	1	7.69
16551.	Hi3rra (hi3rra)	13	40.96	47.74	0	0.00
16552.	Jake (hero7785)	13	79.81	88.50	4	30.77
16553.	script/script (henville12)	13	102.34	115.54	6	46.15
16554.	Hehsbb (hehsbb)	13	72.35	91.82	3	23.08
16555.	Phan (hed_wig)	13	90.20	101.46	5	38.46
16556.	cat (hecknolol2)	13	73.64	102.17	3	23.08
16557.	POCARI (hdpocari)	13	76.03	87.72	6	46.15
16558.	haytch (haytch)	13	42.91	58.66	1	7.69
16559.	Hans5958 (hans5958)	13	80.77	99.43	4	30.77
16560.	Halifay (halifay)	13	80.01	88.26	1	7.69
16561.	Haduu (hadiysd)	13	98.94	103.27	7	53.85
16562.	GrimRaven26 (grim_raven26)	13	56.31	63.56	1	7.69
16563.	amber (gremlinx8)	13	101.55	112.83	8	61.54
16564.	Kevin (greenleafy)	13	131.59	152.44	8	61.54
16565.	Patryk (grayek)	13	83.97	89.76	0	0.00
16566.	Brad (godspeed99)	13	86.12	91.93	4	30.77
16567.	Kenneth (godfetus)	13	104.78	117.83	6	46.15
16568.	glucose (glucose)	13	111.95	137.51	9	69.23
16569.	Robert (glixzor)	13	105.94	115.21	5	38.46
16570.	twitch.tv/giankid (gianthet...	13	160.27	173.69	11	84.62
16571.	Josh (ghostrider5346)	13	54.72	62.87	3	23.08
16572.	TMGAMING (ggatorade)	13	71.57	81.81	4	30.77
16573.	Gary (ggaarryy12340)	13	65.96	76.03	3	23.08
16574.	George (georgepj)	13	58.03	67.45	1	7.69
16575.	gian (geefuco)	13	79.75	96.84	3	23.08
16576.	Газиз (gazizaskar_)	13	47.45	56.19	0	0.00
16577.	Garv (garvgopalia)	13	45.62	52.92	2	15.38
16578.	Garrett (garrettn1899)	13	60.09	67.62	2	15.38
16579.	TypeLX (gamerleelxo)	13	123.49	135.39	6	46.15
16580.	Gabe (gabrielbj29)	13	64.19	83.31	4	30.77
16581.	oof (fyestrietser101)	13	125.36	145.57	9	69.23
16582.	^_^ (fuuje)	13	79.57	94.16	5	38.46
16583.	Sandra (sbs96)	13	116.07	136.37	7	53.85
16584.	Sarah (sarahday)	13	100.45	117.75	7	53.85
16585.	S (sarahac)	13	100.89	119.16	8	61.54
16586.	Sara (sarachespara)	13	60.32	69.77	5	38.46
16587.	Saad (saadeldeen)	13	91.41	102.52	3	23.08
16588.	Xi (rozaana)	13	86.65	93.34	6	46.15
16589.	Roy (roylee0912)	13	123.73	158.29	6	46.15
16590.	rory (roryinnit)	13	82.00	96.40	2	15.38
16591.	Rocky (rocky_whale)	13	84.04	111.66	7	53.85
16592.	robert (robertford)	13	52.75	60.62	1	7.69
16593.	Gabe (roastedleather)	13	73.79	88.67	4	30.77
16594.	RB3 (rlbryant1982)	13	63.48	70.94	1	7.69
16595.	Ralo (rindt_)	13	76.18	84.63	3	23.08
16596.	Riggy (rigorodolico)	13	88.76	100.45	6	46.15
16597.	Chris (rialac)	13	91.10	111.96	4	30.77
16598.	Rennard (rennard)	13	80.85	93.38	5	38.46
16599.	Joshua (redscool)	13	102.89	115.96	5	38.46
16600.	Redking344 (redking344)	13	64.27	77.27	13	100.00
16601.	Xavier (redanky)	13	62.82	69.36	3	23.08
16602.	Juudge (reburm)	13	135.01	152.28	10	76.92
16603.	Gio (raskid)	13	71.85	93.26	3	23.08
16604.	Paul (randomnoob1)	13	124.39	149.25	8	61.54
16605.	random (randomnoob07)	13	51.43	63.13	3	23.08
16606.	Ramdizzle (ramdizzle)	13	59.79	69.14	5	38.46
16607.	Ralph John (ralph_saintaugu...	13	53.99	63.37	2	15.38
16608.	rajus (rajusthedarklord)	13	66.82	71.70	2	15.38
16609.	Rainfluff (rainfluff)	13	74.35	84.86	7	53.85
16610.	kaedyn (rainbowdad)	13	82.61	101.70	3	23.08
16611.	Rahil (rahil3108)	13	69.02	77.45	5	38.46
16612.	Hunter (ragingtimebomb)	13	66.51	79.48	2	15.38
16613.	Olivier (racoon9009)	13	46.84	51.10	2	15.38
16614.	Rab (rabuhana)	13	71.85	76.09	3	23.08
16615.	Viktor (quicksorting)	13	73.69	87.08	2	15.38
16616.	Al (quicksilver95)	13	112.01	131.81	11	84.62
16617.	Qualified (qualified98)	13	98.11	111.73	6	46.15
16618.	Theodor (prospitianknightma...	13	88.00	106.00	7	53.85
16619.	Prizy (prizypower)	13	54.74	67.99	8	61.54
16620.	aiden (poscowsm)	13	86.03	96.87	7	53.85
16621.	Posa2000 (posa2000)	13	63.51	74.50	0	0.00
16622.	Kelsey (pokewolf)	13	61.38	75.16	3	23.08
16623.	Jade (pokemonluv98)	13	86.72	104.05	3	23.08
16624.	Myles (pixelen)	13	81.26	99.86	3	23.08
16625.	PISSPAINTING (pisspainting)	13	82.48	94.83	6	46.15
16626.	miko (pisleo)	13	70.83	81.82	1	7.69
16627.	rey (pieri)	13	121.70	146.25	4	30.77
16628.	bacon (peter_1860)	13	59.77	71.72	5	38.46
16629.	Petr (petajupik)	13	38.52	42.54	1	7.69
16630.	bruh (peplee_)	13	87.43	105.78	2	15.38
16631.	Pear (pear_smo)	13	64.33	75.18	2	15.38
16632.	pb64 (pb64)	13	71.94	78.38	12	92.31
16633.	Pavlo (pavelko)	13	45.63	53.63	3	23.08
16634.	Paddy (paddyl)	13	76.89	85.30	4	30.77
16635.	Owen (owenecollins)	13	84.74	96.24	3	23.08
16636.	Cezar (outstanding29wpm)	13	84.19	89.72	4	30.77
16637.	oribiya-chan (oribiya)	13	50.90	58.97	1	7.69
16638.	☔️ (orella)	13	88.56	106.74	3	23.08
16639.	ayush (orange_master)	13	77.23	88.57	3	23.08
16640.	Oobi (oobixyz)	13	85.18	103.29	5	38.46
16641.	Chris (ohkaychris)	13	95.85	114.48	5	38.46
16642.	Nuge (nugemcgee)	13	106.89	120.44	8	61.54
16643.	Norps (norps)	13	70.94	80.82	2	15.38
16644.	Nolan (nolanporty)	13	68.81	84.85	1	7.69
16645.	nadav (nmcat)	13	19.20	24.70	4	30.77
16646.	Nikolas (nkaiser)	13	82.50	97.15	4	30.77
16647.	NJ (njc99)	13	69.26	83.05	5	38.46
16648.	nikax (nixa202)	13	105.09	118.07	5	38.46
16649.	Nivalis (nivalis11)	13	92.24	105.02	3	23.08
16650.	Nishal (nishalns)	13	43.95	54.06	1	7.69
16651.	Vegard (ninjawegard)	13	59.92	67.88	3	23.08
16652.	niko (nikuruuuuu)	13	92.39	100.87	6	46.15
16653.	Nikhil Sharma (nikhil_bolt)	13	86.97	93.36	3	23.08
16654.	Bash (nidaljaafar1)	13	58.01	71.52	3	23.08
16655.	Nick (nickpat)	13	94.52	117.70	4	30.77
16656.	nick (nickpanda44)	13	97.19	108.49	8	61.54
16657.	Abdul (netf121212)	13	45.29	52.81	2	15.38
16658.	Nazmin (naz_1212)	13	72.29	98.19	2	15.38
16659.	п8 ʅ(｡◔‸◔｡)ʃ ...	13	95.42	131.06	5	38.46
16660.	Nathaniel (nathaniel999)	13	58.48	64.92	4	30.77
16661.	Fran (narfornothing)	13	103.19	146.78	3	23.08
16662.	Chamnann (nannostar)	13	62.19	74.09	4	30.77
16663.	vinicius (nagahori)	13	70.78	79.14	3	23.08
16664.	RED (naga30)	13	29.42	45.73	1	7.69
16665.	Daulet (m_daulet)	13	45.34	54.88	2	15.38
16666.	Mubtasim (mubtasim91)	13	67.67	83.87	2	15.38
16667.	Spencer (mr_rigid)	13	67.81	80.76	4	30.77
16668.	Jakob (mrsuperhorse)	13	41.30	46.20	1	7.69
16669.	power (mrpowerstudiesyt)	13	86.31	105.22	4	30.77
16670.	Matt (mplumado)	13	67.89	80.38	3	23.08
16671.	mousie (mousiecandy)	13	73.33	87.29	2	15.38
16672.	muhammad (moulizax)	13	57.91	69.42	1	7.69
16673.	Gareth (morpen8)	13	110.28	126.83	6	46.15
16674.	Petar (monkeypants274)	13	62.91	68.32	3	23.08
16675.	MO$$ (monilyn)	13	84.82	96.79	5	38.46
16676.	Molly (molgreen)	13	94.71	111.20	10	76.92
16677.	Mohammad (mohammadkhosravi)	13	50.17	54.27	0	0.00
16678.	Mohamed (mohamedsobhi777)	13	72.88	87.88	3	23.08
16679.	Mike (mmiller_52)	13	55.77	63.65	1	7.69
16680.	MLGIN (mlgin)	13	86.96	122.81	9	69.23
16681.	Anon (mklegend)	13	123.10	143.98	11	84.62
16682.	Matt (misterc)	13	105.42	121.12	5	38.46
16683.	Mischa (mischapotter)	13	88.80	106.34	5	38.46
16684.	Miko (mikofinland)	13	65.53	74.90	3	23.08
16685.	Mikechun (mikechun)	13	89.23	107.40	3	23.08
16686.	mike1808 (mike1808)	13	93.77	106.87	6	46.15
16687.	Michael (mike1232b)	13	93.63	116.06	5	38.46
16688.	Maggie (migggggie)	13	110.14	121.51	4	30.77
16689.	Sofia (michael_bjordy)	13	81.58	91.72	4	30.77
16690.	MewX (mewx)	13	78.62	104.09	10	76.92
16691.	Samar (mesam22)	13	52.80	61.53	1	7.69
16692.	naser (memel0rd420)	13	72.27	86.80	3	23.08
16693.	Nur (mehedyhassan865)	13	44.05	59.49	2	15.38
16694.	ollie (mech_typer)	13	94.76	105.07	9	69.23
16695.	MD Gaziur Rahman Noor (mdga...	13	77.33	96.84	6	46.15
16696.	Maven (mavenz)	13	95.69	105.57	5	38.46
16697.	Matt (mattlo)	13	107.39	125.03	9	69.23
16698.	killerkoli (mattiemb)	13	63.87	75.90	2	15.38
16699.	Matan (matan_ati)	13	87.28	99.25	7	53.85
16700.	FunkyChicken (mastalampe)	13	73.39	80.82	4	30.77
16701.	Mark (markparadise)	13	49.76	58.13	1	7.69
16702.	marciano (marcboss06)	13	41.22	48.94	2	15.38
16703.	Marcago (marcago)	13	81.49	94.53	3	23.08
16704.	mapieko (mapieko)	13	45.00	52.55	1	7.69
16705.	Rushikesh (manwatkar)	13	43.24	50.75	0	0.00
16706.	Manikkavel (manikkavel_s)	13	70.47	79.85	2	15.38
16707.	Arissa (arissahsu)	13	101.95	117.19	8	61.54
16708.	Arevilov (arevilov_3)	13	77.46	87.21	3	23.08
16709.	Aquatic (aquache)	13	84.36	101.05	1	7.69
16710.	Mr.Pickles (ap_ultra)	13	93.28	116.72	4	30.77
16711.	Andy (andym04)	13	116.29	139.85	9	69.23
16712.	Andrew (andvorak)	13	60.50	65.81	3	23.08
16713.	Ridge (anawesomefry)	13	85.84	104.82	6	46.15
16714.	Allen (analogaio)	13	112.25	139.19	6	46.15
16715.	amr (amr_el7afy)	13	33.98	38.98	1	7.69
16716.	AmirrezA (amirrezase7en)	13	92.80	106.89	5	38.46
16717.	Amiro (amiro74)	13	47.60	52.70	7	53.85
16718.	aluminae (aluminae)	13	99.41	113.80	5	38.46
16719.	h3llo (alowqo)	13	49.67	57.54	3	23.08
16720.	Abdulaziz (aligonijr)	13	59.45	73.40	3	23.08
16721.	AKW (alice1120)	13	77.12	86.74	3	23.08
16722.	AlexAustria (alexaustria)	13	81.69	88.06	5	38.46
16723.	Ayush (akushwaha11)	13	54.92	65.68	1	7.69
16724.	Akram (akrammiru)	13	53.00	59.55	1	7.69
16725.	akmal (akmalhisyam)	13	42.18	45.43	2	15.38
16726.	Akhil (akhillasrado)	13	82.01	96.98	3	23.08
16727.	Aidan (aidan9500)	13	84.38	94.46	3	23.08
16728.	Alan (affectedmelon)	13	91.60	106.27	4	30.77
16729.	Aye (aexerz)	13	69.52	89.08	3	23.08
16730.	Adam (aeoff72)	13	84.04	110.68	4	30.77
16731.	Adhitya (adhityanugraha96)	13	61.70	69.17	1	7.69
16732.	Adedhuman (adedhuman)	13	77.79	86.45	3	23.08
16733.	Marco (acopazzo)	13	81.33	91.74	8	61.54
16734.	Ace (ace_dragonheart)	13	79.00	103.32	2	15.38
16735.	abdullakh (abdullakh)	13	39.67	45.82	5	38.46
16736.	Tchaqazbilla (abdesslam47)	13	74.61	81.75	2	15.38
16737.	Issaranuwat (aatsaranuwis)	13	60.38	78.48	4	30.77
16738.	Danial (6reload)	13	50.07	55.97	4	30.77
16739.	Danillo (60ppm)	13	104.89	118.71	4	30.77
16740.	Esso (3sso)	13	85.81	104.02	0	0.00
16741.	itchyaminoacid (335080673)	13	89.93	98.40	3	23.08
16742.	1time (1time4da1time)	13	95.75	105.68	4	30.77
16743.	173adrimor (173adrimor)	13	55.76	69.79	4	30.77
16744.	Amanda (111_amanda_111)	13	45.06	59.62	0	0.00
16745.	ekrem. (100percentnonquit)	13	123.55	150.38	6	46.15
16746.	Dominic (dominic127)	13	83.64	94.70	5	38.46
16747.	Maizzie (maizzie)	13	109.94	133.04	4	30.77
16748.	QcDaark (qcdaark)	13	59.45	71.61	4	30.77
16749.	Harishan (hari1111)	13	98.34	113.50	5	38.46
16750.	brendan (brendan4t)	13	61.63	70.27	3	23.08
16751.	Metallic Pea (cooler420)	13	87.15	97.30	3	23.08
16752.	Keith (fingers_skills)	13	70.91	77.66	4	30.77
16753.	Gonen (gonengazit)	13	78.60	96.60	1	7.69
16754.	JSU (mr_funiman)	13	68.69	85.03	5	38.46
16755.	Matt (dabagraham)	13	84.69	102.39	2	15.38
16756.	Knight (knightbedo)	13	59.19	70.44	2	15.38
16757.	vasu (vasu021191)	13	75.66	86.67	6	46.15
16758.	granola (granolagobbler)	13	67.88	74.76	1	7.69
16759.	Kong (denusklo)	13	47.19	51.55	2	15.38
16760.	kaden (hobby273broken)	13	39.60	56.70	9	69.23
16761.	Rasmus (seglats)	13	48.31	56.65	0	0.00
16762.	AyK3r (junior_mlg12)	13	49.76	60.32	1	7.69
16763.	Kritika (phoenix_1307)	13	51.42	60.90	1	7.69
16764.	Jorge (sheparddow)	13	59.10	68.44	3	23.08
16765.	Welton (wxavier)	13	73.88	84.54	3	23.08
16766.	Shin (overgeared_god_grid)	13	71.08	80.88	1	7.69
16767.	CrayonMuncher (shanejefferson)	13	91.00	99.99	4	30.77
16768.	Zeph (zeph_)	13	74.89	92.66	13	100.00
16769.	forCodeIns (synowcode)	13	44.80	56.76	3	23.08
16770.	Marco (makoko)	13	39.81	45.73	4	30.77
16771.	Castlekeepers (castlekeepers)	13	86.68	98.30	2	15.38
16772.	Demon (demon_rocrip)	13	69.51	78.58	2	15.38
16773.	Alonso (lazerblade14)	13	60.81	80.25	1	7.69
16774.	Sigma.Driver (thotslayerron)	13	62.24	72.37	3	23.08
16775.	sunil (sunil1990)	13	51.14	57.45	2	15.38
16776.	Sophie (sophienguyen2004)	13	65.46	83.49	4	30.77
16777.	Gabriel (gabo16quito)	13	62.10	68.07	2	15.38
16778.	Adler (adlerbrin)	13	50.54	64.87	1	7.69
16779.	Typing_King (typing_king_123)	13	91.22	111.67	8	61.54
16780.	wooksen. (wooksen)	13	75.24	86.95	7	53.85
16781.	Simon (simon1293)	13	93.03	109.94	3	23.08
16782.	josesi (nuevetails)	13	56.75	76.96	2	15.38
16783.	Morsbøl (morsboel)	13	83.94	103.84	2	15.38
16784.	Marcie (dinkteam)	13	80.82	109.74	6	46.15
16785.	arrathore (arrathore)	13	95.57	120.72	4	30.77
16786.	jym (jjimjjam)	13	91.92	102.53	3	23.08
16787.	Max (rebel_dog)	13	47.88	56.44	0	0.00
16788.	Franco (franco404)	13	47.66	56.07	1	7.69
16789.	Tachy_Bunker (lo23co7mcpe)	13	90.54	99.66	8	61.54
16790.	Roronoa (roronoa_zoro007)	13	51.56	60.45	1	7.69
16791.	Alfonso (aagtyperacer)	13	47.98	61.58	2	15.38
16792.	Boy Wonder (coding_ninja)	13	54.05	67.96	4	30.77
16793.	Nook (nookydoki)	13	70.44	95.02	1	7.69
16794.	Charlie (charlzalan)	13	88.31	101.96	5	38.46
16795.	The_mayo (rilven)	13	56.97	63.30	1	7.69
16796.	Jerome (jerometan)	13	55.34	69.31	3	23.08
16797.	Harsh (captain_booga)	13	43.97	52.66	1	7.69
16798.	Sabila (sabilaferisya)	13	70.66	85.41	3	23.08
16799.	Kevyn (k3vsk1)	13	82.28	102.06	6	46.15
16800.	AntMan (antmanreis)	13	86.04	103.89	6	46.15
16801.	Audrey (aubreerybak)	13	90.64	101.24	4	30.77
16802.	Caitlin (lemoniio)	13	77.96	89.56	6	46.15
16803.	breadstick (main32134)	13	88.78	102.46	9	69.23
16804.	William (willythewilly)	13	65.98	85.78	1	7.69
16805.	Oussama (kappachier)	13	94.06	116.55	6	46.15
16806.	faizal (faizal104)	13	33.77	43.55	2	15.38
16807.	Darel (dareeellll)	13	73.12	84.09	3	23.08
16808.	Hashim (pheonixflame77)	13	41.19	48.56	0	0.00
16809.	Ilmari (kaljis)	13	45.59	50.37	2	15.38
16810.	Michael (michaeltol)	13	48.48	56.85	2	15.38
16811.	Khalifa (justkhalifa)	13	82.19	99.62	6	46.15
16812.	Jason Oh (sohleil)	13	75.24	82.93	3	23.08
16813.	Jun Kai (phangseafood)	13	50.28	59.67	1	7.69
16814.	Manjeet (manjeet1528)	13	48.72	61.91	1	7.69
16815.	FlameMage (flamemage)	13	98.44	111.62	4	30.77
16816.	Markee (itsmarkee)	13	75.95	98.86	7	53.85
16817.	Jasmine (jazzqt)	13	71.38	92.33	5	38.46
16818.	Ash (ashgen10)	13	38.15	42.65	1	7.69
16819.	takki (liltakki)	13	60.11	83.78	4	30.77
16820.	Himanshu (aatransh)	13	45.13	58.27	0	0.00
16821.	Kenkz (kenkodstark)	13	65.36	77.32	2	15.38
16822.	Nick (christophermarto)	13	54.43	64.79	4	30.77
16823.	Jakub (piorunpl)	13	65.07	75.70	2	15.38
16824.	DK (dkbozz)	13	65.81	70.99	4	30.77
16825.	Sky (_kuraaiii)	13	56.64	79.25	4	30.77
16826.	Sergio (sergio91)	13	53.91	59.98	3	23.08
16827.	CeepTheMaker101 (ceepthemak...	13	91.98	110.60	5	38.46
16828.	seashell (seashell508)	13	39.12	46.87	5	38.46
16829.	Dylan (ap0k)	13	91.31	101.09	5	38.46
16830.	BraveBer (braveber)	13	66.32	78.32	2	15.38
16831.	jiwanshu (jiwanshu_rajput)	13	44.12	62.01	3	23.08
16832.	Bintang (bintangdace)	13	91.02	100.30	1	7.69
16833.	Arath (arathjz)	12	87.59	98.17	5	41.67
16834.	Apple Magic (applemagic4life)	12	127.45	149.73	8	66.67
16835.	Anugrah (anugrahdwikusuma)	12	92.68	116.31	4	33.33
16836.	tstats[anotherbandkid] (ano...	12	80.81	91.66	3	25.00
16837.	Anit (anit2007)	12	75.54	87.36	5	41.67
16838.	angel (angelllfoo)	12	86.07	103.03	4	33.33
16839.	Andrew (andrewfbr)	12	101.38	121.86	6	50.00
16840.	Andrew (andrewdvorak)	12	96.12	106.30	6	50.00
16841.	Abdullah (anarkhos)	12	95.25	101.73	4	33.33
16842.	陳 (amybmy)	12	59.88	73.50	2	16.67
16843.	Nafiul (aminafi)	12	82.16	89.77	4	33.33
16844.	alex (alexllc)	12	70.10	125.48	6	50.00
16845.	Alex (alexlava)	12	78.85	90.18	2	16.67
16846.	Al (alexkjenkins)	12	67.26	78.04	1	8.33
16847.	Albion (albionthegreat)	12	85.25	96.46	1	8.33
16848.	Mohammed (alazzouny)	12	52.53	65.41	1	8.33
16849.	Alarming (alarmngracer)	12	72.15	88.97	4	33.33
16850.	aka49 (aka49)	12	95.90	114.39	5	41.67
16851.	AJspeedy (ajspeedy5)	12	87.08	98.11	5	41.67
16852.	Aishuak (aishonnnn)	12	50.90	57.67	9	75.00
16853.	hadi (airsmite)	12	78.35	91.25	11	91.67
16854.	lelo (aie1900)	12	72.14	84.86	2	16.67
16855.	Aggro (aggro_typer)	12	106.92	121.03	5	41.67
16856.	The (afsanster)	12	41.56	47.57	3	25.00
16857.	Ajitesh (adji2057)	12	61.24	71.33	4	33.33
16858.	adibhehe (adibhehe)	12	67.08	81.21	12	100.00
16859.	henryk (adeczek)	12	113.85	141.77	2	16.67
16860.	Adarsh (adarshkr)	12	76.60	85.31	4	33.33
16861.	Ezra (account_name)	12	117.84	128.04	4	33.33
16862.	Abhiram (abhiramravi)	12	107.30	120.45	6	50.00
16863.	Abdallah (abdallah7)	12	73.04	93.08	3	25.00
16864.	Aakash (aakash3697)	12	79.14	92.07	4	33.33
16865.	Andy (a1i3n0)	12	108.85	129.46	7	58.33
16866.	meme (7fingers)	12	94.00	121.66	5	41.67
16867.	swagfish (4thunion)	12	90.56	104.94	5	41.67
16868.	Osyrs (3556)	12	66.77	76.57	2	16.67
16869.	2qbingxuan (2qbingxuan)	12	68.62	82.92	1	8.33
16870.	2dnas (2dnas)	12	76.40	86.96	2	16.67
16871.	MD (123onick)	12	35.98	42.97	3	25.00
16872.	Owen (123ojb)	12	101.26	109.43	0	0.00
16873.	Arne (11bricks)	12	86.25	102.59	3	25.00
16874.	Jason (j93_quinn)	12	81.14	102.08	3	25.00
16875.	Batman (wellin)	12	76.37	87.25	4	33.33
16876.	Allen (livehappily16)	12	59.72	76.85	2	16.67
16877.	Caboj (dvoraklearner123)	12	86.46	104.00	6	50.00
16878.	Triet (triet228)	12	66.16	81.54	1	8.33
16879.	Yūgen (yugenamane)	12	76.48	87.47	3	25.00
16880.	Rogue_Panda (sanchit___)	12	49.76	60.15	2	16.67
16881.	Ja (jarenmatthew)	12	70.34	81.30	4	33.33
16882.	soft (shattered_lens)	12	88.35	111.38	6	50.00
16883.	matcha (matchanapkin)	12	96.71	112.01	4	33.33
16884.	Sagun (sagunmdr)	12	60.23	71.06	4	33.33
16885.	Kyle (akilies2401)	12	63.41	72.64	6	50.00
16886.	kushal (cheesecakebtw)	12	67.92	76.64	0	0.00
16887.	Allen (enigma_801)	12	125.24	135.88	11	91.67
16888.	Elias (elreylocro)	12	59.47	71.37	6	50.00
16889.	Erik (erhuht)	12	73.79	86.34	2	16.67
16890.	kryeohs (kryeohs)	12	50.29	59.75	3	25.00
16891.	Tantai (tantai115)	12	56.26	62.47	3	25.00
16892.	Mr. (pedley)	12	76.12	85.60	7	58.33
16893.	Cesar (lentil_salad)	12	47.97	52.83	1	8.33
16894.	london (londonxxx)	12	73.63	88.07	4	33.33
16895.	Muhammad (wakype)	12	46.46	51.99	3	25.00
16896.	isniffsharpies (isniffsharp...	12	83.19	99.92	3	25.00
16897.	Phelix (phelix23)	12	102.14	117.35	9	75.00
16898.	Nathalie (larreanathalie)	12	59.18	72.30	1	8.33
16899.	lj (yzthesimp)	12	46.36	55.56	3	25.00
16900.	spongebob (royalespongebob)	12	86.49	102.73	4	33.33
16901.	John (bonsaifarm)	12	89.95	108.77	2	16.67
16902.	Nguyen (nguyenminhtri)	12	37.31	48.31	0	0.00
16903.	chloe (musical_kittycat)	12	98.10	112.24	2	16.67
16904.	Edd (christenlanger)	12	94.37	117.14	5	41.67
16905.	bibney (bibney)	12	88.84	98.33	4	33.33
16906.	ryan (ambush_)	12	73.75	89.93	4	33.33
16907.	Kenshee (knshnsrz)	12	73.58	86.79	4	33.33
16908.	Chris (c4fernandez)	12	82.40	97.97	4	33.33
16909.	novice (kai1234567890)	12	34.69	37.95	0	0.00
16910.	airkool (airkool)	12	57.49	68.36	2	16.67
16911.	Rick (agira)	12	36.21	61.76	0	0.00
16912.	John (khoryl)	12	88.85	100.89	2	16.67
16913.	Rafi (sirtheo)	12	48.59	56.33	3	25.00
16914.	Hunter (htrautz)	12	67.77	76.63	1	8.33
16915.	Dianne (diannutella)	12	86.27	101.56	12	100.00
16916.	Joel (joelitoelisha)	12	71.57	86.94	5	41.67
16917.	An Existing Person (technon...	12	102.25	117.15	9	75.00
16918.	Son Nguyen (xpinpin)	12	70.23	79.38	8	66.67
16919.	Lexie (lexie120)	12	72.16	82.91	2	16.67
16920.	Callum (lemurple)	12	59.71	70.40	0	0.00
16921.	Trying to get to 75wmp (in_...	12	88.74	98.71	5	41.67
16922.	Elizabeth (theatribeth)	12	65.35	73.68	3	25.00
16923.	Jack (jackkaranjan)	12	81.73	94.01	2	16.67
16924.	Prakash (prakash_18)	12	24.03	30.38	4	33.33
16925.	Allee (hayyallee)	12	63.79	95.08	10	83.33
16926.	Peachy (peachynotsimp)	12	55.62	67.63	0	0.00
16927.	ABsuperX (anuraagbarde)	12	57.54	68.49	5	41.67
16928.	Aditya (adishegde)	12	80.35	98.94	3	25.00
16929.	Monke (monke_with_a_keyboard)	12	61.66	74.88	3	25.00
16930.	Mario (marioloop)	12	32.92	38.39	0	0.00
16931.	SandTinx (sandtinx)	12	61.19	70.97	4	33.33
16932.	Aubrey (aubreylynn14)	12	99.27	125.92	4	33.33
16933.	Ridley (ridlz)	12	76.00	83.87	1	8.33
16934.	Hafsa (hafsamohammed200)	12	70.16	80.93	3	25.00
16935.	Alex (chualexchu)	12	91.14	106.65	4	33.33
16936.	Huong (__ian)	12	65.75	73.60	1	8.33
16937.	Mucha (mucha_)	12	78.04	89.06	5	41.67
16938.	spookydoggo (spookydoggo)	12	91.87	119.67	10	83.33
16939.	Manges (friendzonecamper)	12	88.97	112.63	5	41.67
16940.	tony (bananaboyy)	12	82.25	92.68	6	50.00
16941.	malix (malangi)	12	82.54	94.56	3	25.00
16942.	Aeddon (a3ddon)	12	97.18	110.83	3	25.00
16943.	Erick (erickis300)	12	96.91	110.45	9	75.00
16944.	Ley (leeeeymm)	12	70.72	87.91	1	8.33
16945.	Phillip (philyphil)	12	71.55	85.72	2	16.67
16946.	Lisa (xoxfko)	12	42.70	61.61	0	0.00
16947.	Meh Zall (mehzall)	12	90.60	104.21	7	58.33
16948.	mclrn (mclrn)	12	80.67	91.96	3	25.00
16949.	Kaeji (kaeji404)	12	62.59	70.21	0	0.00
16950.	diamond (diamondthecat)	12	48.46	61.02	0	0.00
16951.	Jordi (jordi333)	12	41.36	46.38	11	91.67
16952.	David (davethebravemicrowave)	12	72.24	82.79	9	75.00
16953.	Blake (weekesy)	12	65.33	72.68	0	0.00
16954.	Meister (bmmeister)	12	45.39	53.44	1	8.33
16955.	AthenaHuss (mountainhusky)	12	32.61	35.73	0	0.00
16956.	Riley (kellerxll)	12	82.24	93.46	4	33.33
16957.	Noel (psychoimpulse)	12	70.95	82.02	3	25.00
16958.	Chclo (chclo)	12	105.05	121.88	7	58.33
16959.	Aaron (dunclapicus)	12	106.70	125.80	7	58.33
16960.	Joe (hey__joe)	12	81.13	100.00	12	100.00
16961.	8990 (sinanae)	12	72.84	99.09	4	33.33
16962.	Frozenrings (frozenrings)	12	64.18	79.01	9	75.00
16963.	Jordan (alienshockz)	12	53.00	63.03	1	8.33
16964.	Niam (ninicanuck)	12	79.81	93.59	3	25.00
16965.	yamp (yamp)	12	91.03	100.83	2	16.67
16966.	Cedar (pumpkin_racer)	12	86.75	102.28	2	16.67
16967.	moon (moonrace)	12	77.46	88.89	3	25.00
16968.	Lennox (lennoxn)	12	57.28	64.58	3	25.00
16969.	Noob (_donpablo)	12	29.58	37.60	1	8.33
16970.	Sameen (ninogasuki)	12	86.28	95.63	4	33.33
16971.	Puma (bigfast26)	12	40.20	46.93	0	0.00
16972.	Shidori (shidori)	12	70.08	79.18	4	33.33
16973.	Kyunghwan (mallardk0h)	12	84.37	100.22	2	16.67
16974.	M (maddyjune)	12	86.11	104.51	2	16.67
16975.	Mada (mada_)	12	94.57	106.51	1	8.33
16976.	Manoj (m00npie)	12	55.65	62.73	3	25.00
16977.	thompson (lulugaming_da_pro...	12	79.78	88.35	7	58.33
16978.	LUka (lukazmaj)	12	54.74	62.67	3	25.00
16979.	(luclukiluc)	12	82.23	94.99	3	25.00
16980.	lubi222 (lubi222)	12	124.09	140.97	6	50.00
16981.	LordxChongo (lordxchongo)	12	47.86	62.71	7	58.33
16982.	Locklyn (locky_)	12	84.08	102.31	2	16.67
16983.	Lori (ljflute)	12	95.72	119.38	4	33.33
16984.	Lizard (lizardk99)	12	95.42	108.46	4	33.33
16985.	fusaishi (litaoge)	12	81.11	93.13	7	58.33
16986.	Le Linh (linhkhanhslee)	12	46.29	55.39	1	8.33
16987.	Lily (lilythemc)	12	63.14	73.81	0	0.00
16988.	Nandies (lilnandies)	12	64.93	73.44	3	25.00
16989.	Hisoka (lev872)	12	30.98	35.61	2	16.67
16990.	Lila_lut (lei_ruth)	12	73.36	84.32	4	33.33
16991.	Iota (legendary_alpha)	12	57.61	65.15	7	58.33
16992.	Leang (leangsopoar)	12	48.69	55.53	0	0.00
16993.	leah (leah8jean)	12	47.68	62.05	2	16.67
16994.	Jan (latino_dino)	12	47.18	54.15	0	0.00
16995.	cyamon (kuthiphenchodi)	12	92.39	109.87	5	41.67
16996.	Christian (kunuc)	12	89.37	102.39	5	41.67
16997.	Krutik (krutikp)	12	66.51	74.50	3	25.00
16998.	kovi (kovizzz)	12	100.88	121.63	4	33.33
16999.	Koshi (koshigaming)	12	94.69	110.80	5	41.67
17000.	Knot (knotcj)	12	69.81	85.89	4	33.33
17001.	Klog (klog53)	12	104.94	122.64	5	41.67
17002.	matt (kingspyfox)	12	60.34	68.35	3	25.00
17003.	BingBong (kingcaiden66)	12	99.10	110.18	5	41.67
17004.	Orban (killhorizon23)	12	73.32	87.90	2	16.67
17005.	Kebee (kevwickz)	12	92.10	100.49	7	58.33
17006.	Herb (kellzer)	12	82.23	99.03	4	33.33
17007.	Kean (kean_saneki)	12	71.48	89.26	2	16.67
17008.	Kunal (kc596)	12	69.64	75.23	1	8.33
17009.	John (kasi95)	12	68.28	78.22	4	33.33
17010.	Kanav (kanav__trying)	12	55.41	64.20	0	0.00
17011.	Chris Jozef Cad (kamireign)	12	98.72	112.05	5	41.67
17012.	Kacper (kacpix2000)	12	109.17	145.07	8	66.67
17013.	Lev (kaberan)	12	34.27	39.64	0	0.00
17014.	🤜🏻 (k1s_darya)	12	89.14	101.98	2	16.67
17015.	Joe (jych0)	12	83.20	95.53	6	50.00
17016.	jwt4517 (jwt4517)	12	99.82	111.07	8	66.67
17017.	L (just_a_random_guy_123)	12	71.39	83.11	2	16.67
17018.	isaac (justisaac5)	12	76.17	87.24	0	0.00
17019.	Julian (julianjelfs)	12	59.49	69.87	1	8.33
17020.	JuanDeag111 (juandeag111)	12	83.82	94.58	3	25.00
17021.	n (jtrondy)	12	90.49	103.76	6	50.00
17022.	Flank (jtall4747)	12	81.07	99.94	1	8.33
17023.	JOSH (jo_dpe)	12	82.15	96.48	3	25.00
17024.	jonathan (joschio_o)	12	66.32	79.17	1	8.33
17025.	Jonathan (jon_daub)	12	82.43	105.17	2	16.67
17026.	Esketit (jony1525)	12	95.47	112.09	7	58.33
17027.	Johnny (johnnytct)	12	73.89	87.05	6	50.00
17028.	Joel (joel10)	12	48.79	54.87	3	25.00
17029.	Joseph (joegoldman)	12	105.40	115.18	8	66.67
17030.	Jared (jm1289)	12	58.36	66.30	3	25.00
17031.	jimi (jimi79)	12	92.85	108.58	10	83.33
17032.	Jay (jgupta)	12	98.32	116.83	6	50.00
17033.	asldjf (jfulle3518)	12	111.62	132.32	6	50.00
17034.	Jess (jessnguy)	12	58.42	72.71	1	8.33
17035.	A (jenniesana)	12	74.03	91.46	5	41.67
17036.	Triết (jean2002)	12	40.42	47.63	4	33.33
17037.	Jd (jdthebeanbag)	12	58.85	67.14	1	8.33
17038.	Jatin (jcsteelbender)	12	95.83	106.89	6	50.00
17039.	Michael (javamorris)	12	101.73	114.63	6	50.00
17040.	Debbie (jaedee_debbie)	12	68.42	82.96	4	33.33
17041.	Tim (jackychan564)	12	100.98	129.47	4	33.33
17042.	Jackson (jacksons123)	12	94.99	109.82	2	16.67
17043.	jachym (jachymneumipsat)	12	41.89	48.44	0	0.00
17044.	Justin (iukekini)	12	105.57	115.53	6	50.00
17045.	Bryle (itsbrytastic)	12	100.16	114.74	7	58.33
17046.	sasuke_uchihha (ironman1123)	12	61.57	67.97	0	0.00
17047.	Duy (invinduy)	12	82.24	100.94	10	83.33
17048.	Intesar (intesar)	12	61.83	71.13	3	25.00
17049.	InfiniteCows (infinitecows)	12	98.50	113.08	8	66.67
17050.	Azer (imranovazer)	12	38.50	53.02	0	0.00
17051.	tstats[ilyadancshp] (ilyada...	12	66.42	72.36	3	25.00
17052.	Alonso (igoalonso)	12	63.20	75.70	3	25.00
17053.	Moatasem (idolzy_123)	12	104.84	119.14	5	41.67
17054.	Erin (iceflake)	12	84.59	101.62	3	25.00
17055.	Daniel (ibedacaptainofdaship)	12	103.05	121.60	4	33.33
17056.	VPK (iamvpk)	12	87.11	103.12	6	50.00
17057.	Adam (iadam368)	12	72.36	81.95	10	83.33
17058.	yoyo (i0y0)	12	53.17	60.04	0	0.00
17059.	Andrew (hurricaneandrewbs)	12	85.44	96.96	2	16.67
17060.	Hunter (hunterschool22)	12	103.35	116.33	8	66.67
17061.	Hramich (hramich)	12	57.22	64.07	2	16.67
17062.	Name (housewren)	12	112.40	140.47	8	66.67
17063.	houka (houka)	12	79.15	97.01	6	50.00
17064.	Peter (hoopla27)	12	75.09	89.49	3	25.00
17065.	Juan Raphael (homonovus97)	12	51.72	56.83	1	8.33
17066.	awesome (hobo223)	12	91.43	101.80	5	41.67
17067.	I_will_not_tell (hitme1111)	12	24.34	28.31	1	8.33
17068.	doubt (hightness)	12	86.25	95.30	3	25.00
17069.	xi (highrizery)	12	70.30	78.21	2	16.67
17070.	hhh (hhhaaahhhaa)	12	74.95	89.15	3	25.00
17071.	Alex (heikale)	12	59.56	75.92	1	8.33
17072.	Afifu (healme)	12	60.81	74.00	4	33.33
17073.	Henry (hchen1021)	12	79.60	92.97	3	25.00
17074.	Janet (hasuhime)	12	70.31	85.99	4	33.33
17075.	Hashrin (hashrin)	12	75.83	94.51	4	33.33
17076.	Harsha (harshatalla)	12	64.98	79.11	3	25.00
17077.	Ahsan (haris_ahmed)	12	95.76	106.06	11	91.67
17078.	harcipulyka (harcipulyka)	12	71.02	79.90	3	25.00
17079.	Haotian (haotianxu)	12	106.70	120.85	4	33.33
17080.	j (hanjam)	12	81.19	88.20	4	33.33
17081.	Maurice (halpibad)	12	49.23	60.22	1	8.33
17082.	cleve. (haipong)	12	123.17	137.28	8	66.67
17083.	Kevin (hadoukevin)	12	90.48	101.56	4	33.33
17084.	Joseph (gov_issued)	12	97.35	108.56	0	0.00
17085.	Zack (goodguyzack)	12	79.52	94.65	9	75.00
17086.	GIMLY98 (gimly98)	12	88.01	111.61	5	41.67
17087.	Giancarlo (giancarlo_sturla7)	12	97.75	108.17	5	41.67
17088.	George (georgedmi)	12	74.83	83.00	0	0.00
17089.	Deepak (gdn_td)	12	77.74	92.49	5	41.67
17090.	Jayden (gaminglz)	12	85.41	101.85	3	25.00
17091.	Michel (gamerz026)	12	93.80	108.63	5	41.67
17092.	Friz64 (friz64)	12	78.36	95.91	0	0.00
17093.	FrankSauve (franksauve)	12	67.65	80.68	4	33.33
17094.	Foxrumor (foxrumor)	12	67.18	81.98	5	41.67
17095.	Joel (fonke)	12	80.04	100.64	4	33.33
17096.	Matt (flamingbear)	12	79.98	89.80	7	58.33
17097.	Filip (filipge)	12	47.53	54.71	1	8.33
17098.	Finch (ficxjo)	12	117.93	146.31	6	50.00
17099.	fetix (feticks)	12	93.82	121.63	2	16.67
17100.	Hien (feederchuluc96)	12	50.59	58.26	1	8.33
17101.	Fangxing (fangoling)	12	56.85	64.79	3	25.00
17102.	A (fancy_potato)	12	61.59	85.97	3	25.00
17103.	Fabian (fabiangomez)	12	94.60	100.93	4	33.33
17104.	etienne (etiennne)	12	113.02	122.45	6	50.00
17105.	Ethan (ethantai)	12	110.88	125.60	8	66.67
17106.	Robert (ert00034)	12	114.90	128.85	4	33.33
17107.	Eric (ericplayz132)	12	122.99	133.87	7	58.33
17108.	Elvar (elvar333)	12	71.39	89.57	2	16.67
17109.	Mohamed (elhedeq)	12	35.60	38.65	0	0.00
17110.	Cristian (electpit)	12	57.95	65.71	0	0.00
17111.	Ekshore (ekshore)	12	75.81	92.10	3	25.00
17112.	Faquarl (ekrpat)	12	93.98	111.49	6	50.00
17113.	Eichi (eichitenshouin)	12	100.26	120.58	5	41.67
17114.	Egyptian (egyptianlion)	12	105.79	114.46	7	58.33
17115.	Zac (eastunder)	12	70.03	90.83	7	58.33
17116.	dylan (dywan)	12	85.80	98.00	5	41.67
17117.	Daniel (dxnielz)	12	94.70	109.15	12	100.00
17118.	David (dwang05)	12	102.53	117.43	4	33.33
17119.	Durga (durga32670)	12	47.57	56.48	2	16.67
17120.	Adrianus (dungonmahshoe)	12	93.93	116.48	4	33.33
17121.	duncs (duncs)	12	89.21	103.95	9	75.00
17122.	Duke (dukemagnum)	12	80.68	94.56	1	8.33
17123.	D (ducktypist)	12	104.02	116.06	5	41.67
17124.	Insub (dskumpf)	12	99.00	110.10	7	58.33
17125.	Ariel (drofniarg)	12	101.03	120.51	7	58.33
17126.	D1eg8 (drm86)	12	74.85	86.61	5	41.67
17127.	Dennis (doxalite)	12	61.95	80.44	4	33.33
17128.	Ian (doughs)	12	102.48	125.26	5	41.67
17129.	Doug (dougdimmadan)	12	102.07	114.00	6	50.00
17130.	DosU (dosu)	12	40.23	44.69	0	0.00
17131.	Kevin (dostoyevksy)	12	28.83	36.73	3	25.00
17132.	Dodi (dodic)	12	100.89	108.01	5	41.67
17133.	David (djtm)	12	70.48	76.98	4	33.33
17134.	Dexter (dextergamer)	12	61.71	68.56	4	33.33
17135.	something (destroyer27777)	12	81.05	92.11	1	8.33
17136.	Deron (deron_09)	12	48.17	66.68	3	25.00
17137.	Derek (derekyeh)	12	44.24	53.35	0	0.00
17138.	denzel (dennzzz)	12	73.39	79.80	2	16.67
17139.	DenDu (dendu_respekt)	12	50.81	61.92	6	50.00
17140.	deej (deej195)	12	86.26	96.76	1	8.33
17141.	Declan (dec13)	12	52.64	61.24	6	50.00
17142.	not_that (darkmaster_30)	12	71.51	82.43	7	58.33
17143.	Daniel (danoco)	12	46.37	53.78	0	0.00
17144.	dankerkys (dankerkys)	12	59.02	79.64	7	58.33
17145.	Dani (danivideda)	12	74.27	91.47	4	33.33
17146.	Daniel (dalord)	12	61.61	70.51	2	16.67
17147.	Dakize (dakice)	12	90.18	102.49	5	41.67
17148.	daebro (daebro)	12	80.87	95.02	6	50.00
17149.	CybrZero (cybrzero)	12	53.43	65.98	2	16.67
17150.	Curtis (curtisz)	12	85.90	97.64	3	25.00
17151.	Zxar (cubercubed)	12	72.37	82.10	4	33.33
17152.	Nico (cuber)	12	117.67	148.73	4	33.33
17153.	JP (cryoblivious)	12	83.90	97.12	5	41.67
17154.	Crescendo (crescendot)	12	97.38	115.50	6	50.00
17155.	CrazyhourXD (crazyhourxd)	12	72.11	79.77	3	25.00
17156.	gaoshan (crazydonkehhhhh)	12	77.15	92.17	3	25.00
17157.	Crafty (craftywastaken)	12	92.45	113.34	6	50.00
17158.	aziz (cornea)	12	50.33	55.42	1	8.33
17159.	Bean (cornbreadman)	12	81.02	106.92	9	75.00
17160.	Eric (cool_armadillo)	12	85.35	100.25	5	41.67
17161.	Tyson (cooldude1800)	12	68.23	76.51	4	33.33
17162.	Val (codehacker707)	12	98.69	113.89	6	50.00
17163.	clout (clouted)	12	80.25	97.03	3	25.00
17164.	Clarissa (clarissaclaa)	12	68.30	75.16	1	8.33
17165.	Citizen404 (citizen404)	12	89.07	97.79	6	50.00
17166.	StickInMyButt (chungi)	12	104.01	116.08	5	41.67
17167.	CHRISTIAN (chris7ka)	12	87.65	107.84	4	33.33
17168.	choppery (choppery)	12	74.00	82.39	3	25.00
17169.	Chipper (chipperdiglett)	12	79.61	91.71	7	58.33
17170.	chino (chino69)	12	68.44	77.35	3	25.00
17171.	ching (chingchongchangchink)	12	63.87	85.01	1	8.33
17172.	Danh (chetdanh)	12	97.51	112.73	2	16.67
17173.	50wpm (chengyangz)	12	83.16	89.65	2	16.67
17174.	Sangga (chemicalchaos291)	12	67.91	77.48	2	16.67
17175.	chasing (chasingfastpoker9995)	12	103.74	120.10	2	16.67
17176.	ChaosNuggets (chaosnuggets)	12	97.81	114.68	3	25.00
17177.	chanon (chanonlatt)	12	50.48	54.81	3	25.00
17178.	cathy (cathyyyyy)	12	54.37	63.02	1	8.33
17179.	Carson (carson_a_r)	12	65.70	74.98	7	58.33
17180.	William (caraxd)	12	105.53	118.93	6	50.00
17181.	captain357 (captaincool357)	12	88.26	111.57	7	58.33
17182.	Candace (candacefumeh)	12	39.52	45.60	10	83.33
17183.	callicco (calllicco)	12	111.85	129.29	5	41.67
17184.	Cactus (cactus_jones)	12	95.16	106.08	8	66.67
17185.	Connor (c42855)	12	87.61	101.10	4	33.33
17186.	Bumsu (bumsu)	12	62.03	74.68	3	25.00
17187.	Joshua (brothersquid123)	12	84.81	100.59	2	16.67
17188.	Bob (bromanswagboy)	12	92.95	118.20	3	25.00
17189.	cuki 🍪 (brewlux)	12	107.02	120.42	6	50.00
17190.	Rafael (brafs165)	12	63.60	74.44	3	25.00
17191.	Anthony (boxa)	12	74.82	87.84	6	50.00
17192.	allie (bokutobro)	12	69.92	85.31	3	25.00
17193.	tstats[bobfish] (bobfish)	12	32.84	48.64	0	0.00
17194.	Narwal (bnarwal)	12	50.22	66.76	4	33.33
17195.	BlueTrip (bluetrip)	12	107.94	126.38	8	66.67
17196.	Bluefire (bluefire828)	12	95.75	107.40	5	41.67
17197.	Sujay (bluebeetle)	12	58.27	66.64	1	8.33
17198.	ok (biscuitalex)	12	95.87	114.40	4	33.33
17199.	ol (billturbo)	12	82.29	97.99	6	50.00
17200.	Chris (bigzaddy)	12	78.39	96.94	0	0.00
17201.	cameron (bigmoon)	12	28.91	38.12	3	25.00
17202.	mrbasts10000dollarrefrigera...	12	99.54	111.08	5	41.67
17203.	Gabor (bgabor)	12	79.39	90.01	5	41.67
17204.	Berny (bernyboi)	12	73.81	79.65	3	25.00
17205.	Dennis (bejdenn)	12	65.86	78.17	3	25.00
17206.	Bayu (bayufajariyanto)	12	50.86	60.25	1	8.33
17207.	Rizky (battle_hooks12)	12	82.02	98.34	6	50.00
17208.	Balloon (balloon75)	12	47.57	55.91	2	16.67
17209.	Ben (bakchansoo)	12	77.53	100.28	5	41.67
17210.	Aziron (aziron)	12	122.91	135.91	4	33.33
17211.	azhi (azhi_i)	12	28.89	32.84	1	8.33
17212.	Avy (avygorg)	12	34.69	47.45	0	0.00
17213.	George (ausp1c1ous)	12	93.84	103.92	3	25.00
17214.	Tropticl (aupsidedowncup)	12	54.88	63.74	7	58.33
17215.	AtticusB (atticusb)	12	85.46	98.34	3	25.00
17216.	Accuracy (attempts_at_accur...	12	84.13	94.08	6	50.00
17217.	Brian (atrospecter)	12	94.69	115.15	6	50.00
17218.	ashtunu (ashtunu)	12	64.43	72.57	5	41.67
17219.	Ashraya (ashrayas)	12	59.74	68.86	2	16.67
17220.	Ashish (ashishpatel0720)	12	69.53	84.02	4	33.33
17221.	ASHISH YADAV (ashish001)	12	28.68	32.92	0	0.00
17222.	Sherzod (asdfgh5889)	12	79.57	104.19	6	50.00
17223.	Ahmed (__ahmed__)	12	80.03	87.58	6	50.00
17224.	Zoniax (_zephr)	12	87.77	111.96	4	33.33
17225.	Rodrigo (zurrion)	12	101.43	118.53	12	100.00
17226.	Zuhes (zuhes7)	12	81.14	89.96	5	41.67
17227.	zach (zinfinte57)	12	58.10	62.94	3	25.00
17228.	InVerse (zenmonkinverse)	12	90.34	101.06	5	41.67
17229.	zehvvu (zehvvu)	12	72.89	77.47	6	50.00
17230.	Zeerox (zeerox)	12	61.77	73.61	1	8.33
17231.	William (yuwan1)	12	52.70	77.01	2	16.67
17232.	Josh (yungjosh)	12	117.69	132.51	6	50.00
17233.	APPLE (ytfox_roller)	12	68.59	90.86	5	41.67
17234.	andy (yourmumgey)	12	100.25	128.97	5	41.67
17235.	Johannes (yoshgasm)	12	48.13	54.04	0	0.00
17236.	yellow (yellow00)	12	42.58	51.61	2	16.67
17237.	Ayaan Iftikhar YT (yeet_ayaan)	12	39.63	46.20	3	25.00
17238.	Yakti (yaktithewise)	12	91.10	104.10	8	66.67
17239.	Lorenzo (xxx69420xxx)	12	60.99	77.93	7	58.33
17240.	XXV6 (xxv6)	12	54.99	61.17	2	16.67
17241.	Hassan (xxhassanixx)	12	93.18	112.44	4	33.33
17242.	Erik (xuj1)	12	73.67	78.63	2	16.67
17243.	xLukeAzade (xlukeazade123)	12	57.70	67.27	1	8.33
17244.	xelopan (xelopan)	12	92.75	104.82	4	33.33
17245.	Xbeeft (xbeeft)	12	79.01	95.87	9	75.00
17246.	Jakub (xaneth)	12	100.80	115.61	4	33.33
17247.	レンゾ (wrenji)	12	81.74	92.88	2	16.67
17248.	Ryan (wow963)	12	146.26	164.67	11	91.67
17249.	David (wookiewarrior07)	12	85.79	100.54	3	25.00
17250.	Willie (williecubed)	12	104.27	116.34	4	33.33
17251.	William (willezur)	12	99.30	127.88	5	41.67
17252.	Wildan (wildan_fachriz24)	12	67.22	81.35	4	33.33
17253.	John (wegelius)	12	77.75	102.18	3	25.00
17254.	Arvid (warpzep)	12	51.29	68.22	0	0.00
17255.	Eric the Topre King (wanger...	12	130.59	155.96	9	75.00
17256.	Walfel (walfel)	12	83.54	97.39	3	25.00
17257.	Wahid (wahidhamidi707)	12	51.94	63.58	1	8.33
17258.	Dorime (vojing)	12	112.59	123.22	6	50.00
17259.	Vlad (vlados_shikos)	12	73.28	91.62	0	0.00
17260.	Viper (viper04)	12	74.65	89.52	5	41.67
17261.	Vigeous (vigeous)	12	38.24	51.93	2	16.67
17262.	Vin (vibnarcus)	12	72.33	80.35	4	33.33
17263.	Kyle (vertwon)	12	60.42	68.26	2	16.67
17264.	Steven (venste_)	12	72.17	79.59	1	8.33
17265.	Alexander (vennor)	12	81.58	95.82	3	25.00
17266.	Josh (velocity92c)	12	121.23	140.43	7	58.33
17267.	Javi (vatojavier)	12	42.78	54.57	2	16.67
17268.	violet (validfingers)	12	95.95	106.56	12	100.00
17269.	uxvb (uxvb)	12	109.36	143.83	5	41.67
17270.	Unknownbean (unknownbean)	12	67.85	84.27	0	0.00
17271.	Bojack (uberjoe)	12	110.99	133.12	7	58.33
17272.	in (uaqlover)	12	36.33	43.17	1	8.33
17273.	default car (typingslowly)	12	99.12	112.92	6	50.00
17274.	Typing (typinglegend16)	12	76.95	88.29	3	25.00
17275.	karl (type_of_all_types)	12	67.49	76.69	5	41.67
17276.	S (typer78)	12	28.90	32.21	2	16.67
17277.	Tom (twmc)	12	99.92	128.89	8	66.67
17278.	(tulasaeueng)	12	92.33	101.58	2	16.67
17279.	Zoomies (tthuang1998)	12	98.73	116.31	5	41.67
17280.	Rudolf (trudo)	12	71.18	78.48	4	33.33
17281.	TroulM (troulm)	12	88.06	102.85	4	33.33
17282.	TrainTrains (traintrains)	12	71.73	89.48	4	33.33
17283.	Arthur Toppenberg (tpperware)	12	49.18	57.57	7	58.33
17284.	Eric (toniseo)	12	73.60	81.10	6	50.00
17285.	Nadhim (tnadhim)	12	58.71	75.78	1	8.33
17286.	Alex B (tisan05)	12	69.28	87.33	6	50.00
17287.	Stifmeister (the_stifmeister)	12	107.67	133.41	8	66.67
17288.	. (the_ohioan)	12	90.98	100.23	2	16.67
17289.	yoshi (themune)	12	84.49	95.79	1	8.33
17290.	Seth (thefoxarmy)	12	77.35	90.64	4	33.33
17291.	Daan (thedr3aded)	12	78.57	96.17	4	33.33
17292.	Amy (thedoctastardis)	12	51.45	64.22	1	8.33
17293.	cring (thatguyyoudontknow)	12	69.17	86.43	4	33.33
17294.	A (terrible_penguin)	12	56.35	68.76	1	8.33
17295.	Terkozz (terkozz)	12	67.85	88.89	3	25.00
17296.	Tom (tcrman)	12	70.41	82.95	1	8.33
17297.	tangjm5 (tangjm5)	12	107.36	117.43	8	66.67
17298.	TacticalTux (tacticaltux)	12	119.20	130.15	9	75.00
17299.	Tosic (t0sic)	12	86.94	95.09	6	50.00
17300.	Arles (synthicalarles)	12	61.38	73.45	12	100.00
17301.	swxh89 (swxh89)	12	109.35	124.45	8	66.67
17302.	Sweefty (sweefty)	12	71.76	79.31	2	16.67
17303.	Allen (swaggerinooo)	12	112.18	135.99	11	91.67
17304.	Benjie (superbench03)	12	76.98	92.94	2	16.67
17305.	Duc (sungjinwoo2001)	12	48.47	56.11	1	8.33
17306.	sungit2g (sungit2g)	12	80.75	96.03	3	25.00
17307.	May (suddy)	12	52.24	60.03	2	16.67
17308.	Josh (cuddlysamurai)	12	46.52	56.58	0	0.00
17309.	Strudle (strudlepoodel)	12	102.98	113.01	8	66.67
17310.	frog (strawfrog)	12	86.49	94.62	5	41.67
17311.	Manuel (stonesitter)	12	70.11	79.12	2	16.67
17312.	Stewhog (stewhog)	12	55.94	76.50	2	16.67
17313.	Steve (steve5731)	12	84.63	95.64	4	33.33
17314.	Stella (stellaoctangula)	12	80.60	99.24	1	8.33
17315.	Sergey (steelassasin)	12	68.54	77.77	1	8.33
17316.	Marshall (stackattack14)	12	100.80	118.15	7	58.33
17317.	📵 (sstormwolf22)	12	105.66	123.30	2	16.67
17318.	u slow (spyie)	12	37.62	44.36	3	25.00
17319.	Splash (splashcc)	12	108.27	119.15	7	58.33
17320.	Faleye Slaven (speedhell)	12	30.04	35.12	2	16.67
17321.	Spafa (spafa)	12	93.66	110.95	5	41.67
17322.	spacehrt (spacebop)	12	73.52	90.84	2	16.67
17323.	Ui (so_ta)	12	83.25	96.75	7	58.33
17324.	Soul (soul_eater22)	12	77.10	98.34	2	16.67
17325.	soopasoop (soopasoop)	12	48.16	54.91	1	8.33
17326.	sompur (sompurkrz)	12	86.85	95.24	4	33.33
17327.	(solov)	12	168.86	215.13	11	91.67
17328.	Daniel (smurfzilla)	12	76.26	101.05	5	41.67
17329.	Stacie (slyfoxxli)	12	72.27	88.64	4	33.33
17330.	shams (slo_shams)	12	29.44	34.82	1	8.33
17331.	MrBoombastic (sloth_express)	12	60.39	66.59	0	0.00
17332.	sanic (sleepmoar)	12	118.63	141.66	11	91.67
17333.	Pau (skuhls)	12	58.29	63.18	1	8.33
17334.	Nicolas (skinny13timmy)	12	90.68	98.98	2	16.67
17335.	taichi (sjwsl)	12	59.41	68.42	2	16.67
17336.	Ofir (sipthesoup)	12	86.30	99.05	4	33.33
17337.	Simmons2 (simmonsgarbageacc...	12	72.26	91.07	9	75.00
17338.	Chris (silentshot64)	12	89.97	99.38	6	50.00
17339.	Sierra (sierrasetliff)	12	62.12	73.14	3	25.00
17340.	Siddarth (siddthekid1)	12	41.74	50.66	2	16.67
17341.	Justin (shouganai_1243)	12	63.69	79.47	1	8.33
17342.	Oscar (shopsketch)	12	59.79	65.19	1	8.33
17343.	Shoden (shoden)	12	69.63	77.54	4	33.33
17344.	Shilo (shilomazouz)	12	72.08	78.43	4	33.33
17345.	Shayaan (shayaan206)	12	52.64	65.44	0	0.00
17346.	Shantanu (shatanu)	12	58.18	70.27	1	8.33
17347.	Sharon (sharon102)	12	42.97	49.98	1	8.33
17348.	Aran (sharon032588)	12	96.54	122.38	5	41.67
17349.	Big Booty T (sexy_dino)	12	87.42	95.92	2	16.67
17350.	sen (senoryx)	12	47.24	55.93	4	33.33
17351.	Sendy (sendyakbar)	12	79.93	88.87	3	25.00
17352.	SAIF (sci_fi_saif)	12	59.07	66.34	2	16.67
17353.	ScanCode (scancode8)	12	59.72	74.49	1	8.33
17354.	solsol (scakes)	12	72.18	83.36	2	16.67
17355.	Sam (sbush)	12	57.09	69.86	1	8.33
17356.	Sausage (sausage_person)	12	77.39	89.43	3	25.00
17357.	Saruwatori (saruwatori)	12	81.49	87.18	4	33.33
17358.	sara (saramcr)	12	44.16	49.02	0	0.00
17359.	Indic (sanatanify)	12	73.33	81.29	4	33.33
17360.	tstats[sajald77] (sajald77)	12	79.65	92.69	1	8.33
17361.	sacresful (sacresful)	12	86.21	94.95	3	25.00
17362.	btst (sabelle_)	12	129.72	145.29	5	41.67
17363.	sıןʌɥɹ (s1lvhr)	12	88.52	95.56	3	25.00
17364.	Vali (ryuzul)	12	100.03	129.08	9	75.00
17365.	Jeremy (ryusaki626)	12	80.28	93.91	7	58.33
17366.	Rudra (ryder_on_the_storm)	12	96.72	112.66	9	75.00
17367.	R (ry20)	12	93.30	101.85	7	58.33
17368.	Run (runring)	12	63.51	74.68	3	25.00
17369.	T Lewis (runnamok)	12	61.28	67.08	5	41.67
17370.	Ralph (rotifer_)	12	47.40	65.63	2	16.67
17371.	Shamsuddin (rony0092)	12	43.88	49.68	1	8.33
17372.	Tí cần không bạn (ron...	12	59.27	74.33	2	16.67
17373.	Hi (rom_s)	12	56.47	64.92	1	8.33
17374.	Sergi (rolodophone)	12	74.01	86.62	4	33.33
17375.	Jem (rollingapple)	12	101.51	123.10	8	66.67
17376.	Rokuazery (rokuazery)	12	83.90	92.04	2	16.67
17377.	Rohan (rohan625)	12	54.45	63.51	0	0.00
17378.	Julian (rocky_succ)	12	82.66	94.01	2	16.67
17379.	robby (robby27)	12	71.86	82.56	4	33.33
17380.	Arminda (rmnduhh)	12	93.04	109.23	5	41.67
17381.	Jim (rl_magikz)	12	55.28	68.01	4	33.33
17382.	John (rlawldjs)	12	64.96	72.23	2	16.67
17383.	Ritam (ritam_123)	12	79.23	87.23	6	50.00
17384.	Rikos99 (rikos_omegalul)	12	68.44	80.83	4	33.33
17385.	e (revengepug)	12	102.07	123.96	8	66.67
17386.	George (relaxed_20)	12	58.75	69.93	1	8.33
17387.	gabe (rasalguhl)	12	99.53	106.76	2	16.67
17388.	Yokaii (rartiko)	12	63.10	75.81	0	0.00
17389.	Caio (raposo)	12	62.19	70.93	3	25.00
17390.	Alex (ramini0000)	12	62.71	68.95	2	16.67
17391.	Grant (ragecandybar)	12	86.97	102.86	5	41.67
17392.	aerar (raale)	12	82.18	102.49	5	41.67
17393.	Attican (r4ne)	12	76.82	86.53	2	16.67
17394.	rocky (r0ckyy)	12	61.53	71.32	1	8.33
17395.	Desh (quickzero)	12	106.92	121.52	3	25.00
17396.	julian (quasiker)	12	84.08	104.05	4	33.33
17397.	punj (punj)	12	76.80	87.62	2	16.67
17398.	cockn (pugzip)	12	59.59	71.73	4	33.33
17399.	oleg (prot64)	12	76.76	92.01	3	25.00
17400.	Pratham (pratham522)	12	43.90	49.01	1	8.33
17401.	gb (practicegb)	12	92.37	110.48	4	33.33
17402.	Prabhu (prabhusengal)	12	85.06	97.14	4	33.33
17403.	Param (pparam5241)	12	77.95	89.41	6	50.00
17404.	posaidon (posaidon0802)	12	86.34	97.37	4	33.33
17405.	poparaliais (poparaliais)	12	80.15	95.19	4	33.33
17406.	Jared (pizzj)	12	74.63	85.20	3	25.00
17407.	pizzapablo (pizzapablo)	12	71.87	82.45	12	100.00
17408.	Pine (pinechristmas)	12	68.57	79.11	4	33.33
17409.	pigeon (pigeon_kun)	12	90.08	108.60	2	16.67
17410.	Phobic (phobic21)	12	65.71	81.82	7	58.33
17411.	Duy (phamanhduy1990)	12	72.38	80.25	0	0.00
17412.	petnob (petnob1987)	12	57.65	65.15	2	16.67
17413.	Vicky (person4115)	12	99.10	122.86	2	16.67
17414.	Andrew (penguingm1)	12	114.55	129.62	8	66.67
17415.	Pika (paxn)	12	89.83	104.69	4	33.33
17416.	Mr nyash (paw_sensei)	12	62.53	71.78	2	16.67
17417.	Paulian (paulian7)	12	90.39	117.59	2	16.67
17418.	Arttu (patu556)	12	57.07	63.03	0	0.00
17419.	Parag (paranolverizer)	12	50.82	61.17	4	33.33
17420.	Dejan (paranoid112122)	12	44.78	52.58	2	16.67
17421.	Pan con Palta (panconpalta123)	12	70.42	91.34	2	16.67
17422.	Padwes (padz_kurawa)	12	79.39	96.53	5	41.67
17423.	Owen (owentemp)	12	40.26	50.02	1	8.33
17424.	Osso (ossobuko)	12	61.42	66.17	2	16.67
17425.	HM (opwpahfohuaehiodbfaiwvb...	12	67.15	76.08	2	16.67
17426.	omnomnomnom (omnomnomnomnom...	12	68.97	79.26	3	25.00
17427.	Omar (omar_letaief)	12	81.85	92.54	2	16.67
17428.	Nathan (oliblish)	12	82.42	100.42	1	8.33
17429.	twin (oiaao)	12	55.65	63.02	2	16.67
17430.	prince (ohnoheisgoodxd)	12	78.09	87.80	12	100.00
17431.	ochko (ochkofficial)	12	72.45	85.87	6	50.00
17432.	Pepper (ocean_orca)	12	51.35	56.35	2	16.67
17433.	VietCoffee (nytrogen99)	12	117.63	134.00	10	83.33
17434.	Nyle (nyle_14)	12	80.47	87.87	4	33.33
17435.	Nghia (ntn20112006)	12	87.16	102.93	3	25.00
17436.	spoon (noyoureaspoon)	12	88.43	101.69	5	41.67
17437.	not a typerace account (not...	12	49.01	59.35	4	33.33
17438.	Aaron (noobschizz)	12	64.73	72.41	2	16.67
17439.	Andrew (noobhunter)	12	124.72	143.32	4	33.33
17440.	Nicholas (nkaechele)	12	80.21	89.26	3	25.00
17441.	ninguart (ninguart)	12	102.79	126.68	6	50.00
17442.	Much (nikitin)	12	86.27	92.06	4	33.33
17443.	Liema (nidoc)	12	77.07	86.73	12	100.00
17444.	Nick (nickjj)	12	66.59	83.92	3	25.00
17445.	Van (nickislit14)	12	77.99	87.63	7	58.33
17446.	Niaz (niaztypist)	12	36.34	43.80	0	0.00
17447.	Phuc (nholoinhoi)	12	85.42	97.66	5	41.67
17448.	Qwerty (nhaye23)	12	58.55	69.03	0	0.00
17449.	wen (neverwen)	12	96.38	116.49	5	41.67
17450.	Serena (nerdyjoker)	12	108.08	122.70	6	50.00
17451.	Neil (neilprime16)	12	84.25	106.10	4	33.33
17452.	Vickus (natowns24)	12	81.22	96.81	3	25.00
17453.	Nils Backman (naip12)	12	63.54	87.15	4	33.33
17454.	Krombaa (nadergharsallah)	12	54.67	64.51	4	33.33
17455.	Midhun (mythicalun)	12	112.51	132.93	8	66.67
17456.	Blake (mysticz8)	12	59.78	71.07	2	16.67
17457.	Mike (mybroom10)	12	85.86	112.61	3	25.00
17458.	Rohit (murphy053)	12	64.21	71.45	0	0.00
17459.	Mason (mtyperxd)	12	66.84	79.98	5	41.67
17460.	Slowpez (mr_slowpez)	12	98.31	110.93	1	8.33
17461.	barrack (mr_sandwich1871)	12	105.97	128.25	6	50.00
17462.	Marc (mrthegreattypist)	12	55.62	64.08	1	8.33
17463.	lhagvaag0d (mr4thousands_)	12	36.67	44.30	5	41.67
17464.	Anton (mountainhills)	12	77.38	96.28	2	16.67
17465.	austin (monkey648)	12	103.11	119.17	5	41.67
17466.	Moniba (moniba)	12	52.39	58.81	0	0.00
17467.	mohamed (mohamed_rekaya)	12	57.85	75.60	2	16.67
17468.	Steven (misterpear)	12	117.04	128.88	4	33.33
17469.	migueles (miqriba)	12	61.78	69.03	3	25.00
17470.	Peter (minend)	12	104.07	127.43	9	75.00
17471.	jhon (millkman)	12	35.21	40.15	1	8.33
17472.	mildlyaggressivecherry (mil...	12	101.87	112.28	6	50.00
17473.	Mike (mikystevan)	12	81.37	91.93	3	25.00
17474.	Mike (mike6)	12	54.16	64.34	0	0.00
17475.	Mikayla (mikaylahumphrey)	12	107.79	128.47	6	50.00
17476.	Micah (micahnical)	12	82.19	107.52	1	8.33
17477.	Nikolaj (mexination)	12	52.88	65.16	0	0.00
17478.	Mexero (mexero)	12	37.40	41.43	1	8.33
17479.	Prakhar (menate)	12	64.49	81.58	4	33.33
17480.	Melo (melolem)	12	67.48	75.52	4	33.33
17481.	bokonet (mehrshadk05)	12	66.23	74.85	7	58.33
17482.	platnot (mega2053)	12	86.92	103.35	8	66.67
17483.	Mbenga (mbenga)	12	80.01	100.05	2	16.67
17484.	Sofia (mayi_o4)	12	70.49	87.51	7	58.33
17485.	Julian (mataleao)	12	64.98	71.78	2	16.67
17486.	patrick (mastercraft33)	12	58.01	67.78	3	25.00
17487.	Magister (masterbert02)	12	60.39	66.97	6	50.00
17488.	Perestoronina (mashavtnke)	12	54.17	65.45	1	8.33
17489.	Martin (martin_juan)	12	75.41	85.51	3	25.00
17490.	Martin (martinthebest)	12	103.41	121.64	6	50.00
17491.	Kayla (martina1155)	12	30.41	36.54	1	8.33
17492.	Marie (marsiepatootie)	12	77.96	99.61	4	33.33
17493.	TyperRacer (marccraft)	12	86.73	100.84	3	25.00
17494.	Manraj (man_123lama)	12	78.18	90.53	3	25.00
17495.	Manish (manishspot)	12	56.44	62.18	2	16.67
17496.	Manguy McPersonface (manguy...	12	66.43	79.78	3	25.00
17497.	Kurtis (sauceypubes)	11	104.45	123.40	4	36.36
17498.	Sargis (sargispro)	11	77.43	90.66	1	9.09
17499.	Sarah (sarahnivans)	11	66.77	75.36	1	9.09
17500.	Alix (sarahallisa)	11	66.34	73.78	3	27.27
17501.	Sargis (saqo1997)	11	52.31	57.47	0	0.00
17502.	Samdo (sammematt)	11	122.10	134.74	6	54.55
17503.	Sajan (sajancpatel)	11	91.99	105.72	5	45.45
17504.	Saffron (saffronayy)	11	92.21	118.29	10	90.91
17505.	Saea (saeamak)	11	86.29	96.53	3	27.27
17506.	Sans (s4nsx)	11	62.98	73.17	4	36.36
17507.	Shannon (s0lanum)	11	53.02	59.06	2	18.18
17508.	James (ryandaryno)	11	63.35	75.88	3	27.27
17509.	Raven (rvnfx)	11	71.17	90.00	9	81.82
17510.	Ruslan (ruslan_osmanov)	11	93.64	105.18	3	27.27
17511.	Panagiotis (rulisogeranoulis)	11	83.22	97.54	6	54.55
17512.	Ron (ronald2)	11	81.42	99.70	6	54.55
17513.	Free Palestine (rollno14)	11	103.90	125.89	4	36.36
17514.	Rolandas (rolandas)	11	24.91	32.26	0	0.00
17515.	Roko (rokoroks)	11	79.80	89.47	3	27.27
17516.	pentti (rocket_boi)	11	43.82	50.60	3	27.27
17517.	Robbie (robbietrimble)	11	104.68	134.38	6	54.55
17518.	Absolut (rluyen)	11	82.79	99.44	0	0.00
17519.	Ridge (ritzchu)	11	92.40	101.35	11	100.00
17520.	Kenny (riggedcontingency)	11	100.61	110.49	5	45.45
17521.	ninja (riddickbr)	11	95.04	121.16	4	36.36
17522.	Ricky (rickyyeung)	11	83.89	93.13	4	36.36
17523.	Rickith (rickith)	11	58.23	63.72	0	0.00
17524.	Jeremy (rice_cream)	11	96.18	107.97	5	45.45
17525.	ango (rfthefinal)	11	73.00	86.16	4	36.36
17526.	red (redwastaken)	11	95.35	104.86	2	18.18
17527.	ReddyIsHere (reddy_is_here)	11	58.19	66.40	1	9.09
17528.	Rebel (rebelaj)	11	92.81	99.78	2	18.18
17529.	D A R K Z (reaching130wpm)	11	56.45	66.84	0	0.00
17530.	Rodrigo (rdcmdev)	11	81.67	93.77	2	18.18
17531.	Ray (ray_mond)	11	83.78	95.10	3	27.27
17532.	RAWs (raws)	11	95.06	108.25	4	36.36
17533.	guts (ramosjoshua214)	11	72.67	85.27	3	27.27
17534.	Ajwad Hameem (rajin100000)	11	69.33	81.13	1	9.09
17535.	Exquisition (raimi)	11	98.84	140.33	5	45.45
17536.	Rahmen (rahmennoodles)	11	105.77	136.93	6	54.55
17537.	qweasdyxc (qweasdyxc)	11	64.12	73.23	1	9.09
17538.	Papa (quamthebomb)	11	97.29	114.43	5	45.45
17539.	Pyro (pyromaniac_from_the_sun)	11	78.97	92.43	2	18.18
17540.	tapan (psydelix)	11	71.23	79.97	2	18.18
17541.	Psycho (psychobrainman)	11	78.36	85.98	3	27.27
17542.	Mike (primike)	11	85.69	94.79	6	54.55
17543.	Vorakan (ppaaul_)	11	67.86	81.65	2	18.18
17544.	Hoang (poulet0306)	11	74.22	85.22	4	36.36
17545.	Patric (potric)	11	68.46	88.98	2	18.18
17546.	Potato (potatooe)	11	43.82	59.47	0	0.00
17547.	PenTest-duck (pokemontypist)	11	114.61	128.35	4	36.36
17548.	Cookies (poeannn)	11	70.59	80.58	5	45.45
17549.	Nick (pletlibo)	11	104.51	128.68	7	63.64
17550.	tstats[pkmkb] (pkmkb)	11	63.75	70.73	0	0.00
17551.	Jacob (pinpoint)	11	63.57	74.22	5	45.45
17552.	Phungtastic (phungtastic)	11	73.53	78.86	2	18.18
17553.	Alex (pheudo)	11	72.90	90.30	6	54.55
17554.	nah (phamhuyhuy2005)	11	91.61	108.92	2	18.18
17555.	Peter (petero)	11	87.19	96.06	2	18.18
17556.	Gavin (perfectgavinator)	11	106.97	124.27	6	54.55
17557.	Matous (pelisek16)	11	75.06	85.32	4	36.36
17558.	ama (pcfcace)	11	75.39	83.51	2	18.18
17559.	Phillip (pc15pdx)	11	51.19	59.15	2	18.18
17560.	Payette (payette420)	11	92.78	108.64	1	9.09
17561.	paul (paularoni)	11	64.35	77.32	1	9.09
17562.	Connor (paintrain23)	11	70.26	88.50	3	27.27
17563.	Pinny (p1nny_)	11	65.51	73.05	8	72.73
17564.	ozzy (ozzyk)	11	56.30	70.90	1	9.09
17565.	Squeak (oweozz)	11	78.03	95.34	2	18.18
17566.	Omar (oshnatour)	11	84.73	107.29	2	18.18
17567.	opal (opalisbored)	11	53.30	61.93	2	18.18
17568.	Lou (onyok2010)	11	60.85	71.22	11	100.00
17569.	John (omster83)	11	93.45	111.06	5	45.45
17570.	Saul (old_grandma)	11	104.81	124.11	4	36.36
17571.	officialpm (officialpm)	11	111.79	131.70	3	27.27
17572.	ocodile (ocodile)	11	114.03	132.18	6	54.55
17573.	Gabi (ockra_)	11	55.45	69.33	3	27.27
17574.	np80658 (np80658)	11	68.96	79.11	2	18.18
17575.	Erdal (notasingleduck)	11	58.41	65.39	3	27.27
17576.	Vladimir (nolmegar)	11	124.16	145.61	9	81.82
17577.	Nobu (nobuhiro777)	11	72.12	86.47	3	27.27
17578.	NK (nkpathak1)	11	36.79	51.42	2	18.18
17579.	niven (niven_11)	11	74.08	86.80	4	36.36
17580.	soraya (nilanjona)	11	36.16	42.76	1	9.09
17581.	notjustmetal (nightway11)	11	86.24	95.46	5	45.45
17582.	Nick (nickxz)	11	128.64	143.48	6	54.55
17583.	Nicholas (nicholas_r)	11	98.30	111.36	7	63.64
17584.	Jusuf (nerdtyper)	11	92.29	106.65	7	63.64
17585.	Neptune (neptune_22)	11	85.47	98.08	3	27.27
17586.	Just (needhelpintyping)	11	96.39	112.93	4	36.36
17587.	Jonathan (nebulium)	11	59.21	70.68	2	18.18
17588.	Nathan (nbx3k)	11	101.12	114.88	5	45.45
17589.	Nathan (nathanpg)	11	93.71	108.44	5	45.45
17590.	Nasir (nasir_hussain)	11	62.33	73.65	3	27.27
17591.	narqo (narqo)	11	101.53	122.65	8	72.73
17592.	Night Fury (naimur_rahman)	11	79.08	84.74	3	27.27
17593.	RS (nahor)	11	107.30	129.17	8	72.73
17594.	Nada (nada2004)	11	50.53	58.89	1	9.09
17595.	MZA (mzakm)	11	98.76	120.68	8	72.73
17596.	Mytx (mythflashx)	11	69.39	75.72	3	27.27
17597.	diana (mxclfld)	11	84.25	94.38	5	45.45
17598.	Muntazar (muntazer1)	11	69.63	78.11	6	54.55
17599.	Matthew (msloehr)	11	75.53	84.88	2	18.18
17600.	kailh pinks (mrdooks)	11	104.03	132.76	8	72.73
17601.	Thiemen (mohouzeg)	11	95.14	108.39	9	81.82
17602.	Mohammed (mohammedamarnah)	11	91.80	113.28	4	36.36
17603.	mohammadreza (mohammadrezae...	11	71.81	79.62	0	0.00
17604.	Kacper (mlociak)	11	58.04	63.38	2	18.18
17605.	manjeet (mjydv4548)	11	61.76	69.53	1	9.09
17606.	Mr.GrayBoi (mistergrayboi)	11	77.50	89.76	3	27.27
17607.	Felzii (missartemis_97)	11	63.92	74.53	2	18.18
17608.	mire (mire_kr)	11	88.90	113.26	2	18.18
17609.	gannicus (milaikilaiki)	11	108.16	123.06	5	45.45
17610.	Mohamed (midoukl)	11	50.55	53.40	0	0.00
17611.	Michael Angelo (micky15)	11	101.45	111.12	6	54.55
17612.	Michal (micha13)	11	85.05	96.29	2	18.18
17613.	Matt (mhorsfield)	11	55.66	67.88	3	27.27
17614.	Bob (metsandcavs)	11	77.81	87.78	2	18.18
17615.	Aashish kumar (messy84)	11	39.15	43.07	3	27.27
17616.	Memresable (memresable)	11	66.98	78.90	3	27.27
17617.	Mark Jonathan (max_peterson10)	11	102.79	113.80	4	36.36
17618.	Max (max_evans)	11	86.70	100.65	1	9.09
17619.	john (maxwelllllllllll)	11	66.25	81.59	4	36.36
17620.	Mathias (mattitheguy)	11	77.04	98.32	6	54.55
17621.	Matt3k (matt3k)	11	84.49	108.69	5	45.45
17622.	matex72 (matex72)	11	74.49	85.32	1	9.09
17623.	Marc (marxotkin)	11	98.31	110.15	5	45.45
17624.	Marcus (marqueshark)	11	89.81	137.77	10	90.91
17625.	Jordan (marceless)	11	131.19	140.70	9	81.82
17626.	TOP (man_stop)	11	105.64	115.68	5	45.45
17627.	Manuel (mansrz)	11	76.53	87.52	3	27.27
17628.	Sean (manbeervark)	11	78.85	91.44	3	27.27
17629.	Fromitz (fromitz)	11	94.25	111.14	1	9.09
17630.	Wilson (friwilly)	11	72.60	85.46	3	27.27
17631.	Frat (fratios)	11	113.67	139.61	6	54.55
17632.	Lank (franklank)	11	76.14	84.40	1	9.09
17633.	Forsegle (forsegle)	11	54.41	59.54	3	27.27
17634.	Pog (fooooood)	11	105.56	136.14	6	54.55
17635.	Cody (foggen)	11	95.64	113.96	5	45.45
17636.	Michal (fly_you_fools)	11	75.15	85.18	6	54.55
17637.	Mark Hightower (flytower69)	11	118.65	140.41	9	81.82
17638.	Benson (flowery_robot)	11	71.83	88.55	6	54.55
17639.	hi (florzie_101)	11	73.52	91.20	4	36.36
17640.	floffy (floffyunicorn)	11	100.18	116.69	4	36.36
17641.	saar (flappy_dude)	11	66.08	79.26	1	9.09
17642.	NotFlame (flameon0703)	11	60.21	65.97	1	9.09
17643.	Michael (fkafkaneko)	11	80.11	99.04	4	36.36
17644.	Rishabh (fire_tornado3)	11	72.34	80.86	2	18.18
17645.	Ferresmash (ferdinandohrn)	11	65.85	81.88	5	45.45
17646.	Sasan (farnasirim)	11	107.13	120.43	7	63.64
17647.	tuan (fajerso)	11	78.85	97.62	1	9.09
17648.	Faded (fadedcrown95)	11	54.00	65.66	3	27.27
17649.	Faded7 (faded7)	11	85.11	98.58	3	27.27
17650.	Fabrizio (fab_)	11	81.01	99.69	4	36.36
17651.	Grant (eyz11327)	11	108.02	116.83	6	54.55
17652.	Evan (eyatri)	11	91.43	101.15	4	36.36
17653.	sudden (explosionsarenice)	11	75.65	87.12	3	27.27
17654.	Pepeg (evolvingpepeg)	11	101.79	123.42	6	54.55
17655.	Steeferino (evlpacman)	11	113.55	136.51	7	63.64
17656.	Evan250250 (evan250250)	11	97.51	130.91	3	27.27
17657.	Eugene (eugene1)	11	73.53	93.31	4	36.36
17658.	Roland (errur)	11	90.53	110.90	4	36.36
17659.	Champion (error404_winner)	11	59.86	69.21	2	18.18
17660.	Not Fast (ernmanke)	11	65.16	71.85	4	36.36
17661.	Erim (erimmos)	11	65.49	72.94	6	54.55
17662.	Eric (eric_05)	11	76.73	88.25	6	54.55
17663.	Alex (equidorian)	11	110.30	116.86	5	45.45
17664.	a (eqnzio)	11	100.53	115.31	5	45.45
17665.	Eoghan (eoghanshox420)	11	56.81	63.23	3	27.27
17666.	emon (emonemoemo)	11	107.96	125.57	3	27.27
17667.	Liam (emissions)	11	110.28	136.40	7	63.64
17668.	elnino (elnio2803)	11	87.29	104.24	2	18.18
17669.	Elibay (elibay98)	11	72.91	79.15	5	45.45
17670.	Electro (electrotech17)	11	58.24	67.01	2	18.18
17671.	victor (einzu)	11	46.44	56.55	0	0.00
17672.	asdfhuiosdfgshiodfhji (efrd...	11	116.06	131.87	10	90.91
17673.	eenterr (eenterr)	11	81.27	88.20	2	18.18
17674.	Bob (echonex)	11	74.98	85.88	6	54.55
17675.	Dekaj (d_kaj)	11	69.73	82.56	11	100.00
17676.	dtn (dvdn)	11	106.28	117.93	6	54.55
17677.	Davi (dusk_09)	11	137.41	152.87	7	63.64
17678.	Daulet (dtk6)	11	48.86	62.58	4	36.36
17679.	dsa8 (dsa8)	11	91.00	98.21	2	18.18
17680.	Máté (drunkendegroot)	11	84.25	93.99	4	36.36
17681.	Hugh (drhugh)	11	68.16	77.81	3	27.27
17682.	drew (drewthejedi)	11	75.95	82.44	4	36.36
17683.	ha (drchill)	11	90.64	103.58	1	9.09
17684.	Deric Lewis (dragon760)	11	24.40	36.49	3	27.27
17685.	Jan (draggonnfs)	11	81.42	97.90	2	18.18
17686.	Shrig (dracon7260)	11	101.73	116.98	4	36.36
17687.	dorj (dorjoo)	11	64.42	76.18	2	18.18
17688.	doremy (doremypuyotet)	11	152.03	180.08	9	81.82
17689.	dom (domxrare)	11	57.61	68.66	2	18.18
17690.	Carl (doctorkohaku)	11	104.75	118.50	4	36.36
17691.	ttvdivertingwhale (divertin...	11	116.18	137.66	10	90.91
17692.	Dio (dio_b_)	11	73.13	81.35	11	100.00
17693.	Diogo (diogosilva)	11	45.58	51.08	1	9.09
17694.	Benedikt (dikt73)	11	79.04	93.16	6	54.55
17695.	Dennis (dheitinga)	11	78.38	91.00	7	63.64
17696.	Dev (devparkk)	11	63.25	73.30	4	36.36
17697.	devendra (devendra303)	11	36.48	48.45	0	0.00
17698.	Derhein (derhein24)	11	51.97	68.52	2	18.18
17699.	Yoshimitsu (deep_impact)	11	64.62	71.69	3	27.27
17700.	Deathwish (death_wish)	11	86.53	94.15	2	18.18
17701.	Ahmed (dd3x)	11	69.70	78.90	1	9.09
17702.	Aman Daudung (daudung_5)	11	43.02	47.92	1	9.09
17703.	Anthony (daslayer05)	11	73.30	81.53	2	18.18
17704.	Poop (danukas155)	11	91.30	115.60	4	36.36
17705.	Daniel (danucu22)	11	37.10	52.04	2	18.18
17706.	Salzpanik (daniely1160)	11	86.00	132.61	5	45.45
17707.	Spavid (dadkos34)	11	81.34	115.73	7	63.64
17708.	Jay (cyber_ace)	11	50.30	58.69	1	9.09
17709.	Cris (ctietsort)	11	107.86	121.79	4	36.36
17710.	albert (csnake)	11	99.79	106.64	5	45.45
17711.	csgo (csaddict)	11	61.71	73.47	1	9.09
17712.	Charlie (crystal_gamer)	11	67.12	75.96	3	27.27
17713.	Vincent (cruhm)	11	98.49	131.80	3	27.27
17714.	HKER (crafting112)	11	99.43	115.91	3	27.27
17715.	CPawx (cpawx)	11	102.32	118.71	2	18.18
17716.	Cow (cowscantype)	11	103.44	113.26	4	36.36
17717.	Hugo (cortexior)	11	75.95	82.43	3	27.27
17718.	Jose (cornjose877)	11	82.48	97.85	2	18.18
17719.	CoolMan14 (coolman14)	11	71.27	83.27	8	72.73
17720.	Converto (converto)	11	69.20	78.99	3	27.27
17721.	ocean man (clickbaitt)	11	89.41	97.74	2	18.18
17722.	ㅤ (clarified)	11	131.02	145.38	4	36.36
17723.	lord (cintrixity)	11	83.95	97.12	7	63.64
17724.	clicky (cinadeeye)	11	114.69	129.14	6	54.55
17725.	Christian (christianwells)	11	72.56	85.43	4	36.36
17726.	Hyx (christianmoises)	11	88.19	96.78	0	0.00
17727.	Luis (chiklay)	11	100.08	123.09	1	9.09
17728.	Jason (cherryitbruhnarutojizz)	11	103.38	117.90	4	36.36
17729.	Nurbek (cheburekkek)	11	62.87	72.12	2	18.18
17730.	Sahil (chazos)	11	46.44	51.71	3	27.27
17731.	Wei (charles2007)	11	79.79	94.12	10	90.91
17732.	Vei (cengi)	11	97.79	123.29	5	45.45
17733.	Cel (celad0n)	11	104.50	118.85	5	45.45
17734.	*** (ccccalvinn)	11	73.38	89.03	2	18.18
17735.	Carlos (carloshdelreal)	11	55.42	62.57	1	9.09
17736.	Cameron (camma)	11	69.10	82.30	1	9.09
17737.	c4th0d3 (c4th0d3)	11	97.98	121.30	2	18.18
17738.	Heriberto (c4rt4sbarajas)	11	54.12	68.73	2	18.18
17739.	Marcus (byteeater)	11	93.96	107.39	7	63.64
17740.	ByamB4 (byamb4)	11	81.91	95.61	6	54.55
17741.	Benjamin (bxrivx)	11	106.33	125.89	2	18.18
17742.	mikey (buzzpmikey)	11	101.24	123.45	7	63.64
17743.	Andrew (buttmann64)	11	102.89	126.59	6	54.55
17744.	bunkered (bunkeredgame)	11	90.83	109.38	6	54.55
17745.	Nicholas (bsg8)	11	55.83	65.16	2	18.18
17746.	Bryce (bryce_verberne)	11	76.86	93.82	7	63.64
17747.	Marko (bru_)	11	63.90	72.94	1	9.09
17748.	Brian (briannstiven)	11	51.77	55.70	5	45.45
17749.	brady (bradyone)	11	79.20	92.22	2	18.18
17750.	Bradley (bradley_brown)	11	94.94	105.48	1	9.09
17751.	Hannah (bored_hannah)	11	53.18	63.25	1	9.09
17752.	Not as fast as Reckful (bol...	11	93.92	104.09	6	54.55
17753.	bob (bobobb)	11	142.93	169.74	10	90.91
17754.	m (bluesiren)	11	96.41	120.45	5	45.45
17755.	Richard (blitzd2020)	11	91.19	100.04	3	27.27
17756.	Bucecean (blaskowiscz)	11	144.46	189.80	7	63.64
17757.	Black (black_pineapple)	11	64.98	76.86	3	27.27
17758.	bitte (bitteschnell)	11	85.40	106.22	8	72.73
17759.	bishwash (bishwash_patel)	11	42.02	62.78	2	18.18
17760.	Bishwash (bishwashadhikari)	11	58.92	75.13	3	27.27
17761.	bill (bill_hunt22)	11	29.01	32.41	0	0.00
17762.	Brian (bgan)	11	93.49	100.79	6	54.55
17763.	Musharaf (benthorzm)	11	86.39	100.82	3	27.27
17764.	Ben (bendoman_)	11	107.93	119.29	6	54.55
17765.	Borky (beckysingasong)	11	104.20	122.71	6	54.55
17766.	Grayson (beanbagman)	11	57.67	70.21	8	72.73
17767.	Bdog (bdogblue)	11	50.90	56.78	2	18.18
17768.	Batuhan (batuhan_tbb)	11	61.24	74.25	4	36.36
17769.	voidtab (battini)	11	68.17	74.50	3	27.27
17770.	Bogdan (bartfast42)	11	46.30	51.02	1	9.09
17771.	Bartek (barteker19)	11	69.79	80.29	1	9.09
17772.	brendan (barnold2)	11	97.31	114.78	4	36.36
17773.	li (badplayer970)	11	97.71	118.29	4	36.36
17774.	Kyle (badadc)	11	92.70	112.81	5	45.45
17775.	Baby (babyfacedassassin)	11	79.15	97.84	1	9.09
17776.	Bryan (b27i5n)	11	111.95	129.52	5	45.45
17777.	Nany (a_nany)	11	43.09	48.62	1	9.09
17778.	ayy (ayy_cocotype17)	11	56.44	69.27	10	90.91
17779.	Caleb (awsumbabysnarl)	11	86.55	100.30	2	18.18
17780.	Avlotis (avlotis)	11	106.81	114.95	4	36.36
17781.	Turbo (avash101)	11	64.56	75.66	1	9.09
17782.	Auiyin (auiyin)	11	89.27	99.72	6	54.55
17783.	choi (ateezofficial)	11	71.82	83.52	2	18.18
17784.	Ahmad (asz13)	11	99.75	109.87	5	45.45
17785.	AC (astralcalamity)	11	96.24	107.48	3	27.27
17786.	Panagiotis (asifo)	11	47.14	59.28	0	0.00
17787.	Living (asianliving)	11	92.14	100.35	2	18.18
17788.	Thuan (asianboiii)	11	61.00	81.28	0	0.00
17789.	Ashiquzzaman (ashiquzzaman33)	11	70.98	78.21	1	9.09
17790.	Buster (artistinthehoodie)	11	48.78	61.22	0	0.00
17791.	Artur (arthurisit)	11	86.23	100.30	4	36.36
17792.	Adam (armorcle)	11	108.97	122.99	7	63.64
17793.	Arjuna (arjuna_)	11	84.63	95.21	3	27.27
17794.	NewKeyboardDontLaugh (arisk...	11	86.71	102.38	6	54.55
17795.	Ariful (ariful_farhad)	11	52.79	59.37	0	0.00
17796.	ayu (areyouayu)	11	91.72	107.20	4	36.36
17797.	null (apstamp45)	11	58.80	65.36	1	9.09
17798.	DC (applespammer)	11	74.80	89.84	0	0.00
17799.	Abhinay (apasunuri)	11	86.04	94.80	0	0.00
17800.	Anthony (anthony_787)	11	83.99	99.74	1	9.09
17801.	Anthony (ant333man)	11	75.33	83.16	3	27.27
17802.	anoniman (anoniman_0001)	11	102.18	117.96	1	9.09
17803.	Andrewb (andrewbb)	11	89.42	97.02	7	63.64
17804.	Leroy (ancientnoodles)	11	78.17	84.74	7	63.64
17805.	Ahmet (amutlugun)	11	75.39	83.73	2	18.18
17806.	Aman (amanminerulez)	11	67.63	75.29	2	18.18
17807.	Bryo (alta1r)	11	47.85	70.23	7	63.64
17808.	AJ (alquinso_)	11	87.43	100.61	3	27.27
17809.	alisa (alisalmao)	11	76.27	89.83	5	45.45
17810.	Alexander (alexanderfzz)	11	69.53	81.17	4	36.36
17811.	Alaa (alaaalmasri00)	11	75.38	84.42	3	27.27
17812.	Akitolight (akitolight)	11	106.91	113.86	6	54.55
17813.	aki (akiiiwashere)	11	79.68	98.76	5	45.45
17814.	Gabriel (akgabe)	11	63.76	69.70	4	36.36
17815.	Aidan (aidan605)	11	70.64	78.33	2	18.18
17816.	Ahmad (ahmad_a_0)	11	86.22	104.28	2	18.18
17817.	ahgirl (ahgirl123)	11	74.29	90.03	2	18.18
17818.	Aubrey (ahensley)	11	83.32	95.49	1	9.09
17819.	Vincent (aetherxd)	11	94.91	115.81	4	36.36
17820.	Aedrick (aedrick)	11	69.19	83.49	1	9.09
17821.	Advaanture (advaanture)	11	60.17	71.62	2	18.18
17822.	(adma)	11	153.99	186.35	11	100.00
17823.	Adam (adam1101)	11	79.14	95.26	5	45.45
17824.	Marc (ackermanick)	11	67.46	76.19	2	18.18
17825.	Ace (aceofcaps)	11	74.37	89.36	2	18.18
17826.	Abyo (abyo)	11	60.68	69.98	1	9.09
17827.	Mahmudul Hasan🕋🕌 (abo...	11	62.76	76.06	0	0.00
17828.	Dominique - Axl (able_04)	11	54.08	61.96	0	0.00
17829.	Fyroo (abelkarbel)	11	60.41	68.47	5	45.45
17830.	Homieboy (abcjohnabdjohn)	11	48.20	58.06	2	18.18
17831.	TTTT (aa7608327)	11	56.64	65.96	3	27.27
17832.	Vikas (a4atom)	11	83.98	94.00	3	27.27
17833.	Zak (7zephyr)	11	104.30	117.19	6	54.55
17834.	yanna (7yanna)	11	115.49	132.08	4	36.36
17835.	Random (65h1000)	11	104.57	111.26	5	45.45
17836.	Cody (5niffles)	11	87.78	100.34	4	36.36
17837.	Pixel (2pixles)	11	61.99	76.25	4	36.36
17838.	Liam (2020lhall)	11	67.81	78.57	2	18.18
17839.	Afik (afikrazanafi)	11	33.74	38.78	0	0.00
17840.	MeeM (memepolice)	11	73.50	86.96	8	72.73
17841.	Amit (_amit_)	11	75.16	84.49	2	18.18
17842.	joefromfamilyguy (joefromfa...	11	91.40	111.61	7	63.64
17843.	Chris (kringlepringle)	11	85.24	99.34	1	9.09
17844.	Alex (yettibvc)	11	41.16	48.33	0	0.00
17845.	Kitzia (kavila7)	11	56.11	76.16	0	0.00
17846.	ITZZAC (itzzac_youtube)	11	44.20	57.78	2	18.18
17847.	Tim (twitchanbumaniac)	11	52.48	65.24	5	45.45
17848.	salah (salah1406)	11	66.96	77.88	1	9.09
17849.	Phindoll (philosopher_phun)	11	71.35	87.03	4	36.36
17850.	Tissue (tissuenoob)	11	55.84	61.56	2	18.18
17851.	Typist_1 (_chethan18)	11	55.80	62.71	4	36.36
17852.	JMoneyThug (jthugmoney)	11	77.84	92.86	2	18.18
17853.	Ryyn (ryyn_isr)	11	71.24	78.30	2	18.18
17854.	Firestar162 (firestar162)	11	45.57	61.54	3	27.27
17855.	Christian (campi)	11	100.13	122.09	6	54.55
17856.	rin (rieiode)	11	65.49	79.40	2	18.18
17857.	Ronin (ronin_1)	11	63.07	71.11	3	27.27
17858.	Jiyon (johnrhey324)	11	36.21	46.20	0	0.00
17859.	Falin (falin224)	11	49.74	59.24	5	45.45
17860.	Luke (sirlukeoiv)	11	61.39	70.19	4	36.36
17861.	Guillaume (bilaptor)	11	51.39	55.81	0	0.00
17862.	AJ (applepie314)	11	66.19	80.74	1	9.09
17863.	nht (nhtonmoy)	11	58.53	64.48	5	45.45
17864.	Jachin (optimal_husky)	11	85.20	94.15	5	45.45
17865.	Dave (jungolo)	11	80.78	90.20	2	18.18
17866.	Jason (jpbascon)	11	87.29	95.28	4	36.36
17867.	Morgen (germansdfsd)	11	58.46	69.83	2	18.18
17868.	Vilgot (fido_mandem)	11	73.35	87.04	4	36.36
17869.	Matus (zlatovlasko)	11	67.62	79.36	3	27.27
17870.	Steph (stephsim)	11	55.76	65.05	1	9.09
17871.	BurntBac0n (burnt_bacon08)	11	91.35	105.66	6	54.55
17872.	AcroniX (acronix_iom)	11	83.50	92.33	4	36.36
17873.	Rain (ghetsis)	11	66.77	72.26	0	0.00
17874.	EdmiszTheProto (edmisz1000)	11	62.85	74.49	1	9.09
17875.	Grant (grant_types)	11	66.01	78.26	2	18.18
17876.	Philip (philipisawesome4)	11	76.64	91.91	1	9.09
17877.	Saif (littleboy291)	11	42.28	48.69	0	0.00
17878.	Sam (caldeen)	11	73.42	84.40	3	27.27
17879.	Axel (axless)	11	32.49	35.46	1	9.09
17880.	hououin (hououinkyouma10)	11	61.43	68.99	2	18.18
17881.	Jackson (saintpepsi)	11	44.00	55.47	0	0.00
17882.	cameron (cammyteo)	11	99.78	114.25	6	54.55
17883.	Ammar (shaikh_ammar)	11	89.97	97.04	6	54.55
17884.	Eduard Felipe (efmorab)	11	67.11	75.91	2	18.18
17885.	Edris (babyheaven)	11	80.24	101.26	5	45.45
17886.	Ehm (doubleuehm)	11	84.13	108.04	2	18.18
17887.	Herf (heerf)	11	72.34	84.70	3	27.27
17888.	Pai (paipai00)	11	72.03	86.70	1	9.09
17889.	Ferdie (ferdiepie)	11	84.78	110.51	7	63.64
17890.	Antoni (fixyyy)	11	48.56	52.79	0	0.00
17891.	Josh (joshuayu12)	11	85.23	106.68	5	45.45
17892.	Bob (bob_the_driver)	11	75.76	95.63	3	27.27
17893.	Axrorbek (abduxolikov_axror)	11	41.66	49.07	1	9.09
17894.	Vansh (vansh_)	11	85.17	93.02	5	45.45
17895.	daniel (danniel_29)	11	71.19	77.94	4	36.36
17896.	Jewel (jcpenguin168)	11	94.57	113.21	9	81.82
17897.	R (treeondirt)	11	79.65	89.52	3	27.27
17898.	LaikaX2 (laikax2)	11	75.05	87.31	4	36.36
17899.	Burakki (burakki)	11	90.88	104.60	7	63.64
17900.	Rezaul (rezaulhsagar)	11	72.41	87.43	5	45.45
17901.	Buggati Beetle (dwiil)	11	103.98	122.95	6	54.55
17902.	mikolah (gruby1265)	11	74.80	84.61	1	9.09
17903.	Faisal (faisal_eub)	11	39.14	47.61	3	27.27
17904.	Imam (imam_droubi)	11	55.76	71.37	2	18.18
17905.	Omar (omar963963)	11	50.49	58.01	0	0.00
17906.	muffnbuttn (muffnbuttn)	11	69.03	82.46	3	27.27
17907.	Michaella Alessandra (bling...	11	68.19	74.36	3	27.27
17908.	tongs (skglo)	11	79.57	89.78	5	45.45
17909.	Richard (ziveria)	11	47.32	58.10	0	0.00
17910.	Džiugas (xdziugas)	11	41.43	50.36	1	9.09
17911.	Sai (nikhil_nikky_1221)	11	30.53	37.50	1	9.09
17912.	Troy (yeahaha010)	11	68.95	82.31	7	63.64
17913.	Julian (julian72cr)	11	41.58	50.87	3	27.27
17914.	ked (kedary3)	11	37.15	45.84	2	18.18
17915.	TJ (planee)	11	51.16	60.47	8	72.73
17916.	asdf (cyber_gny)	11	65.66	85.52	3	27.27
17917.	Martin (waldoska)	11	67.07	80.76	4	36.36
17918.	Sina (sinaakh)	11	54.83	62.78	3	27.27
17919.	Weegee (littleweegee)	11	102.88	119.92	5	45.45
17920.	Miya (miya11)	11	54.13	60.55	1	9.09
17921.	Nazmul Haque (codebyred)	11	59.34	69.27	3	27.27
17922.	Mizuto- (yull)	11	55.29	63.06	0	0.00
17923.	tomer (tomerkligman)	11	50.00	60.50	2	18.18
17924.	Jun (unicornsandrainbows)	11	82.94	94.31	2	18.18
17925.	Nitesh (malster)	11	61.21	65.03	3	27.27
17926.	Malo (malodrome)	11	43.73	50.29	2	18.18
17927.	Adam (maldoren)	11	103.81	126.82	0	0.00
17928.	Max (macksx)	11	68.19	80.97	3	27.27
17929.	maciej (maciek3290)	11	59.80	66.69	2	18.18
17930.	Daniel (macguffinstv)	11	94.67	108.87	3	27.27
17931.	Peerawitch (maaaai)	11	57.72	62.67	0	0.00
17932.	Tyler (m4rshm4)	11	110.93	131.10	10	90.91
17933.	Luxson (luxsonx)	11	40.16	50.54	1	9.09
17934.	Luthriel (luthriel)	11	101.53	110.31	8	72.73
17935.	Luis (luis_vs_the_world)	11	60.82	71.17	2	18.18
17936.	Luis (luisyt)	11	76.17	88.39	3	27.27
17937.	jason (luckiestluckster)	11	95.12	105.93	8	72.73
17938.	Luke (ltuite)	11	82.09	94.67	6	54.55
17939.	Louie (louie4825)	11	101.20	119.26	8	72.73
17940.	Louai (louai_zahran)	11	46.60	51.98	0	0.00
17941.	No (loisk1)	11	78.48	90.18	6	54.55
17942.	Little (littlesailor123)	11	74.15	89.09	1	9.09
17943.	Lior (liorg225)	11	66.51	77.57	4	36.36
17944.	Lilly (lilly713)	11	105.68	122.20	6	54.55
17945.	🤑 (liljasonmoney)	11	74.77	81.68	4	36.36
17946.	Lilikoi (lilikoiv)	11	70.18	92.10	4	36.36
17947.	IllIllIllIll (liliiilil)	11	123.47	136.20	5	45.45
17948.	Lucius (lightwastaken)	11	91.57	110.97	2	18.18
17949.	Christina (libermay)	11	73.28	79.37	2	18.18
17950.	Thomas (ldsg99999)	11	56.41	64.43	2	18.18
17951.	Flame On Me (lamtrinhan1503)	11	51.70	58.03	1	9.09
17952.	Laiyon (laiyon)	11	58.16	63.98	2	18.18
17953.	Luke (laaa)	11	105.47	114.56	4	36.36
17954.	l0gically (l0gically)	11	73.19	80.82	5	45.45
17955.	Alish (kzmadcat)	11	70.46	84.59	0	0.00
17956.	Kaptain K (kxdang)	11	82.63	104.52	5	45.45
17957.	star (kuuym)	11	93.13	113.74	6	54.55
17958.	Speedy (kuulex)	11	71.92	82.73	2	18.18
17959.	Lukas (kukess)	11	77.98	84.74	7	63.64
17960.	ktns (ktns)	11	71.53	77.39	3	27.27
17961.	lai (krylite)	11	82.27	89.49	0	0.00
17962.	yes but (krosis2706)	11	70.10	85.72	5	45.45
17963.	Derek (kroni)	11	61.48	75.12	1	9.09
17964.	Eren (krishi__)	11	50.89	57.46	1	9.09
17965.	Ali (kraken_wrath)	11	62.20	76.04	2	18.18
17966.	KOROCO (koroconotu)	11	88.79	108.38	1	9.09
17967.	Andrew (kooey_u)	11	48.35	53.86	3	27.27
17968.	KIXK (kixk)	11	69.71	76.53	3	27.27
17969.	Kivon (kivonsclipz)	11	76.86	91.87	3	27.27
17970.	cat (kitkat79)	11	62.04	73.21	2	18.18
17971.	Dimas (kirito_69)	11	43.62	50.84	0	0.00
17972.	Ayden (king_nedya)	11	88.24	102.11	3	27.27
17973.	Ferret (kingko)	11	47.40	55.87	1	9.09
17974.	MA1T8 (kingking540)	11	91.68	99.43	4	36.36
17975.	bo (kibums)	11	86.24	104.75	3	27.27
17976.	Kent (kfreezen)	11	98.87	113.59	4	36.36
17977.	Kevin (kevinliu050505)	11	93.01	102.71	4	36.36
17978.	Kevin (kevindkao)	11	100.17	118.18	4	36.36
17979.	Kev (kev9933)	11	106.44	117.78	4	36.36
17980.	KenDvorak (kensan73dvorak)	11	67.83	83.35	1	9.09
17981.	Kenny (kenny1232)	11	68.00	86.22	3	27.27
17982.	Kennedy (kennedykozak)	11	72.51	88.09	4	36.36
17983.	fover (keitotrash)	11	108.12	127.08	8	72.73
17984.	Kate (kate_haha)	11	54.50	62.95	5	45.45
17985.	kasra (kasra44)	11	69.15	80.61	1	9.09
17986.	Kasra (kasra15)	11	59.30	69.25	1	9.09
17987.	kaelan (kae1)	11	110.17	128.14	5	45.45
17988.	James (jvlasak)	11	70.12	78.89	2	18.18
17989.	Justin (justin000)	11	93.00	103.09	4	36.36
17990.	Justa (justaboss101)	11	60.90	69.75	2	18.18
17991.	jumpscarez the fox (jumpsca...	11	39.62	50.22	1	9.09
17992.	Juan (juanpadoodle)	11	74.55	85.11	3	27.27
17993.	Joshua (joshuajoshuak)	11	121.70	133.12	8	72.73
17994.	Jonathan (jonathanatx)	11	73.02	86.93	5	45.45
17995.	Jo (jojoey21)	11	109.08	125.92	7	63.64
17996.	johny2021 (johny2021)	11	48.23	55.17	2	18.18
17997.	JohnsDog (johnsdog)	11	114.49	131.45	3	27.27
17998.	Johnnybib (johnnybib)	11	103.72	127.20	5	45.45
17999.	John (johndzxu)	11	62.64	71.05	2	18.18
18000.	Joey (joeygetthedoughy)	11	86.18	99.96	8	72.73
18001.	Jonathan (jnybo)	11	72.66	88.55	4	36.36
18002.	Jacob (jlagarespo)	11	106.85	122.31	9	81.82
18003.	Jeff (jjj11x)	11	93.14	107.04	4	36.36
18004.	JTL (jimthelegend)	11	82.45	87.52	3	27.27
18005.	jimmhealer (jimmyhealer)	11	60.38	74.08	2	18.18
18006.	Jim (jimdavia99)	11	62.93	69.59	2	18.18
18007.	jiirrarr (jiirrarr)	11	58.24	67.54	3	27.27
18008.	JeffJeff (jeffjeffgames)	11	51.31	59.72	0	0.00
18009.	Pierce (jedipierce)	11	102.71	123.72	6	54.55
18010.	Jakob (jdwalburger)	11	87.36	104.42	7	63.64
18011.	John (jctad)	11	89.69	101.69	5	45.45
18012.	Shlim (javah1)	11	80.44	93.36	1	9.09
18013.	Jared (jaredtypist)	11	95.77	113.08	6	54.55
18014.	Z (jaredezane)	11	102.21	116.20	7	63.64
18015.	Hikaru (japism)	11	82.16	104.44	5	45.45
18016.	Clive (jadenm770)	11	13.45	18.63	2	18.18
18017.	Jacky (jackyjac)	11	72.73	85.78	4	36.36
18018.	John (jacks3141)	11	64.42	74.66	2	18.18
18019.	Jack (jackkieny)	11	59.92	68.80	3	27.27
18020.	i (ivantse2)	11	100.12	111.79	7	63.64
18021.	Taken (itztaken)	11	101.37	115.39	6	54.55
18022.	Games (itzbond)	11	86.41	101.01	5	45.45
18023.	jay! (its_jay_)	11	108.82	117.20	0	0.00
18024.	NewbPianist (instantnoodles...	11	111.54	126.39	7	63.64
18025.	s3lec (inputselec)	11	64.06	75.39	1	9.09
18026.	started from 50 now we here...	11	120.38	146.76	7	63.64
18027.	Owen (innitbruv)	11	54.33	64.21	3	27.27
18028.	John (infzer0)	11	78.05	88.10	3	27.27
18029.	Jayden (infamousphoenix)	11	110.64	134.65	11	100.00
18030.	Indiana Mitko (indianamitko)	11	34.61	42.97	1	9.09
18031.	Farzad (impulsion)	11	70.10	83.00	4	36.36
18032.	Mr. Qwerty (imnotawimpykid)	11	86.22	94.93	4	36.36
18033.	DW (immortal_tree)	11	98.78	107.08	6	54.55
18034.	Richard (iliveinthexu)	11	147.55	158.38	9	81.82
18035.	Michael (idobemikey)	11	63.99	73.06	4	36.36
18036.	idkwhojamesis (idkwhojamesis)	11	87.14	99.92	1	9.09
18037.	Moko (iamspeedkachiga)	11	83.60	98.05	4	36.36
18038.	Player_II (iamplayer)	11	86.52	92.20	4	36.36
18039.	Hxrry (hxrry)	11	65.76	93.48	4	36.36
18040.	Pady (hundertzwoelf)	11	87.68	104.13	1	9.09
18041.	Max (hooterr)	11	83.26	90.09	6	54.55
18042.	seanghong (hongracer)	11	87.55	100.47	3	27.27
18043.	Dominic (hobomonkey5)	11	76.98	93.29	3	27.27
18044.	minnie (hiitzmemini)	11	63.85	76.15	2	18.18
18045.	Hessel (hessel_s)	11	80.09	87.86	3	27.27
18046.	Santiago (helix_02)	11	80.88	101.02	4	36.36
18047.	Skyler (hausky)	11	96.40	109.75	6	54.55
18048.	Nayan (hatke42)	11	60.39	71.07	4	36.36
18049.	harambe (harambetypes)	11	43.18	57.80	1	9.09
18050.	UE (hanue)	11	40.76	53.32	0	0.00
18051.	Hana (hanatf2)	11	104.18	118.41	4	36.36
18052.	Han (han3)	11	93.14	109.55	3	27.27
18053.	Jason (haisaru)	11	76.64	90.30	5	45.45
18054.	Haiden (haidenb10)	11	91.73	103.94	4	36.36
18055.	Aldrich (gwaldrich)	11	97.00	112.03	3	27.27
18056.	gegg (guy_sama)	11	73.63	85.42	3	27.27
18057.	vinnie (gun_xox)	11	58.23	78.34	2	18.18
18058.	Guest (guest002)	11	79.70	86.69	2	18.18
18059.	grossdesign (grossdesign)	11	114.74	129.30	9	81.82
18060.	Colin (grolxe_1)	11	91.75	107.52	3	27.27
18061.	Clayton (grizzleybear62)	11	57.56	67.18	2	18.18
18062.	Grifit (grifit)	11	47.99	61.03	3	27.27
18063.	Griffin (grider1)	11	91.97	102.35	2	18.18
18064.	GreatLama (greatlama)	11	80.31	93.50	4	36.36
18065.	Vin (gracien)	11	62.19	69.47	2	18.18
18066.	George (gpa138)	11	93.66	112.81	7	63.64
18067.	Hcaz (gosuperzach)	11	46.38	55.27	3	27.27
18068.	Cheap (gorid)	11	64.52	77.33	1	9.09
18069.	Mar (gonefishing123)	11	94.36	109.68	5	45.45
18070.	Jared (going2prison)	11	66.43	81.00	2	18.18
18071.	William (godliam)	11	51.13	62.24	4	36.36
18072.	godaberi (godaberi)	11	67.26	76.93	4	36.36
18073.	Virtuoso™ (gkarthick)	11	93.87	100.39	3	27.27
18074.	gi (gi_prim)	11	44.29	53.95	1	9.09
18075.	Willy (gfif01)	11	72.60	82.65	5	45.45
18076.	alem (gewaltxd)	11	75.63	91.61	7	63.64
18077.	Get Racc'd (getraccd_)	11	58.70	67.67	2	18.18
18078.	GerDi (gerdii)	11	61.75	80.20	5	45.45
18079.	Genie (genielee)	11	111.77	137.01	6	54.55
18080.	Griffin (gdawg_10)	11	70.58	81.07	7	63.64
18081.	Sam (garuda1221)	11	86.23	98.47	8	72.73
18082.	Gaphnix (gaphnix)	11	63.68	66.80	4	36.36
18083.	Galib (galib2051)	11	70.49	77.81	4	36.36
18084.	Gabber (gabbergandalf)	11	62.84	67.87	3	27.27
18085.	Gochu (g0inginsqne)	11	108.43	116.69	5	45.45
18086.	UppedFusion (fusion_)	11	110.27	119.53	6	54.55
18087.	FusionHimSelf (fusionraider1)	11	53.87	66.54	2	18.18
18088.	Tonkata (_tonkata_)	11	53.24	63.97	2	18.18
18089.	bruh (_sidnair2003_)	11	107.38	130.59	11	100.00
18090.	guitrstrngscr (_resh_)	11	66.09	80.60	2	18.18
18091.	Pendi (_pendi)	11	120.63	131.72	8	72.73
18092.	Daniela (_noodleynoodles_)	11	114.29	131.76	6	54.55
18093.	Nilesh (_nex_)	11	76.47	85.69	1	9.09
18094.	Mick (_mickey_)	11	69.76	83.82	1	9.09
18095.	Jeff (_jeff_)	11	54.02	59.42	1	9.09
18096.	MrClumzzy (zxgod)	11	68.80	85.94	4	36.36
18097.	Josh (zumoariri)	11	59.00	67.80	2	18.18
18098.	Ronnie (zoroaki)	11	51.24	70.59	2	18.18
18099.	Zuja (zoojah)	11	95.21	108.76	5	45.45
18100.	tstats[Zmiester0828] (zmeis...	11	76.96	100.75	3	27.27
18101.	zoey (zjskating)	11	72.61	83.33	3	27.27
18102.	jorje (zhonti)	11	51.97	67.79	4	36.36
18103.	ZapSlow (zapadobo)	11	102.26	123.97	5	45.45
18104.	tstats[zanies07] (zanies07)	11	48.29	52.62	2	18.18
18105.	Jonathan (z33nine)	11	49.12	54.47	0	0.00
18106.	lixiang (yuan_yuan)	11	97.55	107.85	5	45.45
18107.	yuan (yuanyangty)	11	111.08	122.62	4	36.36
18108.	R. (yeetertheskeeter)	11	113.49	146.91	1	9.09
18109.	YeetedOrca (yeetedorca)	11	66.87	78.91	1	9.09
18110.	Zalvy (ydnav)	11	97.09	116.23	4	36.36
18111.	Husain (yahyahusain)	11	87.22	102.47	9	81.82
18112.	Dan (x_danma)	11	70.87	82.87	2	18.18
18113.	XXRobzz (xxr0bzz)	11	80.51	91.83	5	45.45
18114.	OOF (xpinoyx)	11	98.29	111.55	4	36.36
18115.	Gunn (xg88)	11	90.34	129.16	7	63.64
18116.	Kyle (xdestroyer83)	11	88.98	99.67	4	36.36
18117.	Alex (xanfan01)	11	117.46	133.76	7	63.64
18118.	oTk (wulongi)	11	86.68	103.71	6	54.55
18119.	Khaled (wtcherr)	11	54.03	58.00	0	0.00
18120.	wowzaa (wowzaa1)	11	70.57	85.53	1	9.09
18121.	kellogg's (wnluqmnn)	11	87.78	109.92	4	36.36
18122.	lee (wndnjs4389)	11	59.47	71.56	2	18.18
18123.	wlitchw (wlitchw)	11	52.59	63.68	3	27.27
18124.	Will (윌) (willwang)	11	91.93	104.42	4	36.36
18125.	william (williamivandy)	11	79.62	91.90	2	18.18
18126.	wigglyworm (wigglyworm)	11	75.04	92.04	2	18.18
18127.	whynottt (whynottt)	11	74.84	98.81	4	36.36
18128.	Tray (whitefalcon684)	11	88.29	102.25	3	27.27
18129.	WhaleVomit (whalevomit)	11	123.29	129.60	9	81.82
18130.	TomCeria (wertyboy)	11	91.84	103.24	6	54.55
18131.	weidel (weidel)	11	58.41	70.42	1	9.09
18132.	jasmin (wawfles)	11	81.25	93.03	3	27.27
18133.	wango (wango)	11	94.11	119.47	7	63.64
18134.	Walden (walnutwaldo20)	11	75.81	122.35	3	27.27
18135.	Wakeel (wakeel_ahmed)	11	36.68	45.52	1	9.09
18136.	wael (wael2)	11	58.65	67.80	1	9.09
18137.	Chalach (waddee)	11	89.12	103.93	1	9.09
18138.	Omar (v_omar11)	11	88.49	94.30	2	18.18
18139.	Ayesha (vogue212)	11	83.73	93.65	2	18.18
18140.	Visa (visatron)	11	91.63	119.18	4	36.36
18141.	Aashrya (virtualvector)	11	85.97	101.12	10	90.91
18142.	Vihaan (vilecn2609)	11	20.52	24.16	10	90.91
18143.	V (viktiro)	11	109.72	132.25	8	72.73
18144.	Gravity (vgravity)	11	74.46	86.75	0	0.00
18145.	Ritika Garg (ve_ronica)	11	40.07	44.80	1	9.09
18146.	Vanu (vanu88)	11	56.99	68.98	2	18.18
18147.	Sonia (vannvilla)	11	97.03	106.55	8	72.73
18148.	Dard (vaderking)	11	69.34	79.72	11	100.00
18149.	Vadacurry (vadacurry)	11	74.53	86.71	3	27.27
18150.	v1ruso (v1ruso)	11	101.70	110.57	7	63.64
18151.	ivﾠonﾠutube (unreaii)	11	117.70	135.11	7	63.64
18152.	unowildcard (unowildcard)	11	101.41	112.47	6	54.55
18153.	Trevor (uneasythrower24)	11	59.88	65.69	1	9.09
18154.	Mythical (ultrabow)	11	73.84	88.39	2	18.18
18155.	Tzo (tzoatplay)	11	59.94	66.31	2	18.18
18156.	Tys0100 (tys0100)	11	67.58	74.94	0	0.00
18157.	matthew (typeredemption)	11	30.09	36.12	3	27.27
18158.	Jesse Klaver (typeracernoob...	11	78.39	93.18	4	36.36
18159.	typeracer (typeracer550)	11	73.46	82.87	3	27.27
18160.	Colin (typeofwhey)	11	87.14	101.16	3	27.27
18161.	Miles (txlore)	11	83.65	99.57	6	54.55
18162.	turutupa (turutupa)	11	96.07	110.66	6	54.55
18163.	Turtley (turtleyjk)	11	89.54	105.84	6	54.55
18164.	Tu (tuawesome)	11	81.48	96.84	5	45.45
18165.	T (tt147)	11	100.46	113.00	5	45.45
18166.	MoDX (trollcannon)	11	84.94	92.93	2	18.18
18167.	Thomas (trinitymeister)	11	54.31	64.41	2	18.18
18168.	Travis (travis4d)	11	67.83	78.73	5	45.45
18169.	T (toompaxd)	11	83.70	92.55	0	0.00
18170.	Toast (toastmaster127)	11	85.87	116.65	4	36.36
18171.	professor (tm_professor)	11	64.81	72.98	8	72.73
18172.	Dinmarc (tmlololol)	11	53.71	62.56	0	0.00
18173.	Scaught (tiktoks)	11	91.91	104.11	4	36.36
18174.	Asd (thinedes)	11	101.51	132.88	5	45.45
18175.	Captn (the_nobody3786)	11	60.38	80.89	2	18.18
18176.	The (the_learning_savage)	11	82.21	104.96	2	18.18
18177.	Ayush (the_dealer)	11	75.06	89.50	2	18.18
18178.	The Try (thetryhardguy01_)	11	57.31	67.01	3	27.27
18179.	Undisclosed (thetechnicalfox)	11	108.24	129.67	3	27.27
18180.	Ryan (theryanshan)	11	65.87	72.83	1	9.09
18181.	Shreshth (thefoxwithanelytra)	11	93.75	100.26	4	36.36
18182.	TheFoodMan52 (thefoodman52)	11	90.44	111.04	7	63.64
18183.	steelmonkey (thecornhobble)	11	124.84	149.12	3	27.27
18184.	THATGUYtm (thatguytm)	11	79.60	96.61	6	54.55
18185.	butterfingers (th3panda)	11	82.47	97.20	2	18.18
18186.	Tejas (tejasfarera)	11	64.54	74.75	3	27.27
18187.	Teerapat (teerapatlaongdee)	11	69.68	85.94	3	27.27
18188.	Joseph (techvideomaster)	11	89.02	103.44	4	36.36
18189.	Andy (teaestaye)	11	90.09	108.13	3	27.27
18190.	Mocha (tdrewek)	11	81.66	90.83	1	9.09
18191.	Tasnimul Hasan Rafid (tasni...	11	48.80	56.60	0	0.00
18192.	Nishant (tarzanjunior)	11	63.51	73.05	4	36.36
18193.	Tarun (tarun_valasa)	11	54.23	71.25	2	18.18
18194.	Tarashankar (tarashankar)	11	50.61	59.65	0	0.00
18195.	Jay (taragine)	11	98.71	111.63	5	45.45
18196.	Owen (taenguar)	11	106.90	124.38	5	45.45
18197.	Patrik (tacticalnuke)	11	86.78	103.16	3	27.27
18198.	Ben (tabman)	11	92.29	104.67	9	81.82
18199.	taylor (taayloor)	11	125.82	140.41	5	45.45
18200.	ស៊ីថេ (sythe_net)	11	38.04	47.70	2	18.18
18201.	Malik (sweetbubblegum_50)	11	85.23	98.80	2	18.18
18202.	Swati (swati0609)	11	53.52	63.87	1	9.09
18203.	SuperDucky1875 (superducky1...	11	48.45	58.20	2	18.18
18204.	a (suk_)	11	97.04	126.01	8	72.73
18205.	Suchit (suchit_reddi)	11	48.62	57.44	3	27.27
18206.	Filip (sucicf7)	11	93.69	105.34	1	9.09
18207.	steven (styper3030)	11	46.85	60.78	1	9.09
18208.	Stuart (sturay)	11	99.55	111.77	6	54.55
18209.	flyingcakes (strx_)	11	78.93	93.42	2	18.18
18210.	#EndCars (stratmann)	11	96.70	102.56	5	45.45
18211.	Storm (stormheezen)	11	56.84	61.01	3	27.27
18212.	Hayden (stoptake)	11	79.95	96.38	5	45.45
18213.	Dan (stefanstef)	11	99.42	114.15	7	63.64
18214.	Rong Liew (springbaron)	11	129.63	141.02	8	72.73
18215.	Peter (spinbot)	11	63.77	75.08	3	27.27
18216.	Shivam (sorcerer626)	11	89.54	107.50	6	54.55
18217.	Sophie (sophie0413)	11	87.65	102.92	2	18.18
18218.	Travis (sonicspeed06)	11	64.39	71.09	5	45.45
18219.	Prosper Solomon (solomontz)	11	53.03	60.65	2	18.18
18220.	bjonk (sojho)	11	121.80	133.00	6	54.55
18221.	Zoom Zoom (soccerman12345)	11	106.97	124.28	7	63.64
18222.	smmbam (smmbam)	11	79.53	88.35	3	27.27
18223.	Tamer (smartlead)	11	36.89	42.45	4	36.36
18224.	kek (slongdongbong)	11	62.17	68.98	2	18.18
18225.	tim (slipperyreptile)	11	106.67	131.41	9	81.82
18226.	Ilias (skysrex)	11	78.45	95.94	5	45.45
18227.	Skreemmy (skreemmy)	11	56.22	63.71	2	18.18
18228.	Aditya (skaarfacee)	11	54.52	59.44	1	9.09
18229.	Tyler (silver_typer)	11	103.01	114.24	5	45.45
18230.	busshyzDRill (silvercrow0)	11	50.51	54.85	2	18.18
18231.	Anthony (sildreon)	11	81.78	94.05	1	9.09
18232.	Suienish (sikoesch)	11	69.14	74.55	2	18.18
18233.	Nicola (shougt)	11	61.18	71.48	2	18.18
18234.	Sharos (sharos)	11	53.66	60.31	2	18.18
18235.	hello (sharkyboy)	11	124.91	134.90	6	54.55
18236.	Shark (sharkbeargator)	11	92.17	104.85	3	27.27
18237.	Shafiq (shafiq7911)	11	78.21	88.78	1	9.09
18238.	Andrew (sertria)	11	93.49	100.08	3	27.27
18239.	sergieric (sergieric)	11	58.71	68.94	3	27.27
18240.	SjåDæmSjøgølls (seethem...	11	63.76	76.19	2	18.18
18241.	SeCre (secre13)	11	72.45	84.37	2	18.18
18242.	long bus (sealegs)	11	141.36	154.43	9	81.82
18243.	Corrin (scynth)	11	98.60	105.44	4	36.36
18244.	i write code (_yay)	10	84.83	105.36	8	80.00
18245.	Mr.Buttons (_tanuuuu)	10	85.05	93.72	3	30.00
18246.	Megatypist (_megatypist_)	10	120.16	138.55	7	70.00
18247.	Eoyzyc (_eoyzyc_)	10	34.94	46.27	2	20.00
18248.	Fabian (zyzyx)	10	80.93	88.70	4	40.00
18249.	Marz (zuchan)	10	94.41	109.12	6	60.00
18250.	zoomrickyyy (zoomricky)	10	75.97	87.21	5	50.00
18251.	Zachary (zjroote)	10	79.09	89.99	1	10.00
18252.	Zir0 (ziiro)	10	93.75	105.60	4	40.00
18253.	Tony (zhukant)	10	109.46	121.48	5	50.00
18254.	Zen (zencreepz)	10	91.79	110.60	4	40.00
18255.	zanydruid (zanydruid)	10	72.35	85.14	2	20.00
18256.	Zak (zak1388)	10	73.24	96.74	5	50.00
18257.	Cojo (zagoat)	10	62.27	70.51	1	10.00
18258.	Tim (yutuyt)	10	112.35	132.08	8	80.00
18259.	Zach (yo_zs)	10	58.60	73.16	1	10.00
18260.	Aleksandar (yoursis)	10	53.68	62.93	3	30.00
18261.	Yothin (yothinix)	10	60.75	66.75	0	0.00
18262.	Kevin (yolonce)	10	50.65	57.92	2	20.00
18263.	Yerkegul (yerkesha)	10	41.44	45.16	2	20.00
18264.	Yelzhan (yelzhansky)	10	36.92	39.88	0	0.00
18265.	yamrawr (yamrawr)	10	148.98	167.45	7	70.00
18266.	yoshiking (y05h1k1ng)	10	57.82	70.64	2	20.00
18267.	huge (xxxtentaciontrippiere...	10	46.31	58.45	2	20.00
18268.	Ted (xted)	10	111.56	131.99	6	60.00
18269.	Noah (xsonorous)	10	92.38	103.55	2	20.00
18270.	xsharawi (xsharawi)	10	64.10	84.60	2	20.00
18271.	Nick (xogtwo)	10	49.53	63.35	2	20.00
18272.	xLikely (xlikely1)	10	113.72	124.99	7	70.00
18273.	Lian (xlian)	10	84.26	106.87	4	40.00
18274.	Zach (xachg)	10	70.92	79.00	4	40.00
18275.	Hoesmad (woshinidie123)	10	74.32	86.93	2	20.00
18276.	Fluffster (wlmao)	10	74.76	105.39	2	20.00
18277.	Witre (witred)	10	74.31	91.50	6	60.00
18278.	William (willkosasih)	10	66.58	71.19	1	10.00
18279.	Nathaniel (wiiman)	10	59.41	68.13	4	40.00
18280.	Walter (whunt5757)	10	93.70	115.67	4	40.00
18281.	what (what_what_what)	10	97.06	114.98	4	40.00
18282.	50 Year Old Girl (whatsthis)	10	83.47	108.09	3	30.00
18283.	Zachary (weiser)	10	83.35	97.23	4	40.00
18284.	Wanizame (wanizame)	10	76.44	92.92	2	20.00
18285.	TheDecentPretender (wamsly)	10	90.50	99.97	2	20.00
18286.	Dean (wahrheit)	10	84.12	102.85	3	30.00
18287.	V (vy171)	10	100.35	130.17	1	10.00
18288.	Average (vuzid)	10	92.14	119.27	10	100.00
18289.	Vojtěch (vojtar)	10	72.44	85.03	1	10.00
18290.	Vic (vicjen)	10	99.60	114.09	6	60.00
18291.	han (vapour_)	10	106.13	116.04	5	50.00
18292.	van (van8878)	10	45.29	54.38	0	0.00
18293.	Kevin (v3rmillian)	10	82.26	96.98	0	0.00
18294.	Mats (uxorialrook)	10	85.40	94.79	3	30.00
18295.	uska95 (uska95)	10	55.56	67.71	1	10.00
18296.	Denni (uramazing)	10	102.08	114.44	7	70.00
18297.	Smooth (undeadplayer)	10	49.55	54.41	1	10.00
18298.	Orlando (ultraonlinexd)	10	46.47	61.79	0	0.00
18299.	Esther (ueatmypoop)	10	58.68	70.63	1	10.00
18300.	Typing (typotyper1738)	10	59.69	80.18	1	10.00
18301.	Rider (typerrider)	10	116.04	132.79	6	60.00
18302.	Andrew (typegad)	10	54.25	63.49	4	40.00
18303.	Matthew (twixinator)	10	96.81	110.68	2	20.00
18304.	Felix (twiizy)	10	71.51	82.27	4	40.00
18305.	Daniel (turnercommadan)	10	66.83	71.80	3	30.00
18306.	Jim (turkeyfetish)	10	90.03	103.33	5	50.00
18307.	Mike (tsunami21)	10	93.91	105.94	1	10.00
18308.	Taush (tsampley)	10	85.62	103.19	4	40.00
18309.	TREMAINE (tremaine_m)	10	67.97	83.15	1	10.00
18310.	Tour2738 (tour2738)	10	42.08	46.69	1	10.00
18311.	ToncaIlPunta (toncailpunta)	10	77.57	89.05	4	40.00
18312.	Token (token_typer)	10	77.47	91.63	3	30.00
18313.	Isaac (tkdwarrior)	10	63.51	70.53	3	30.00
18314.	hihihi (tjddb123456)	10	137.77	149.04	7	70.00
18315.	Timmy (tjdaroya1)	10	99.07	115.95	9	90.00
18316.	Tinky (tinkywinkyy)	10	82.77	94.14	2	20.00
18317.	TinklyBell (tinklybell1608)	10	77.21	85.94	4	40.00
18318.	Stewart (timberland9x)	10	63.05	83.95	0	0.00
18319.	tilen (tilen219)	10	51.07	61.54	2	20.00
18320.	Ella (tigger1854)	10	76.37	98.85	4	40.00
18321.	TRUMP (tiepin)	10	93.01	102.01	2	20.00
18322.	Mrigank (tickatron)	10	40.03	53.52	1	10.00
18323.	@itz_ramy (thugsheep)	10	82.12	94.94	3	30.00
18324.	Thooq (thooq)	10	57.53	61.23	2	20.00
18325.	Lan (thien_hai13)	10	56.25	66.09	1	10.00
18326.	Nikolas (the_sleepy)	10	75.89	79.36	1	10.00
18327.	the_redcar (the_redcar)	10	93.67	123.69	6	60.00
18328.	themar (themar)	10	57.26	66.13	1	10.00
18329.	not_inte2 (theinte)	10	93.97	105.12	4	40.00
18330.	Thang (thangvu7)	10	83.26	102.39	4	40.00
18331.	Patrick (tepill)	10	100.76	116.87	4	40.00
18332.	Teo (teotheterminator)	10	56.76	65.88	3	30.00
18333.	Sean (tensai888)	10	80.92	97.21	3	30.00
18334.	Templeton (templetontsai)	10	63.50	68.46	0	0.00
18335.	funky (teletubbystan)	10	59.22	65.18	3	30.00
18336.	Caleb (tekksic)	10	61.68	76.23	3	30.00
18337.	Harshit (techallbyharshit)	10	67.15	80.30	2	20.00
18338.	Tcoman (tcoman1)	10	67.27	72.54	6	60.00
18339.	Luke (tbsky92)	10	93.15	110.75	9	90.00
18340.	Tavora (tavora)	10	108.41	127.19	6	60.00
18341.	Tatsky (tatskynuki)	10	151.19	191.75	6	60.00
18342.	Andrew (taroth)	10	101.23	119.97	4	40.00
18343.	Talbiya (talbiya)	10	37.12	43.09	4	40.00
18344.	takeoutfoo (takeoutfoo)	10	102.43	121.23	6	60.00
18345.	Andy (tactilegangriseup)	10	109.47	134.41	5	50.00
18346.	Tasman (t4sm4n)	10	66.82	73.75	1	10.00
18347.	Sybetron (sybetron)	10	34.21	43.97	1	10.00
18348.	Sweeter (sweetervanilla)	10	96.29	112.21	5	50.00
18349.	swat (swatxian)	10	64.59	74.83	5	50.00
18350.	Sushanth (sushanthgeorgesur...	10	54.02	67.00	3	30.00
18351.	Huy (xthyax)	10	58.98	68.01	3	30.00
18352.	Sultan (sultanai)	10	92.68	109.64	4	40.00
18353.	me (suited4hike)	10	126.04	143.15	10	100.00
18354.	lior (sudden_lee)	10	57.22	66.57	0	0.00
18355.	deegl0rd (stimoze)	10	93.61	100.85	4	40.00
18356.	Sticfigure (sticfigure)	10	45.19	50.61	1	10.00
18357.	Starmaster (starmasterx)	10	63.52	71.88	7	70.00
18358.	Venice (starbucks272)	10	99.48	107.79	4	40.00
18359.	StaliaN (stalian)	10	77.50	88.68	0	0.00
18360.	Ok (ss__)	10	69.11	82.56	1	10.00
18361.	Soph (sssoooppphhh)	10	85.18	98.02	1	10.00
18362.	ssofia (ssofia_bas)	10	28.29	33.91	2	20.00
18363.	speed (speed_boiiii)	10	64.70	76.25	3	30.00
18364.	Speed (speedarmstrong)	10	95.73	119.65	3	30.00
18365.	Specter (spectergrrim)	10	99.12	112.11	2	20.00
18366.	Spammer (spammerforlife)	10	100.47	112.48	7	70.00
18367.	K. (spacewalker)	10	111.10	128.77	5	50.00
18368.	ejay (spacebars_)	10	79.53	86.11	2	20.00
18369.	Moz (soul3n)	10	98.47	114.00	4	40.00
18370.	mooth (sooruva)	10	80.87	90.19	4	40.00
18371.	Sonic (sonicaks)	10	83.87	90.68	1	10.00
18372.	bruh (sojucravings)	10	92.60	109.15	4	40.00
18373.	Soggy (soggydog)	10	93.02	106.75	2	20.00
18374.	SockYeh (sockyeh)	10	84.99	97.81	5	50.00
18375.	void (soberr)	10	75.10	84.99	3	30.00
18376.	saumitra (smtrd3)	10	38.89	44.76	0	0.00
18377.	tiffany (skipperdee)	10	76.90	94.64	3	30.00
18378.	Chris P. (sirjean_pepper)	10	97.28	109.39	4	40.00
18379.	Sidveed (sidveed)	10	96.63	116.44	2	20.00
18380.	shxvnk (shxvnk)	10	80.55	87.17	3	30.00
18381.	Shivam Kumar (shivam51)	10	71.23	84.01	3	30.00
18382.	(shinobukocho)	10	126.55	167.48	7	70.00
18383.	TWICE Dahyun (sheenic)	10	83.58	100.25	5	50.00
18384.	quit=trash (shatapfajjat69)	10	82.41	100.21	3	30.00
18385.	Shashank (shanky92)	10	82.23	92.25	2	20.00
18386.	Shania (shaniacans)	10	57.49	66.15	1	10.00
18387.	Alan (sexillamasexi)	10	84.22	98.33	6	60.00
18388.	sebastian (seviago)	10	48.51	54.96	2	20.00
18389.	I_love_seulgi (seulgischurro)	10	94.57	103.17	1	10.00
18390.	Sergio (sergio96c)	10	91.70	102.53	5	50.00
18391.	Anonymous (argong1)	10	100.81	127.62	5	50.00
18392.	syed (areeb290805)	10	66.53	86.01	4	40.00
18393.	rumi (archsun)	10	94.84	108.34	3	30.00
18394.	Aravinthan (aravinthan)	10	47.00	60.79	2	20.00
18395.	Aravind (aravindsreeram)	10	100.47	115.86	6	60.00
18396.	Aqib (aqib1990)	10	64.55	73.11	1	10.00
18397.	TERT (antonhsu)	10	101.45	118.99	5	50.00
18398.	anpan (anpann)	10	44.80	55.90	3	30.00
18399.	Another (anotherkaneki)	10	88.89	109.66	3	30.00
18400.	ANKIT (ankit_2002)	10	22.80	27.29	3	30.00
18401.	Doe (animitz)	10	101.74	114.22	3	30.00
18402.	Animal (animalracional)	10	105.33	114.54	2	20.00
18403.	Anil (anil1631988)	10	46.29	57.44	2	20.00
18404.	Angelo (angeloanan)	10	86.51	102.51	2	20.00
18405.	Angel (angeldavinci)	10	107.71	125.72	4	40.00
18406.	andrucc (andrucc)	10	124.90	137.56	7	70.00
18407.	Andrea (andrea_oboe)	10	56.90	70.35	2	20.00
18408.	Anastacia (anastaciagurina)	10	43.99	50.57	0	0.00
18409.	manizman (amznima)	10	46.88	58.82	1	10.00
18410.	Amirun (amumrzmh)	10	49.23	55.98	1	10.00
18411.	Amr (amr_alnas)	10	63.57	75.60	2	20.00
18412.	chi (amaz1n)	10	122.68	137.95	4	40.00
18413.	Amaru (amaruescalante)	10	73.70	86.36	2	20.00
18414.	Nux (amades)	10	82.24	93.43	4	40.00
18415.	allLuck (allluck)	10	51.71	63.43	0	0.00
18416.	M (allinnn)	10	70.00	84.05	4	40.00
18417.	Alistair (alistairmross)	10	49.91	56.06	1	10.00
18418.	Alif (aliftheruslan)	10	64.30	72.04	2	20.00
18419.	Alfie (alfiefogg)	10	68.46	76.79	1	10.00
18420.	Aryan (alemantrix)	10	80.47	97.33	1	10.00
18421.	Alec Gian (alecgian)	10	59.96	74.87	2	20.00
18422.	Ajay (ajaygunacr7)	10	82.83	97.64	1	10.00
18423.	noneov (aidentypefast)	10	64.38	72.27	7	70.00
18424.	Ahmad (ah_abualrob)	10	39.15	45.42	1	10.00
18425.	Ahnaf (ahnaf_habib)	10	72.62	82.00	4	40.00
18426.	Annette (ahhooah)	10	53.37	57.11	0	0.00
18427.	Diana (agent_artemis)	10	84.30	104.84	2	20.00
18428.	Keenan (agentk9)	10	72.52	77.13	4	40.00
18429.	muhammad afiq (afiq101)	10	77.69	84.78	3	30.00
18430.	Tim (afferin_)	10	127.97	151.63	7	70.00
18431.	Fher (aether78)	10	28.93	36.77	3	30.00
18432.	Eric (aerran)	10	105.47	113.92	8	80.00
18433.	Adhyay (adyr_152)	10	43.35	56.80	1	10.00
18434.	Adromrial (adromrial)	10	94.00	103.21	5	50.00
18435.	Percy (adladd)	10	78.94	89.23	1	10.00
18436.	acidxburn87 (acidxburn87)	10	49.97	56.93	2	20.00
18437.	Dr_ (abrarsikder_123)	10	50.19	66.71	2	20.00
18438.	primrose (abigaillll)	10	56.10	62.15	2	20.00
18439.	gwen (abcdbga)	10	107.73	119.09	4	40.00
18440.	Aaryan sharma (aaryan21)	10	54.40	61.02	1	10.00
18441.	Mani (93z9a)	10	59.36	68.10	1	10.00
18442.	Jason (921jason921)	10	79.21	104.20	3	30.00
18443.	Jack (666jack)	10	39.20	47.99	0	0.00
18444.	Shalin (29wpm)	10	60.71	65.34	0	0.00
18445.	skies (17phantom)	10	103.77	124.70	3	30.00
18446.	1015634 (1015634)	10	103.28	121.34	5	50.00
18447.	Masood (004993)	10	74.33	88.86	10	100.00
18448.	Alinoo (alinooo)	10	34.19	40.77	0	0.00
18449.	i (iiooddaa)	10	67.57	73.94	3	30.00
18450.	Avijeet (avijeet_03)	10	46.57	51.59	2	20.00
18451.	Colby (kerble)	10	107.38	140.65	6	60.00
18452.	JC (alicawj)	10	87.28	96.66	3	30.00
18453.	Allen (applausingallen)	10	58.80	73.35	2	20.00
18454.	Dante (drogers279)	10	89.42	99.00	5	50.00
18455.	Harmony (harms)	10	73.79	88.69	0	0.00
18456.	Aito (aitogod)	10	52.85	61.08	1	10.00
18457.	Joksa (joksa_19)	10	59.06	65.74	2	20.00
18458.	paper (paperhead)	10	65.50	72.42	4	40.00
18459.	Daksh (daksh_10)	10	47.21	51.41	0	0.00
18460.	matt (skizxo)	10	88.32	106.36	5	50.00
18461.	Ryan (cryptopulse)	10	89.04	102.56	4	40.00
18462.	Kamshat (jklsyk)	10	36.49	40.58	3	30.00
18463.	Leo (leonidas_)	10	89.78	104.85	2	20.00
18464.	Terry (terry77)	10	70.37	81.93	10	100.00
18465.	phoenix (phoenix_mint)	10	67.76	75.91	2	20.00
18466.	_ (ovorampage)	10	81.92	94.75	3	30.00
18467.	Aayan (aayanali808)	10	82.24	98.40	3	30.00
18468.	Abdelrahman (abdelrahman247...	10	39.49	49.00	0	0.00
18469.	john (scholarbackmarathanee)	10	103.34	110.19	8	80.00
18470.	Slayer (slayerontwitch)	10	108.23	122.97	5	50.00
18471.	mado (mado_sam)	10	29.25	38.25	0	0.00
18472.	Tomaz (mali_frodo)	10	53.06	58.54	1	10.00
18473.	Fynn (fynn__)	10	86.79	96.39	3	30.00
18474.	Sh0t.0 (sudhanshu8302)	10	54.33	61.49	3	30.00
18475.	Eric (vulbex)	10	54.75	79.16	1	10.00
18476.	50wpm (verynoob)	10	114.44	139.50	6	60.00
18477.	Álvaro (ashsan98)	10	83.41	92.40	6	60.00
18478.	Nacca (nacca47)	10	73.74	83.22	4	40.00
18479.	Darkn (darkn_yt)	10	120.59	160.37	8	80.00
18480.	Mary (maryxo)	10	84.29	98.76	8	80.00
18481.	: (lazering_death)	10	74.91	96.09	1	10.00
18482.	Someone (arilaro)	10	62.86	68.30	5	50.00
18483.	cool cat! (kid_apollo)	10	45.25	50.50	0	0.00
18484.	Ronak (raun707)	10	52.14	60.75	0	0.00
18485.	Nicholas (nicocook)	10	91.24	103.51	2	20.00
18486.	BC190 (bc190)	10	65.08	70.66	3	30.00
18487.	Synplet (synplet)	10	79.04	103.57	8	80.00
18488.	DADE (dad_ee)	10	71.23	83.45	1	10.00
18489.	Leon (dutchwarrior)	10	57.20	62.32	1	10.00
18490.	Sul (mrsul_)	10	82.90	92.14	8	80.00
18491.	Lorenzo (gr8monk3ys)	10	87.69	95.23	3	30.00
18492.	Chapman (sevenagueroes)	10	53.56	57.77	1	10.00
18493.	yens_ (jens8732)	10	72.52	79.29	3	30.00
18494.	Jonten (jrpx9)	10	43.83	61.77	1	10.00
18495.	Brendan (typingtops)	10	65.67	78.87	2	20.00
18496.	Vicki (vickil)	10	62.13	72.52	4	40.00
18497.	Hamilton (hammer3000)	10	69.46	85.72	1	10.00
18498.	Michelle (chickzor)	10	51.09	56.88	1	10.00
18499.	tstats[mmh49] (mmh49)	10	55.83	67.23	0	0.00
18500.	Brugarin (brugarin)	10	67.50	78.98	4	40.00
18501.	Ayberk (ayberkt)	10	101.41	119.10	5	50.00
18502.	abua (chelian)	10	84.25	92.77	2	20.00
18503.	CleverB (cleverboo)	10	46.75	56.46	0	0.00
18504.	Kelvin (amdabest)	10	46.45	63.05	3	30.00
18505.	Alec (dhracergc)	10	68.95	87.00	8	80.00
18506.	James (james_f)	10	94.04	114.58	9	90.00
18507.	lethimcook (aahiiks)	10	39.73	46.17	0	0.00
18508.	gamer (rkiks)	10	45.73	53.81	1	10.00
18509.	finity (finity_dvorak)	10	26.85	33.74	3	30.00
18510.	U-Jean (sedimaster007)	10	93.37	105.36	5	50.00
18511.	IIan (ilan7411_)	10	73.09	86.53	3	30.00
18512.	Gangnam (andreselcashete)	10	124.52	154.32	8	80.00
18513.	Duck (wubbaduck)	10	50.25	63.62	1	10.00
18514.	Pedro (pdbaroni)	10	63.63	86.81	4	40.00
18515.	Alexander (kiknalex)	10	94.65	114.66	2	20.00
18516.	Human (ame5057)	10	79.03	95.48	2	20.00
18517.	Sarah (skutti)	10	115.61	122.62	8	80.00
18518.	Karan (karan_2505)	10	40.10	45.80	0	0.00
18519.	Yamp4 (yamp4)	10	41.41	55.97	1	10.00
18520.	arion (arion_)	10	64.19	80.27	7	70.00
18521.	Kanon (krsr23)	10	53.30	62.91	0	0.00
18522.	Not (notbeluga)	10	73.33	84.05	5	50.00
18523.	Mohd (mohdbilal)	10	45.59	50.48	1	10.00
18524.	neo (neosylph)	10	85.19	96.97	3	30.00
18525.	mehzad (meiyotaco)	10	58.09	67.88	2	20.00
18526.	Typeternel (typeternel)	10	92.27	102.07	3	30.00
18527.	Fancy_Dog (fancy_dog)	10	43.95	48.67	2	20.00
18528.	H (tyrfing)	10	67.36	71.94	1	10.00
18529.	DaFishBoi (dafishboi)	10	66.61	75.17	5	50.00
18530.	frustration (bczsalba)	10	69.94	80.13	4	40.00
18531.	Tyler (tylergm1)	10	60.53	72.05	2	20.00
18532.	kim (jasmins3r)	10	40.09	46.00	2	20.00
18533.	Omar (meowot)	10	43.53	50.03	0	0.00
18534.	H5%hz (h5hztype)	10	47.60	60.09	1	10.00
18535.	javier (lechon2103)	10	40.71	46.29	0	0.00
18536.	kajal (kajall)	10	29.04	58.48	1	10.00
18537.	Bobby (mistabobby)	10	62.18	65.57	10	100.00
18538.	Mark (macdalo)	10	60.70	76.80	4	40.00
18539.	Ash (lillemann)	10	65.98	82.05	0	0.00
18540.	Mahbub (mahasayz)	10	69.72	83.31	5	50.00
18541.	LC (64tiananmen)	10	105.80	111.78	5	50.00
18542.	C (stormdrain)	10	95.72	110.88	5	50.00
18543.	Suspicious McGee (suspiciou...	10	66.87	77.04	4	40.00
18544.	Mostafa (3400mostafa)	10	60.40	70.71	1	10.00
18545.	10exer (spartibartfast)	10	72.83	85.18	0	0.00
18546.	AN (combaker)	10	56.11	63.28	1	10.00
18547.	Petar (crimenibba69)	10	83.83	97.33	7	70.00
18548.	Y.S (petitpotat)	10	75.15	88.03	2	20.00
18549.	sugar (sugarcqnes)	10	76.34	99.56	0	0.00
18550.	Brandon (stokesbro)	10	60.59	65.56	2	20.00
18551.	Summer (sccb_14)	10	46.89	54.56	8	80.00
18552.	Acetaminophen (savirbaas)	10	108.32	128.24	2	20.00
18553.	Saurus (saurus)	10	77.64	86.30	4	40.00
18554.	princeton (santabiii)	10	55.99	62.80	2	20.00
18555.	Sanmeel (sanmeel)	10	70.31	85.01	4	40.00
18556.	Samz (samzgm)	10	86.70	98.70	6	60.00
18557.	Sam (samh410)	10	86.25	101.18	4	40.00
18558.	Ezona (sambumbuslayer)	10	67.42	91.04	5	50.00
18559.	Rose (salemluna)	10	68.98	74.28	4	40.00
18560.	Sadaq (sadaq)	10	59.91	66.25	2	20.00
18561.	Saagster (saagster)	10	73.79	86.21	3	30.00
18562.	David (ryzeros)	10	94.27	111.16	3	30.00
18563.	Ricky (ryckler)	10	87.68	100.95	5	50.00
18564.	Rem (ryanz778)	10	117.40	129.51	5	50.00
18565.	Robert (rwschuster)	10	122.74	147.40	6	60.00
18566.	Antti (rustling)	10	81.53	94.06	4	40.00
18567.	Russell (russell_t3ap)	10	98.44	113.24	4	40.00
18568.	IMZA (runawayse)	10	71.26	79.33	1	10.00
18569.	Yash (rubikstyper)	10	69.76	84.41	1	10.00
18570.	Rsijlowpez (rsijlowpez)	10	120.08	131.44	6	60.00
18571.	Maroy (roymaaa)	10	107.23	127.22	3	30.00
18572.	lap (roeloflucka2)	10	74.99	85.86	2	20.00
18573.	Mohammad (robin420024)	10	16.03	19.82	2	20.00
18574.	Thint (rma251209)	10	58.41	69.25	2	20.00
18575.	Rafi (rkyum)	10	71.88	79.04	2	20.00
18576.	hplr (rkg0612)	10	105.27	119.21	3	30.00
18577.	Ricky (riyu22)	10	90.37	108.13	3	30.00
18578.	Rinat (rinatzh)	10	64.82	77.10	1	10.00
18579.	Rim (rimkyul)	10	59.66	69.25	7	70.00
18580.	Riggles (riggles)	10	89.74	103.38	1	10.00
18581.	ridan (ridanrekas)	10	67.81	75.92	2	20.00
18582.	Ricky (rickythedude)	10	61.55	68.54	1	10.00
18583.	Rickard (rickyspr)	10	69.67	84.42	4	40.00
18584.	I am cool (ribombee_mobile)	10	82.09	104.05	1	10.00
18585.	Removeris (removeris)	10	78.83	92.67	1	10.00
18586.	Relletro (relletro)	10	65.69	77.66	3	30.00
18587.	Relja Bulat (relja0804)	10	48.39	56.28	2	20.00
18588.	Krsman (rektix)	10	85.80	93.21	1	10.00
18589.	Simon (rehy)	10	41.78	46.28	2	20.00
18590.	Regan (regank1)	10	67.02	74.49	2	20.00
18591.	Raynei (raynei)	10	90.04	107.34	4	40.00
18592.	Ravindi (rav2525)	10	71.95	89.92	4	40.00
18593.	Zain (rasnouk)	10	76.14	86.30	2	20.00
18594.	Rania (rania_mostafak)	10	40.61	45.85	0	0.00
18595.	Rana (rana2706)	10	49.39	57.20	1	10.00
18596.	Teddy (rampagingteddy)	10	62.78	69.10	1	10.00
18597.	Ramson (rammun)	10	69.27	80.89	0	0.00
18598.	Ralph (ralphcyrus0015)	10	68.85	80.67	2	20.00
18599.	MD ASHIQUL (rajib470)	10	58.94	66.19	0	0.00
18600.	weiss (rag_penguin)	10	107.08	135.37	3	30.00
18601.	t (raccoon_emoji)	10	57.76	71.48	4	40.00
18602.	Giovanni (qwertyg01)	10	66.18	75.37	3	30.00
18603.	tadeo (qwerm)	10	74.58	87.66	3	30.00
18604.	Eequla (quintaboy)	10	105.36	120.60	4	40.00
18605.	Lucas (pythonvx)	10	84.62	93.26	6	60.00
18606.	phasawat (puppaprubchok)	10	46.89	52.78	3	30.00
18607.	pun (punoar)	10	65.96	76.07	1	10.00
18608.	PulseAD (pulsead)	10	96.75	109.70	7	70.00
18609.	ProBlasters (pro_blasters)	10	63.06	76.56	4	40.00
18610.	Alexander (prayforwinter)	10	96.59	114.63	5	50.00
18611.	Prajwal10s (prajwal10s)	10	49.24	60.50	2	20.00
18612.	Molasses (practice12_3)	10	89.22	95.90	3	30.00
18613.	Mish (powerpuffgirl23)	10	57.04	66.98	5	50.00
18614.	Pouya (pouyav)	10	66.28	79.53	2	20.00
18615.	Nick (potatoshavings)	10	104.43	131.26	9	90.00
18616.	kyle (popedude22)	10	106.51	127.90	4	40.00
18617.	krisztofer (poofartmaster)	10	59.35	65.80	1	10.00
18618.	Jakis (polishboy12221)	10	74.07	78.86	2	20.00
18619.	Matt (pointlesspostulate)	10	84.60	90.94	7	70.00
18620.	podolsero (podolsero)	10	57.92	67.14	4	40.00
18621.	Grape (plrplrplr12345)	10	82.19	96.82	4	40.00
18622.	Kailh BOX Jade (plixxreeb)	10	101.52	119.95	5	50.00
18623.	Joe (playspout)	10	98.11	106.64	3	30.00
18624.	Gustavo (pizza_water)	10	68.32	75.34	2	20.00
18625.	P (pizzapita)	10	79.71	85.24	2	20.00
18626.	Daredevil (piyush_123)	10	66.93	71.86	3	30.00
18627.	Piyush (piyushc)	10	71.75	78.77	1	10.00
18628.	Phantom (phantomzamber)	10	56.38	67.12	2	20.00
18629.	Tim (penguins178)	10	81.76	100.58	3	30.00
18630.	peedmypants420 (peedmypants...	10	80.98	95.32	4	40.00
18631.	RIP Byron ❤ (pdnegreiros)	10	93.77	105.58	1	10.00
18632.	Willy (paxson2008)	10	87.28	96.04	4	40.00
18633.	Blagoj (pauc_99)	10	89.23	96.50	1	10.00
18634.	Francisco (patleitao)	10	93.37	109.07	7	70.00
18635.	Baki (p4n7r0n1c)	10	56.40	63.13	0	0.00
18636.	Alex (p08r)	10	86.21	95.15	3	30.00
18637.	oTTo (otto43)	10	67.20	83.26	1	10.00
18638.	Martin (ostlangarn)	10	62.88	68.66	2	20.00
18639.	Josh (orceun)	10	94.98	101.56	3	30.00
18640.	hyungjin (optimizion)	10	72.70	80.84	3	30.00
18641.	Drapanji (onedrapo)	10	74.75	83.68	1	10.00
18642.	Kenneth (omgkenken)	10	104.95	121.10	5	50.00
18643.	Olivia (olivisthecow)	10	97.42	112.02	6	60.00
18644.	Erwin (oldskoollogik)	10	80.11	94.16	4	40.00
18645.	Andy (okiandy)	10	106.40	125.70	6	60.00
18646.	Nush (nush98)	10	92.27	108.47	4	40.00
18647.	nurmyrza (nurzoik)	10	58.03	68.49	4	40.00
18648.	Numpunk (numpunk)	10	75.21	89.86	4	40.00
18649.	numdegased (numdegased)	10	96.37	102.96	3	30.00
18650.	I'm Bad (nssv101)	10	124.71	143.55	3	30.00
18651.	Tintallë (nparadigm)	10	68.96	73.79	2	20.00
18652.	Note (note_r)	10	89.86	113.95	5	50.00
18653.	kevin (noob98)	10	60.43	66.98	4	40.00
18654.	noniino (noniino)	10	53.41	57.38	2	20.00
18655.	DirtyDan.jpeg (nomar_76)	10	64.93	84.43	3	30.00
18656.	NoFace (nofacecastle)	10	52.07	68.97	1	10.00
18657.	Bryan (noddlersnorm)	10	97.08	105.17	4	40.00
18658.	Noah (noahbradderz)	10	75.01	90.58	1	10.00
18659.	Nitin (nitinaturdsk)	10	60.70	66.78	0	0.00
18660.	Sef (niktarera)	10	95.18	122.14	5	50.00
18661.	Nightmare (nightmare_foxy)	10	64.67	79.04	2	20.00
18662.	Nicholas (nicshoe13)	10	90.99	104.88	1	10.00
18663.	Nicholas (nichbillcliff)	10	90.84	93.57	3	30.00
18664.	BountifulFever5 (nguyenanhn...	10	47.38	50.27	1	10.00
18665.	NeVMiku (nevmiku)	10	67.23	81.07	3	30.00
18666.	mat (netman)	10	85.96	99.03	3	30.00
18667.	Neil (neil3110)	10	35.53	38.45	2	20.00
18668.	aaron (naruto2141)	10	92.08	103.96	2	20.00
18669.	nyaa~ (nakkooo)	10	131.02	173.70	6	60.00
18670.	Cát Gia (nahidk)	10	67.24	77.31	2	20.00
18671.	Nadia Gonzalez (nadiaig)	10	82.94	94.92	5	50.00
18672.	danielwolf (n3kro)	10	89.14	103.47	2	20.00
18673.	Louay (n0break)	10	36.50	42.85	0	0.00
18674.	Michael (m_soutar3)	10	108.35	122.09	6	60.00
18675.	Angela (mytypingskillsarent...	10	74.17	85.14	2	20.00
18676.	Michael (myki21)	10	70.18	84.68	3	30.00
18677.	Mustang (mustangmaster)	10	54.14	62.65	0	0.00
18678.	Mukul (mukul27wno)	10	41.53	47.22	0	0.00
18679.	M (mttt001)	10	80.94	90.24	4	40.00
18680.	Martin (mr_pandabear)	10	92.31	100.75	5	50.00
18681.	mr. (mr_maam)	10	91.37	107.29	4	40.00
18682.	Cara (mrsham)	10	81.91	104.28	9	90.00
18683.	MrLolu (mrlolux)	10	54.95	62.36	1	10.00
18684.	Michael (mrgryph0n)	10	104.48	114.33	2	20.00
18685.	Jordan (mrempyrean)	10	113.14	125.37	9	90.00
18686.	Jack (mopex)	10	63.66	75.95	2	20.00
18687.	Light (moory5)	10	86.95	93.18	1	10.00
18688.	tstats[montedeu] (montedeu)	10	61.55	69.85	1	10.00
18689.	Free Palestine (mohamad01)	10	58.24	66.06	1	10.00
18690.	TheScientist (mixalocyber)	10	67.24	79.98	2	20.00
18691.	Mistermanfith (mistermanfith)	10	35.31	40.73	0	0.00
18692.	Aidana (missboss77)	10	27.51	34.67	0	0.00
18693.	Wong (mioky)	10	33.11	38.21	1	10.00
18694.	mingw (mingw)	10	105.19	111.82	6	60.00
18695.	Mikael (mikael_abe)	10	61.37	71.25	1	10.00
18696.	Miday (miday)	10	106.31	118.04	4	40.00
18697.	Michael (michaell018)	10	63.28	74.19	3	30.00
18698.	SeeStarz (mfahrim)	10	94.22	115.43	4	40.00
18699.	Mentafind (mentafind)	10	79.73	93.59	5	50.00
18700.	XFootballManX (meme_licker_21)	10	45.30	53.26	0	0.00
18701.	Lil (memebigboy69xx)	10	79.03	86.52	5	50.00
18702.	Zsombor (melidon)	10	41.43	54.56	1	10.00
18703.	melau (melau)	10	105.46	125.84	5	50.00
18704.	Laisvidas (meizind)	10	55.14	59.71	1	10.00
18705.	Caba (megiorr69)	10	57.96	64.52	3	30.00
18706.	Meeze (meeze)	10	98.14	117.00	2	20.00
18707.	slow. (meeper24)	10	97.95	109.55	5	50.00
18708.	Max (mcm20)	10	94.68	102.52	0	0.00
18709.	Max (max_adagio)	10	104.11	121.32	1	10.00
18710.	Max (maxies)	10	57.63	65.60	3	30.00
18711.	Max (maxbro)	10	85.05	100.12	5	50.00
18712.	Matthew (mawalker66)	10	81.90	90.90	9	90.00
18713.	Groot (marcogroot)	10	106.35	122.64	4	40.00
18714.	bbl_drizzy (marcofia)	10	78.87	89.46	3	30.00
18715.	Marvin (marbinelyo)	10	65.49	74.64	3	30.00
18716.	Manuel (mannymnz)	10	80.52	96.89	4	40.00
18717.	Pavel (fugives)	10	62.92	77.97	7	70.00
18718.	Franz (franzl_fang)	10	48.41	56.11	1	10.00
18719.	Force (foce3954)	10	41.38	45.94	1	10.00
18720.	Jacob (floodedcodeboy)	10	69.15	77.93	4	40.00
18721.	sgfd (fish_speckle)	10	61.78	73.27	3	30.00
18722.	Fifi (fififishcake)	10	76.80	87.30	3	30.00
18723.	Felipe (felipekde)	10	60.51	69.68	1	10.00
18724.	Felipe (felipeav2)	10	27.37	34.51	1	10.00
18725.	Elio (fcasper)	10	69.24	76.63	5	50.00
18726.	Alan (faux_ray)	10	97.73	121.10	6	60.00
18727.	Eric (fastestfatfingers)	10	102.40	115.57	6	60.00
18728.	IlhanKhayru (fangian)	10	85.14	103.71	2	20.00
18729.	Х. (falcon0338)	10	75.82	86.27	5	50.00
18730.	FadedSpirits (fadedspirits)	10	87.29	100.25	2	20.00
18731.	Cece (e_m_p_t_y)	10	79.64	91.52	1	10.00
18732.	igig (eztau)	10	56.62	61.33	1	10.00
18733.	Ezra (ezratyping)	10	89.78	103.39	5	50.00
18734.	eyedin (eyedin)	10	115.21	132.12	5	50.00
18735.	Eve (evehelin)	10	85.50	96.81	2	20.00
18736.	Adrian (evadetoxinz)	10	44.52	55.32	2	20.00
18737.	Ethan (ethro)	10	56.44	76.27	1	10.00
18738.	Walter (eskaytee)	10	52.55	64.00	0	0.00
18739.	Ashfaque (eshan_)	10	59.83	64.80	9	90.00
18740.	typing (errors_intesify)	10	82.87	95.78	3	30.00
18741.	Eric (erictie)	10	80.54	107.49	2	20.00
18742.	Eric (ericboyce)	10	103.60	115.56	6	60.00
18743.	eRFoRever (erforever)	10	110.79	135.13	9	90.00
18744.	Henri (enzzzx)	10	112.20	131.47	5	50.00
18745.	Renz (enriqatron52)	10	99.77	109.99	5	50.00
18746.	Lior (endlease)	10	91.40	103.24	5	50.00
18747.	i am Dog (endi_69)	10	66.26	77.61	4	40.00
18748.	Sky (elucentx)	10	103.55	116.33	7	70.00
18749.	Aron (ellipsoul)	10	111.48	121.77	4	40.00
18750.	Elias (elias_17)	10	62.68	76.26	3	30.00
18751.	Elias (eliasura)	10	110.99	129.28	8	80.00
18752.	el (elchupo)	10	37.35	60.87	2	20.00
18753.	ahmed (elberawy)	10	23.72	27.94	1	10.00
18754.	Evan (eh30)	10	55.79	62.67	1	10.00
18755.	愛する (ecstxsy)	10	93.99	112.48	0	0.00
18756.	Shamil (echonaut)	10	97.00	103.34	4	40.00
18757.	Ori (echoloche)	10	56.56	63.57	4	40.00
18758.	P. Leboid (eccentricpleboid)	10	44.91	56.60	0	0.00
18759.	Dennis (dya26)	10	116.21	134.19	4	40.00
18760.	mazen (dweedar)	10	74.71	84.17	2	20.00
18761.	Diana (dustystar96)	10	60.21	69.18	0	0.00
18762.	Aashish (dunsman)	10	43.74	50.15	1	10.00
18763.	speed (druggedrice)	10	121.63	136.81	2	20.00
18764.	j (droozyayayaya)	10	143.83	161.89	8	80.00
18765.	Matthew (drogoton)	10	63.40	75.90	3	30.00
18766.	José (dqcheetqh)	10	67.58	75.03	4	40.00
18767.	Dinesh (dineshkandy)	10	77.39	98.37	1	10.00
18768.	Dimitris (dimgag)	10	63.63	72.21	2	20.00
18769.	Dimfred (dimfred)	10	83.03	98.18	3	30.00
18770.	diamond (diamond)	10	22.41	30.47	5	50.00
18771.	Dylan (dhatx13)	10	97.43	117.67	4	40.00
18772.	1 (desser2)	10	88.75	96.90	3	30.00
18773.	despaciko (despaciko)	10	81.66	90.12	4	40.00
18774.	deniz (dendiz)	10	75.50	91.80	2	20.00
18775.	Tom (demarini)	10	104.95	117.71	4	40.00
18776.	rudraksh (delusionaloptimist)	10	60.76	70.58	2	20.00
18777.	Do (dekul1205)	10	79.54	92.60	1	10.00
18778.	Osama (default_1011)	10	71.20	81.14	4	40.00
18779.	Rui (deathnight1234)	10	73.11	83.53	8	80.00
18780.	asdfasdf (ddgg007)	10	73.89	94.26	2	20.00
18781.	David (dchoboy)	10	74.37	85.77	2	20.00
18782.	Đejms (db007)	10	72.10	87.18	4	40.00
18783.	Luyene (dauxsis)	10	103.82	120.41	1	10.00
18784.	DatMoonGamer (datmoongamer)	10	115.74	139.38	7	70.00
18785.	Khaeran S. (dark_ze7en)	10	56.83	69.45	0	0.00
18786.	DarkZplays (darkzplays_qwerty)	10	88.60	96.90	5	50.00
18787.	Kadie (darkskies0107)	10	80.32	86.44	3	30.00
18788.	DarkPrinceGandalf (darkprin...	10	91.81	103.95	5	50.00
18789.	stabby stab (darkholdwizerd)	10	78.93	95.12	3	30.00
18790.	Dannica (danni_bear_)	10	48.41	56.20	1	10.00
18791.	Daniel (dankasu)	10	34.45	40.06	1	10.00
18792.	Daniel (daniel1212)	10	75.25	80.90	2	20.00
18793.	Danchik (danchikg)	10	73.09	82.78	3	30.00
18794.	Can't (daddaaddad)	10	105.94	118.19	2	20.00
18795.	Cyrus (cyrus19)	10	76.98	92.04	5	50.00
18796.	Cyden (cyden)	10	58.26	99.51	3	30.00
18797.	Adrian (cui3e)	10	99.61	111.93	9	90.00
18798.	Colby (ctgap)	10	140.01	152.06	8	80.00
18799.	Wall (csgoscam)	10	66.55	88.01	2	20.00
18800.	CatToTheFour (cryptica)	10	97.46	112.20	4	40.00
18801.	Lau (cryptextinct)	10	83.77	96.70	3	30.00
18802.	Crossland (crossjbeer)	10	102.70	122.77	6	60.00
18803.	Michael (crecious)	10	99.98	128.13	6	60.00
18804.	Cream Of (creamofroach)	10	102.00	113.85	8	80.00
18805.	cozy (cozy_c)	10	65.32	85.84	6	60.00
18806.	Corin (corlexc)	10	76.72	93.20	0	0.00
18807.	rsdigital.com.au (cooper1289)	10	131.18	143.88	5	50.00
18808.	C (cmmg1)	10	78.70	89.17	2	20.00
18809.	Connor (cmcl)	10	60.82	68.27	2	20.00
18810.	Cole (cmacd)	10	87.84	97.88	2	20.00
18811.	e (cjasonp)	10	106.38	119.02	3	30.00
18812.	unit (chuwii)	10	74.28	82.53	1	10.00
18813.	Darkchuby (chubyxdxd)	10	47.13	60.03	2	20.00
18814.	Chris... (chrishollow7)	10	98.78	108.92	4	40.00
18815.	Chris (chrishene)	10	71.26	80.98	2	20.00
18816.	Cyrus (chonky_garfield)	10	48.83	58.08	4	40.00
18817.	Chiggas (chinesecodingmaster)	10	59.02	66.03	1	10.00
18818.	chetanya (cheti)	10	67.32	76.32	2	20.00
18819.	han (chenhan)	10	46.69	51.66	0	0.00
18820.	Bruce Mang (cheeseburger_98)	10	93.35	118.59	2	20.00
18821.	Chatic (chatic)	10	79.77	92.56	1	10.00
18822.	Person (chaon7)	10	80.45	93.79	8	80.00
18823.	JOn (chaomeister986)	10	121.06	143.79	6	60.00
18824.	Chad (chadley69)	10	53.45	64.49	1	10.00
18825.	Cefe (cefe_origol)	10	64.10	68.13	4	40.00
18826.	Cat (cat_tanks_mod_maker)	10	68.62	78.82	2	20.00
18827.	BigBoss (catalin2522)	10	57.65	63.67	0	0.00
18828.	Josh (cantmakemoney)	10	90.34	99.56	2	20.00
18829.	Californium (californium)	10	65.32	75.11	2	20.00
18830.	Caddar (caddar)	10	117.74	147.15	5	50.00
18831.	crowdofworkmen (bu_te)	10	87.22	96.34	5	50.00
18832.	Butter (butterfingers_)	10	95.61	105.75	4	40.00
18833.	burritorolls-royce (burrito...	10	82.09	96.89	2	20.00
18834.	Budder40 (budder40)	10	49.06	55.03	1	10.00
18835.	Saran (bssarankumar)	10	66.56	77.50	0	0.00
18836.	Bra Steve (bra_steve)	10	66.29	74.10	3	30.00
18837.	Brandon (brandonsg)	10	87.19	100.23	2	20.00
18838.	Joël (bongo13)	10	94.23	103.06	4	40.00
18839.	Bobby (bobnfuz)	10	64.57	78.62	1	10.00
18840.	Ezra 🖤⛓ (blurr_yfa_ce)	10	46.77	51.09	1	10.00
18841.	Ekko (blue9995566)	10	60.90	65.76	0	0.00
18842.	blekekok (blekekok)	10	80.42	118.74	1	10.00
18843.	blademagic (blademagic)	10	107.64	115.22	6	60.00
18844.	Bruh (blackbacon08)	10	96.75	105.76	5	50.00
18845.	bingcheng45 (bingcheng45)	10	93.78	108.87	5	50.00
18846.	Hoa (billybobstuff)	10	69.24	73.58	3	30.00
18847.	Bharat Kumar (bharat12345)	10	47.48	53.78	1	10.00
18848.	Brian (bgriffeth)	10	61.15	76.62	3	30.00
18849.	berserker02 (berserker02)	10	61.47	73.12	3	30.00
18850.	Daniele (berdelicious)	10	77.45	86.86	1	10.00
18851.	benny (bennythecow)	10	69.07	80.10	3	30.00
18852.	Benny (bennyni101)	10	62.97	70.58	1	10.00
18853.	Benko (benkay)	10	78.00	96.20	6	60.00
18854.	Bob (benjiboy970)	10	84.54	90.58	1	10.00
18855.	beefchow (beefchow)	10	67.52	79.17	2	20.00
18856.	Austin (bear666)	10	61.94	70.19	5	50.00
18857.	Kevin (baven)	10	57.33	69.97	3	30.00
18858.	:) (bavadin)	10	118.62	129.59	4	40.00
18859.	Gus (battm4n)	10	62.68	75.55	2	20.00
18860.	Baris (baris23)	10	94.79	104.60	0	0.00
18861.	_ (baga_rashy)	10	37.79	43.20	0	0.00
18862.	Kaelyn (badpun56)	10	94.35	106.46	2	20.00
18863.	Bad (badminton87)	10	47.34	65.76	2	20.00
18864.	bachira (bachira)	10	59.55	65.03	2	20.00
18865.	Babon (babonbunting)	10	56.27	68.82	2	20.00
18866.	Anto (babafroga)	10	75.43	82.58	6	60.00
18867.	Robert (b0ssofthisgym)	10	63.65	70.73	3	30.00
18868.	Cootsynanus (a_yellow_evan)	10	87.16	100.35	3	30.00
18869.	Michael (azumifan)	10	81.39	88.88	4	40.00
18870.	Never (azasal)	10	93.15	109.57	2	20.00
18871.	SPREAD DVORAK PROPAGANDA (a...	10	87.46	109.44	2	20.00
18872.	Mudit (awesomenessmax)	10	69.92	81.44	7	70.00
18873.	Anthony (avald30)	10	75.41	86.72	3	30.00
18874.	🐐 (auaomamm)	10	96.91	108.41	5	50.00
18875.	BigMan (attel)	10	80.03	89.70	4	40.00
18876.	Isse (attalion)	10	74.81	83.32	3	30.00
18877.	best overlord (athrnls)	10	128.04	150.66	4	40.00
18878.	Atakan (atakannguven)	10	54.59	70.02	4	40.00
18879.	Jairo (asophiel)	10	63.89	80.53	2	20.00
18880.	David (asian_masterium)	10	77.82	92.39	0	0.00
18881.	Destiny (asaak)	10	46.72	55.39	0	0.00
18882.	Arul (arulseth1998)	10	70.51	83.86	2	20.00
18883.	Daniel (arpsteid)	10	83.73	98.08	5	50.00
18884.	arman_ferdous (arman_ferdous)	10	85.30	92.64	2	20.00
18885.	tstats[armanto] (armanto)	10	80.17	91.01	4	40.00
18886.	Madhusudan (mainali449)	10	56.01	63.04	2	20.00
18887.	RoyMcGround (maggyroyrowins...	10	25.99	28.60	1	10.00
18888.	Orion (maggiea718)	10	73.58	82.82	3	30.00
18889.	Mae (maeeeeee)	10	143.25	168.65	10	100.00
18890.	Nagy (lurgul)	10	49.45	58.65	3	30.00
18891.	Luke (lukep421)	10	82.94	94.89	1	10.00
18892.	Gabe (lukeimyourdaddy)	10	76.45	82.42	6	60.00
18893.	Lucite (lucite)	10	103.77	111.64	5	50.00
18894.	Lucifer (lucifer_96)	10	47.04	55.74	2	20.00
18895.	Lucas (lucaz_)	10	57.71	64.45	2	20.00
18896.	Lowell (lowellfailingenglish)	10	95.59	120.25	3	30.00
18897.	Loukas (loukatar)	10	77.81	86.97	1	10.00
18898.	Lorky (lorkylav)	10	63.14	71.86	4	40.00
18899.	ju (lordofthecoochie)	10	52.19	56.78	0	0.00
18900.	最靚嘅仔 (lookingdepres...	10	82.89	92.44	2	20.00
18901.	Doc (lolnice)	10	97.78	125.18	6	60.00
18902.	Stephen (lollidude)	10	81.66	94.58	1	10.00
18903.	Lluna (lluna)	10	80.55	89.98	1	10.00
18904.	lluis (lluissuros)	10	25.73	28.15	1	10.00
18905.	simsimhae yagi (ljd1)	10	122.08	137.10	5	50.00
18906.	liv (livlyf_)	10	62.58	68.75	1	10.00
18907.	lisa (lisa99116)	10	79.07	106.05	1	10.00
18908.	Linda (lindaslabbert)	10	31.42	38.61	0	0.00
18909.	Youngbin (limesoda14)	10	74.71	80.37	1	10.00
18910.	Giannis (lil_spani)	10	74.65	89.88	6	60.00
18911.	boomer (lightaway)	10	51.13	62.66	0	0.00
18912.	lea (leyley01)	10	37.13	41.61	0	0.00
18913.	Francesco (lews_)	10	109.63	120.81	5	50.00
18914.	Justin (leslav)	10	114.99	144.04	6	60.00
18915.	leakcentral (leakcentral)	10	100.67	112.41	4	40.00
18916.	always_choking (leadmen4y)	10	131.65	145.12	9	90.00
18917.	Jason (laysonchillz)	10	73.61	83.60	3	30.00
18918.	Veronica (latenightpizza)	10	97.51	111.20	6	60.00
18919.	LastStar (laststar)	10	71.49	88.90	4	40.00
18920.	Larry (larryquartz)	10	100.91	116.63	7	70.00
18921.	Logan (larmack)	10	111.70	129.13	7	70.00
18922.	Chris (kyoriosity)	10	99.24	114.65	10	100.00
18923.	Sunny (kukie5)	10	90.00	97.39	4	40.00
18924.	Chris (kryss_404)	10	63.75	72.70	2	20.00
18925.	You're Slow (kronosxfleet)	10	69.01	79.82	2	20.00
18926.	Christian (krisco)	10	136.47	156.38	4	40.00
18927.	Big (kralefegaming)	10	62.39	72.87	2	20.00
18928.	Koiysn (koiysn)	10	59.62	75.71	1	10.00
18929.	Koii (koii2003)	10	80.97	89.35	5	50.00
18930.	Richard (killerscotchy)	10	73.29	94.07	5	50.00
18931.	kiki (kikifrederique)	10	37.05	41.82	3	30.00
18932.	KickBull (kickbull)	10	89.99	106.69	3	30.00
18933.	🏎️t.me/abdulhamidsulto...	10	59.38	70.55	3	30.00
18934.	Not telling (kevinveinein)	10	105.76	120.63	3	30.00
18935.	Kevin (kevinchang823)	10	53.78	60.36	1	10.00
18936.	Kevin (kevinator314)	10	91.26	95.74	5	50.00
18937.	Kenshin (kenshin47)	10	96.10	110.85	7	70.00
18938.	Kei 100 (kei100)	10	83.01	95.03	4	40.00
18939.	bean (keenheen)	10	94.03	106.32	3	30.00
18940.	Keanu (keanu72)	10	88.66	101.26	4	40.00
18941.	Kyle (kbuschy)	10	89.16	104.87	1	10.00
18942.	Kaz (kaz_the_kuz)	10	90.42	103.73	1	10.00
18943.	Dennis (kavalier)	10	108.28	131.66	8	80.00
18944.	kang (kasusuwowo)	10	86.52	104.14	6	60.00
18945.	karim (karimkohel)	10	75.93	79.71	2	20.00
18946.	kamikadze (kamikadze009)	10	69.94	76.05	1	10.00
18947.	King of Pirates (kaizokuouu...	10	67.79	72.49	1	10.00
18948.	Minh (kaishj91)	10	70.45	77.99	2	20.00
18949.	Ka (kafong_0123)	10	39.09	45.10	0	0.00
18950.	kae (kaelul)	10	52.52	63.96	5	50.00
18951.	Joseph (jwkeating99)	10	98.84	108.93	5	50.00
18952.	Just (justdandy_)	10	117.85	141.63	5	50.00
18953.	lucy (justarat90)	10	73.84	84.60	4	40.00
18954.	Jure (jujecat)	10	87.79	103.05	1	10.00
18955.	Sid (judgementdey)	10	74.64	82.74	3	30.00
18956.	Judd (judd123)	10	86.70	100.55	1	10.00
18957.	jsve (jsve)	10	82.66	97.43	3	30.00
18958.	Josh (jrc23)	10	83.11	96.44	4	40.00
18959.	Jason (jpngfile)	10	99.99	113.57	4	40.00
18960.	Josh (joshtegart)	10	112.08	145.91	3	30.00
18961.	Nicholas (joshjoshjoshjosh)	10	107.75	145.27	5	50.00
18962.	joey (josephb20252)	10	103.67	115.00	4	40.00
18963.	bonsii (jorhlo)	10	88.39	99.19	3	30.00
18964.	Jonathan (joni1234)	10	61.63	82.52	3	30.00
18965.	Jonathan (jonathan_200605)	10	80.18	94.41	8	80.00
18966.	Jonathan Justin (jonathanjw05)	10	96.91	102.67	4	40.00
18967.	jolene (jolenech)	10	73.25	85.18	2	20.00
18968.	Gamer (joksb2k)	10	44.27	47.89	2	20.00
18969.	Sanjay (joker979)	10	62.11	78.00	3	30.00
18970.	Ivan (john_the_unigoat)	10	51.11	64.19	0	0.00
18971.	Garrett (joejoefriez)	10	79.31	98.91	2	20.00
18972.	Kev (joebob1235)	10	90.70	106.24	5	50.00
18973.	Antonio (joancoma05)	10	41.74	45.85	1	10.00
18974.	Sep (jltariman)	10	63.53	71.43	1	10.00
18975.	J (jkim55k)	10	64.57	72.18	5	50.00
18976.	I can't type anymore (jjwiz...	10	77.73	95.37	5	50.00
18977.	Josh (jjrandle1013)	10	63.92	72.34	1	10.00
18978.	Joey (jj4ster)	10	104.42	129.76	6	60.00
18979.	Jin (jinjohn)	10	50.41	55.92	2	20.00
18980.	Jwarchild (jimmyhaffaren)	10	76.17	93.27	3	30.00
18981.	Tim (jimbo112)	10	91.23	111.91	4	40.00
18982.	Josh (jgeoppo)	10	59.19	68.05	2	20.00
18983.	Joosep (jet_e)	10	80.51	88.84	2	20.00
18984.	TheLegend27 (jethro2003)	10	99.95	107.66	6	60.00
18985.	Jv (jemish_variya)	10	43.76	48.84	0	0.00
18986.	KaptainFroggy_YT (jellybean...	10	74.92	86.08	1	10.00
18987.	Jo (jelli017)	10	50.89	60.38	2	20.00
18988.	jedishong (jedishong)	10	85.80	114.03	6	60.00
18989.	Jon (jcrossley)	10	84.35	93.39	4	40.00
18990.	Jin (jchoi1994)	10	134.88	152.29	9	90.00
18991.	jboog (jboog)	10	79.87	91.88	8	80.00
18992.	Bubbz (jaydenfiesta)	10	61.61	70.96	3	30.00
18993.	Tom (javor)	10	76.74	83.89	5	50.00
18994.	e (javascriptdude)	10	131.29	156.50	6	60.00
18995.	Jamiel (jamiel_exe)	10	71.61	81.78	1	10.00
18996.	Jamie (jam8554)	10	68.78	80.90	2	20.00
18997.	Johann (jalohann)	10	111.07	136.35	8	80.00
18998.	Jacob (jacobru)	10	54.58	66.40	0	0.00
18999.	Jack (jack_tran04)	10	93.90	100.62	6	60.00
19000.	M (izzyissad)	10	68.69	79.71	2	20.00
19001.	neverbreaking170 (ivan28283)	10	140.80	161.28	6	60.00
19002.	its_zaaid (its_zaaid)	10	42.63	48.50	0	0.00
19003.	Tony (itsonlytony)	10	71.52	82.11	1	10.00
19004.	kat (itskat_boba)	10	54.74	59.60	0	0.00
19005.	Islam (islam_anwer)	10	47.14	55.32	1	10.00
19006.	isaacgoe (isaacgoe)	10	97.45	118.71	3	30.00
19007.	Instynkt (instynkt)	10	101.97	120.98	5	50.00
19008.	InSaein (insaein)	10	49.26	56.55	1	10.00
19009.	Kat (inoobo)	10	67.06	79.48	1	10.00
19010.	Inferno2332 (inferno2332)	10	105.27	132.41	8	80.00
19011.	Il Capitano (ilcapitano)	10	93.13	103.39	3	30.00
19012.	creative (idoofus123)	10	144.74	158.69	5	50.00
19013.	Ido (idodobird)	10	83.90	100.63	4	40.00
19014.	Alexander (idkwhatimdoin9)	10	59.57	71.31	1	10.00
19015.	icy (icyxo)	10	75.00	84.26	4	40.00
19016.	hi (ibadattyping)	10	105.97	121.16	2	20.00
19017.	Smith (iamhablo)	10	59.50	62.24	1	10.00
19018.	Daniel (hyunholee13)	10	102.93	123.62	4	40.00
19019.	Icy_Istanbul (hypzx_x)	10	82.00	95.95	0	0.00
19020.	hydroPUMP (hydropump)	10	58.88	68.14	1	10.00
19021.	kvin (hwkhoa)	10	82.04	93.97	5	50.00
19022.	Howbtard (howbtard)	10	113.92	147.90	5	50.00
19023.	HotTubStream (hottubstream)	10	88.49	97.80	4	40.00
19024.	Patrick (hongkongfui)	10	90.03	107.85	2	20.00
19025.	HK_BAKA (hkuzumaki)	10	50.52	60.59	2	20.00
19026.	Henry (henrytidholm)	10	65.72	72.10	5	50.00
19027.	hello1900 (hello1900)	10	18.77	20.99	4	40.00
19028.	haylie (hayizme)	10	44.21	53.93	0	0.00
19029.	Jan (hautix)	10	53.31	63.27	0	0.00
19030.	Kakashi (hatakeclan)	10	87.93	112.81	4	40.00
19031.	hasan (hasan2000)	10	75.98	85.32	2	20.00
19032.	Zach (hardtoki11)	10	99.13	126.66	3	30.00
19033.	Wellington (happydonut)	10	104.28	134.45	5	50.00
19034.	Hannah (hannityyy)	10	98.45	117.13	3	30.00
19035.	Harry (hajohlay)	10	110.67	130.13	4	40.00
19036.	HeMAN (h3m4n)	10	37.31	44.26	0	0.00
19037.	Gurman (gurmns)	10	83.82	99.71	1	10.00
19038.	Gunel (gunel12)	10	41.96	46.67	1	10.00
19039.	Gurveer (gundo_1)	10	64.60	76.70	0	0.00
19040.	Smoto (grozmot)	10	57.45	62.65	2	20.00
19041.	Godstime (gozi3)	10	51.44	60.81	4	40.00
19042.	Robert (gorilla710)	10	92.43	103.15	6	60.00
19043.	Gongster (gongster1)	10	95.01	109.13	5	50.00
19044.	ishan (gmd_cuber)	10	60.68	66.53	3	30.00
19045.	OblivionGlisor (gliscor2004)	10	86.32	100.85	6	60.00
19046.	WHEN THE IMPOSTER IS SUS SU...	10	29.39	30.66	0	0.00
19047.	Gino (gino758)	10	61.25	69.78	2	20.00
19048.	Gianmarco (gianma)	10	63.02	75.96	0	0.00
19049.	Superfast (ghoststop)	10	126.97	143.68	7	70.00
19050.	GGanon (gganon)	10	88.49	97.85	5	50.00
19051.	tian (gfriend)	10	90.23	99.62	5	50.00
19052.	GeeBee_29 (geebee29)	10	60.33	71.57	1	10.00
19053.	Jacob (gaycob)	10	75.69	83.48	1	10.00
19054.	Gat (gatmonke)	10	62.63	69.69	0	0.00
19055.	Gary (gary_dahmer)	10	75.04	86.38	2	20.00
19056.	garin (garinholiyana)	10	57.29	60.52	0	0.00
19057.	garbyal ✌(-‿-)✌ (garb...	10	104.05	115.62	7	70.00
19058.	GamersFTV (gamersftv)	10	38.64	45.32	0	0.00
19059.	Funnier04 (funnier04)	10	71.79	82.51	5	50.00
19060.	Lauto (fuji_puji)	10	98.54	109.35	3	30.00
19061.	freelo (majoreuphoria)	9	89.80	94.96	4	44.44
19062.	siti (mahmudahsiti)	9	94.76	107.84	4	44.44
19063.	mahmud (mahmoudtahaa111)	9	27.37	31.27	3	33.33
19064.	Donovan (maggigorengayam)	9	71.78	79.00	2	22.22
19065.	Max (maexxx)	9	88.31	93.30	2	22.22
19066.	Lycarions (lycarions)	9	93.86	102.32	5	55.56
19067.	Luther (luthermanhole)	9	111.09	133.20	4	44.44
19068.	poopycock17 (luigi65536)	9	86.12	95.60	2	22.22
19069.	Dhruv (loneninja__)	9	70.62	79.54	2	22.22
19070.	Hunter (lokitypingusa)	9	91.28	103.40	3	33.33
19071.	Ioishi (loishi)	9	59.04	64.67	3	33.33
19072.	Logan (loganthewizkid)	9	49.52	56.04	3	33.33
19073.	lockheed (lock_heed)	9	78.06	87.35	2	22.22
19074.	Lochan (lochanr)	9	68.98	80.18	4	44.44
19075.	Misael (llillill)	9	70.74	80.59	3	33.33
19076.	liwmus (liwmu)	9	95.38	104.57	4	44.44
19077.	Victor (liucow)	9	103.28	129.44	1	11.11
19078.	Sam (litesam)	9	79.30	89.82	1	11.11
19079.	Óskar (lillibilli)	9	69.52	82.91	0	0.00
19080.	Lilith (lilith333)	9	97.17	103.44	8	88.89
19081.	from brazil (liech)	9	107.74	114.69	5	55.56
19082.	Your (lftam319)	9	67.61	72.18	1	11.11
19083.	Ramsha (lexi25)	9	37.58	49.10	0	0.00
19084.	tstats[levo2001] (levo2001)	9	58.71	68.94	3	33.33
19085.	Levi (levimeijer)	9	57.12	63.73	1	11.11
19086.	luce (leuvis)	9	54.87	61.26	1	11.11
19087.	(leunn)	9	70.73	81.49	3	33.33
19088.	lemon (lemongrabbb)	9	61.17	74.87	1	11.11
19089.	FleshEyes (lejitt)	9	95.14	101.02	4	44.44
19090.	Legacy (legacylegacy)	9	96.81	111.54	3	33.33
19091.	Learning Bone (learning_bone)	9	66.73	71.89	4	44.44
19092.	Lewis (lcole)	9	71.90	88.28	1	11.11
19093.	chandu (lavinyoutube)	9	32.06	41.84	1	11.11
19094.	James Ethan (laszerbeam)	9	91.41	105.22	6	66.67
19095.	alex (larrythesnail82)	9	55.24	64.03	2	22.22
19096.	laptop (laptopsakti)	9	44.72	46.66	2	22.22
19097.	tstats[lapakatapulta] (lapa...	9	120.36	133.32	3	33.33
19098.	lahmacun (lahmacun228)	9	61.56	67.50	2	22.22
19099.	Sandesh (labradoodle)	9	74.35	82.33	1	11.11
19100.	Denis (l2p200iqplays)	9	100.28	110.25	3	33.33
19101.	KonoKono (kzunderscoresamao...	9	101.58	114.24	5	55.56
19102.	Kyle (kyjasa88)	9	96.78	110.03	3	33.33
19103.	Charles (kyaw12)	9	62.11	75.40	4	44.44
19104.	kweg (kweg)	9	131.43	148.79	4	44.44
19105.	Kai (kulturekiah)	9	56.27	64.13	2	22.22
19106.	kuino, (kuino)	9	103.97	124.18	9	100.00
19107.	×͜×KRISHNA _ (krishna00)	9	48.72	54.87	1	11.11
19108.	Jano (kossvk)	9	92.03	100.85	4	44.44
19109.	Kyle (koshu)	9	64.37	77.50	0	0.00
19110.	konvay (konvay)	9	124.85	140.92	9	100.00
19111.	Koji (kojinb)	9	90.05	99.46	3	33.33
19112.	Luca (kodzack)	9	84.43	98.71	3	33.33
19113.	kodzy (kodzy)	9	88.53	101.89	2	22.22
19114.	Allen (kochengoren)	9	72.48	83.08	1	11.11
19115.	Kleuz (kleuz)	9	64.45	75.81	3	33.33
19116.	Aly (kixiris)	9	55.66	68.66	9	100.00
19117.	sigma shmoo (kingshmoo)	9	75.16	91.79	2	22.22
19118.	Kai (kingkaikster)	9	69.08	76.25	1	11.11
19119.	thia (kingbarney)	9	65.00	81.63	2	22.22
19120.	kiara (kia_via_dia_arara)	9	50.97	66.15	2	22.22
19121.	kiannu (kiannaj)	9	68.95	84.09	2	22.22
19122.	Khende (khende)	9	64.07	71.29	9	100.00
19123.	ionlytype60wpm (keyboardssl...	9	99.10	111.57	5	55.56
19124.	Kevin (kevbobbly)	9	83.57	97.22	2	22.22
19125.	hmmm (kesh______)	9	108.45	119.33	5	55.56
19126.	k (ker1ne)	9	72.02	82.34	3	33.33
19127.	Ken (kennoji)	9	83.27	117.87	8	88.89
19128.	William (keneth10)	9	65.65	79.01	1	11.11
19129.	Kempo (kempochinois)	9	55.10	63.60	0	0.00
19130.	Kelopio (kelopio)	9	127.15	149.49	4	44.44
19131.	how bad am I (keletheking)	9	77.09	87.22	4	44.44
19132.	Kin (kccchiu)	9	87.65	93.20	2	22.22
19133.	kb (kbaccam)	9	94.78	110.08	4	44.44
19134.	Katie (kaytay0111)	9	100.69	123.25	1	11.11
19135.	kensen (kawatashi)	9	66.25	74.89	1	11.11
19136.	Kavita (kavita_chaubey)	9	45.48	50.76	0	0.00
19137.	Xero (kataclysm)	9	91.38	102.59	3	33.33
19138.	ben (kashikura)	9	49.56	56.28	0	0.00
19139.	kap (kappow)	9	107.99	121.44	5	55.56
19140.	MySpaceBarIsBroken (kanto)	9	117.10	128.74	6	66.67
19141.	kanacurry (kanacurry)	9	104.70	116.92	7	77.78
19142.	Kamiye (kamiye)	9	91.75	101.05	2	22.22
19143.	kamea (kamea)	9	95.58	111.27	2	22.22
19144.	kaka (kakaburra)	9	89.44	102.81	4	44.44
19145.	joy (jyyjng)	9	77.63	88.30	3	33.33
19146.	Ben (jynn7)	9	107.38	127.64	5	55.56
19147.	christine (just_trying_to_g...	9	62.59	77.94	1	11.11
19148.	Justin (justin_ephemeral)	9	101.14	112.54	8	88.89
19149.	John (jspar)	9	92.30	104.97	2	22.22
19150.	jasmine (jsmine)	9	100.76	117.23	1	11.11
19151.	j (jrdib57)	9	105.92	121.59	5	55.56
19152.	Barokah (jowotulen)	9	94.56	102.40	3	33.33
19153.	Josh (joshindahood)	9	92.86	102.89	2	22.22
19154.	José (josehenrique91)	9	61.39	77.13	1	11.11
19155.	joris (jorisss)	9	86.63	96.08	5	55.56
19156.	Jordan (jordansmithnz)	9	81.29	99.18	2	22.22
19157.	Jordi (joorrrrrrrr)	9	58.22	68.81	4	44.44
19158.	Jon (jonlee17)	9	70.51	81.22	3	33.33
19159.	Johann (jona_die_jood)	9	60.50	69.16	0	0.00
19160.	John (jolomaho)	9	59.58	63.47	1	11.11
19161.	Jo (joemamma_38)	9	125.99	144.88	3	33.33
19162.	jnnwn (jnnwn)	9	101.37	108.01	6	66.67
19163.	Jordan (jmoneymyer)	9	67.88	75.83	0	0.00
19164.	Jeremy (jmetzger55)	9	75.99	94.88	1	11.11
19165.	Matin (jivago)	9	63.71	73.39	2	22.22
19166.	Jennifer (jinglebingo)	9	92.53	102.49	3	33.33
19167.	jimmy (jimnish)	9	44.62	49.44	1	11.11
19168.	JIHAD (jihad_14)	9	63.91	68.29	4	44.44
19169.	Jerry (jerry_licious)	9	107.24	114.24	5	55.56
19170.	Jerry (jerry300)	9	77.28	82.85	1	11.11
19171.	jeans (jelowo)	9	72.95	95.07	2	22.22
19172.	Jed (jed_)	9	69.46	78.42	1	11.11
19173.	Jay (jaysalvi)	9	94.18	108.54	2	22.22
19174.	Jayden (jaydensar)	9	96.25	113.87	3	33.33
19175.	jawes (jawes123)	9	97.79	114.78	6	66.67
19176.	jasmine (jasminneee)	9	68.07	73.03	2	22.22
19177.	Jan (janm2001)	9	76.08	87.25	2	22.22
19178.	jam (jamola)	9	101.22	113.25	5	55.56
19179.	James (james000)	9	71.21	80.42	0	0.00
19180.	deskrabbit (jalaymie)	9	74.28	83.95	3	33.33
19181.	jaemy (jaemywest)	9	50.65	57.32	0	0.00
19182.	acjk (jackolant199)	9	69.38	80.23	1	11.11
19183.	Jack (j4ck6643)	9	75.54	82.97	5	55.56
19184.	I3B (i_3b)	9	56.39	62.30	8	88.89
19185.	Eren Yeager (itzadit)	9	65.06	73.43	1	11.11
19186.	Kevin Jeonghun (itskevinjeong)	9	71.94	77.38	5	55.56
19187.	ir4un (ir4un)	9	53.48	67.08	2	22.22
19188.	IQ1537 (iq1537)	9	131.41	146.28	7	77.78
19189.	Libby (inkgenious)	9	68.29	74.25	2	22.22
19190.	Vincent (indronna)	9	82.07	90.70	4	44.44
19191.	imsynthex (imsynthex)	9	77.92	96.36	5	55.56
19192.	aerora (imqyuu)	9	140.41	157.78	9	100.00
19193.	Sam (ilikeyourcutghee)	9	86.16	99.33	2	22.22
19194.	Reece (iifuze)	9	104.45	122.73	4	44.44
19195.	IGO (igo_)	9	65.32	77.18	3	33.33
19196.	Igor (igotim)	9	72.58	80.97	2	22.22
19197.	Icecuber (icecuber)	9	102.37	112.78	3	33.33
19198.	ICANNOTLOSE (icannotlose)	9	134.63	169.24	6	66.67
19199.	konnie (ibeatonwhitewomen)	9	76.58	84.53	3	33.33
19200.	pillows (hyluu)	9	149.61	167.97	8	88.89
19201.	John (hylkinator)	9	108.96	128.62	5	55.56
19202.	HY (hygh)	9	33.02	37.45	0	0.00
19203.	Hunter (hunterup)	9	98.79	106.96	4	44.44
19204.	hunter (hunter667)	9	75.57	86.09	4	44.44
19205.	Vlad (hunter4858)	9	80.93	94.16	1	11.11
19206.	HUng (hunggnuh0407)	9	78.69	93.25	2	22.22
19207.	Who (hunatank)	9	79.83	97.18	1	11.11
19208.	Roni (human_ro)	9	85.21	93.70	7	77.78
19209.	Shohid (humangod)	9	87.06	112.97	2	22.22
19210.	hoku✨ (hokuyato)	9	89.45	96.01	2	22.22
19211.	Van Hoang (hoangelec)	9	92.71	106.70	3	33.33
19212.	Hmed (hmed_belgassem)	9	34.52	38.20	1	11.11
19213.	HiDa (hiida)	9	111.03	129.89	4	44.44
19214.	The (hermaninator)	9	64.91	72.20	4	44.44
19215.	Adrian (hellfi_18)	9	50.07	55.41	3	33.33
19216.	hela (helabwr)	9	49.23	52.41	2	22.22
19217.	healy (healy1453)	9	88.82	101.70	3	33.33
19218.	headtr1p (headtr1p)	9	100.16	118.12	6	66.67
19219.	Typer (haydyn49)	9	77.03	83.65	1	11.11
19220.	Kevin (havek)	9	107.76	119.43	5	55.56
19221.	Taika (hariyoshi41)	9	84.93	92.65	4	44.44
19222.	HARI (hariom_01)	9	49.78	54.01	1	11.11
19223.	harbeanger (harbeanger)	9	97.64	102.42	4	44.44
19224.	Torben (hansi36)	9	62.88	71.73	7	77.78
19225.	Hansel (hansels)	9	65.95	73.11	2	22.22
19226.	Hannah (hannahwagner)	9	82.80	92.61	3	33.33
19227.	Hannah Mei (hannahmei_steury)	9	52.08	64.05	2	22.22
19228.	Michael (hangene92)	9	108.98	128.88	9	100.00
19229.	Hamburgahh (hamburgahh)	9	91.93	108.91	2	22.22
19230.	Gabriel (halamawala)	9	109.15	118.68	5	55.56
19231.	HackzPlayz (hackzplayz)	9	71.99	79.63	3	33.33
19232.	Turkey (habibiturkey)	9	84.09	104.57	5	55.56
19233.	Anakin (gunmoon)	9	97.60	104.53	5	55.56
19234.	Gum (gumwrapper)	9	80.23	85.30	3	33.33
19235.	Kevin (gudern)	9	95.59	119.75	6	66.67
19236.	ed sheeran (guccigangtae)	9	61.50	73.34	0	0.00
19237.	John (gryndal)	9	81.57	88.55	5	55.56
19238.	Alexander Grill (grill__alex)	9	57.13	64.94	1	11.11
19239.	Gribbit (gribbit)	9	60.39	69.26	2	22.22
19240.	Gaby (grebliale)	9	90.58	106.62	3	33.33
19241.	Pandaru (grancrackerr)	9	87.79	97.68	5	55.56
19242.	Vamsi Krishna (gordongecko)	9	71.72	78.42	4	44.44
19243.	Josh (goldfingerer)	9	87.52	98.80	5	55.56
19244.	Nguyen (gohweiz)	9	50.87	70.08	6	66.67
19245.	mike (godlykanadian)	9	81.60	86.07	2	22.22
19246.	GM (gmbao)	9	94.98	104.53	4	44.44
19247.	Letsy (glitchyletsy)	9	70.89	95.09	4	44.44
19248.	glenn (glenneroo)	9	104.33	119.98	7	77.78
19249.	Ghost (gh0st3423)	9	73.09	91.53	2	22.22
19250.	Tamjid (getrektfab)	9	47.59	54.10	2	22.22
19251.	Max (getmackt)	9	80.22	88.06	6	66.67
19252.	Greg (gecko231)	9	89.89	108.17	3	33.33
19253.	Gauley (gauley)	9	70.21	77.94	6	66.67
19254.	Gansukh (gansuh)	9	40.95	48.44	2	22.22
19255.	gamesgant313 (gamesgant313)	9	91.57	112.00	9	100.00
19256.	Gallagher (gallaghercat11)	9	60.49	70.36	1	11.11
19257.	Owen (furyng)	9	65.30	71.37	9	100.00
19258.	Furaha (furfur_beast)	9	71.25	78.95	1	11.11
19259.	Scotty (scoma)	9	104.29	124.69	2	22.22
19260.	Samantha (sbscruton)	9	50.92	59.48	0	0.00
19261.	Kittatro (saysikerightnow)	9	71.67	79.31	2	22.22
19262.	NEM0 (saybloo)	9	97.75	113.64	6	66.67
19263.	grubres (saveall)	9	117.89	128.94	1	11.11
19264.	Saugat (saugat2003)	9	41.90	47.18	0	0.00
19265.	saturn (sat3rns)	9	62.02	79.21	9	100.00
19266.	sasmit_qwerty (sasmit_neogi)	9	83.95	120.35	3	33.33
19267.	Sasha (sasha_satanenko)	9	67.88	80.08	3	33.33
19268.	IDK (sarpain)	9	59.21	64.14	2	22.22
19269.	Phrog (sargent_frog)	9	86.74	138.49	7	77.78
19270.	ChlamydiaHaver (sarcasmx)	9	130.08	137.71	6	66.67
19271.	Saph (saphie)	9	85.38	98.76	4	44.44
19272.	Jose (sand62)	9	65.70	78.27	3	33.33
19273.	sam (samx90s)	9	45.05	53.84	1	11.11
19274.	mikduc (samurai_dodo)	9	76.41	90.47	2	22.22
19275.	sammito1 (sammito1)	9	106.47	115.74	3	33.33
19276.	Samuel (sambg)	9	100.49	109.81	6	66.67
19277.	ahmed (sakakill)	9	48.93	53.72	0	0.00
19278.	sahil (sahil9057)	9	57.70	68.34	1	11.11
19279.	Sahil (sahilmandoliya)	9	45.37	53.15	0	0.00
19280.	James (sagpro_23)	9	73.62	80.70	2	22.22
19281.	Saeed (saeed247)	9	70.17	83.12	2	22.22
19282.	suki (sackclothandashes)	9	99.51	110.88	2	22.22
19283.	Guo (s9723)	9	58.50	66.42	1	11.11
19284.	siddhanth (s1ddhxnth)	9	69.08	79.43	2	22.22
19285.	A (russ1anrock3t)	9	84.38	95.63	9	100.00
19286.	Roi (rugh)	9	65.92	72.25	2	22.22
19287.	Ethan (rtdrtd)	9	117.42	132.54	3	33.33
19288.	Robert (rpmulligan)	9	86.65	105.40	1	11.11
19289.	Yash (royal_ralhi)	9	28.17	33.08	2	22.22
19290.	Changnam (rotoflemf)	9	55.50	60.24	1	11.11
19291.	Roshan (roshan_)	9	73.57	88.07	4	44.44
19292.	Ultralord (ronelijahruiz)	9	98.31	119.82	2	22.22
19293.	Callum (rockwallaby)	9	51.39	59.32	0	0.00
19294.	Alessandro (rocchia)	9	80.82	94.54	2	22.22
19295.	Ronald (roanlds12345)	9	91.50	102.23	3	33.33
19296.	Quang Trung (rikateamovt1)	9	69.27	76.74	3	33.33
19297.	Richard (richyk1)	9	95.96	111.11	3	33.33
19298.	Rice (rice363)	9	86.16	92.56	3	33.33
19299.	rhyno3d (rhyno3d)	9	92.50	110.80	6	66.67
19300.	Randy (rhomusic)	9	96.62	104.47	4	44.44
19301.	Tyler (rhodetyl000)	9	79.18	82.95	5	55.56
19302.	rhinoracer (rhinoracer)	9	46.84	51.71	1	11.11
19303.	Keyan (rezor)	9	95.16	110.85	6	66.67
19304.	Zhaparka (retsinnal)	9	47.80	57.95	0	0.00
19305.	Red (redsharp)	9	69.27	85.58	3	33.33
19306.	Redox (redox_p)	9	96.58	109.27	2	22.22
19307.	Raostrich (raostrich)	9	87.82	98.57	2	22.22
19308.	Rafa (rafimm)	9	41.68	50.41	2	22.22
19309.	S3LVA (r06ramanat)	9	76.74	81.92	4	44.44
19310.	qwerty443 (qwerty443)	9	46.58	54.27	1	11.11
19311.	Quzrin (quzrin)	9	99.10	107.09	2	22.22
19312.	qusdty (qusdty)	9	36.51	43.04	1	11.11
19313.	Quer (queroin)	9	61.91	83.24	0	0.00
19314.	hand (quarterpastnine)	9	119.33	129.45	5	55.56
19315.	quackstuff (quackstuff)	9	84.67	87.80	3	33.33
19316.	Riley (qpixel)	9	92.24	101.64	3	33.33
19317.	Pupill (pupill)	9	63.64	71.95	7	77.78
19318.	Puleva (puleva)	9	77.33	93.73	2	22.22
19319.	Tom (pugsay)	9	92.57	101.92	2	22.22
19320.	pudge (pudge_phatt)	9	90.53	100.48	4	44.44
19321.	Proxima (proxima009)	9	62.27	66.39	4	44.44
19322.	Protik (protiknag)	9	59.13	67.77	0	0.00
19323.	David (prosic723)	9	49.56	53.39	0	0.00
19324.	Project (project_racer)	9	103.99	121.45	6	66.67
19325.	Kasper (probablykasper)	9	95.43	104.78	4	44.44
19326.	Powerid (poweriddd)	9	85.93	97.13	3	33.33
19327.	Matthew (potqto)	9	87.28	102.53	1	11.11
19328.	Potate (potatocloud)	9	64.00	69.77	2	22.22
19329.	bill nye (pokepo6)	9	91.52	103.48	2	22.22
19330.	p (poke1)	9	153.24	171.45	9	100.00
19331.	plupl (pluppypluplplupus)	9	72.13	88.91	1	11.11
19332.	Plommon (plommon)	9	98.81	108.22	4	44.44
19333.	PKDDDroid (pkdddroid)	9	79.21	88.71	3	33.33
19334.	egg (pipidozer)	9	63.86	76.25	2	22.22
19335.	Nathan (pimpleton)	9	106.14	127.60	2	22.22
19336.	pigeonistic (pigeonistic)	9	121.98	133.64	6	66.67
19337.	K (phua8686)	9	50.39	54.70	0	0.00
19338.	Amangus (phsycomonkek1)	9	81.66	91.47	3	33.33
19339.	Phoebe (phoebek99)	9	91.79	113.15	5	55.56
19340.	Peyton (peytondk)	9	102.21	112.74	9	100.00
19341.	Pernesz (pery)	9	81.24	95.08	5	55.56
19342.	penguiny2001 (penguiny2001)	9	98.61	106.98	4	44.44
19343.	Peak (peak_dvorak)	9	114.77	139.35	9	100.00
19344.	Pcgnome (pcgnome)	9	95.14	115.51	5	55.56
19345.	Tappy_333 (pat29403)	9	65.96	73.36	2	22.22
19346.	Brendan (partyhipster)	9	108.85	127.06	6	66.67
19347.	Gaurav (parthbudds)	9	68.18	76.20	2	22.22
19348.	Parhy (parhy)	9	94.45	108.99	3	33.33
19349.	Max (parabalt)	9	99.12	120.18	6	66.67
19350.	JazzyP (pandawarrior101)	9	92.35	109.71	0	0.00
19351.	Gabriel Owen (owen2)	9	40.64	48.23	2	22.22
19352.	OMG (omgawannabe)	9	92.45	103.01	6	66.67
19353.	Daniel (omegadan_)	9	78.89	89.95	2	22.22
19354.	Paolo (oloapss)	9	78.26	95.17	5	55.56
19355.	Oliver (oliver_22_11)	9	42.50	46.92	3	33.33
19356.	🦈 (okamiro)	9	55.77	63.11	2	22.22
19357.	Ohad (ohadshwartzman)	9	94.91	114.46	2	22.22
19358.	totnamjoon (off_the_page)	9	81.30	90.70	2	22.22
19359.	yellow car (oddsorcery)	9	99.55	109.44	9	100.00
19360.	iGeo (oddhampton)	9	76.54	81.87	1	11.11
19361.	Plato (observer_02)	9	103.20	114.06	5	55.56
19362.	XxBairyHallsxX (nwalker1129)	9	113.63	135.62	3	33.33
19363.	Tushar (nutzingfork)	9	28.72	39.76	0	0.00
19364.	Riley (nulll)	9	91.82	105.29	4	44.44
19365.	Nullius (nullius)	9	58.93	63.36	2	22.22
19366.	Anh (nta1207)	9	92.77	99.75	4	44.44
19367.	Novotny (novynevi)	9	63.66	75.49	2	22.22
19368.	Minideez (novadeez)	9	50.22	58.49	1	11.11
19369.	Nour (nourokbi)	9	44.63	54.69	2	22.22
19370.	Elvis (noratic)	9	108.39	128.23	3	33.33
19371.	brendi (noobgodbrendi)	9	59.61	75.59	2	22.22
19372.	Noober (noobest_noober)	9	103.85	129.11	4	44.44
19373.	(nonquitwarrior)	9	114.25	146.90	3	33.33
19374.	whutthiphon (nongmai)	9	26.95	31.02	0	0.00
19375.	nikole (nmkxos)	9	46.03	53.71	2	22.22
19376.	Nicholas (nkt8256)	9	113.08	130.31	3	33.33
19377.	njwn (njwnsr)	9	73.71	80.62	2	22.22
19378.	Nikolaj (nikolaj808)	9	88.68	95.72	2	22.22
19379.	Roberto (neowolf)	9	79.26	89.16	4	44.44
19380.	Neo-lap (neolaptop)	9	80.36	100.56	1	11.11
19381.	Roland (nemvagyokolyangyors)	9	70.20	80.93	2	22.22
19382.	NEKROME2.0 (nekrometwo)	9	60.66	69.28	4	44.44
19383.	Name (needevidence)	9	114.72	134.44	2	22.22
19384.	Nawfox (nawfox)	9	72.60	76.53	3	33.33
19385.	cryptid (naturalcryptid)	9	145.91	174.37	8	88.89
19386.	Existential Explorer (natmac4)	9	91.62	110.65	3	33.33
19387.	Natalie (natatat48)	9	73.30	87.92	0	0.00
19388.	nat2980 (nat2980)	9	65.32	76.01	1	11.11
19389.	Nasos (nasos2311)	9	76.86	88.92	2	22.22
19390.	Nan (nantuzi)	9	88.35	96.68	3	33.33
19391.	naman (naman14)	9	60.78	71.23	1	11.11
19392.	Nabalazs (nabalazs)	9	68.39	78.04	3	33.33
19393.	Mystree (mystree)	9	86.20	96.90	4	44.44
19394.	Cyberbullet (mstfelq)	9	83.06	98.49	4	44.44
19395.	Mr (mrghost_yes)	9	65.82	71.83	3	33.33
19396.	Amar (mrfartboss)	9	80.11	96.47	7	77.78
19397.	Simon (mosie)	9	45.20	53.26	3	33.33
19398.	Morshedul (morshedul)	9	36.48	40.19	0	0.00
19399.	sadaf (morphinefather)	9	88.59	117.71	4	44.44
19400.	Rosewill RK-9000V2 (morphin...	9	111.91	128.04	3	33.33
19401.	moonlight (moonlight_21)	9	87.94	103.69	5	55.56
19402.	monster (monster)	9	115.57	134.20	5	55.56
19403.	Monotype2 (monotype2)	9	83.31	101.23	7	77.78
19404.	Fickle (mongolo123)	9	104.96	119.91	2	22.22
19405.	Nate (mmmcac)	9	59.89	68.24	1	11.11
19406.	mllm (mllm1771)	9	57.42	75.24	0	0.00
19407.	Michelle (mktsoprano2)	9	103.87	111.62	6	66.67
19408.	Muhammed Murad (mkmusafir)	9	49.51	56.04	1	11.11
19409.	diya (mixxanber)	9	134.14	167.32	6	66.67
19410.	SystemOfAKitty (mischi334)	9	84.72	95.01	1	11.11
19411.	Mis (miscellaneous)	9	74.27	100.99	1	11.11
19412.	Miranite (Dvorak) (miranite)	9	105.06	125.42	9	100.00
19413.	Kaan (mirackhle)	9	53.54	64.81	2	22.22
19414.	Mayank (minkk777)	9	87.71	99.60	3	33.33
19415.	Jonathan (minifoke)	9	55.09	63.01	0	0.00
19416.	Miki (miki888)	9	89.58	93.47	2	22.22
19417.	Michael (michaeleh_colemak)	9	69.06	77.07	3	33.33
19418.	Hai (michaeldp)	9	77.76	84.77	3	33.33
19419.	Mevin (mevinn)	9	75.37	87.74	3	33.33
19420.	metrodous (metrodous_yt_6)	9	72.42	89.79	3	33.33
19421.	biggestkrug139 (mentalpatient)	9	129.52	145.36	6	66.67
19422.	melvynAIDS (melvynaids)	9	92.76	104.00	5	55.56
19423.	Matthew (meloooche)	9	82.79	92.65	4	44.44
19424.	Oleg (meidebshy)	9	31.40	36.86	1	11.11
19425.	Mohit (meeoww)	9	53.90	65.82	1	11.11
19426.	Michael (mdstumpfy123)	9	84.59	91.61	4	44.44
19427.	Marcus (mckhaann)	9	78.58	88.93	2	22.22
19428.	M (mchang416)	9	92.14	103.23	2	22.22
19429.	maxigus (maxigus_mcfly)	9	99.46	109.39	6	66.67
19430.	maxf (maxf8)	9	87.51	100.12	5	55.56
19431.	Alex (maveriiic)	9	67.25	72.41	1	11.11
19432.	Matthew (matty_venus)	9	75.69	88.12	2	22.22
19433.	Mat (matrix303)	9	74.34	84.46	2	22.22
19434.	Henry (matrixial)	9	103.27	123.43	5	55.56
19435.	Made Dandy (mathzie)	9	65.31	77.06	3	33.33
19436.	harih (masterharish)	9	57.17	64.92	4	44.44
19437.	Oyo (marauder316)	9	64.47	71.11	2	22.22
19438.	MangalicA (mangalica)	9	64.99	78.08	1	11.11
19439.	steff (_stuf)	9	114.16	129.16	5	55.56
19440.	Iftekharul (_sayeed)	9	66.07	88.91	2	22.22
19441.	Kuna (_kuna)	9	85.54	96.44	2	22.22
19442.	Adam (_adam_bomb)	9	60.48	66.79	1	11.11
19443.	Zven (zven69)	9	109.96	135.73	6	66.67
19444.	Daniel (zuse90)	9	61.38	67.11	2	22.22
19445.	Violet (znn7)	9	56.76	64.14	2	22.22
19446.	adam (zingerbox460)	9	92.88	106.40	4	44.44
19447.	zien (ziensoo)	9	50.06	54.64	2	22.22
19448.	zenzurie (zenzurie)	9	58.53	65.35	2	22.22
19449.	Stefan (zekan)	9	100.55	112.93	3	33.33
19450.	boris (zekaida)	9	98.71	106.91	1	11.11
19451.	Zia (zeeya)	9	115.44	139.04	4	44.44
19452.	Zed (zed_op)	9	29.98	33.93	2	22.22
19453.	Naz (zdkraner)	9	77.21	93.95	1	11.11
19454.	Yxjou (yxjou)	9	44.13	51.90	0	0.00
19455.	💎 (yx3_darya)	9	83.02	96.36	3	33.33
19456.	Alan (yuzhi)	9	84.90	99.45	1	11.11
19457.	Yuki (yukisitu)	9	88.45	111.39	5	55.56
19458.	Yuich (yuichi123)	9	67.71	80.79	2	22.22
19459.	Ryan (ysys9)	9	83.18	93.44	5	55.56
19460.	Jarek (yorrickus)	9	77.96	85.98	5	55.56
19461.	Yuvraj (yoowee)	9	47.89	52.61	3	33.33
19462.	zahra (yoonoh)	9	73.93	85.12	6	66.67
19463.	Yo (yongb)	9	68.86	82.26	2	22.22
19464.	Yash (yomat)	9	75.98	84.35	2	22.22
19465.	ben (yngtwbabd)	9	94.56	100.70	2	22.22
19466.	STONES (yiminggg)	9	90.71	103.38	3	33.33
19467.	Andrew (yertssbm)	9	123.44	135.13	6	66.67
19468.	Korey (yellowdozer)	9	105.45	116.58	2	22.22
19469.	Yams (yams_)	9	56.25	62.87	1	11.11
19470.	Yamajac (yamajac)	9	153.74	166.82	0	0.00
19471.	yaeda (yaeda)	9	100.09	110.97	4	44.44
19472.	Josh (xxldaddy69)	9	132.97	139.32	9	100.00
19473.	cope (xucolite)	9	90.05	105.69	3	33.33
19474.	John (xtrospective)	9	54.54	63.01	1	11.11
19475.	Evan (xtremeelectrix)	9	109.03	128.53	4	44.44
19476.	Ray (xray2)	9	109.62	118.72	1	11.11
19477.	Swaggy (xiarnaq)	9	134.08	172.10	8	88.89
19478.	Tony (xiao_hong)	9	61.82	70.94	0	0.00
19479.	Xetin (xetin)	9	100.58	117.42	1	11.11
19480.	xavier (xavieregan)	9	49.24	53.80	5	55.56
19481.	Turtle (xarenox)	9	94.94	109.38	8	88.89
19482.	Willem (woosterum)	9	40.55	53.05	0	0.00
19483.	Woffy (woffy888)	9	83.42	110.18	6	66.67
19484.	William (wmilberry)	9	81.30	90.18	0	0.00
19485.	M&W (wmichaelwhitlock)	9	108.99	129.85	4	44.44
19486.	Tate (wizard5)	9	56.73	65.88	2	22.22
19487.	48%SuicideRate (wint4r)	9	120.22	144.87	9	100.00
19488.	Ryan (wilderrw)	9	84.98	105.01	2	22.22
19489.	wiku (wiku025)	9	64.15	73.00	4	44.44
19490.	Victor (whitenecro21)	9	93.10	100.26	2	22.22
19491.	samantha (whalieninluv)	9	104.84	112.79	6	66.67
19492.	Jake (wetfart1738)	9	63.58	71.90	4	44.44
19493.	werdnalliw (werdnalliw)	9	80.71	97.37	3	33.33
19494.	William (wei9798)	9	73.47	79.52	1	11.11
19495.	William (wazambelina)	9	77.33	83.45	2	22.22
19496.	wabdeali (wabdeali)	9	99.11	116.19	2	22.22
19497.	Vyas (vyas_123)	9	105.88	125.94	4	44.44
19498.	Vrum (vrumvrum56)	9	65.28	73.57	0	0.00
19499.	dunno (vokunsahvoz)	9	36.44	40.66	1	11.11
19500.	Viktor (vixtorr)	9	65.62	76.38	6	66.67
19501.	Vipul (vipulr)	9	80.01	100.98	4	44.44
19502.	Vinson (vinsonbudiman)	9	76.07	92.56	1	11.11
19503.	Victor (victorfaarvang)	9	100.62	121.34	1	11.11
19504.	Peter (vettel_)	9	69.61	73.17	4	44.44
19505.	Vertennn (vertennn_)	9	100.02	112.50	6	66.67
19506.	d'un vecchio caminetto inga...	9	119.41	134.34	5	55.56
19507.	Vitalie (veeveeoh)	9	43.27	53.45	1	11.11
19508.	Giovanni (vecchiogio)	9	58.14	67.38	1	11.11
19509.	BJ (unusualgoose)	9	69.56	82.01	1	11.11
19510.	James (unbranded)	9	127.86	142.50	8	88.89
19511.	ultraXD (ultragamersss)	9	99.44	109.42	2	22.22
19512.	Ultraa (ultrabladez)	9	59.75	73.02	2	22.22
19513.	UltimaticCatz (ultimaticcatz)	9	78.20	97.07	6	66.67
19514.	Jason (ultimatehumungousaur)	9	89.93	96.32	5	55.56
19515.	Toby (ueue_)	9	84.40	102.87	6	66.67
19516.	Ucheely (ucheely)	9	124.10	134.89	4	44.44
19517.	McClout (type_69_master)	9	96.84	117.44	6	66.67
19518.	Johannes (typerjojo)	9	70.83	83.59	0	0.00
19519.	TyperDood (typerdoodz)	9	103.60	113.13	2	22.22
19520.	Steven (txp2037)	9	65.38	78.27	3	33.33
19521.	tuvumba (tuvumba)	9	61.07	66.94	7	77.78
19522.	Tubby (tubbsters)	9	141.61	160.84	8	88.89
19523.	Joshua (ttemingyu)	9	111.78	138.65	4	44.44
19524.	Meinte (trinityy6)	9	61.11	69.72	3	33.33
19525.	Trial (trial_name)	9	69.09	84.44	2	22.22
19526.	Trevor (trev_23)	9	72.47	90.02	0	0.00
19527.	shashank (trash_typer_74)	9	64.28	73.35	2	22.22
19528.	Antonín (toniczech)	9	59.90	65.92	2	22.22
19529.	Tom (tom020900)	9	91.79	99.17	3	33.33
19530.	Tode (todengaard)	9	126.07	146.45	8	88.89
19531.	Tinh (tinh1000000)	9	89.54	97.70	4	44.44
19532.	Tina (tinangu272)	9	89.48	97.19	3	33.33
19533.	Tino (timppara)	9	77.22	92.41	1	11.11
19534.	Edwin Chiriboga (tilt_ed)	9	61.23	72.37	0	0.00
19535.	trash (thiccumthebig)	9	52.68	64.20	0	0.00
19536.	ReRo (the_rero)	9	72.45	92.42	3	33.33
19537.	Max (the_maxinater)	9	63.79	72.65	2	22.22
19538.	Brandon (theyimi)	9	101.56	112.39	4	44.44
19539.	Emery (thetruffinmuffin)	9	53.73	61.37	1	11.11
19540.	Henri (therealkanyeeast)	9	113.08	129.45	3	33.33
19541.	pbj (thepbj)	9	59.65	75.79	2	22.22
19542.	TheMates (themates)	9	43.33	52.72	0	0.00
19543.	M (thefastlightningtyper)	9	78.25	89.43	4	44.44
19544.	ThatCoolCoder (thatcoolcoder)	9	91.73	104.25	2	22.22
19545.	Ethan (thandrew)	9	68.39	84.41	2	22.22
19546.	Leo (teslaomega)	9	71.91	83.98	3	33.33
19547.	Teriyaki (teriyaki03)	9	92.49	104.13	0	0.00
19548.	taramysh (tentech)	9	49.66	55.46	3	33.33
19549.	Mark (tenseimaa)	9	90.91	100.79	1	11.11
19550.	tasha (tbrown_89)	9	98.63	115.30	4	44.44
19551.	Sebastian (tbgseb)	9	70.92	80.55	3	33.33
19552.	Eren Yeager (tarzan_19)	9	53.60	62.16	2	22.22
19553.	Kevin (taow)	9	102.84	108.55	4	44.44
19554.	Tanuj (tanuj23)	9	105.30	114.20	4	44.44
19555.	Tanamr (tanamr)	9	99.71	106.19	5	55.56
19556.	Kevin (tactictorn)	9	111.81	122.55	6	66.67
19557.	S Aditya (s_aditya)	9	60.40	63.90	2	22.22
19558.	Vroom (synphade)	9	85.87	96.27	2	22.22
19559.	ok doinb (superex23)	9	85.24	89.81	3	33.33
19560.	supe (supe56)	9	83.20	93.63	5	55.56
19561.	Jordan (sugarytaco)	9	82.39	99.03	8	88.89
19562.	NO ONE (subhroxeon)	9	86.74	103.14	1	11.11
19563.	Sterling (stvrling)	9	89.38	103.97	5	55.56
19564.	Ahri (strylas)	9	104.01	125.85	4	44.44
19565.	Strike (strike_elite)	9	103.08	116.86	3	33.33
19566.	JL (strikewolfgg)	9	116.34	134.28	5	55.56
19567.	Stretch (stretch_flex)	9	77.88	87.90	2	22.22
19568.	stream (stream_cipher)	9	48.16	61.11	1	11.11
19569.	Stefarno (stefarno)	9	48.32	58.00	1	11.11
19570.	Stefan (stefan_t)	9	117.11	128.66	7	77.78
19571.	Steel (steeltissue)	9	80.74	92.51	2	22.22
19572.	Steady (steady32)	9	80.61	90.08	2	22.22
19573.	Stanley (stanley_gogo)	9	56.14	68.06	1	11.11
19574.	Josh (standedjoshh)	9	80.65	99.62	8	88.89
19575.	St1nk (st1nkk)	9	63.29	78.74	4	44.44
19576.	joni (squire2264)	9	86.17	92.80	2	22.22
19577.	Kimikazee (squalo101)	9	102.93	121.14	4	44.44
19578.	Rafael (spyhard12)	9	114.84	132.90	6	66.67
19579.	Jim (sprinks41)	9	80.55	93.60	2	22.22
19580.	shaq$ (springrollgod)	9	82.82	93.87	4	44.44
19581.	Ayush Hazarika (ayush_hazar...	9	42.55	49.71	0	0.00
19582.	Peter (speedyboi95)	9	91.97	115.19	5	55.56
19583.	John (speedking456)	9	86.76	102.05	3	33.33
19584.	Sourav (souravdey_1)	9	32.78	37.54	1	11.11
19585.	xy (soox0001)	9	86.47	113.42	3	33.33
19586.	Someone (someonetyping)	9	90.51	101.64	1	11.11
19587.	UnoriginalName (someguywhoh...	9	100.91	121.82	8	88.89
19588.	Marcus (snuskbulle)	9	87.36	97.23	2	22.22
19589.	Snafu (snafudk)	9	92.25	104.17	3	33.33
19590.	Sam (smtype100)	9	94.40	104.50	4	44.44
19591.	spoon (smallspoon)	9	85.95	109.88	4	44.44
19592.	Phuong Anh (smallcat2020)	9	45.14	50.55	6	66.67
19593.	smakkacow (smakkacow)	9	70.71	77.11	0	0.00
19594.	Slow Spider (slow_spider)	9	58.08	64.00	0	0.00
19595.	ur (slowtyperfromcz)	9	59.04	65.63	3	33.33
19596.	snail_twin_turbo (sloth_99)	9	54.73	59.47	1	11.11
19597.	Simonas (slapukas321)	9	55.81	66.77	1	11.11
19598.	Shadow (skyronman)	9	71.79	82.75	3	33.33
19599.	SkillfulRheyme4 (skillfulrh...	9	55.88	71.53	2	22.22
19600.	Luis (siulul)	9	60.73	71.15	2	22.22
19601.	René (sirrene)	9	76.93	90.16	9	100.00
19602.	$ (sirenss)	9	124.44	134.81	3	33.33
19603.	Sioun (sioun)	9	94.99	102.81	4	44.44
19604.	Sindre| (sinros01)	9	63.87	71.75	5	55.56
19605.	Sindri (sindri300)	9	72.91	81.04	4	44.44
19606.	Silk (silkdragon)	9	50.79	58.69	2	22.22
19607.	⁶⁶⁶ (siign)	9	93.48	98.48	3	33.33
19608.	Siddharth28 (siddharth28)	9	49.75	71.43	1	11.11
19609.	Shubham (shubham_112013)	9	61.53	65.26	0	0.00
19610.	Glenn (shroom_slice)	9	73.26	92.67	3	33.33
19611.	shrimp (shrimpcraackers)	9	64.52	69.11	2	22.22
19612.	Nate (shortysama)	9	63.38	70.06	3	33.33
19613.	Marcus (shock598x)	9	85.68	106.34	3	33.33
19614.	Ab (shk_faysal)	9	57.91	66.70	3	33.33
19615.	sarthak (shivasarthak)	9	48.28	61.59	0	0.00
19616.	karim (shinobikarim)	9	44.35	51.56	2	22.22
19617.	Nathan (sharkking487)	9	81.45	95.08	6	66.67
19618.	Khalilur (shafiq_02)	9	41.05	50.25	1	11.11
19619.	Luke (sfv_)	9	88.99	95.80	3	33.33
19620.	Shay (sewer_rat)	9	103.76	111.01	4	44.44
19621.	Accuracy (servesh)	9	67.74	84.12	1	11.11
19622.	Sergio (sergiorbuge)	9	115.34	129.98	7	77.78
19623.	Serenitea (serenitea)	9	91.19	102.50	3	33.33
19624.	Patrick (senseiblaze)	9	78.79	94.77	0	0.00
19625.	Bobby (senseibets)	9	86.17	103.15	4	44.44
19626.	Player (sellnox)	9	71.41	77.53	2	22.22
19627.	see you dont bump his head ...	9	86.53	96.00	5	55.56
19628.	Ginger (seanwho42)	9	68.93	84.94	2	22.22
19629.	Sean (seanshawn198)	9	132.20	146.32	8	88.89
19630.	Saral (scrummaster)	9	71.49	78.66	2	22.22
19631.	Reynaldi (script303)	9	103.33	120.34	3	33.33
19632.	Nate (scourse)	9	65.15	78.22	0	0.00
19633.	Cam (archlinuxuser)	9	71.92	81.60	3	33.33
19634.	Aqualuma (aqualuma1)	9	97.17	114.43	3	33.33
19635.	APR (apr_fernando)	9	39.01	48.84	2	22.22
19636.	Alexandre (apeloquin)	9	50.28	55.18	0	0.00
19637.	Anthony (anto_onwuka)	9	87.36	92.89	1	11.11
19638.	Anton (antonidas)	9	66.98	73.92	3	33.33
19639.	Benedek (antokben)	9	78.04	89.53	4	44.44
19640.	ante321 (ante321)	9	43.87	48.62	1	11.11
19641.	Anoop (anooprajreddym)	9	49.42	62.38	1	11.11
19642.	Anmol (anmolmb)	9	37.76	47.07	1	11.11
19643.	Aniket (aniiket)	9	66.55	69.93	3	33.33
19644.	jon (angbunehneh)	9	71.18	79.16	3	33.33
19645.	anepik (anepik)	9	84.90	101.51	7	77.78
19646.	𝐃𝐫𝐞𝐰 (andreanfi...	9	65.91	78.16	3	33.33
19647.	Andi (andi_m)	9	47.48	54.84	2	22.22
19648.	Someone (anamedplayer)	9	92.43	99.23	4	44.44
19649.	zzzzz (amzzzz771)	9	75.58	91.75	0	0.00
19650.	Amy (amy159)	9	94.55	109.66	6	66.67
19651.	Seeker (amer1996)	9	28.96	31.71	2	22.22
19652.	AmbrosiA (ambrosialeeann)	9	62.39	70.58	2	22.22
19653.	Amazing (amazinghedgehog)	9	115.15	137.85	7	77.78
19654.	Amal (amal_ronak)	9	81.72	97.50	6	66.67
19655.	Aluumina (aluumina)	9	73.48	84.41	1	11.11
19656.	Jason (altaria13)	9	102.03	114.65	3	33.33
19657.	František (alphabettt)	9	61.16	73.38	1	11.11
19658.	Nelson (alkatzer)	9	85.85	98.98	2	22.22
19659.	alixsch (alixsch)	9	62.77	76.70	5	55.56
19660.	Ali (alimann)	9	39.43	48.29	6	66.67
19661.	Alfredo (alfredosojr)	9	77.07	96.34	0	0.00
19662.	Alex (alextheo)	9	59.94	66.13	1	11.11
19663.	Alek (alexno)	9	54.47	58.19	0	0.00
19664.	Alex (alexdaguy)	9	89.49	105.29	1	11.11
19665.	Hadi (alcatroz)	9	98.91	107.61	6	66.67
19666.	ALAKI (alaki_uka)	9	54.03	68.52	1	11.11
19667.	Akshay (akshay2604)	9	62.13	78.22	3	33.33
19668.	Pash (akratics)	9	54.41	68.42	1	11.11
19669.	Sheeky (akiyoto)	9	69.29	80.79	3	33.33
19670.	Akshay (ak63)	9	34.58	43.64	2	22.22
19671.	aj (ajpingol)	9	94.63	118.95	8	88.89
19672.	Ajim (ajimgram)	9	24.64	30.69	1	11.11
19673.	Sinon (ajey_de_shadow)	9	88.02	94.17	3	33.33
19674.	Corgious (aiwoon)	9	58.98	65.71	1	11.11
19675.	Airree (airree)	9	75.81	81.59	4	44.44
19676.	aidil (aidilqayyim)	9	81.42	91.31	0	0.00
19677.	Agah (agah)	9	52.13	56.95	1	11.11
19678.	Becz (adosz_56)	9	43.41	52.12	0	0.00
19679.	Shadab (acclr8)	9	77.43	86.85	4	44.44
19680.	Alex (abohac99)	9	57.09	63.74	2	22.22
19681.	ab (abhi800)	9	55.74	67.88	0	0.00
19682.	Aarohi (aarohi24)	9	50.30	59.76	2	22.22
19683.	Alex (aalleexx1)	9	46.38	56.81	0	0.00
19684.	Ocean (975miles)	9	81.04	87.61	0	0.00
19685.	Parikshit (7767064953)	9	64.27	73.04	2	22.22
19686.	74R45 (74r45)	9	112.46	139.83	4	44.44
19687.	AJ (5onn)	9	84.75	96.37	2	22.22
19688.	WeiChen (50wpmbtw)	9	80.51	92.35	4	44.44
19689.	jck (404jmre)	9	99.17	108.03	6	66.67
19690.	3DegreeK (3degreek)	9	82.04	87.24	2	22.22
19691.	32587 (32587cj)	9	78.13	85.48	2	22.22
19692.	Amelia (2sidedpolygon)	9	111.51	126.33	6	66.67
19693.	mike (1749mike)	9	66.50	84.60	3	33.33
19694.	Andrew (10001k)	9	79.57	91.21	2	22.22
19695.	Rory (typertypertyping)	9	62.40	75.19	3	33.33
19696.	shmuck (devrajwashereyt)	9	72.52	90.81	8	88.89
19697.	Sophie (milk8080)	9	62.81	75.51	2	22.22
19698.	woken (lofineedmint)	9	92.28	116.98	1	11.11
19699.	Sadge (sadge_da_amateur)	9	89.60	100.50	3	33.33
19700.	plusp (plusp)	9	45.95	52.61	2	22.22
19701.	marshal (marshalstrakencz)	9	44.13	55.50	4	44.44
19702.	harith (hrthtypo_310)	9	47.91	56.71	1	11.11
19703.	Nick (flakesflakes)	9	77.25	89.21	7	77.78
19704.	Red. (yesbutactuallyno21)	9	78.96	105.33	3	33.33
19705.	A (traplordadan)	9	118.83	132.24	6	66.67
19706.	tstats[annapal_9288] (annap...	9	60.31	78.70	9	100.00
19707.	Speeps (keyzkieidan)	9	74.65	86.29	5	55.56
19708.	bry400 (andromeda64)	9	80.91	93.00	2	22.22
19709.	Petrowl (rainspringwell)	9	45.95	49.96	0	0.00
19710.	Paige (twtvpaigelol)	9	149.65	168.04	5	55.56
19711.	Michał (michal2287)	9	79.50	92.87	3	33.33
19712.	Jason (hhheeeelllpppp)	9	74.97	84.89	4	44.44
19713.	Manish (manish_17)	9	81.20	99.02	0	0.00
19714.	Shokhrukhbek (incredible_sy)	9	60.25	66.15	1	11.11
19715.	Mellow (mellophor)	9	81.48	91.67	2	22.22
19716.	Yiyang (applehuner)	9	102.03	112.22	3	33.33
19717.	Variares (variares)	9	59.45	64.76	0	0.00
19718.	RyderWxnted#5380 (ryderwxnted)	9	84.58	106.36	2	22.22
19719.	Madeline (madee0325)	9	98.94	118.86	5	55.56
19720.	elliellielliellie (eventual...	9	69.56	79.34	2	22.22
19721.	Taki (patini)	9	62.30	71.21	2	22.22
19722.	junhan (junhanlee)	9	52.93	59.38	0	0.00
19723.	Elah (elaaaaah)	9	66.01	74.52	1	11.11
19724.	Justin Thomas (justin_bijoy)	9	56.50	62.13	1	11.11
19725.	Jonathan (leadsaf11)	9	98.19	118.77	4	44.44
19726.	Pco (pcorow)	9	66.43	74.67	3	33.33
19727.	masderryl (masderryl)	9	50.04	57.95	1	11.11
19728.	Rūdolfs (rudolfs_w)	9	34.86	37.27	0	0.00
19729.	EpikHerolol (epikherolol)	9	57.15	63.77	4	44.44
19730.	Isaac (iceman8083)	9	60.14	71.66	3	33.33
19731.	Chandramouli (chandramoulig)	9	44.47	55.35	1	11.11
19732.	ChoweeXCookie1879 (dojapusa...	9	44.72	49.55	1	11.11
19733.	lol (moto31005)	9	76.00	88.57	3	33.33
19734.	Jupp (cryt4x)	9	52.14	58.27	2	22.22
19735.	Upsideman (upsideman)	9	73.09	85.99	2	22.22
19736.	Saleh (salahiano)	9	53.91	60.99	0	0.00
19737.	lieky (liekyw)	9	69.19	76.86	0	0.00
19738.	Tudor (lad23)	9	67.02	78.82	1	11.11
19739.	Wouter (walterdankers)	9	84.03	96.06	1	11.11
19740.	Donn (dickies1)	9	49.39	57.72	1	11.11
19741.	Zack (kazsz)	9	90.81	101.78	3	33.33
19742.	Aaditys (aadityagiri_bis)	9	57.98	64.83	1	11.11
19743.	svetina (hotxpuns)	9	81.14	98.30	4	44.44
19744.	BQ (bayanda)	9	47.53	62.65	4	44.44
19745.	Robert (robmal1)	9	73.10	79.43	2	22.22
19746.	Blabbermouth (blabbermouth_)	9	74.74	88.71	3	33.33
19747.	Ryan (rns86)	9	89.46	111.38	3	33.33
19748.	Sherwin (sherwin_24)	9	39.35	46.80	3	33.33
19749.	Mary (kassywithac)	9	57.31	64.90	0	0.00
19750.	Amisently (amisently)	9	106.80	127.99	6	66.67
19751.	b1nga (b1nga)	9	75.03	94.37	3	33.33
19752.	johnlex1k (dark_eclipse)	9	57.91	70.37	1	11.11
19753.	Brandon (2fasteyes)	9	78.89	86.87	2	22.22
19754.	Bloppy (smurfy_03)	9	47.21	51.08	0	0.00
19755.	Antoine (loser3172)	9	75.32	93.00	2	22.22
19756.	Kazzzi (kazzzi)	9	26.58	31.18	1	11.11
19757.	Joey (lashawna)	9	77.95	89.61	2	22.22
19758.	Yeah (donojang)	9	126.68	139.17	5	55.56
19759.	Alec (alec935)	9	84.43	93.06	2	22.22
19760.	coastal (coastalrookie)	9	78.91	96.56	4	44.44
19761.	Washdude7 (yashvarde)	9	80.15	90.40	5	55.56
19762.	Blue (blueballerz)	9	62.78	76.24	4	44.44
19763.	Noobbkour (noobbykour)	9	72.05	81.74	2	22.22
19764.	Hooward (hooward)	9	49.04	55.47	0	0.00
19765.	Atomic_Typh00n (star_gaming...	9	111.08	143.43	6	66.67
19766.	Peter (pitabreadd)	9	92.78	106.68	1	11.11
19767.	adzenny (adzenny)	9	83.54	105.46	5	55.56
19768.	shinji-llorica-kun (shinji_...	9	63.16	70.63	7	77.78
19769.	Drainyyy (drainyyy)	9	84.35	91.49	4	44.44
19770.	Nicolas (itsnickxd1)	9	85.81	110.91	9	100.00
19771.	rautji (divyanshrautji123)	9	53.90	60.04	3	33.33
19772.	Colt (barksonq)	9	111.84	141.49	9	100.00
19773.	John (neptuneposiedon)	9	104.93	127.45	4	44.44
19774.	Lovelace (lovelacelovesc)	9	93.38	111.94	7	77.78
19775.	Annie (annievalentinekuo)	9	87.36	106.13	4	44.44
19776.	zac (tylerblevins43)	9	93.37	100.48	4	44.44
19777.	LimiTrix (limitrix)	9	86.61	96.00	4	44.44
19778.	Taylor (tayl)	9	80.31	90.32	2	22.22
19779.	opmj5 (opmj5)	9	46.33	57.16	3	33.33
19780.	Bryan (bryan_shao)	9	85.41	96.14	4	44.44
19781.	Severus (surajchopra002)	9	87.47	102.72	2	22.22
19782.	Nyuminzt (nyuminzt)	9	33.83	41.52	1	11.11
19783.	Nate (fastfingerer1984)	9	71.08	83.56	2	22.22
19784.	Jason (jason_n)	9	102.12	118.55	3	33.33
19785.	Joe (joe_mama_speed_at_typing)	9	63.85	68.89	1	11.11
19786.	cl0ud (hykroz)	9	51.43	59.73	0	0.00
19787.	Swag (swagsanji)	9	75.62	81.10	6	66.67
19788.	Edmund (edmndfx)	9	54.56	66.85	1	11.11
19789.	Keenan (km1nd)	9	67.62	87.97	3	33.33
19790.	kat (tehkraft)	9	92.98	115.32	3	33.33
19791.	Anjalie :) (cra0009)	9	43.70	53.57	1	11.11
19792.	Tatsam (tatsam_03)	9	77.23	87.88	2	22.22
19793.	Capeman (godzhell22)	9	57.31	70.91	0	0.00
19794.	Ebenezer (ebenezeryu)	9	72.32	84.43	4	44.44
19795.	ClassAMaverick (classamaver...	9	76.77	83.27	8	88.89
19796.	Eduardo (eder_vs)	9	70.46	87.60	4	44.44
19797.	brad (bradpaul525)	9	63.10	70.12	4	44.44
19798.	Will (zalear)	9	73.62	81.85	2	22.22
19799.	Lilgovo (lilgovo)	9	58.30	72.53	5	55.56
19800.	ForGe (dccvx)	9	93.23	114.51	2	22.22
19801.	Sammy (virtualtyper)	9	109.76	130.14	3	33.33
19802.	Cyborg (cyborg112)	9	51.79	62.16	1	11.11
19803.	brateboi (brateboi)	9	77.05	85.38	3	33.33
19804.	Blunt (bluntsam)	9	68.29	73.13	2	22.22
19805.	Dexter Martin (dexterguilalas)	9	48.14	52.22	4	44.44
19806.	Qiyuan (keonjoe)	9	108.36	121.91	3	33.33
19807.	Husker (husker9)	9	61.62	71.90	3	33.33
19808.	Brisseira (mintdaisy101)	9	51.08	63.96	1	11.11
19809.	Matthias (yotuhyper)	9	16.16	33.06	2	22.22
19810.	BoomBa (boombaman)	9	74.19	82.98	1	11.11
19811.	Fastasfackboi (fast_as_fack...	9	56.72	65.83	3	33.33
19812.	tstats[ahmedmhm2024] (ahmed...	9	42.98	47.04	0	0.00
19813.	Shambhu (veganshambhu)	9	66.89	73.17	4	44.44
19814.	abksabermaster (abksabermas...	9	67.86	81.29	3	33.33
19815.	Rafael (rafaelrs)	9	88.00	99.84	3	33.33
19816.	birb (smallbirb2)	9	109.74	121.43	4	44.44
19817.	fzerty (shreyasminocha)	9	97.30	109.00	5	55.56
19818.	Kit (karma_88)	9	65.35	74.66	0	0.00
19819.	Lakshya (smashed_potato)	9	23.92	29.22	4	44.44
19820.	Start slow (sancriuse)	9	58.58	66.60	2	22.22
19821.	JelyRenee' (jelybely_21)	9	55.01	60.54	2	22.22
19822.	_ (freshnewname)	9	65.20	80.47	1	11.11
19823.	song yuqi (ralkinho)	9	65.71	68.88	0	0.00
19824.	WdMalus (_wdmalus31_)	9	36.33	41.21	3	33.33
19825.	meerbay (meerbay)	9	60.37	68.58	2	22.22
19826.	Sáng (supersentaj)	9	46.04	48.85	3	33.33
19827.	Oliver (oliververandus)	9	100.08	117.40	8	88.89
19828.	Kayne (kayne256)	9	96.36	116.31	4	44.44
19829.	OmNommy (_omnommy)	9	55.35	59.14	1	11.11
19830.	Suchanya (suchayann)	9	40.47	46.39	7	77.78
19831.	rj (bruh_momento364)	9	70.98	79.36	2	22.22
19832.	Seam (shademaster69)	9	67.50	79.47	3	33.33
19833.	Einkie (qtr_typer)	9	55.05	60.82	0	0.00
19834.	chocolate (chocolate1111)	9	54.57	65.41	3	33.33
19835.	Sunil (sunildev)	9	41.68	44.95	5	55.56
19836.	Emma (skunkiii)	9	42.49	46.22	1	11.11
19837.	Mike (fuccuppo)	9	75.26	88.22	1	11.11
19838.	Pink Mutt (frugalmussel)	9	70.13	83.31	1	11.11
19839.	Adimas (frostyslr)	9	100.43	117.67	7	77.78
19840.	Freddo (freddo7)	9	97.82	110.25	3	33.33
19841.	Freddie (freddiesanchez)	9	92.55	106.87	2	22.22
19842.	Ferrari (fluidcoder)	9	70.62	76.95	4	44.44
19843.	Ruth (flirtatiouswizard)	9	90.79	100.16	2	22.22
19844.	FlippLoki (flipploki)	9	94.69	114.83	4	44.44
19845.	Franklin (flipfloppm)	9	122.47	149.35	7	77.78
19846.	297 (flightsim297)	9	132.29	161.89	8	88.89
19847.	Kuldip (flash007)	9	69.22	74.44	3	33.33
19848.	Flappy (flappysnake)	9	47.57	54.12	0	0.00
19849.	Slow_AF (flaming_gladius)	9	77.42	85.15	1	11.11
19850.	Jeremiah (fiveminus1)	9	101.73	129.45	3	33.33
19851.	fintelia (fintelia)	9	79.08	85.71	2	22.22
19852.	Oliwer (financialojay)	9	46.88	52.64	3	33.33
19853.	Fred (fcbsd)	9	45.81	55.29	3	33.33
19854.	Farkhan (farkhann)	9	56.75	72.20	0	0.00
19855.	Kai حيادي (famboy32)	9	92.41	111.00	5	55.56
19856.	Levi (fajpaj)	9	96.29	113.61	2	22.22
19857.	Amaranth (fadingamaranth)	9	93.06	110.89	3	33.33
19858.	EXT YOYO (ext_yoyo)	9	41.78	59.87	2	22.22
19859.	Nathan (exodus_king)	9	82.32	89.43	4	44.44
19860.	Fingerkart sweat (exford0)	9	110.26	115.59	5	55.56
19861.	daddy (evilaristotle)	9	61.23	66.51	2	22.22
19862.	John (everderp)	9	93.64	115.67	4	44.44
19863.	Evanz (evanzyt)	9	70.44	78.16	4	44.44
19864.	espo (espooooo)	9	86.12	105.37	3	33.33
19865.	Nick (escalt)	9	104.43	125.88	6	66.67
19866.	(erny2)	9	105.42	115.30	5	55.56
19867.	epicgamer412 (epicgamer412)	9	109.23	124.34	5	55.56
19868.	Endku (endku)	9	75.43	85.21	1	11.11
19869.	Mohammed (enchantful)	9	90.75	99.95	2	22.22
19870.	Elvy (elvy_)	9	48.93	57.40	3	33.33
19871.	Elemental (elementl)	9	99.68	116.69	3	33.33
19872.	Eldin (eldin_)	9	59.86	74.36	2	22.22
19873.	Elaine (elainehuang)	9	53.83	63.11	0	0.00
19874.	Ethan (egoldman)	9	99.80	122.89	5	55.56
19875.	Edward (edwmai18)	9	75.64	98.80	3	33.33
19876.	Eduard (eduard20)	9	102.88	116.06	4	44.44
19877.	engie (edrian_a)	9	106.12	126.44	3	33.33
19878.	EddieVonShmeddie (eddievons...	9	84.17	102.75	2	22.22
19879.	Ecila246 (ecila246)	9	47.14	50.78	0	0.00
19880.	Echo (echoet)	9	65.59	81.47	4	44.44
19881.	DZ_no (dzeano)	9	83.26	91.09	3	33.33
19882.	Dylan (dyl0e)	9	96.31	101.90	3	33.33
19883.	Drake (dunkchai)	9	83.34	97.78	4	44.44
19884.	Sam Luke (ducksako)	9	82.32	95.95	2	22.22
19885.	Shamit (dr_neshmitz)	9	88.28	96.80	3	33.33
19886.	Drixppy (drixppy)	9	49.75	57.11	2	22.22
19887.	John (driftan)	9	103.20	115.61	3	33.33
19888.	Dries (driesvanspauwen)	9	91.16	101.75	4	44.44
19889.	John (drchase)	9	106.53	114.90	3	33.33
19890.	Kris (doyouthink)	9	92.81	108.90	4	44.44
19891.	DottyShark31762 (dottyshark...	9	52.74	64.56	2	22.22
19892.	Juan (dostoevsky)	9	64.14	73.59	1	11.11
19893.	Sophie Feldman (doodlefinny)	9	96.19	114.65	4	44.44
19894.	Kyle (donttouchmyrice)	9	90.05	110.61	6	66.67
19895.	Dominikus (dnk_dom)	9	36.33	43.04	2	22.22
19896.	Keegan (djkeegs)	9	84.51	96.04	2	22.22
19897.	Ian (disnailandd)	9	107.33	133.79	6	66.67
19898.	Velislav (disaster_veli)	9	45.01	49.39	1	11.11
19899.	J (dingkid)	9	117.45	125.49	5	55.56
19900.	Alan (dick_licker666)	9	90.00	116.87	2	22.22
19901.	DewWhite (dewwhite)	9	68.70	75.98	6	66.67
19902.	Devin (devingalway)	9	107.27	123.56	2	22.22
19903.	Deux (deuxgrosman)	9	94.51	105.34	2	22.22
19904.	joanna (deulseobs)	9	120.97	137.00	6	66.67
19905.	Domenic (denenfx)	9	110.88	127.07	3	33.33
19906.	Tobi (demizu_)	9	110.75	122.39	4	44.44
19907.	delfador42 (delfador42)	9	80.34	86.20	4	44.44
19908.	Roxx III (deathsoul117004)	9	58.37	66.05	2	22.22
19909.	Samson (deathreturns)	9	43.31	49.54	1	11.11
19910.	David (davidt585)	9	97.34	108.11	1	11.11
19911.	David (davidsayshello)	9	80.25	92.81	3	33.33
19912.	DavidFinlForm (davidfinalform)	9	49.17	55.02	0	0.00
19913.	DankAlzein (dankalzein)	9	121.93	140.08	6	66.67
19914.	arin (dakotubbs)	9	51.07	65.90	0	0.00
19915.	nunya (daintyfawn)	9	82.09	111.87	9	100.00
19916.	Dauniverse (daimabao2003)	9	60.49	67.96	3	33.33
19917.	D (daikuri)	9	103.76	117.24	4	44.44
19918.	Mark (cyclingguy536)	9	80.26	92.96	1	11.11
19919.	Nid (cyanid_)	9	81.45	97.80	2	22.22
19920.	tyler (cyanamethyst)	9	95.11	113.83	3	33.33
19921.	Christian (cwoo)	9	93.67	107.64	6	66.67
19922.	O (cvxnjopsad)	9	86.62	98.82	2	22.22
19923.	Ryan (cuoituoi1996)	9	92.33	114.57	4	44.44
19924.	Cody (cuday)	9	91.07	104.44	4	44.44
19925.	halloo (crystaalsnow)	9	57.34	66.08	2	22.22
19926.	shoop (crimmsy)	9	87.53	98.64	4	44.44
19927.	Oual (crankcrash)	9	71.65	90.64	3	33.33
19928.	Charly (cpn29)	9	43.98	51.26	1	11.11
19929.	Edvin (cowsmacker69)	9	64.44	79.56	4	44.44
19930.	Cotle (cotle)	9	53.48	66.33	2	22.22
19931.	Fast (cooloppo)	9	88.40	96.81	4	44.44
19932.	Ian (coocooman3)	9	84.60	93.28	2	22.22
19933.	Wilko (colacake84)	9	83.94	92.95	3	33.33
19934.	Cole (cmrrockstar85)	9	106.09	121.38	5	55.56
19935.	Bassim. (cmpleteidiot)	9	94.30	113.83	3	33.33
19936.	Clit (cliffcatastrophe)	9	146.20	161.46	4	44.44
19937.	Xenomorph (claygnot10)	9	88.86	104.48	1	11.11
19938.	charlie (cl23456)	9	86.68	101.74	2	22.22
19939.	Classical (cl123)	9	47.53	56.91	1	11.11
19940.	Cole (ckoehler)	9	77.42	93.98	3	33.33
19941.	Cijarot (cijarot)	9	70.86	81.09	2	22.22
19942.	Chub (chubbyhands)	9	67.47	80.70	3	33.33
19943.	Christian (christian9182)	9	72.74	78.95	4	44.44
19944.	Chris (chrisbones)	9	70.86	83.97	2	22.22
19945.	Christopher (chrisaua)	9	83.18	101.31	5	55.56
19946.	Kevin (chqu7424)	9	91.83	104.08	6	66.67
19947.	Chlebíček (chlebicek)	9	36.31	42.49	0	0.00
19948.	Lii4 (chjh21005)	9	71.67	79.78	2	22.22
19949.	tstats[chihayafuru] (chihay...	9	123.78	134.07	6	66.67
19950.	Kachika (chickhicks_)	9	112.09	137.74	4	44.44
19951.	cherub (cherub)	9	111.89	126.79	4	44.44
19952.	Eduardo (chekedu)	9	47.38	63.29	0	0.00
19953.	Jordan (cheetoburritoes)	9	88.22	95.72	3	33.33
19954.	LOL (cheesecakeisgud)	9	117.74	129.25	5	55.56
19955.	chedted (chedted)	9	78.93	91.73	2	22.22
19956.	Chaws5 (chaws5)	9	111.36	120.37	6	66.67
19957.	Manos (chatzakes)	9	68.39	77.44	2	22.22
19958.	Charmen (charmen)	9	56.03	64.20	3	33.33
19959.	charles (charles1106)	9	60.34	70.96	2	22.22
19960.	chakuch (chakuch)	9	62.90	84.18	1	11.11
19961.	Cian (ceol93)	9	110.76	123.00	6	66.67
19962.	Ce (celineusa)	9	86.45	100.96	3	33.33
19963.	Carl (cbho73)	9	105.52	112.55	2	22.22
19964.	Tika (catluvr543)	9	124.67	146.60	7	77.78
19965.	Jason (cathayjason)	9	104.97	115.34	6	66.67
19966.	Cassius (cassius_vlok)	9	53.82	62.37	0	0.00
19967.	Carbon (carbon28)	9	69.28	80.51	3	33.33
19968.	Cao Sy Hai (caosyhailong99)	9	95.29	110.17	2	22.22
19969.	Sniffff (can_i_sniffff)	9	67.05	81.71	4	44.44
19970.	Cameron (cameron__)	9	78.78	91.76	4	44.44
19971.	Lia (calumhood_)	9	76.38	90.15	4	44.44
19972.	Calsuis (calsuis)	9	86.29	98.13	3	33.33
19973.	mechanical (cakesogood)	9	95.11	132.97	4	44.44
19974.	Type (cainvelasquez)	9	75.01	87.46	6	66.67
19975.	LongGone (byejack123)	9	64.72	72.28	0	0.00
19976.	BWho? (bwho)	9	90.91	97.48	3	33.33
19977.	Alex (buttonmeister)	9	75.73	88.94	4	44.44
19978.	Topher (burritopher)	9	70.28	82.76	3	33.33
19979.	Burner (burnerburner)	9	78.43	89.24	4	44.44
19980.	Bucketboi (bucketheadmit13)	9	81.99	94.34	3	33.33
19981.	Jason (buckbuck5646)	9	113.50	133.74	7	77.78
19982.	brian (bsill)	9	56.65	68.00	2	22.22
19983.	Bruce (bs99)	9	54.51	59.89	1	11.11
19984.	Bryan (bryangne)	9	75.80	92.70	2	22.22
19985.	aaron (brwnmn6)	9	92.35	109.24	3	33.33
19986.	bronts (brontus)	9	86.86	103.34	2	22.22
19987.	Matt (britzkrieg)	9	91.66	105.60	3	33.33
19988.	Brekzit (brekzit__)	9	73.13	86.55	2	22.22
19989.	Brandon (brandongva)	9	63.86	70.24	4	44.44
19990.	Francisca (borg58hd)	9	65.61	76.23	3	33.33
19991.	Tristan (bombomb)	9	57.38	80.13	5	55.56
19992.	Max (bolognacolonel)	9	84.16	90.25	5	55.56
19993.	dead (bob_mcbobberbob)	9	71.57	81.53	3	33.33
19994.	Borislav (bobun)	9	83.91	94.33	1	11.11
19995.	Bobby (bobbydhiman69)	9	92.90	104.62	3	33.33
19996.	BlueSlimeX (blueslimex)	9	85.02	94.74	8	88.89
19997.	blues (blues856)	9	110.14	127.86	3	33.33
19998.	blublueagle (blublueagle)	9	58.83	66.49	2	22.22
19999.	Bilguun (blgn94)	9	57.30	63.92	2	22.22
20000.	Jesse (bleedobsidian)	9	73.46	91.01	4	44.44
20001.	Eejay (blazesfolife)	9	80.50	87.33	4	44.44
20002.	Daniel (blastanks)	9	100.53	117.49	2	22.22
20003.	Saul Goodman (blarg_23)	9	74.44	82.07	2	22.22
20004.	frederik (birgerbrosa)	9	90.27	105.17	3	33.33
20005.	biotox (biotoxz)	9	112.61	134.34	5	55.56
20006.	bincent (bincentlife)	9	85.66	103.39	6	66.67
20007.	emmanuel (bigginer20)	9	25.54	29.23	2	22.22
20008.	Big Bird (bigbird61)	9	34.39	38.47	0	0.00
20009.	bido (bidoteima)	9	97.94	121.84	7	77.78
20010.	batmunkh (batmunkh)	9	56.13	61.46	0	0.00
20011.	Son (baby_hanz)	9	95.57	109.26	3	33.33
20012.	¯\_(ツ)_/¯ (babanin)	9	73.46	82.31	5	55.56
20013.	A Newbie (a_newbie_a)	9	55.38	62.64	1	11.11
20014.	Azhar (azhartyper123)	9	43.80	52.03	2	22.22
20015.	envy (ayytsklmao)	9	103.06	117.62	1	11.11
20016.	AyuAnchor (ayu_anchor)	9	28.25	33.97	3	33.33
20017.	Emilio (ayasesenpai)	9	75.94	85.47	4	44.44
20018.	Paul (axxmodeus)	9	69.89	80.52	4	44.44
20019.	Abigayle (awesomeness2470)	9	42.39	53.24	0	0.00
20020.	Alex (awb101)	9	81.75	95.16	3	33.33
20021.	Blyon (avocado_punched)	9	78.41	88.34	2	22.22
20022.	Vignesh (avkvignesh)	9	68.25	73.88	2	22.22
20023.	Avil (avilvineko)	9	55.40	60.77	0	0.00
20024.	au_hermit (au_hermit)	9	72.53	85.28	4	44.44
20025.	Hugh (atticush99)	9	86.37	96.13	4	44.44
20026.	[][][][] (atomskk)	9	116.09	141.12	5	55.56
20027.	Blitz (athul)	9	112.43	124.12	4	44.44
20028.	Dustin (athleticsaddict)	9	95.38	108.03	5	55.56
20029.	Atabek (atabekarapov14)	9	73.22	91.25	2	22.22
20030.	Samit (astro_0)	9	69.62	84.19	3	33.33
20031.	Andre (astrothetypist)	9	96.93	107.09	3	33.33
20032.	panda bear (astronicus)	9	137.42	147.81	6	66.67
20033.	cody (astro8192)	9	65.97	69.41	3	33.33
20034.	Alex (aspectings)	9	96.74	123.99	9	100.00
20035.	あしくさい (asikusai)	9	77.09	86.21	2	22.22
20036.	Asian (asiansupremacy)	9	102.95	119.02	7	77.78
20037.	😷 (ashraaf_k)	9	59.64	71.64	2	22.22
20038.	Arvid (arvid_a)	9	54.16	60.78	0	0.00
20039.	aiman (armm)	9	27.96	33.26	1	11.11
20040.	fuadul (fuadul)	8	38.73	42.20	2	25.00
20041.	FruityCigar (fruitycigar)	8	60.22	71.49	3	37.50
20042.	Frozen_Robot (frozen_robot)	8	80.27	90.84	1	12.50
20043.	Determined (frosty_flame)	8	94.62	99.82	2	25.00
20044.	Freshanatha (freshanatha)	8	61.92	68.83	4	50.00
20045.	Fran (frannyg)	8	46.76	60.90	1	12.50
20046.	rose (fr0gspawnn)	8	108.87	115.68	2	25.00
20047.	Fowwer (fowwer)	8	78.34	96.78	2	25.00
20048.	Foofmeister (foofmeister)	8	117.45	137.42	3	37.50
20049.	Cole (fluke1890)	8	80.68	89.23	1	12.50
20050.	flora (flora1111)	8	123.70	144.91	6	75.00
20051.	Elvis (flareblu_workman)	8	67.40	81.95	3	37.50
20052.	bigdad (fillmeupdaddy)	8	81.90	89.99	2	25.00
20053.	El Psy Kongroo (fiive_starboy)	8	67.42	91.53	3	37.50
20054.	fffd (fffd)	8	82.89	98.33	5	62.50
20055.	Ferris (ferrisprimanugraha)	8	88.49	94.87	4	50.00
20056.	Fernando (fedevegili)	8	102.17	115.14	5	62.50
20057.	Feakl (feakl)	8	41.73	51.64	1	12.50
20058.	Diego (faustian_nero)	8	55.09	61.86	0	0.00
20059.	FastTypist448 (fast_typist448)	8	57.00	67.21	2	25.00
20060.	Aminul (fardin1bd)	8	55.85	63.03	0	0.00
20061.	Austin (fallow64)	8	107.29	124.23	4	50.00
20062.	Regent (fagol)	8	74.03	86.91	3	37.50
20063.	Danial (fadyboi)	8	87.24	92.22	3	37.50
20064.	ChiBai (f0rg0tten)	8	68.55	87.19	1	12.50
20065.	Eyal (eyalnir7)	8	58.54	72.15	4	50.00
20066.	e (evzh)	8	35.01	42.05	0	0.00
20067.	Morgan (evirabbi)	8	100.53	115.46	1	12.50
20068.	Sidewalk (euantis)	8	77.05	87.09	3	37.50
20069.	Evan (etiger)	8	66.09	77.21	0	0.00
20070.	Eternal (eternai)	8	84.47	125.48	3	37.50
20071.	Erna (ernasolberg69)	8	80.55	96.66	0	0.00
20072.	Erik (eriklvalentin)	8	97.31	111.27	3	37.50
20073.	bruh (erik2405_)	8	104.92	115.21	6	75.00
20074.	Epsile (epsilian)	8	124.83	149.06	7	87.50
20075.	Owen (epic_own_gamer)	8	69.57	78.08	2	25.00
20076.	Enamul (enamul)	8	32.31	38.06	2	25.00
20077.	Elrohir (elrohirtypo)	8	71.28	78.21	0	0.00
20078.	ellowell (ellowell)	8	125.79	150.31	4	50.00
20079.	Elius H Himel (eliushhimel)	8	45.91	52.79	0	0.00
20080.	Adridri (eidorian)	8	83.07	133.33	4	50.00
20081.	Eric (ehshark)	8	108.49	120.03	5	62.50
20082.	mrspaghettimeatballs (ehreg...	8	84.00	91.23	2	25.00
20083.	Snowbear (ehj1258)	8	90.27	103.86	3	37.50
20084.	edward (edwardkarra)	8	47.70	66.00	5	62.50
20085.	Ed (ed2005)	8	65.40	74.19	2	25.00
20086.	Fee (dylanfee)	8	127.42	137.84	5	62.50
20087.	Isa (dxnamic_)	8	70.23	78.77	1	12.50
20088.	areyouagirloraguymonkey (dw...	8	151.90	166.24	8	100.00
20089.	gale (dwah)	8	86.69	103.85	3	37.50
20090.	AAA (duraszess)	8	91.18	99.15	5	62.50
20091.	Tung (dungtang)	8	112.38	130.06	3	37.50
20092.	🔖. (dumplinling)	8	52.61	59.24	0	0.00
20093.	teethmc (dudeboi63589)	8	85.49	110.97	3	37.50
20094.	Per (dubgeiser)	8	81.20	84.91	1	12.50
20095.	Sasha (dtelesman1)	8	75.24	86.18	1	12.50
20096.	Kristof (driftydifty)	8	53.70	56.53	2	25.00
20097.	droo (drew215)	8	112.11	128.22	5	62.50
20098.	Dregni (dregni)	8	61.25	66.52	1	12.50
20099.	Khondokar (draenor06)	8	70.84	90.06	4	50.00
20100.	Manan (dpmanan)	8	57.64	64.80	2	25.00
20101.	Kris (doubleace5747)	8	98.16	104.21	3	37.50
20102.	1337 (dotnet)	8	74.91	83.01	3	37.50
20103.	Aang (dorjeaang)	8	62.01	71.21	1	12.50
20104.	Doodle (doodle_doot)	8	67.83	79.27	4	50.00
20105.	sam_sep10l (don_simon)	8	69.26	80.62	1	12.50
20106.	Donzelle (donnie12)	8	78.42	85.42	0	0.00
20107.	Danish (donish)	8	61.59	65.09	3	37.50
20108.	dongster (dongster)	8	96.34	121.51	1	12.50
20109.	Dominik (domynig)	8	65.35	79.25	3	37.50
20110.	ziomek (dombrol)	8	77.35	88.43	1	12.50
20111.	Doctorgreenyou (doctorgreen...	8	88.72	102.66	5	62.50
20112.	Daniel (dkincorperated)	8	52.06	61.59	2	25.00
20113.	djole (djole)	8	60.26	64.04	2	25.00
20114.	Dylan (dillyv)	8	86.07	93.84	3	37.50
20115.	Nick (diggle)	8	121.25	146.89	6	75.00
20116.	DaRealZubyy (dexisnothome)	8	37.08	48.48	2	25.00
20117.	Mart (devli)	8	18.16	19.86	0	0.00
20118.	Detha (detha_)	8	63.36	70.97	2	25.00
20119.	Neil Adrian (destroyer_46)	8	109.75	119.03	4	50.00
20120.	Desmond (desmondspeedy)	8	90.94	107.19	6	75.00
20121.	twitch.tv/YasuoNA (denigratez)	8	98.26	110.61	3	37.50
20122.	Jack (delysid)	8	100.80	119.46	3	37.50
20123.	DeltaDraco (delta_draco)	8	100.90	108.01	3	37.50
20124.	Dan (deltaenergy)	8	73.21	78.37	0	0.00
20125.	sugi (dea_agent)	8	106.95	119.70	5	62.50
20126.	Jeaffffffffffffff (deadvull)	8	66.81	78.62	0	0.00
20127.	David (davylern)	8	104.12	114.36	5	62.50
20128.	Davin (davinnnnn)	8	78.01	86.51	0	0.00
20129.	David (davidm_2020)	8	125.02	138.03	4	50.00
20130.	Brian (dataslayer)	8	107.03	122.57	5	62.50
20131.	Darkplayer3 (darkplayer3)	8	89.02	97.34	5	62.50
20132.	darkestrevolt (darkestrevolt)	8	85.25	92.99	3	37.50
20133.	Darapsas (darapsas)	8	84.48	97.03	5	62.50
20134.	TIN (daons)	8	85.51	88.53	2	25.00
20135.	Daniel (danyu1)	8	86.18	96.88	2	25.00
20136.	Jack (dante17)	8	75.08	82.12	1	12.50
20137.	danny (dannyvokje)	8	86.14	96.59	3	37.50
20138.	Daniel (danielstebbins)	8	68.17	74.75	3	37.50
20139.	Russell (dalenu)	8	120.94	138.45	3	37.50
20140.	da (dahanci)	8	118.37	127.75	7	87.50
20141.	BathTime (daddysbathtime)	8	58.49	71.26	1	12.50
20142.	ab (dabglob)	8	99.85	110.67	3	37.50
20143.	D3LTA (d3lta)	8	98.10	101.28	4	50.00
20144.	G (cyutie__g)	8	91.37	107.47	8	100.00
20145.	Cyan (cyan_cloud)	8	66.67	78.62	3	37.50
20146.	cyan (cyanaspect)	8	91.08	97.99	2	25.00
20147.	Colin (cwreath43)	8	89.69	102.53	3	37.50
20148.	curtythurty (curtythurty)	8	45.09	51.56	1	12.50
20149.	cursedgandhi (cursedgandhi)	8	93.03	100.32	4	50.00
20150.	ravi (culdesaccer)	8	60.51	80.93	1	12.50
20151.	Andrew (cuetime)	8	39.88	43.97	1	12.50
20152.	cse_kyle (cse_kyle)	8	71.73	85.69	2	25.00
20153.	Hoppy (crunchydog)	8	70.91	77.43	1	12.50
20154.	Dran (creyon)	8	74.28	78.86	1	12.50
20155.	Campbell (cphalen)	8	97.28	120.36	2	25.00
20156.	rashawn (corthas)	8	103.14	121.98	3	37.50
20157.	Corey (corrreyjay)	8	123.72	147.82	7	87.50
20158.	Rainnier (corrby)	8	108.82	166.75	5	62.50
20159.	Timothy (cornmono)	8	83.79	95.40	1	12.50
20160.	Lorenzo (cool_and_good)	8	62.52	67.34	1	12.50
20161.	Helena (coolister3)	8	102.27	119.77	6	75.00
20162.	Emmet (contrambulance)	8	92.12	106.25	1	12.50
20163.	Alice (communistbean)	8	71.48	84.65	4	50.00
20164.	Cole (cole_denson)	8	84.80	90.34	5	62.50
20165.	Colemak User (colemak_behbear)	8	92.31	111.37	3	37.50
20166.	wEN (coldblacktea)	8	83.53	95.00	3	37.50
20167.	ここ (coco_jumbo)	8	72.76	80.08	6	75.00
20168.	Coalpi (coalpi)	8	79.82	94.02	3	37.50
20169.	CMcK (cmck)	8	89.17	94.95	3	37.50
20170.	Clever (cleverdom)	8	61.59	65.90	0	0.00
20171.	Clare (clareb31)	8	77.00	89.86	3	37.50
20172.	Charles (ckypros)	8	74.46	87.07	4	50.00
20173.	Christina (cjkoikara)	8	64.05	66.55	0	0.00
20174.	Simon (ciscomalware)	8	67.71	76.06	6	75.00
20175.	Bryjeen (chronoalpha)	8	85.35	92.98	4	50.00
20176.	koen (chromoplast)	8	84.88	94.54	0	0.00
20177.	Chong Shan (chong_shan)	8	69.12	77.89	1	12.50
20178.	Oluwatomi (chidori21)	8	42.56	51.56	0	0.00
20179.	Calvin (cheekuan321)	8	100.67	121.60	5	62.50
20180.	Chayse (chaysegr)	8	90.56	100.62	3	37.50
20181.	SpongeBob (cerealkila)	8	67.94	76.72	1	12.50
20182.	Athos (cdelafere)	8	74.93	83.14	1	12.50
20183.	Jam (cayajam)	8	72.80	86.99	1	12.50
20184.	s (caustlc)	8	96.47	110.54	5	62.50
20185.	Alex (carrot_ironfoundersson)	8	54.17	59.41	1	12.50
20186.	Rystian (cap_redhawk)	8	58.61	65.51	2	25.00
20187.	Captain2 (captain_)	8	58.35	66.17	8	100.00
20188.	s. (capslooock)	8	91.53	106.68	4	50.00
20189.	Cam (camtain)	8	52.29	63.81	2	25.00
20190.	Cade (cadelanktree)	8	74.41	94.52	4	50.00
20191.	Cache (cachemonet)	8	87.58	95.61	2	25.00
20192.	b (b_rabbit019)	8	58.34	71.40	0	0.00
20193.	buzz (buzzdale2)	8	80.62	88.17	2	25.00
20194.	punk (bulatefishballs)	8	92.53	103.35	2	25.00
20195.	Bubbles (bubbles81833)	8	124.80	145.87	6	75.00
20196.	Brian (btgrant76)	8	69.31	87.74	3	37.50
20197.	AJ (bsptc)	8	105.46	117.64	5	62.50
20198.	Brett (brettshaw)	8	85.44	112.11	2	25.00
20199.	Brenden (brenden_2021)	8	57.76	68.21	2	25.00
20200.	Myth (brendanlai1999)	8	61.19	71.81	2	25.00
20201.	Brecken (breck1234)	8	95.91	117.44	3	37.50
20202.	boxxibis (boxxibis)	8	102.70	122.70	3	37.50
20203.	Bovinova (bovinovain)	8	72.08	82.86	3	37.50
20204.	Adhitya (borakx007)	8	90.31	95.59	4	50.00
20205.	Alias (boinkus)	8	124.05	145.98	6	75.00
20206.	boby (bobybomby)	8	59.97	77.34	3	37.50
20207.	Bob (bobanton02)	8	113.36	129.87	4	50.00
20208.	Minleg (bminleg)	8	67.03	77.46	2	25.00
20209.	Billy (blipdip)	8	59.92	71.11	3	37.50
20210.	blitter (blitter56)	8	60.69	72.16	2	25.00
20211.	Joshua (blink180dude)	8	81.14	95.14	1	12.50
20212.	camille (bleuish)	8	94.77	106.19	5	62.50
20213.	Black (blacksiderino)	8	91.79	100.97	3	37.50
20214.	Sean (blackandwhitemuppet)	8	142.09	155.35	5	62.50
20215.	Christian (bl0btypes)	8	82.78	98.86	1	12.50
20216.	bitter (bitternightmares100)	8	100.55	112.57	4	50.00
20217.	Bertil (bingobertil)	8	98.53	109.60	3	37.50
20218.	Mack (bigmack10)	8	82.25	91.73	1	12.50
20219.	bigburd (bigburd)	8	99.23	104.96	4	50.00
20220.	Marshall (bigboycold)	8	78.50	88.30	3	37.50
20221.	BIdi (bidi)	8	100.67	109.33	4	50.00
20222.	Bibek (bibek77)	8	42.56	49.39	0	0.00
20223.	Bheta (bheta)	8	122.97	149.14	5	62.50
20224.	bhavya (bhav_)	8	50.74	58.27	4	50.00
20225.	Kevin (besnier)	8	82.20	87.44	2	25.00
20226.	Azerty 0w0 (benz_)	8	94.23	100.95	3	37.50
20227.	ben (benlee27)	8	56.79	68.79	3	37.50
20228.	Ben (bencyi)	8	122.27	151.75	6	75.00
20229.	bench (bench0)	8	101.75	114.50	1	12.50
20230.	Bempe (bempe)	8	96.72	106.03	3	37.50
20231.	Bektur (bektur8888)	8	31.82	37.47	3	37.50
20232.	Tristan (beckonez)	8	92.26	101.51	3	37.50
20233.	Elizabeth (bebecam)	8	115.28	129.70	6	75.00
20234.	beastboy (beastboy1787)	8	57.09	68.76	0	0.00
20235.	batwayne1 (batwayne1)	8	71.57	79.54	4	50.00
20236.	Bartacus (bartacus)	8	72.37	79.63	3	37.50
20237.	Joseph (barcaftw05)	8	102.33	110.19	6	75.00
20238.	Balint (balint2004)	8	79.69	92.34	2	25.00
20239.	Bagel (baegirl)	8	122.87	131.75	3	37.50
20240.	Baby (baby3am)	8	49.74	62.94	1	12.50
20241.	Felix (babford)	8	69.74	73.92	1	12.50
20242.	xtian (babbageclunk)	8	48.48	54.31	1	12.50
20243.	Zheng Hao (a_random_slow_ty...	8	49.48	61.31	1	12.50
20244.	Anubhav (a_a_pandey)	8	52.24	64.04	2	25.00
20245.	Ayush (ayushnanda14)	8	82.31	88.96	2	25.00
20246.	ayumiii (ayumiii)	8	55.07	70.19	1	12.50
20247.	A (axeborn)	8	48.98	56.06	0	0.00
20248.	awesomedude1440 (awesomedud...	8	85.04	116.53	5	62.50
20249.	Avi (avi_130)	8	95.43	119.89	4	50.00
20250.	AvD (avd3369)	8	58.57	67.07	1	12.50
20251.	Vladimir (av1ty)	8	69.09	77.19	2	25.00
20252.	Austin (austinwc)	8	82.49	97.10	0	0.00
20253.	Daniel (aussiegrillgamr)	8	65.06	71.39	2	25.00
20254.	Aureus (aureuswastaken)	8	113.08	130.32	5	62.50
20255.	Ambrose (astrealix)	8	95.57	105.18	3	37.50
20256.	Jason (ason6678)	8	56.29	65.87	6	75.00
20257.	Shahariar (ashikkkkk)	8	71.84	90.08	1	12.50
20258.	Asher (asher_xxi)	8	52.33	58.09	0	0.00
20259.	arti (artiarti)	8	73.02	79.65	1	12.50
20260.	Eric (__eric__f__)	8	81.84	90.34	1	12.50
20261.	zensei (_zensei_)	8	75.30	82.15	0	0.00
20262.	sexyman (_may_)	8	64.30	78.92	2	25.00
20263.	Eternap (_eternal_)	8	76.28	87.02	6	75.00
20264.	Chris (_c3a)	8	82.45	98.61	0	0.00
20265.	zuritor (zuritor)	8	53.47	73.04	8	100.00
20266.	Michael (zoyp)	8	84.69	117.43	0	0.00
20267.	Kevin (zolt4r)	8	103.30	109.37	2	25.00
20268.	Jillian (zolemnx)	8	51.25	59.15	0	0.00
20269.	Dwarf (znagol)	8	69.06	72.66	1	12.50
20270.	Sanity (zjhaun)	8	61.28	67.37	3	37.50
20271.	ZiyanTheZink (ziyan_the_zink)	8	79.73	87.71	8	100.00
20272.	Ziron (ziron)	8	86.42	102.86	0	0.00
20273.	Zilla1218 (zilla1218)	8	74.28	81.82	2	25.00
20274.	Zia (zia__)	8	31.87	35.61	5	62.50
20275.	Zeta (zetanegativeone)	8	96.33	109.51	5	62.50
20276.	todayis_WanD (zeropatience)	8	84.87	107.43	2	25.00
20277.	zerg (zerggirl)	8	110.98	140.14	6	75.00
20278.	zenyatta (zenyattamondatta)	8	79.50	95.48	2	25.00
20279.	Zekken (zekken12345)	8	89.03	105.94	6	75.00
20280.	Jack (zbroooksy)	8	102.35	126.77	2	25.00
20281.	ZAKARIAAAAAAAAAAAAAAAAAAAAA...	8	52.20	60.56	0	0.00
20282.	Zach (zachtepp)	8	114.85	125.75	5	62.50
20283.	Zach (zachninjakiller6)	8	48.80	56.09	1	12.50
20284.	Yuuki (yuukiy)	8	75.78	86.79	3	37.50
20285.	Yuliana (yuli_a)	8	73.35	83.05	0	0.00
20286.	CHONG YU JIE (yujie_is_typing)	8	80.46	88.27	1	12.50
20287.	y (ys26908)	8	58.72	67.24	0	0.00
20288.	YowzaH (yowzah)	8	131.38	146.23	6	75.00
20289.	Jack (yourmomahhahaahaha)	8	106.55	126.79	3	37.50
20290.	your mom (yourmother369)	8	114.15	129.26	4	50.00
20291.	Yomie (yomie)	8	71.30	82.02	7	87.50
20292.	yinho (yinhotype)	8	58.11	74.04	2	25.00
20293.	Yimin (yimindvorak)	8	124.97	139.37	5	62.50
20294.	Yi-Chen (yichenlo)	8	58.41	72.91	1	12.50
20295.	Yasif (yasif345)	8	65.45	71.95	1	12.50
20296.	Greg (yaohan)	8	117.51	136.77	8	100.00
20297.	yannick (yannickbaze)	8	57.80	62.95	1	12.50
20298.	Time (yaboiiiwill)	8	104.20	111.59	3	37.50
20299.	six (y33t3r)	8	72.91	86.79	2	25.00
20300.	XYZ (xyzabc1799)	8	77.09	83.44	1	12.50
20301.	Fabian (xylia_fabian)	8	70.23	77.20	3	37.50
20302.	xxxodarap (xxxodarap)	8	40.76	48.25	1	12.50
20303.	RelaxCozy (xxodus999)	8	89.77	95.95	3	37.50
20304.	Moritz (xp0s31d0nx99)	8	69.88	76.74	2	25.00
20305.	jonny (xjboix)	8	93.48	115.36	3	37.50
20306.	Rohit (xdeadly)	8	51.20	60.89	2	25.00
20307.	charli (xdbiscuits)	8	61.98	70.96	2	25.00
20308.	Jeffrey (xcjeffrey)	8	50.21	60.42	0	0.00
20309.	Bryan (xarga)	8	103.87	117.26	8	100.00
20310.	Jason (xaraer)	8	69.74	78.38	2	25.00
20311.	Will (wwwong)	8	97.51	111.79	4	50.00
20312.	Fabio (wrist_strength)	8	82.08	89.54	3	37.50
20313.	Nicky (wownickywow)	8	75.37	83.30	3	37.50
20314.	parker (withouthue)	8	44.95	55.55	0	0.00
20315.	C (windyreed)	8	115.71	130.55	3	37.50
20316.	Wilson (wilson_ang)	8	74.78	81.57	2	25.00
20317.	Tjerk (whiz_nl)	8	102.26	113.59	5	62.50
20318.	Hunter (whdahl)	8	94.56	103.93	5	62.50
20319.	Erik (whatafuas)	8	94.94	106.61	1	12.50
20320.	Michael (whalee)	8	93.14	97.70	2	25.00
20321.	Owen (wertls)	8	69.55	82.07	7	87.50
20322.	w (wenjun)	8	127.12	144.75	4	50.00
20323.	Leonardo (wenjiedrick)	8	93.88	111.36	4	50.00
20324.	Jay (wenisknees)	8	88.37	109.67	1	12.50
20325.	Shantanu (wckd1)	8	47.41	51.30	1	12.50
20326.	James (waterpuree)	8	70.04	80.53	3	37.50
20327.	Waterghosteus (waterghosteus)	8	82.03	96.10	3	37.50
20328.	Ethan (waitblock)	8	103.17	109.96	0	0.00
20329.	Adam (waffelele)	8	71.28	79.81	8	100.00
20330.	Cuong (vucuong21)	8	76.46	83.94	2	25.00
20331.	vslip (vslipyt)	8	57.64	64.28	3	37.50
20332.	Van Philip (vppexis)	8	89.52	97.18	2	25.00
20333.	VK (vk_7)	8	41.47	56.71	5	62.50
20334.	Visionss (visionss)	8	89.56	108.91	3	37.50
20335.	Forrest (verybigpenguin)	8	112.06	128.90	4	50.00
20336.	Looking For GF (veiven)	8	113.63	129.48	4	50.00
20337.	Vedang (vedang1312)	8	38.52	43.28	2	25.00
20338.	Doug (vastvincent)	8	93.25	107.52	6	75.00
20339.	josh (vapeypoo)	8	80.36	88.94	1	12.50
20340.	Philip (vanp)	8	121.78	138.16	7	87.50
20341.	Peter (vajco)	8	66.13	71.40	1	12.50
20342.	Hiyam (v1ctor1x)	8	99.43	109.21	4	50.00
20343.	v0lkoff (v0lkoff)	8	101.29	119.61	4	50.00
20344.	Aya (uwub)	8	108.68	117.48	7	87.50
20345.	Prakhar (username_copied)	8	52.73	65.56	2	25.00
20346.	999 WPM (usedarktheme)	8	67.32	77.84	0	0.00
20347.	Daniel (unreal_beam)	8	65.78	72.61	1	12.50
20348.	unpr0gr4mm3d (unpr0gr4mm3d)	8	91.83	101.90	1	12.50
20349.	unnat (unnat)	8	85.55	98.23	2	25.00
20350.	ULUSHA (ulugbek0602)	8	70.17	82.16	2	25.00
20351.	K Sooraj (ultron_ksk)	8	39.98	47.39	0	0.00
20352.	Ultrabooby (ultranooby)	8	125.94	136.62	4	50.00
20353.	Ivan Richard (ugololeivan)	8	58.18	64.31	1	12.50
20354.	⌨️🖱️ (t_0nio)	8	116.53	137.06	8	100.00
20355.	Split keeeeeb (tzbob)	8	112.45	122.74	6	75.00
20356.	Chris (typistgod14)	8	51.38	65.34	3	37.50
20357.	typing pro (typingze)	8	38.53	44.27	2	25.00
20358.	typing (typingmr)	8	82.88	89.13	2	25.00
20359.	bob (typer_bob)	8	100.72	114.41	2	25.00
20360.	bhrigu (typer_21)	8	70.24	80.19	6	75.00
20361.	Tyler (tylermsmith199)	8	89.89	103.12	2	25.00
20362.	TUwU (tuwu)	8	108.84	115.83	1	12.50
20363.	Andrej (tunas1337)	8	104.03	120.00	4	50.00
20364.	Thomas (tszkoda)	8	48.67	52.40	3	37.50
20365.	Grayson (troydenite)	8	86.02	94.62	3	37.50
20366.	tay (trongaus)	8	110.90	121.31	4	50.00
20367.	MIr (triple_mmm)	8	41.62	47.02	0	0.00
20368.	🇵🇸 (' _ゝ') (trickroom)	8	117.94	126.35	3	37.50
20369.	Towbie (towbie)	8	94.34	111.14	3	37.50
20370.	Touhid (touhid23du)	8	45.55	52.03	0	0.00
20371.	Ofek (too_slow_to_go)	8	81.20	88.83	2	25.00
20372.	Toni (tony_playz)	8	79.57	98.36	8	100.00
20373.	Tony (tonyngu)	8	95.59	112.14	1	12.50
20374.	Antonio (tonibudal)	8	50.46	54.72	1	12.50
20375.	TommiTMX (tommitmx)	8	99.43	110.75	5	62.50
20376.	Thomas (tmsopogi)	8	90.28	102.85	3	37.50
20377.	Tahar (tmasmaliyev)	8	35.56	50.80	0	0.00
20378.	tken (tken_tokyo)	8	58.20	66.17	0	0.00
20379.	Tyler (tinss619)	8	85.36	91.65	3	37.50
20380.	Meeper (timelysaucer)	8	97.99	102.20	1	12.50
20381.	Tim (timbob5380)	8	77.20	89.26	4	50.00
20382.	testo (tillman1981)	8	79.42	91.89	3	37.50
20383.	tilko (tilko)	8	97.09	105.31	3	37.50
20384.	Tiberius (tiberiusceter)	8	101.50	121.55	5	62.50
20385.	Joshua (the_rockstar)	8	57.92	61.96	3	37.50
20386.	The (the_phoenix)	8	46.92	52.48	0	0.00
20387.	Sabrina (the_ice_within)	8	119.47	148.60	8	100.00
20388.	perky (theperkiestpotato)	8	87.18	96.22	2	25.00
20389.	ThePCJakub (thepcjakub)	8	103.07	113.63	5	62.50
20390.	Svetlin (thepb)	8	54.35	64.09	1	12.50
20391.	0rz0rz (thenine)	8	99.25	104.58	3	37.50
20392.	­ (thelurkerman)	8	112.37	138.14	2	25.00
20393.	Theo (thelogdude)	8	88.65	98.42	2	25.00
20394.	JJ (thejapie)	8	100.69	107.24	5	62.50
20395.	Michael (thedoctor506)	8	81.16	88.77	1	12.50
20396.	bee (tggb)	8	43.92	46.47	0	0.00
20397.	Nhat Anh (texward)	8	90.77	98.97	5	62.50
20398.	Tor (temyrvang)	8	82.89	89.55	2	25.00
20399.	temmo (temmo)	8	121.23	141.89	4	50.00
20400.	Benjamin (telekinesis)	8	74.05	90.41	5	62.50
20401.	teenpro (teenpro)	8	59.64	76.47	4	50.00
20402.	Ted (tednation)	8	86.88	96.54	1	12.50
20403.	Alex (tec9rushb)	8	80.59	89.70	2	25.00
20404.	Logan (tcalogan)	8	95.31	102.89	5	62.50
20405.	mati (taux)	8	95.85	107.35	4	50.00
20406.	Umair (tastyorange)	8	68.26	83.37	1	12.50
20407.	Tasty (tastytomato)	8	75.97	81.83	5	62.50
20408.	TasteOfCancer (tasteofcancer)	8	91.31	107.65	2	25.00
20409.	Tam (tamlee573)	8	86.99	95.87	2	25.00
20410.	Luis (tallwhitestck)	8	100.13	107.71	7	87.50
20411.	Mikasa (tahabashar11)	8	71.92	86.20	3	37.50
20412.	Tom (tacocatdeboss)	8	100.34	115.50	2	25.00
20413.	swim (swammmy)	8	83.50	100.43	5	62.50
20414.	Swah (swahaha)	8	61.26	76.45	1	12.50
20415.	Ryan (suzerainy)	8	97.62	109.94	2	25.00
20416.	Kachow (suvigya)	8	61.62	70.75	1	12.50
20417.	sussy (sussybaka11)	8	58.97	65.35	0	0.00
20418.	surdyyy (surdyyy)	8	52.21	57.70	1	12.50
20419.	koen (super_stinky)	8	44.20	55.33	1	12.50
20420.	eurobeats (super0)	8	75.66	103.85	1	12.50
20421.	Suigikawa (suigikawa)	8	85.14	95.97	4	50.00
20422.	subhojeet (subho12134)	8	61.59	69.23	0	0.00
20423.	Pui (suaingam)	8	47.57	61.61	0	0.00
20424.	Stuge (stugefin)	8	58.55	64.99	0	0.00
20425.	George (stoptheads)	8	114.25	122.47	4	50.00
20426.	Stephy (stephy2202)	8	74.75	86.71	0	0.00
20427.	stepbrother69 (stepbrother69)	8	101.68	124.57	4	50.00
20428.	Suraj (st1ck14)	8	62.07	70.68	3	37.50
20429.	sszebrat (sszebrat)	8	78.67	92.96	4	50.00
20430.	Sukh Singh (ssothegreat)	8	62.62	77.47	8	100.00
20431.	squirrelslow (squirrelslow)	8	94.47	114.35	2	25.00
20432.	Michael (infinity34)	8	64.92	74.16	5	62.50
20433.	Maximus (sprachzarathustra)	8	96.26	110.52	2	25.00
20434.	Brandon (spookybees)	8	86.26	104.31	3	37.50
20435.	Wayne (spollox)	8	88.37	97.55	3	37.50
20436.	Tim (speedy_neutron)	8	60.53	65.61	1	12.50
20437.	Lul (spammeh)	8	93.96	106.60	3	37.50
20438.	Macaroni (spacial_macaroni)	8	77.25	82.60	1	12.50
20439.	spacebagel (spacebagel)	8	107.50	132.70	3	37.50
20440.	SoupThyme (soupthyme)	8	74.88	88.17	6	75.00
20441.	soufiane (soufianebth)	8	42.05	47.20	4	50.00
20442.	Sophie (sophiebrown6)	8	56.44	62.10	0	0.00
20443.	Redugo (somebodyelse)	8	84.69	99.11	5	62.50
20444.	anonRED (somebody_red)	8	46.49	54.12	1	12.50
20445.	Barry (somalisam)	8	101.19	114.59	4	50.00
20446.	Snek (snekking)	8	89.17	93.85	2	25.00
20447.	Anders (snazzy)	8	76.44	86.72	1	12.50
20448.	SmokR (smokeydbear)	8	89.84	105.39	1	12.50
20449.	Shane (smokedbread)	8	68.37	77.59	4	50.00
20450.	Nafeez (smileywee)	8	84.62	97.21	4	50.00
20451.	kaydence (smhkaydence)	8	45.66	51.97	1	12.50
20452.	Mel (smelons)	8	104.67	117.57	0	0.00
20453.	Slow (slow_keyboard)	8	53.61	61.35	1	12.50
20454.	I am speed (slowhand18)	8	95.16	111.07	4	50.00
20455.	Sam (slimwhit)	8	63.63	66.68	1	12.50
20456.	Karthik (slickfalcon)	8	63.74	71.56	3	37.50
20457.	Edwin (skitargduva)	8	66.46	77.75	1	12.50
20458.	Skillet (skillet18)	8	125.21	136.42	7	87.50
20459.	Nhan (skhylines)	8	85.53	109.55	3	37.50
20460.	SJ (sjmoon110718)	8	47.72	55.17	0	0.00
20461.	Sir (sirnoodles05)	8	93.23	103.52	2	25.00
20462.	Gal (sirdouchebag)	8	73.56	92.70	0	0.00
20463.	Sinan (sinan)	8	121.62	148.27	4	50.00
20464.	Pedro (simplypedro)	8	76.24	90.72	3	37.50
20465.	Simas (simgint)	8	77.42	88.72	3	37.50
20466.	Josh (shwahhh)	8	111.83	122.70	4	50.00
20467.	Shub (shubhamgoel352)	8	69.30	75.60	1	12.50
20468.	Denny (shizkr)	8	86.42	98.56	4	50.00
20469.	Rey x MountainStride (shinr...	8	83.03	95.82	0	0.00
20470.	Mubarak (sgtcuredpanda)	8	48.86	52.03	0	0.00
20471.	クローエ (seyasoya)	8	84.33	92.63	2	25.00
20472.	Seth (sethbangerter)	8	115.42	127.14	2	25.00
20473.	Serji (serji)	8	57.40	65.22	2	25.00
20474.	Senseiparks (senseiparks)	8	100.67	111.55	3	37.50
20475.	kayla (senlin)	8	72.35	86.69	5	62.50
20476.	senara (senara124)	8	91.99	100.10	3	37.50
20477.	George (sellers1234)	8	63.87	70.09	1	12.50
20478.	seb (sebbbbbbb)	8	82.05	92.54	3	37.50
20479.	Bastian (sebastianovoam)	8	71.87	77.67	2	25.00
20480.	Shane (sdoyle4499)	8	64.68	78.52	1	12.50
20481.	Maxim (malincik)	8	66.70	74.99	5	62.50
20482.	Mikhail (maklaya)	8	105.23	117.24	6	75.00
20483.	marvin (magnimarve)	8	125.98	147.93	3	37.50
20484.	maestro (maestro2048)	8	62.29	69.90	3	37.50
20485.	Hina (lyraxh)	8	80.48	92.54	2	25.00
20486.	LULU (luluthecow)	8	101.55	119.44	5	62.50
20487.	Luke (lukejr0123)	8	61.73	70.77	3	37.50
20488.	Luisovc1812 (luisovc1812)	8	59.57	70.10	0	0.00
20489.	Luin (luingear)	8	66.64	78.72	1	12.50
20490.	Jacob (lugia1572)	8	65.90	72.20	1	12.50
20491.	Tachanka (lordtachankatm)	8	102.66	112.19	5	62.50
20492.	Guest (lolteamtroll)	8	59.76	70.84	4	50.00
20493.	Lachlan (lochstar)	8	51.42	57.58	2	25.00
20494.	ellyboycott (localhinatakin...	8	105.16	120.81	4	50.00
20495.	liu (liuluil)	8	105.15	114.58	6	75.00
20496.	Andrew (littlefleece)	8	108.81	120.14	8	100.00
20497.	Litevex (litevvx)	8	133.00	150.02	5	62.50
20498.	nic (limpehordlo)	8	98.97	110.58	3	37.50
20499.	limdaepicpber (limdaepicpber)	8	59.56	67.50	4	50.00
20500.	Erdnaxela (lil_toogood)	8	52.34	62.00	2	25.00
20501.	LilTexan (lil_texan)	8	79.07	85.81	3	37.50
20502.	Cameron (lilcamwin)	8	46.69	54.35	0	0.00
20503.	Liko (likofortino)	8	62.75	75.78	5	62.50
20504.	Sam An (liasss)	8	47.43	53.44	0	0.00
20505.	Fabian (lgtrushzhm)	8	113.78	130.38	4	50.00
20506.	Le' (letyper_)	8	72.68	84.41	2	25.00
20507.	NIcola (lenh)	8	84.27	92.20	2	25.00
20508.	Itsbuddy⌨ (legendarybeast...	8	35.70	45.72	1	12.50
20509.	Lefos (lefos357)	8	44.79	49.90	1	12.50
20510.	Dvorak (learningdvorak101)	8	67.47	72.03	2	25.00
20511.	Laz (lazzo)	8	71.21	79.05	1	12.50
20512.	randint (lawlombie)	8	92.18	103.20	4	50.00
20513.	nina (lavendee)	8	94.14	98.09	3	37.50
20514.	Laurence (laurencee_desu)	8	80.52	89.34	1	12.50
20515.	Jackie (laserelite)	8	115.51	126.20	6	75.00
20516.	laobiz (laobiz)	8	88.38	103.29	5	62.50
20517.	La (lanumu)	8	78.62	97.21	4	50.00
20518.	Malcolm (lampshadess)	8	82.13	91.82	4	50.00
20519.	Slow Typist (lammian)	8	98.54	105.07	1	12.50
20520.	IckyPixel (kyoneoran)	8	70.18	88.59	4	50.00
20521.	Pro (kvis)	8	55.97	60.53	1	12.50
20522.	KJ (kushagra_j)	8	55.64	73.52	1	12.50
20523.	Kurt (kurtv13)	8	80.49	87.66	1	12.50
20524.	kati (ktiisler)	8	52.41	59.32	3	37.50
20525.	Rohit (krullun)	8	59.45	64.83	0	0.00
20526.	kristjon (kristjon)	8	77.13	81.04	0	0.00
20527.	idkhi (krisstesink)	8	74.61	83.99	8	100.00
20528.	Krishan Pal (kris987)	8	47.06	52.15	1	12.50
20529.	Sandpiper (krafty)	8	113.35	130.01	6	75.00
20530.	котакбассик (kot...	8	99.44	113.18	8	100.00
20531.	klima7 (klima7)	8	82.65	91.23	1	12.50
20532.	Jon (kixoidiot)	8	49.41	59.15	1	12.50
20533.	kingcabrams (kingcabrams)	8	103.60	106.82	2	25.00
20534.	kimi (kimboli)	8	86.78	116.64	7	87.50
20535.	kie (kieret25)	8	95.57	108.13	4	50.00
20536.	Christian (kickstyping4thewin)	8	80.33	89.03	3	37.50
20537.	khye (khyelerk)	8	100.82	129.55	3	37.50
20538.	khem (khemsadon)	8	69.52	76.49	3	37.50
20539.	khadie (khadiekun)	8	77.81	90.53	4	50.00
20540.	Khabibkhanov (khabibkhanov)	8	43.93	48.86	1	12.50
20541.	Kushagra (kgtypes)	8	72.93	84.36	2	25.00
20542.	kev2k (kev2k)	8	92.99	110.05	4	50.00
20543.	Kenny (kenjeo)	8	103.30	116.46	3	37.50
20544.	Keigo (keigo_yoshiura)	8	73.16	81.53	2	25.00
20545.	KC (kc2002)	8	95.29	107.30	2	25.00
20546.	Katie (katielemaster)	8	79.54	96.49	2	25.00
20547.	Katie (kat41911)	8	106.23	117.39	7	87.50
20548.	🍁 (kaspars)	8	105.85	120.86	4	50.00
20549.	ryan jason (kapsutka)	8	45.12	53.59	0	0.00
20550.	Jonathan (kamikazecupcake)	8	99.70	111.58	4	50.00
20551.	kalvin (kalvin2171)	8	40.33	54.57	0	0.00
20552.	Daniel (kald3s)	8	93.66	109.88	5	62.50
20553.	holymoly (kajohnny)	8	104.91	112.68	5	62.50
20554.	abdul (kaium55)	8	49.53	71.85	1	12.50
20555.	Kaijou (kaijou)	8	72.01	87.79	6	75.00
20556.	skrtskrt (kad832000)	8	103.08	116.94	6	75.00
20557.	khai (kaariee)	8	82.20	97.57	4	50.00
20558.	Jayshil (just_chillll)	8	49.21	54.26	1	12.50
20559.	Jurre (jurrevonk)	8	101.42	131.85	6	75.00
20560.	Josh (jshearer34)	8	62.72	72.81	1	12.50
20561.	Jorge (jquiroz728)	8	78.19	89.73	2	25.00
20562.	jpow (jpowwow)	8	82.73	97.24	3	37.50
20563.	Jacob (jpoopy)	8	100.41	108.05	4	50.00
20564.	Jimmy (jphan98)	8	104.69	120.40	2	25.00
20565.	sakuraphael (joseraphael)	8	67.21	85.28	2	25.00
20566.	Jorunn (jorunn)	8	109.60	115.92	5	62.50
20567.	JJ (joojoob1004)	8	104.57	121.30	4	50.00
20568.	victor (jontakenols)	8	69.52	89.51	0	0.00
20569.	jonathanirvings (jonathanir...	8	104.49	124.52	2	25.00
20570.	John (johnmanga)	8	78.52	84.30	1	12.50
20571.	J0hn (johnjonez23)	8	100.21	107.31	2	25.00
20572.	Jomama (johanwashere)	8	110.66	123.18	4	50.00
20573.	Johannes (jogameshd)	8	82.26	97.47	2	25.00
20574.	Joesph (joecool3)	8	62.89	74.02	1	12.50
20575.	Jake (jmp2814)	8	77.82	87.63	1	12.50
20576.	jf (jkkl)	8	102.15	122.61	4	50.00
20577.	jawad (jiqlsh)	8	50.46	58.64	1	12.50
20578.	jip (jipgg)	8	37.05	42.94	0	0.00
20579.	Azriel (jing_long)	8	47.65	54.03	1	12.50
20580.	guan (jgbiggy96)	8	88.71	98.10	2	25.00
20581.	Joe (jfratello)	8	82.21	100.09	3	37.50
20582.	Yulia (jewels04)	8	36.17	39.76	0	0.00
20583.	Jerry (jernjej)	8	82.36	91.01	3	37.50
20584.	Jedwidz (jedwidz)	8	101.81	113.07	4	50.00
20585.	Jayden (jay62)	8	85.14	101.12	5	62.50
20586.	Jason (jasonledrika)	8	102.50	119.94	4	50.00
20587.	Andrew (jargazes)	8	108.56	115.49	5	62.50
20588.	JJ (japie4life)	8	106.05	124.82	5	62.50
20589.	James (jamvng)	8	127.42	137.77	3	37.50
20590.	J (jakobam)	8	132.40	144.90	6	75.00
20591.	JackSparrow (jack__sparrow)	8	66.62	74.43	0	0.00
20592.	Jack (jacktypeman)	8	68.00	79.52	4	50.00
20593.	Jack (jackthehuman)	8	88.73	92.75	4	50.00
20594.	EddyEndo (jackpoteddie)	8	56.04	63.51	1	12.50
20595.	jackn11 (jackn11)	8	94.30	103.88	2	25.00
20596.	Sonny (j3dmosly)	8	90.09	94.74	1	12.50
20597.	Jeff (i_bad)	8	40.31	47.83	0	0.00
20598.	Elizabeth (i_am_piece_of_tr...	8	54.52	62.50	2	25.00
20599.	iwannabebee (iwannabebee)	8	16.65	21.56	1	12.50
20600.	honey (ivan_avr)	8	90.03	103.01	4	50.00
20601.	BadAtTyping (itzsecretive)	8	83.28	91.09	2	25.00
20602.	Khushal (its_warhead)	8	52.79	59.54	1	12.50
20603.	forg (itsmetimwastaken)	8	114.75	129.57	5	62.50
20604.	Average (isuckattypoing)	8	64.88	69.93	5	62.50
20605.	Tobias (iseeicetea)	8	44.35	54.29	0	0.00
20606.	Incognito (im_incognito)	8	83.29	92.95	2	25.00
20607.	David (imdaveed)	8	51.57	59.76	1	12.50
20608.	ilyassq (illiazo)	8	60.13	71.24	2	25.00
20609.	Illayne (illayne)	8	71.47	89.95	0	0.00
20610.	Zudio (ildosrel)	8	83.08	90.09	3	37.50
20611.	Kennie (ikentalk)	8	50.91	59.56	3	37.50
20612.	Shut (ihavekillaura)	8	113.45	123.58	6	75.00
20613.	oshan (ice_cold)	8	73.99	83.66	1	12.50
20614.	glizzy (icecreamgoblin)	8	99.05	121.51	7	87.50
20615.	Ibrokhimjon (ibrokhimjon23)	8	30.67	35.55	2	25.00
20616.	Ivan (iamiam)	8	78.83	84.94	0	0.00
20617.	Daniel (hylianwarrior)	8	111.50	142.52	8	100.00
20618.	Hydrix (hydrix03)	8	71.03	79.63	2	25.00
20619.	Khanh Hung (hungnkuon)	8	86.45	96.57	2	25.00
20620.	Teddy (hulksgreenass)	8	109.47	117.17	6	75.00
20621.	Hermogenes (hrivas)	8	41.88	52.28	0	0.00
20622.	chubby (hoocub)	8	36.55	45.60	1	12.50
20623.	Rionil (holyshock)	8	104.38	134.83	5	62.50
20624.	HoldShift (holdshift)	8	69.46	80.32	1	12.50
20625.	AAAAAAAAAAAAAAAAAAAAAAAAAAA...	8	84.50	92.14	4	50.00
20626.	AZNDAD (hmoth84)	8	94.32	104.22	0	0.00
20627.	Hjalte (hjaltebuch)	8	89.97	107.50	4	50.00
20628.	Hit360D (hit360d)	8	57.45	73.98	5	62.50
20629.	Mari (hisokaslave)	8	78.64	96.98	0	0.00
20630.	Anshul (hindu_123)	8	84.18	92.18	4	50.00
20631.	henry 🎩 (henzolo)	8	104.03	110.87	3	37.50
20632.	Heaven (heavenx)	8	74.17	82.09	4	50.00
20633.	Lan (heatblaze)	8	93.44	103.61	3	37.50
20634.	Haven (havenjd)	8	85.82	98.84	4	50.00
20635.	Mufassir (hashtag_pro)	8	63.32	72.68	0	0.00
20636.	Roy (harlos9090)	8	66.17	72.42	2	25.00
20637.	coc (han_duo)	8	92.08	111.52	3	37.50
20638.	2Lenne (hannaloresa)	8	67.63	75.08	3	37.50
20639.	HamsterSales (hamstersales)	8	75.01	88.02	2	25.00
20640.	Khai (haikhaiphan)	8	70.14	79.99	2	25.00
20641.	han (hahhan)	8	23.36	26.23	1	12.50
20642.	Hashmia (haaashmiah)	8	56.10	67.50	3	37.50
20643.	Nicolas (ha27)	8	80.02	84.55	4	50.00
20644.	Yifan (gyyy1995)	8	70.98	80.34	3	37.50
20645.	:Talpiie (gwaporosh)	8	73.41	87.51	3	37.50
20646.	Gusklipsch (gusklipsch)	8	54.41	58.33	0	0.00
20647.	gurzil (gurzil)	8	63.15	72.90	0	0.00
20648.	Dan (gunpowdergolem)	8	95.64	103.75	7	87.50
20649.	gunga (gungafarts)	8	79.98	87.75	1	12.50
20650.	guy (guius)	8	80.56	85.80	4	50.00
20651.	La (guinea_peeg_1234)	8	93.10	99.65	1	12.50
20652.	guid (guid07)	8	74.73	95.01	5	62.50
20653.	grantgoosten (grantgoosten22)	8	82.60	93.78	2	25.00
20654.	Marko (gragole)	8	94.68	104.44	1	12.50
20655.	grac (gracthegrac)	8	63.00	77.21	4	50.00
20656.	Yellow (gracet_b)	8	49.50	57.33	1	12.50
20657.	Eddie (goombah1)	8	107.83	112.88	4	50.00
20658.	dheeraj (goldsnort)	8	68.63	75.03	4	50.00
20659.	Leloush (goal9871231st)	8	36.01	41.57	2	25.00
20660.	glip (glip014)	8	91.73	102.52	3	37.50
20661.	Jack (ginganinjajack)	8	115.15	120.57	4	50.00
20662.	Connor Gil (gillionayre)	8	57.35	64.39	2	25.00
20663.	Giich (giich)	8	88.95	96.60	2	25.00
20664.	Judah (ghostboyjude)	8	48.85	56.79	1	12.50
20665.	Bonne (ggraznpv)	8	28.30	30.09	1	12.50
20666.	Jaden (ggjaden)	8	75.01	88.57	1	12.50
20667.	Geo (geojumper)	8	67.12	72.43	2	25.00
20668.	Ray (gelastical)	8	85.37	95.68	2	25.00
20669.	Artemida (gayswordfish)	8	87.80	104.77	3	37.50
20670.	Gareth (gathlic)	8	57.85	66.68	4	50.00
20671.	Garfield (garfield_fluff_jr)	8	78.18	83.92	1	12.50
20672.	gamer (gamer_2002)	8	31.91	37.37	0	0.00
20673.	Gabryel John (gabryeljison)	8	67.81	81.97	4	50.00
20674.	Kevin (fvnction)	8	73.47	89.17	2	25.00
20675.	Poop_57 (fuzzydestroyer)	8	55.25	72.68	2	25.00
20676.	fuzzed (fuzionite)	8	91.35	116.92	5	62.50
20677.	Kenneth (furball728)	8	110.01	122.91	3	37.50
20678.	Ronald (funnyturtles)	8	54.76	59.50	3	37.50
20679.	f (fulmerformal)	8	101.12	109.90	4	50.00
20680.	Scorbutsale (scorbutsale)	8	78.13	85.23	1	12.50
20681.	BoiledAir7 (sawt)	8	79.91	90.67	0	0.00
20682.	Sagar (saucy_d)	8	70.30	80.95	3	37.50
20683.	Sarvottam (sarvottampriyada...	8	95.94	112.10	1	12.50
20684.	Sarah (sara_g)	8	124.44	132.05	7	87.50
20685.	Sara (sarasmile)	8	30.78	45.61	2	25.00
20686.	Santiago (santpp85)	8	31.17	35.22	0	0.00
20687.	Santosh (santoshm33)	8	58.00	68.89	2	25.00
20688.	Sander (sander5151)	8	86.15	93.40	2	25.00
20689.	(samuraipie)	8	122.12	144.36	5	62.50
20690.	Sam (samschreibt)	8	100.18	112.68	4	50.00
20691.	Sami (samihasaspine)	8	102.43	123.84	3	37.50
20692.	Patrick (saboe)	8	71.99	82.65	3	37.50
20693.	اعجاذ حسين (s183ds...	8	61.89	70.76	2	25.00
20694.	Ryley (r_sand11)	8	48.61	63.35	0	0.00
20695.	Ryan (ryanmc99)	8	112.00	125.67	3	37.50
20696.	Aditya (rust_eze)	8	54.36	67.70	1	12.50
20697.	ABtech19 (rushildhar)	8	40.30	44.99	4	50.00
20698.	Rushil (rushil13579)	8	68.89	83.54	2	25.00
20699.	Joe (rufu)	8	131.46	158.41	7	87.50
20700.	Ruben (rubennijhuis)	8	64.25	98.57	2	25.00
20701.	RSCArne (rscarne)	8	68.68	81.69	2	25.00
20702.	roywastaken (roywastaken)	8	37.25	41.76	1	12.50
20703.	Rotem (rotemsela)	8	102.55	124.70	4	50.00
20704.	xRoshx (roshdip)	8	60.51	68.25	2	25.00
20705.	Ron (ron107)	8	31.25	40.21	0	0.00
20706.	Romin (rominpasa)	8	63.18	70.54	1	12.50
20707.	Yessir (romans828)	8	111.10	136.56	3	37.50
20708.	Viki (roastedice)	8	99.94	121.66	6	75.00
20709.	6fingers (rktspcr)	8	72.87	89.26	2	25.00
20710.	Sadia (riyan_sadia)	8	54.90	64.09	0	0.00
20711.	RISE (riseee)	8	57.16	73.20	1	12.50
20712.	rickythedino (rickythedino)	8	96.12	115.32	3	37.50
20713.	Ricky (rickyb663)	8	89.70	100.14	5	62.50
20714.	garry (richgarry)	8	82.12	100.81	4	50.00
20715.	★ d (retronub)	8	125.87	145.37	5	62.50
20716.	Islam ❤ (respectedfeeds)	8	102.54	107.54	3	37.50
20717.	Yangyang (renasceim)	8	78.77	87.42	2	25.00
20718.	Josh (remember000this)	8	80.44	87.38	1	12.50
20719.	Reed (reedhaffner)	8	99.63	114.12	2	25.00
20720.	Brendo (rebelx)	8	75.01	82.25	0	0.00
20721.	real (realscav)	8	111.64	125.61	4	50.00
20722.	Roman (rdprice)	8	84.13	95.19	3	37.50
20723.	Mikey (rctyogo)	8	72.38	77.07	0	0.00
20724.	Heem (rayhim)	8	58.87	64.19	2	25.00
20725.	pogron (rawhnald)	8	97.90	113.05	3	37.50
20726.	Ian (raveian)	8	49.00	58.79	1	12.50
20727.	Rall (raullll)	8	84.73	97.68	2	25.00
20728.	Jefferson (rasmus06)	8	109.13	127.46	4	50.00
20729.	too_slow (rakki7)	8	76.82	83.32	2	25.00
20730.	Prathamesh (rajputprathames...	8	56.46	62.47	3	37.50
20731.	rai_10101 (rai_10101)	8	81.62	101.30	5	62.50
20732.	Ayuxh (raix29)	8	41.40	45.76	2	25.00
20733.	rainmaker (rainmaker6)	8	62.72	70.53	0	0.00
20734.	Fred (raijinpanda)	8	103.88	114.91	5	62.50
20735.	Quang (quanglc00)	8	52.92	56.00	4	50.00
20736.	Pieter (pvanuffelen)	8	66.70	78.27	3	37.50
20737.	Angela (purplehalo3)	8	81.63	93.81	0	0.00
20738.	Dave (punskilled)	8	117.34	128.92	3	37.50
20739.	Jedidiah (puisanberg)	8	102.08	116.63	8	100.00
20740.	Puffone (puffone)	8	28.18	32.27	2	25.00
20741.	Smith (pucymae)	8	84.33	93.67	2	25.00
20742.	Ben (pro_benny)	8	90.55	106.89	1	12.50
20743.	blue (primaryblu)	8	125.52	158.22	2	25.00
20744.	Connor (pressurr)	8	94.56	103.15	2	25.00
20745.	PRANJAL (pranjalgogoi1999)	8	51.13	56.26	0	0.00
20746.	Jeremy (potrainer)	8	102.66	123.84	3	37.50
20747.	potato_pig12 (potato_pig12)	8	106.74	118.89	6	75.00
20748.	potato0329 (potato0329)	8	66.25	70.44	5	62.50
20749.	Eric (potatcs)	8	84.71	99.01	4	50.00
20750.	PossiblyRandom (possiblyran...	8	104.68	118.50	4	50.00
20751.	Porsit (porsit)	8	68.33	83.04	2	25.00
20752.	Dai ca (porrydeptrai)	8	62.73	83.67	7	87.50
20753.	. (popdon990)	8	70.16	85.74	3	37.50
20754.	Poopy4757 (poopy4757)	8	56.74	69.62	1	12.50
20755.	Kom (poobscoob)	8	95.78	113.51	2	25.00
20756.	Polyatomic (polyatomic)	8	113.14	126.18	6	75.00
20757.	Sid (pokecrater1)	8	99.76	108.81	3	37.50
20758.	Lee (pohsien)	8	30.64	39.85	0	0.00
20759.	podlesk (podlesk)	8	64.29	74.83	2	25.00
20760.	Patrick (pmurfdesign)	8	54.68	61.91	0	0.00
20761.	Mads (planntt)	8	53.54	59.53	2	25.00
20762.	Patrick (pjawesomegaming)	8	80.20	104.78	4	50.00
20763.	Sciencio (pinkdiam0nd)	8	72.11	84.67	0	0.00
20764.	Jonas (piglin)	8	67.36	76.75	2	25.00
20765.	Goal: 70wpm average (pietpo...	8	28.01	31.29	0	0.00
20766.	Pichu (pichu_pals)	8	76.45	89.63	8	100.00
20767.	Tim (phuc131)	8	71.96	80.07	0	0.00
20768.	Philip (philiplu7777)	8	98.92	109.62	2	25.00
20769.	Joseph (phantom5k)	8	75.83	82.85	4	50.00
20770.	Patrik (pgdth)	8	62.88	70.45	3	37.50
20771.	fastfingas (petryk21)	8	80.09	91.38	0	0.00
20772.	Petit (petitjuju)	8	104.89	126.64	3	37.50
20773.	alex (peopel)	8	69.89	78.43	0	0.00
20774.	Kaleb (penguinunreal)	8	85.57	90.64	3	37.50
20775.	black google (peeperin)	8	83.94	105.64	3	37.50
20776.	paul (peazie)	8	114.22	122.24	5	62.50
20777.	lit (paul615)	8	57.56	64.58	2	25.00
20778.	patembe (patembe)	8	72.29	82.45	4	50.00
20779.	Brandon (pastaneko)	8	87.24	95.54	1	12.50
20780.	Adem (paramone)	8	89.33	102.20	5	62.50
20781.	Paper (paperstache)	8	84.57	89.97	1	12.50
20782.	Zephaniah (pandu11)	8	79.01	92.13	5	62.50
20783.	Palta (palta_hass05)	8	70.38	79.93	1	12.50
20784.	Andy (paingle)	8	93.73	104.79	3	37.50
20785.	Stelios (paff)	8	103.14	126.46	3	37.50
20786.	Speedo (pacmaniac)	8	68.19	76.34	2	25.00
20787.	Bill (p0werc0rd0fjustice)	8	83.21	97.00	2	25.00
20788.	Barbo (o_mon)	8	117.98	132.50	4	50.00
20789.	Ozark (ozarkian)	8	117.78	137.75	7	87.50
20790.	Chelsea (oxfordkarma)	8	74.69	84.46	4	50.00
20791.	Rick (outrunwolf)	8	82.47	86.41	0	0.00
20792.	ONRAGE (onrage)	8	94.12	103.51	2	25.00
20793.	onel (onel11)	8	76.54	88.84	2	25.00
20794.	omajez (omajez)	8	71.84	86.98	5	62.50
20795.	𝖔𝖑𝖎𝖜𝖆𝖗�...	8	121.79	139.65	6	75.00
20796.	Okhelloandhi (okhelloandhi)	8	61.96	73.06	2	25.00
20797.	rai (ohrai)	8	103.51	128.91	8	100.00
20798.	ohad (ohad8353)	8	64.12	82.33	3	37.50
20799.	OG3G (og3g)	8	76.12	91.46	0	0.00
20800.	Sophia (officialsophiagarman)	8	69.50	72.49	2	25.00
20801.	sul (ofb_hunted)	8	42.46	46.61	0	0.00
20802.	Arshad (o0arshad0o)	8	46.25	50.76	0	0.00
20803.	Kucing (nyandesuyo)	8	56.43	67.79	1	12.50
20804.	Hugo (nuvions)	8	54.78	61.70	0	0.00
20805.	NukeADS (nukeads101)	8	26.06	31.23	0	0.00
20806.	Shanks (nuggetxd)	8	102.13	118.68	4	50.00
20807.	Noz (nozz)	8	119.78	132.19	7	87.50
20808.	nousmh (nousmh)	8	91.76	106.29	3	37.50
20809.	namie (notyournamie)	8	57.99	64.04	1	12.50
20810.	SchizoKami (notaniki)	8	74.90	80.70	2	25.00
20811.	Jorden (nostera)	8	65.59	71.12	1	12.50
20812.	Henry (noodles10)	8	77.28	90.74	2	25.00
20813.	Noah (noahboa1234)	8	71.99	82.40	2	25.00
20814.	Nneeku (nneeku)	8	80.86	95.55	2	25.00
20815.	b1shop (nnebsi)	8	67.13	80.40	1	12.50
20816.	nitro (nitrocircus)	8	62.39	71.19	2	25.00
20817.	H (nin9zer0)	8	55.73	63.56	1	12.50
20818.	Viktor (niktor76)	8	45.31	53.59	1	12.50
20819.	Niko (nikolearnstotype)	8	102.22	123.40	4	50.00
20820.	Late (nikolaholmes)	8	77.44	88.48	1	12.50
20821.	nikita (nikitapelagecha)	8	74.45	87.92	4	50.00
20822.	Niheee (niheee)	8	91.01	108.38	8	100.00
20823.	♛ Nick...	8	103.98	118.18	3	37.50
20824.	Phuc (nhphucqt)	8	60.94	67.42	2	25.00
20825.	Nerret (nerr3t)	8	58.50	67.27	4	50.00
20826.	NeoX (neoxbit)	8	72.43	84.81	0	0.00
20827.	Rowan (neonowlbar)	8	60.54	66.98	2	25.00
20828.	Bendegúz (negyzetracs)	8	40.87	50.07	1	12.50
20829.	Adam (nefrepitou)	8	71.21	80.53	6	75.00
20830.	Cin_min (needs_alife)	8	74.40	81.97	1	12.50
20831.	Hoo (navvvz)	8	82.88	100.38	2	25.00
20832.	nathan (nathanfrenzel)	8	104.14	123.72	5	62.50
20833.	Matheus (narrogai)	8	57.81	65.51	4	50.00
20834.	Narix (narix)	8	88.50	98.33	4	50.00
20835.	nailfc (nailfc)	8	75.86	80.54	3	37.50
20836.	Nadia (nadiapun)	8	46.78	57.72	1	12.50
20837.	Nacho (nachofry)	8	113.98	127.86	4	50.00
20838.	Vuh (n00bmaster_69_)	8	61.24	66.70	0	0.00
20839.	Kevin (mystified)	8	92.27	106.94	3	37.50
20840.	draven (mutable)	8	111.26	127.88	4	50.00
20841.	Jasmine (mustardsucks)	8	113.63	140.10	4	50.00
20842.	mushi (musfiq)	8	61.40	68.23	1	12.50
20843.	Leo (murkymurky)	8	83.85	89.13	3	37.50
20844.	Munta (munta)	8	59.55	73.23	2	25.00
20845.	Mukhamejan (mukhamejan)	8	48.86	54.17	1	12.50
20846.	Marios (mr_kk13)	8	61.83	70.13	4	50.00
20847.	Iboo (mriboo)	8	90.64	104.50	2	25.00
20848.	Cayke (mrcayke)	8	89.71	99.22	1	12.50
20849.	Bara (mrbobby)	8	104.67	125.01	3	37.50
20850.	Extreme Bass Tester (mrbass...	8	96.44	110.99	5	62.50
20851.	Trevor (mouspe)	8	68.83	83.37	2	25.00
20852.	Ike (mouseandkeyboard)	8	97.81	104.87	2	25.00
20853.	Motan (motanrobert)	8	52.07	63.52	1	12.50
20854.	Mostafa (mostafadelgouda)	8	60.16	69.22	4	50.00
20855.	K (mosspath16)	8	97.13	111.19	6	75.00
20856.	Koneko (moon_l1ght)	8	65.20	73.77	2	25.00
20857.	Petr (monsterkick123)	8	70.18	78.54	2	25.00
20858.	Dan (monkyman12)	8	76.73	88.56	2	25.00
20859.	Moogii (mongoljan)	8	70.27	72.70	0	0.00
20860.	Shiyue (molllllllly)	8	54.78	62.52	2	25.00
20861.	Nikita (mohwai)	8	73.12	86.14	2	25.00
20862.	محمد (mohammed_mourad)	8	36.03	43.63	0	0.00
20863.	Foxes (moazkhaled)	8	51.78	54.48	1	12.50
20864.	Mo (moahmed0987)	8	65.36	77.42	8	100.00
20865.	Brandon (mo0nfire)	8	69.18	80.56	0	0.00
20866.	Matthew (mmcjoynt)	8	84.86	99.79	4	50.00
20867.	Miro7543 (miro7543)	8	47.54	56.35	1	12.50
20868.	Mindjolt (mindjolt)	8	93.39	105.49	2	25.00
20869.	Mik (miks1)	8	92.30	111.71	3	37.50
20870.	Mike (mikethompsontech)	8	98.59	106.99	4	50.00
20871.	at my own pace (mijacim)	8	129.22	153.46	5	62.50
20872.	Midas Gold (midasgold)	8	99.73	131.65	5	62.50
20873.	Michael (michaelskyba)	8	135.44	149.16	3	37.50
20874.	Michael (michaelshahin2)	8	124.34	159.15	5	62.50
20875.	fynn (metallicbow)	8	65.20	73.53	2	25.00
20876.	Stanislaw (mestreponas)	8	93.89	100.08	1	12.50
20877.	Meppou (meppou)	8	82.55	96.10	3	37.50
20878.	Mendyng (mendyng)	8	73.52	85.40	3	37.50
20879.	A (melori)	8	49.47	62.82	1	12.50
20880.	Melvin (mellikyun)	8	89.72	100.67	1	12.50
20881.	mason (meezusxd)	8	82.14	92.61	2	25.00
20882.	Subahan (mdsubahan)	8	28.89	33.99	2	25.00
20883.	uwu (mdby_enn)	8	68.49	76.33	1	12.50
20884.	jumpingjilligan (maxy97322)	8	80.81	101.56	4	50.00
20885.	Max (maxstacks)	8	43.02	48.25	2	25.00
20886.	Max (maxlau09)	8	100.16	104.42	5	62.50
20887.	Mathias (mathi2912)	8	93.20	102.10	3	37.50
20888.	mathan (mathanha)	8	111.81	133.04	6	75.00
20889.	Marco (marquouo)	8	63.36	69.56	2	25.00
20890.	Cream (marom)	8	63.83	78.03	4	50.00
20891.	Tiffany (mangles)	8	82.40	94.09	1	12.50
20892.	Josue (mangalarge)	8	56.75	73.75	1	12.50
20893.	Mohammed (manchi)	8	47.98	53.35	0	0.00
20894.	Acwyg (arjung0055)	8	39.21	48.40	0	0.00
20895.	apexstrada (apexstrada)	8	91.12	118.51	4	50.00
20896.	Anzac (anxan)	8	82.24	91.78	3	37.50
20897.	Anush Rao (anushrao)	8	40.21	48.49	0	0.00
20898.	Anthony (anthonydsr)	8	75.75	87.91	3	37.50
20899.	Aniq (aniq_asd)	8	67.91	73.26	1	12.50
20900.	Andrius (andriusius)	8	78.51	87.19	1	12.50
20901.	Andrew (andmarek)	8	119.37	129.35	5	62.50
20902.	jay (anakanjay)	8	74.74	86.20	0	0.00
20903.	Amr (amr_emara)	8	48.03	54.59	0	0.00
20904.	Amir (amir_bc)	8	71.21	84.87	2	25.00
20905.	Amanda (amandaaaa_)	8	71.47	87.00	0	0.00
20906.	Altra (altra)	8	86.54	111.43	6	75.00
20907.	Alpha (alpha_atk)	8	72.37	89.76	5	62.50
20908.	CaccMann (aloned)	8	109.44	139.12	2	25.00
20909.	Almonds (almonds_and_nutella)	8	43.10	51.67	1	12.50
20910.	Allen (allen8811)	8	56.40	63.85	2	25.00
20911.	Alan (allanafdn)	8	136.62	153.43	3	37.50
20912.	Alfian (alfianzv)	8	83.86	112.21	2	25.00
20913.	Alex (alexk123)	8	58.41	66.35	0	0.00
20914.	Aleksandar (alexg2003)	8	87.84	101.49	2	25.00
20915.	Alejandra (alejandrabruh29)	8	31.70	38.65	3	37.50
20916.	Osama (aldemeery)	8	72.65	79.15	1	12.50
20917.	alan (alanthebest1212)	8	74.03	86.16	5	62.50
20918.	Alamgir (alamgirvigu)	8	51.77	61.15	1	12.50
20919.	Alvin (al04)	8	114.28	126.08	7	87.50
20920.	Aaron (akuch32)	8	63.13	68.59	2	25.00
20921.	Jun (akiboard)	8	110.91	129.44	7	87.50
20922.	AK (ak24)	8	61.69	72.46	4	50.00
20923.	Tryin to make a change :-\ ...	8	115.03	131.62	4	50.00
20924.	fdgojasfd (ajaypokharel)	8	39.63	46.76	2	25.00
20925.	Romil (aidag)	8	93.12	101.29	3	37.50
20926.	DevGuyAhnaf (ahnafzamil)	8	101.23	120.12	8	100.00
20927.	Arnel II (agujathis)	8	98.77	110.48	5	62.50
20928.	Fretzeldurmf (agent_gametur...	8	102.13	115.30	2	25.00
20929.	Ahmad Gamal (agazzaz)	8	62.88	68.58	1	12.50
20930.	Advit Upadhyay (advit0708)	8	56.18	60.59	2	25.00
20931.	Adora (adorablebanana)	8	131.86	145.81	7	87.50
20932.	adithedon (adithedon)	8	32.82	36.11	1	12.50
20933.	Adhy (adhy)	8	81.43	94.29	0	0.00
20934.	Adfrian (adfrianrais)	8	52.81	56.34	0	0.00
20935.	Adam (adamxlofaro)	8	88.14	100.30	3	37.50
20936.	Adam (adamisspeed)	8	100.32	133.51	3	37.50
20937.	Adaephon (adaephon)	8	111.53	120.41	6	75.00
20938.	acewiz (acewiz)	8	94.16	98.14	1	12.50
20939.	Raiyantstats[accursed_] (ac...	8	82.94	95.76	1	12.50
20940.	Abuela (abuela)	8	65.15	74.33	1	12.50
20941.	Alex (abrown516)	8	113.04	125.44	8	100.00
20942.	Aarya (aaryatambe)	8	58.15	70.37	0	0.00
20943.	Aakash (aakash_rp_621)	8	70.32	75.38	4	50.00
20944.	Aaron (aaaronnguyen)	8	83.22	93.86	2	25.00
20945.	a3533 (a3533)	8	85.41	93.80	1	12.50
20946.	jordan (7jrdn)	8	65.17	73.99	3	37.50
20947.	Ren (6cdh)	8	72.40	85.76	1	12.50
20948.	K (4pple)	8	60.37	77.79	2	25.00
20949.	ariel (44tech_)	8	57.22	66.09	0	0.00
20950.	Naresh (303nash)	8	100.22	105.30	3	37.50
20951.	Ivan (1v4n)	8	60.07	69.24	3	37.50
20952.	Zero (0gundam)	8	145.45	169.58	7	87.50
20953.	Giuseppe Bottazzi (051znn)	8	66.35	79.92	1	12.50
20954.	emanuel (emumu)	8	78.70	91.68	5	62.50
20955.	Olivier (opet)	8	90.39	105.69	2	25.00
20956.	Yash (kumar02)	8	48.52	59.68	1	12.50
20957.	Bluee (blueegamer)	8	128.86	151.91	8	100.00
20958.	D2 (dtsu)	8	94.81	117.98	8	100.00
20959.	Pulkit (dinodude17)	8	62.81	80.28	1	12.50
20960.	Philo (philophobic)	8	65.79	77.01	3	37.50
20961.	Nic (nchlsh)	8	80.19	91.39	0	0.00
20962.	Ace (acedawg123)	8	72.33	79.41	1	12.50
20963.	peepee (gamerman2000)	8	92.47	100.07	4	50.00
20964.	brm (brmstr)	8	75.94	85.33	3	37.50
20965.	Lucifer (lucifermorningstar...	8	60.69	66.84	0	0.00
20966.	longshot (longshot19)	8	37.22	43.52	0	0.00
20967.	Tony (dnacid)	8	66.83	88.31	3	37.50
20968.	André (aistcold)	8	89.32	103.73	5	62.50
20969.	olivia (oliviadance)	8	56.59	64.54	2	25.00
20970.	Sretnik (vedran3)	8	99.26	116.38	4	50.00
20971.	Hackyeah (hackyeah)	8	69.19	94.64	3	37.50
20972.	Yehonatan (yonac)	8	55.77	63.44	0	0.00
20973.	Raven (veintan23)	8	62.19	69.92	2	25.00
20974.	Bakhtiyar (baha123)	8	30.89	33.62	0	0.00
20975.	Longlegdog (longlegdog)	8	103.84	117.53	5	62.50
20976.	Jack (wapow811_official)	8	30.65	35.19	4	50.00
20977.	Thanh (ncthanh2000)	8	74.13	85.96	5	62.50
20978.	Neeraj (nerdarrow)	8	73.47	87.35	3	37.50
20979.	raVen (raven01)	8	74.74	81.53	2	25.00
20980.	WishICouldLiveLongerThanMyW...	8	70.29	85.79	4	50.00
20981.	Matthew (sharen0904)	8	37.59	42.19	0	0.00
20982.	Alex (2abc6)	8	66.85	73.54	3	37.50
20983.	SP (spider_swing)	8	46.07	48.94	0	0.00
20984.	Jacob (wooperking)	8	85.03	94.18	4	50.00
20985.	Space (space_bound)	8	60.57	64.67	0	0.00
20986.	Evan (alien_lover)	8	132.32	138.57	5	62.50
20987.	Nikkulet (nikkulet)	8	70.63	78.03	3	37.50
20988.	William (donwee88)	8	59.77	70.47	3	37.50
20989.	Gambit (zereth09)	8	82.48	94.42	3	37.50
20990.	Alexis (alunesp15)	8	61.29	68.16	1	12.50
20991.	LONESTAR (lone_star)	8	49.51	59.85	2	25.00
20992.	jisoo (jisoooleee)	8	90.10	117.73	3	37.50
20993.	Sky (skyking1484)	8	59.09	65.67	7	87.50
20994.	Thanakrit (mnchtnk)	8	46.08	50.39	1	12.50
20995.	Mecin Man (mecin_man3011)	8	51.51	56.88	0	0.00
20996.	Alexander (sheeplordz)	8	61.19	67.44	0	0.00
20997.	Snowman (snowmanisgood)	8	77.23	84.63	0	0.00
20998.	Hriju (hriju)	8	55.10	62.96	3	37.50
20999.	OrangeJuicer (arskiir)	8	74.42	86.27	2	25.00
21000.	Menace (menace101)	8	102.18	107.11	4	50.00
21001.	fida (ferarida)	8	82.20	94.65	7	87.50
21002.	Winda (windamrtrn)	8	59.23	69.58	8	100.00
21003.	Speky (speky)	8	46.28	55.01	1	12.50
21004.	Master (medo2006)	8	77.37	95.17	3	37.50
21005.	لركيد (lorchid)	8	68.59	74.81	5	62.50
21006.	Andrew (thekirkendall)	8	89.90	101.73	7	87.50
21007.	Milos (kaoss14)	8	72.13	86.05	3	37.50
21008.	Barfo (barfo)	8	80.00	89.96	2	25.00
21009.	Dominic (dominicp97)	8	75.53	81.75	1	12.50
21010.	Seth (sandwichseth)	8	62.27	81.15	2	25.00
21011.	Mikrit (mickey035)	8	92.40	103.38	1	12.50
21012.	Jessica (jessi_p3)	8	74.58	87.33	2	25.00
21013.	Anlanther (anlanther)	8	81.59	89.58	4	50.00
21014.	Sergio (dallmyt)	8	36.87	48.89	0	0.00
21015.	Andrew (andrewawesome04)	8	113.01	132.13	7	87.50
21016.	axari (axari)	8	70.78	82.70	1	12.50
21017.	Rionne (aeolus27)	8	84.66	89.24	2	25.00
21018.	pastapirate (pastapirate)	8	98.54	114.14	7	87.50
21019.	Dcoldburn (dcoldburn)	8	73.87	80.85	4	50.00
21020.	MedicalMuscle (medicalmuscle)	8	55.82	70.68	2	25.00
21021.	Prince (prince_sangwan)	8	49.35	56.89	0	0.00
21022.	Christian (kirisuto)	8	99.32	118.67	7	87.50
21023.	REEE (tiucoken77)	8	91.67	108.78	2	25.00
21024.	sw0shy (sw0shy)	8	46.38	66.26	7	87.50
21025.	Lukas (tumultlol)	8	76.16	93.14	3	37.50
21026.	Jamin (hoonji)	8	74.56	97.15	1	12.50
21027.	Rentib (rentib)	8	45.15	52.83	0	0.00
21028.	Deafknight (usernameistaken03)	8	66.42	84.17	8	100.00
21029.	swak (swak_za)	8	48.49	60.01	0	0.00
21030.	Dev Akhilesh (devakhil06)	8	65.23	75.98	3	37.50
21031.	vishesh (vishesh312)	8	60.99	66.91	5	62.50
21032.	David (vapordew)	8	62.96	74.38	3	37.50
21033.	Daniel (daw9801)	8	128.25	135.93	5	62.50
21034.	$now (oldsnow)	8	74.33	83.49	4	50.00
21035.	mostafa (just_dreamer)	8	56.10	63.75	1	12.50
21036.	Mi Co (greeds)	8	61.45	68.32	2	25.00
21037.	Joseph (mintypenguin)	8	60.81	73.63	0	0.00
21038.	Casper-Drawz-Stuff (mrdrawz)	8	44.07	48.48	1	12.50
21039.	Jerry Henry Rose (jerryrose89)	8	101.22	114.25	4	50.00
21040.	Sergio (sergio_gardella)	8	49.18	54.73	0	0.00
21041.	Dan (danpdx)	8	83.82	105.14	5	62.50
21042.	ahammed (ahammed_saeed)	8	55.01	74.13	2	25.00
21043.	Joshua (krotaku)	8	52.45	59.86	1	12.50
21044.	Hans (hjensen)	8	81.79	103.74	3	37.50
21045.	Ayana (mangoez)	8	89.57	98.07	3	37.50
21046.	lawrence (lawrenc)	8	73.60	93.45	1	12.50
21047.	Lis (lussss)	8	64.29	77.15	6	75.00
21048.	chair (chairtypingshit)	8	48.34	55.21	3	37.50
21049.	Snowbat (snowbat)	8	66.69	73.44	2	25.00
21050.	nem (nem2k18)	8	67.31	78.12	3	37.50
21051.	colahhh (colahhh)	8	67.70	80.74	5	62.50
21052.	Nico (bynixo)	8	58.67	69.52	3	37.50
21053.	G M Sohanur Rahman (th3r0b0t)	8	31.46	35.42	0	0.00
21054.	Yash (yashkul)	8	63.78	70.98	0	0.00
21055.	Pierce (fiercepierce123)	8	79.54	89.87	6	75.00
21056.	Akash (kuekuatsu)	8	46.40	57.13	0	0.00
21057.	Alex (x731)	8	93.26	100.84	3	37.50
21058.	Suka (sukatoho)	8	77.73	84.97	2	25.00
21059.	Qasim (qoofbop)	8	66.80	81.57	5	62.50
21060.	Brad (braynie)	8	31.40	50.59	1	12.50
21061.	Isaiah (icongamingyt)	8	62.38	71.31	0	0.00
21062.	Corbyn (skibbity)	8	91.20	107.38	3	37.50
21063.	Nashiruddien (diditsadidnsm)	8	34.29	44.61	5	62.50
21064.	Guy (need4speed_)	8	55.42	59.45	1	12.50
21065.	Hasnat (hasnat79)	8	67.55	74.54	4	50.00
21066.	Louis (giantshlong)	8	102.33	116.55	5	62.50
21067.	Amir (spaghetti_wolf)	8	42.64	51.90	1	12.50
21068.	sunny (mishmish34)	8	77.42	97.55	3	37.50
21069.	Raneth (raneth)	8	28.99	32.86	3	37.50
21070.	slowaf (slowaf66552)	8	33.83	36.62	0	0.00
21071.	willn5702 (willn5702)	8	94.49	106.15	3	37.50
21072.	Kq_al (kqal)	8	80.43	87.08	4	50.00
21073.	LION784 (lion784)	8	50.84	59.03	1	12.50
21074.	acadia (acadiaskye)	8	70.21	74.97	1	12.50
21075.	Akash (akashsaxena2308)	8	48.40	64.55	0	0.00
21076.	Awak3 (_awak3_)	8	68.97	78.46	2	25.00
21077.	Ronni (thepinhead)	8	52.00	65.10	2	25.00
21078.	benrito (benrito)	8	102.25	122.87	5	62.50
21079.	Why Are We (why_are_we_stil...	8	71.88	85.95	2	25.00
21080.	Mátyás (matyas646)	8	41.04	51.73	8	100.00
21081.	Matthew (kaisermk)	8	69.83	83.77	3	37.50
21082.	Lavi (lavirinea)	8	80.97	92.37	2	25.00
21083.	Everton (hissyfits)	8	92.38	101.51	6	75.00
21084.	Isaad (colguy123)	8	76.74	88.42	3	37.50
21085.	Giancarlo (glitch3890)	8	63.43	69.95	3	37.50
21086.	Geoffrey (colleqtivity)	8	105.12	122.11	1	12.50
21087.	lucy (royaltoe)	8	92.83	101.31	1	12.50
21088.	Epic (foxonlaptop)	8	77.68	90.14	5	62.50
21089.	Arkinator (arkinator)	7	101.07	117.82	5	71.43
21090.	Argon (argon11110)	7	111.41	126.28	3	42.86
21091.	rommyarb (arbantas)	7	75.19	84.28	1	14.29
21092.	artahian (aram90)	7	130.61	148.08	4	57.14
21093.	AtM5 (araconda)	7	90.91	101.71	2	28.57
21094.	hi (appleeee)	7	64.89	69.68	1	14.29
21095.	Deceime (applebabycare)	7	106.81	115.02	4	57.14
21096.	Anuvrat (anuvrat)	7	94.40	100.45	3	42.86
21097.	antloflow (antloflow)	7	39.60	47.14	0	0.00
21098.	Antlocwe (antlocwe)	7	83.00	106.41	0	0.00
21099.	Raisin (annielam)	7	71.81	82.58	1	14.29
21100.	Anmol (anmol_786)	7	38.53	44.30	0	0.00
21101.	Connor (animegorl2000)	7	67.80	83.61	0	0.00
21102.	Tu (anhtu96)	7	103.93	122.11	2	28.57
21103.	angie (angelow)	7	52.20	65.76	0	0.00
21104.	Andrew (andrewmosey)	7	71.65	77.13	5	71.43
21105.	Andrew (andrew03)	7	73.00	87.01	0	0.00
21106.	anavel (anavel03)	7	79.69	94.15	2	28.57
21107.	K N (ananthan2k)	7	72.30	76.00	0	0.00
21108.	Amy (amytypes123)	7	123.38	134.86	5	71.43
21109.	Amr (amrhachicho)	7	90.34	101.38	4	57.14
21110.	T2DR (amogussus)	7	53.79	59.66	4	57.14
21111.	amine (aminerdene17)	7	44.86	50.51	0	0.00
21112.	John (amhacking)	7	82.17	86.54	1	14.29
21113.	a (aly394)	7	97.39	115.43	2	28.57
21114.	al (alpasto)	7	60.29	73.04	1	14.29
21115.	Eva (allyve)	7	56.19	65.43	3	42.86
21116.	Matthew (allotec)	7	62.60	73.17	1	14.29
21117.	a (allorang)	7	113.80	134.36	4	57.14
21118.	Alif (alif_)	7	50.25	55.41	0	0.00
21119.	Alex (alexthegamer281)	7	88.98	100.09	4	57.14
21120.	Alex (alexkyo)	7	85.44	102.28	2	28.57
21121.	Alex (alexbananex)	7	55.43	62.05	2	28.57
21122.	Tiger (alcatrazx)	7	68.78	80.58	4	57.14
21123.	Alan (alansanchez)	7	105.95	118.36	4	57.14
21124.	Alaa (alaasultan)	7	27.43	30.41	1	14.29
21125.	Veedora (akuyepe)	7	95.46	103.41	7	100.00
21126.	Peter (akr0nik)	7	104.07	115.23	6	85.71
21127.	Squall (akaisquall)	7	107.61	126.48	5	71.43
21128.	Roberto (ajaxlord28)	7	83.72	99.91	3	42.86
21129.	Rob (airgo32)	7	82.88	94.37	3	42.86
21130.	Ahmed (ahmed_elamory)	7	66.85	73.96	2	28.57
21131.	niz (ahegao_hunter)	7	76.06	93.55	1	14.29
21132.	I_like_Billie_Eilish (agiun...	7	63.91	71.88	0	0.00
21133.	reyal171_ (agdplayer64x)	7	75.57	91.94	3	42.86
21134.	Muh. Habibi (agemagi)	7	93.10	101.12	1	14.29
21135.	afq984 (afq984)	7	73.58	79.62	3	42.86
21136.	Rui (adranos)	7	100.98	108.05	4	57.14
21137.	aditya (addy2001)	7	52.25	54.27	1	14.29
21138.	Ace (ace_axk)	7	57.31	69.44	5	71.43
21139.	iquitwhenimakemistake (ace_...	7	92.08	102.15	5	71.43
21140.	Abum (abum)	7	62.59	76.36	1	14.29
21141.	ac (abpqjbdhsj)	7	61.86	75.31	0	0.00
21142.	Abdurrahman (abood_abu_jawad)	7	51.13	55.89	1	14.29
21143.	ABIZABI (abizabi)	7	61.19	69.52	1	14.29
21144.	Abdulwahab (abdulwahabksa)	7	95.94	114.80	5	71.43
21145.	زياد (aatrox0_0)	7	90.01	105.44	3	42.86
21146.	Tony (aarup)	7	114.99	140.07	5	71.43
21147.	Aaron (aaronoct)	7	46.38	55.11	0	0.00
21148.	Anthony (aantho)	7	98.69	108.33	7	100.00
21149.	Elias (9elias)	7	103.86	112.31	4	57.14
21150.	Akira (8amb1)	7	64.09	72.13	4	57.14
21151.	86hawks (86hawks)	7	85.51	94.48	2	28.57
21152.	G00N (600n)	7	45.85	51.56	0	0.00
21153.	Dj (4tonystanit)	7	90.96	106.82	0	0.00
21154.	artie (4rtie)	7	73.07	92.15	2	28.57
21155.	4aeon (4aeon)	7	98.60	109.53	1	14.29
21156.	Adam (420adam)	7	60.02	70.34	1	14.29
21157.	Rachin (33rachin)	7	76.05	84.62	3	42.86
21158.	Omar (22omar)	7	42.48	50.36	0	0.00
21159.	Tomazio99 (tomazio99)	7	52.28	54.90	0	0.00
21160.	Primez (tff_primez)	7	88.00	101.85	1	14.29
21161.	Emmanuel (manu_0717)	7	45.02	50.90	0	0.00
21162.	Lazer (lazer_michael68)	7	87.69	99.56	4	57.14
21163.	Charles (snarls_charles)	7	60.08	69.81	1	14.29
21164.	Alan (cabinbeaver)	7	95.14	102.81	4	57.14
21165.	neec (neec)	7	58.05	62.92	0	0.00
21166.	haziq (gleam467)	7	47.43	55.14	0	0.00
21167.	Ed (edddddddie)	7	72.29	77.66	3	42.86
21168.	Abdulkader (abdulkader_safi)	7	26.41	29.75	2	28.57
21169.	Long (tphl)	7	43.81	57.70	2	28.57
21170.	shine (shinepagne)	7	77.60	83.08	4	57.14
21171.	Tyron (cerebral_sustenance)	7	66.07	72.39	6	85.71
21172.	Ohze (ohze)	7	113.79	133.41	4	57.14
21173.	agz (xagz)	7	87.43	92.98	3	42.86
21174.	Nathan (yourhomienate)	7	90.85	102.69	2	28.57
21175.	Sawad (myrstival)	7	83.42	96.83	1	14.29
21176.	Matt (hadot)	7	91.18	105.78	3	42.86
21177.	Cat (littlecaaat)	7	76.97	84.09	4	57.14
21178.	Felix (kirken)	7	56.73	67.27	2	28.57
21179.	rainy (rainypay)	7	40.25	55.81	0	0.00
21180.	Reagan (bigsquidwardmomma)	7	50.78	55.55	2	28.57
21181.	SHAHIN (shahin98)	7	52.79	64.07	3	42.86
21182.	Mykailah (mykailahk)	7	85.32	96.90	5	71.43
21183.	PleasedPanda (pleasedpanda)	7	53.20	61.16	1	14.29
21184.	Ian (burgerleadr)	7	72.00	79.10	2	28.57
21185.	Jahns (lewflo)	7	84.79	98.99	3	42.86
21186.	Jimbo toot n fart (shakenfake)	7	84.66	88.71	2	28.57
21187.	Whitsy (driedss)	7	87.09	105.03	2	28.57
21188.	BleaKrytE (bleakryte)	7	80.18	86.11	1	14.29
21189.	Luke (itscrucial)	7	72.67	82.58	1	14.29
21190.	Ben (benthedink8)	7	106.92	116.21	1	14.29
21191.	Neil Cyril (cycy501)	7	69.77	84.12	1	14.29
21192.	40wpm beta (tenseworthy)	7	74.93	82.78	5	71.43
21193.	Nicolas (anicolas26)	7	95.44	105.66	1	14.29
21194.	Ákos (mrazakos05)	7	51.95	55.73	0	0.00
21195.	sammie (sammiethelamest)	7	80.93	98.09	3	42.86
21196.	Samuel (cornymovie)	7	32.95	44.92	0	0.00
21197.	Elis (speedyboio)	7	37.67	43.98	1	14.29
21198.	Alex (imalexorange)	7	88.72	109.47	1	14.29
21199.	Caleb (caleb2099)	7	79.57	96.33	0	0.00
21200.	Angela (midnitelady1889)	7	81.94	90.80	4	57.14
21201.	FIFI (fi_fi)	7	48.35	56.18	6	85.71
21202.	nathan (muskratz)	7	98.60	133.70	1	14.29
21203.	Nivedit (_nivedit_)	7	67.43	75.50	0	0.00
21204.	tacohiro (tacohiro)	7	83.68	98.31	2	28.57
21205.	VictorOTrumper1 (apulh1)	7	44.60	53.54	0	0.00
21206.	test (eratest)	7	42.99	55.64	2	28.57
21207.	Sean (minutoh)	7	112.80	127.28	5	71.43
21208.	Cahetel (hyperkevenau)	7	57.94	65.72	1	14.29
21209.	Pawsom (pawsom)	7	35.29	42.49	0	0.00
21210.	Satya (jordge)	7	74.42	94.88	2	28.57
21211.	seennotheard (seennotheard)	7	106.21	116.49	3	42.86
21212.	Lucas (brenkie)	7	73.81	82.14	4	57.14
21213.	James (pooman111)	7	79.23	85.31	5	71.43
21214.	Darren (chem_notebook)	7	89.30	100.96	6	85.71
21215.	lila (t4rtagl1a_)	7	55.78	82.20	0	0.00
21216.	Suvarchas (suvarchas)	7	69.47	81.94	3	42.86
21217.	នាគអាស៊ី (s...	7	71.98	88.35	3	42.86
21218.	Link (crimson_mecha)	7	64.18	70.46	1	14.29
21219.	Mamnoon (mamnoon7264)	7	49.12	59.02	2	28.57
21220.	WkwK (halwiy76)	7	54.86	59.85	1	14.29
21221.	LowSpecGaming (afif87123)	7	61.36	68.94	1	14.29
21222.	Long Nguyen (_longnguyen)	7	60.40	63.87	0	0.00
21223.	Jacob (dajacob2335)	7	65.98	81.47	0	0.00
21224.	Xang (xangszane)	7	122.82	137.88	4	57.14
21225.	Rohan (bobzy)	7	78.06	85.25	0	0.00
21226.	rumman (rumman_sust)	7	56.09	71.64	0	0.00
21227.	Verde (verdezapo)	7	100.18	111.07	7	100.00
21228.	Rogin (robogin123)	7	75.61	84.59	3	42.86
21229.	or (ordol)	7	66.82	75.82	5	71.43
21230.	DcThaGoat (crxxzz11)	7	73.95	82.56	7	100.00
21231.	Tony (diceruler)	7	107.18	115.95	7	100.00
21232.	Zach (zachmeikle)	7	60.44	63.92	1	14.29
21233.	Jia En (jiaennn)	7	61.46	79.45	1	14.29
21234.	Henry (flexion)	7	70.83	78.91	4	57.14
21235.	carplist (carplist)	7	42.37	49.37	1	14.29
21236.	Edward (mudgoth)	7	75.11	89.61	3	42.86
21237.	zir (thywolfie)	7	90.28	102.30	2	28.57
21238.	Mbappe (kylian_mbappe)	7	82.94	89.52	3	42.86
21239.	Erblin (gherblino)	7	112.11	118.29	6	85.71
21240.	Sukhendu (shane690)	7	47.60	53.83	1	14.29
21241.	Shafayath (shafayath_jr)	7	65.88	69.24	2	28.57
21242.	Gabby (gubbs_cabubs)	7	92.60	104.66	4	57.14
21243.	Vas (vasgergo)	7	31.86	37.65	1	14.29
21244.	Rashid (sudaneseterrorist)	7	49.37	56.92	2	28.57
21245.	hazem (hazem_1)	7	41.75	48.94	0	0.00
21246.	Manuel (manuelol)	7	40.80	47.98	1	14.29
21247.	Sabyrzhan (olsabyr)	7	46.22	50.70	2	28.57
21248.	Matthew (ankka89)	7	63.28	77.30	2	28.57
21249.	John (100024701)	7	54.15	58.87	2	28.57
21250.	5hadow (kuro5hadow)	7	62.39	71.13	0	0.00
21251.	James (wm370)	7	87.06	92.74	2	28.57
21252.	carson (tenson)	7	94.54	108.01	2	28.57
21253.	Tulen (tulen)	7	78.46	83.32	2	28.57
21254.	RenitentClaw (renitentclaw)	7	78.65	95.25	1	14.29
21255.	Sameer (ssr_)	7	41.88	49.15	0	0.00
21256.	Max (max_gomez_)	7	47.15	50.42	0	0.00
21257.	AK (akraemer)	7	68.50	73.32	0	0.00
21258.	reinaru (reinaru)	7	42.08	49.35	1	14.29
21259.	Kevin (ksogata)	7	90.09	106.67	6	85.71
21260.	[ M E T A ] (metatea)	7	84.93	91.61	3	42.86
21261.	Roshan (eending)	7	65.20	76.77	0	0.00
21262.	Jay (ljay24)	7	113.99	124.28	4	57.14
21263.	Amber (ammbbbeer)	7	89.91	103.79	4	57.14
21264.	Al (cheekybastard)	7	81.60	87.94	2	28.57
21265.	Jaysheel (redchief10)	7	42.84	52.42	1	14.29
21266.	Anastacio (anastacio123)	7	66.01	72.27	2	28.57
21267.	bossing (bosslot)	7	36.77	40.78	0	0.00
21268.	Niko (niko2925)	7	34.90	42.58	2	28.57
21269.	_loeb (loeb___)	7	88.84	98.24	3	42.86
21270.	Ajz (ajzprz)	7	32.87	37.58	0	0.00
21271.	Oceans (mnd8)	7	64.19	74.70	4	57.14
21272.	Alex (awesomepie01)	7	104.81	118.99	4	57.14
21273.	david (etherbyte)	7	59.89	66.64	1	14.29
21274.	Alejandro (alejandrok)	7	46.56	52.12	1	14.29
21275.	Miha (funny_psycho)	7	46.04	52.54	0	0.00
21276.	Dgi (dgi09)	7	51.98	56.89	1	14.29
21277.	starin (starin)	7	111.74	133.24	4	57.14
21278.	Steveee (stephenomenon21)	7	89.13	102.58	4	57.14
21279.	TheDude (sushilbokade)	7	49.45	54.12	0	0.00
21280.	TZ (tzid)	7	66.03	77.68	2	28.57
21281.	Giorgi (tavalf)	7	56.33	65.92	0	0.00
21282.	Muhammad Raheem (_muhammadr...	7	50.48	55.63	0	0.00
21283.	cole (tofubaru)	7	96.93	109.56	4	57.14
21284.	Brhea (beebopowo)	7	74.83	85.06	4	57.14
21285.	Tenzin (daposeidonguy)	7	115.88	130.72	5	71.43
21286.	victoria (vhirsh12)	7	89.35	110.04	5	71.43
21287.	Samira (samira_zareie)	7	24.58	26.92	0	0.00
21288.	Auggie (adogjbaum)	7	91.73	98.85	4	57.14
21289.	Ethan (narwhals64)	7	93.22	117.25	6	85.71
21290.	Jeffrey (googlerjeff)	7	78.51	89.97	3	42.86
21291.	Yous (youssefriz)	7	78.77	88.34	1	14.29
21292.	Autumn (autumnleaf05)	7	51.83	61.84	3	42.86
21293.	Galahad (galahad49)	7	62.61	71.96	0	0.00
21294.	precise (precisexd)	7	49.59	58.36	2	28.57
21295.	CrazyV (bigsloth)	7	86.40	102.86	3	42.86
21296.	Jakub (_imp)	7	88.43	104.63	2	28.57
21297.	Bui Thien (vladimir001)	7	33.45	36.57	4	57.14
21298.	the heroic trout (theheroic...	7	72.49	84.15	3	42.86
21299.	Cartier (cartierflair)	7	101.56	105.70	2	28.57
21300.	Plantpreyer (plantpreyer)	7	74.26	84.11	2	28.57
21301.	Apple (iisapplepie)	7	48.47	51.76	0	0.00
21302.	16 Typh (binh0411)	7	50.08	59.43	1	14.29
21303.	Juan Andrés (darkandy)	7	54.79	62.46	2	28.57
21304.	Srinivas (sublimegallant)	7	51.38	62.84	0	0.00
21305.	Jacob (moderndaypoison)	7	101.13	112.22	1	14.29
21306.	MooMoo18919 (moomoo18919)	7	95.82	113.55	2	28.57
21307.	addison (addisoned)	7	49.37	58.99	2	28.57
21308.	Maliir (maliir)	7	56.09	62.33	1	14.29
21309.	Maks (makso02)	7	60.10	71.42	7	100.00
21310.	mairzydoats_mason (mairzydo...	7	86.55	98.15	1	14.29
21311.	Sakib (mahmud1)	7	88.08	102.66	2	28.57
21312.	mahdy (mahdy7)	7	62.78	72.73	1	14.29
21313.	Shane (maggiepie)	7	66.80	91.98	2	28.57
21314.	Madsin (madsin)	7	49.54	54.25	1	14.29
21315.	Elad (madror1)	7	40.36	48.77	7	100.00
21316.	Dan (maddolis)	7	122.00	139.12	6	85.71
21317.	Mayank (maaynx)	7	67.60	92.71	4	57.14
21318.	LYF (lyf_)	7	55.02	73.20	1	14.29
21319.	Tyler (lydes)	7	91.65	103.18	2	28.57
21320.	Alexis (lxsmndl)	7	77.84	98.72	4	57.14
21321.	Yumzy (lusileven)	7	66.56	75.43	0	0.00
21322.	cade (lunacy_)	7	101.29	108.30	3	42.86
21323.	Luklein (luklein)	7	53.22	58.46	7	100.00
21324.	Dat (ltdat1618)	7	81.10	90.69	6	85.71
21325.	andrei (loomit)	7	77.98	98.36	1	14.29
21326.	Long (longgho)	7	62.69	75.29	2	28.57
21327.	KILLA (longhin_mark)	7	110.53	122.49	3	42.86
21328.	Löncswing (loncswing)	7	69.66	84.84	1	14.29
21329.	Lovro (lolvrol)	7	63.95	72.16	1	14.29
21330.	Lokizypresse_902 (lokizypre...	7	90.07	118.07	4	57.14
21331.	Lluis (lluisteixido)	7	74.48	86.87	2	28.57
21332.	Ashvik (llamma)	7	63.25	81.13	4	57.14
21333.	Paul (llamaking86)	7	86.45	101.94	2	28.57
21334.	LionMane (lion_mane_jellyfish)	7	104.46	122.17	3	42.86
21335.	Daddy (liondj7)	7	78.21	84.24	1	14.29
21336.	lil_vince (lil_vince)	7	81.46	91.67	1	14.29
21337.	liv (lilolive)	7	76.73	86.36	0	0.00
21338.	lili (lilihsu)	7	59.55	65.12	0	0.00
21339.	Liam (liamdaman)	7	52.98	62.90	1	14.29
21340.	UnsaidFred (leophidian)	7	82.78	88.47	4	57.14
21341.	Lê Hùng Luận (lehungluan)	7	59.32	65.57	1	14.29
21342.	Lego (legogurke)	7	53.42	60.28	1	14.29
21343.	Reese (leeseree)	7	90.28	107.29	7	100.00
21344.	benihana (ledecade)	7	117.35	120.82	4	57.14
21345.	Lucas (ldahmm)	7	78.71	89.34	3	42.86
21346.	Wahh (lazydude1)	7	83.30	103.27	2	28.57
21347.	Lazar (lazer123)	7	71.36	82.15	3	42.86
21348.	Catherine (lautherine)	7	67.61	84.84	2	28.57
21349.	Hamza (lasthamzastanding)	7	65.56	70.42	2	28.57
21350.	Lanz (lanz22)	7	92.00	111.05	1	14.29
21351.	Sean (laggermc)	7	89.01	96.54	0	0.00
21352.	Labib (l4bib)	7	92.15	106.53	0	0.00
21353.	George (kyrite)	7	102.93	119.15	4	57.14
21354.	Louise (kyarakutaa)	7	81.26	93.40	3	42.86
21355.	nully (kuwurakkuheddo_)	7	72.38	96.01	0	0.00
21356.	Kushal (kushaltrivedi5)	7	83.68	89.77	2	28.57
21357.	Kushal (kushalkumar)	7	67.15	74.01	2	28.57
21358.	Adam RIP Byron (kurfew)	7	105.58	111.22	2	28.57
21359.	Kurai (kuraiflame)	7	70.17	76.08	1	14.29
21360.	Kuerbiskosar (kuerbiskosar)	7	57.91	64.88	3	42.86
21361.	Only typing will save the w...	7	100.09	106.25	2	28.57
21362.	Kuanysh (kuanyshby)	7	41.91	50.46	2	28.57
21363.	Kristoffer (krioxia)	7	84.60	97.12	5	71.43
21364.	supernoob (krcellucci)	7	86.19	90.76	3	42.86
21365.	Mateusz (krakeusz)	7	84.33	94.43	2	28.57
21366.	Adam (kolcow)	7	52.16	61.32	3	42.86
21367.	Ella (kokookie)	7	60.97	69.76	4	57.14
21368.	Buo YU (koh100)	7	105.68	117.30	4	57.14
21369.	Koco (koco001)	7	36.74	46.69	1	14.29
21370.	Knight (knight_shadow)	7	49.70	52.80	2	28.57
21371.	Knight (knightfury18)	7	45.92	55.04	1	14.29
21372.	Klash (klashghost)	7	89.57	95.81	3	42.86
21373.	kizzgotnorest (kizznorest)	7	44.99	51.53	2	28.57
21374.	Ika (kitkatslr)	7	60.13	63.17	1	14.29
21375.	Toru (kir6meki)	7	86.48	99.26	4	57.14
21376.	Kilty (kilty)	7	96.65	108.20	5	71.43
21377.	Filip (kicklets)	7	81.01	96.69	2	28.57
21378.	Khen (khen2003)	7	90.17	96.41	1	14.29
21379.	Khairosh (khairosh)	7	75.64	87.50	3	42.86
21380.	Keyser (keyserrr)	7	89.18	94.13	2	28.57
21381.	Kevin (kevinm162)	7	73.21	87.71	4	57.14
21382.	Kevin (kevinity)	7	132.62	141.05	7	100.00
21383.	Brett (kermin)	7	110.10	133.03	5	71.43
21384.	h (kenthios)	7	105.62	122.29	2	28.57
21385.	Kelton (kelkidman)	7	58.04	60.80	0	0.00
21386.	kektor (kektorkuan)	7	76.48	93.22	2	28.57
21387.	Anvar (kekstroke)	7	51.17	56.33	0	0.00
21388.	Keith (keith_qwerty)	7	53.72	60.65	0	0.00
21389.	Jeff (keeperofbees)	7	80.13	87.33	4	57.14
21390.	Gábor (kecske116)	7	65.41	75.69	0	0.00
21391.	Keagan (keagonian_16)	7	40.71	51.08	0	0.00
21392.	Kawasaki (kawasaki_314)	7	66.99	79.73	3	42.86
21393.	Ghribi (kaspersaif)	7	50.91	59.63	1	14.29
21394.	Sebastian (karuispa)	7	55.43	65.63	1	14.29
21395.	Caroline (karialyn)	7	108.94	119.95	5	71.43
21396.	Karel (kareldang)	7	81.57	86.83	2	28.57
21397.	Kaphran (kaphran)	7	112.23	126.12	6	85.71
21398.	marc (kangdashman)	7	71.81	83.39	4	57.14
21399.	Jyotirmoy (jyotirmoy_halder)	7	102.53	114.20	4	57.14
21400.	James (jynx0)	7	62.31	68.19	2	28.57
21401.	Joey (jxmp)	7	62.06	74.59	3	42.86
21402.	Jv (jv_2002)	7	79.70	86.93	2	28.57
21403.	Ser (juzser)	7	62.84	66.60	2	28.57
21404.	Alex (just_alex)	7	74.02	94.29	2	28.57
21405.	Rodney (justrodneylee)	7	98.19	102.20	2	28.57
21406.	Joke (justjokeing)	7	109.51	117.11	5	71.43
21407.	Jens (justjens)	7	82.81	95.11	0	0.00
21408.	Nick (justintolerable)	7	66.39	71.65	0	0.00
21409.	Justin (justinjd)	7	131.66	146.02	5	71.43
21410.	Justienz (justienz)	7	92.10	99.04	1	14.29
21411.	justavg (justavg)	7	92.90	99.87	2	28.57
21412.	Jr (jrlynn)	7	28.50	30.38	2	28.57
21413.	JRey (jreyranoco)	7	96.27	102.15	3	42.86
21414.	J (jrazn)	7	77.41	86.84	3	42.86
21415.	JQuez (jquez)	7	103.98	115.87	5	71.43
21416.	Joy (joyisawesome)	7	114.81	127.60	4	57.14
21417.	Jude (joodels)	7	75.20	78.92	3	42.86
21418.	Jon (jon_ackbar)	7	92.29	101.78	2	28.57
21419.	Jons (jonserino)	7	72.79	79.11	4	57.14
21420.	Jon (jonlauws)	7	98.40	106.06	3	42.86
21421.	Jonwin (jonawi)	7	38.86	43.90	0	0.00
21422.	Jonas (jonasbalante123)	7	62.14	65.93	3	42.86
21423.	Jonas (joltux)	7	97.14	100.75	3	42.86
21424.	John (johhpreston)	7	53.21	60.15	2	28.57
21425.	jody (jody10)	7	64.98	79.75	1	14.29
21426.	Jon-Michael (jm_george99)	7	49.99	58.27	2	28.57
21427.	Justin (jmgrim16)	7	73.79	88.96	3	42.86
21428.	jkrkvld (jkrkvld)	7	71.81	83.46	1	14.29
21429.	Joshua (jkim0206)	7	106.77	124.38	7	100.00
21430.	Jamie (jkelly21)	7	98.26	111.95	1	14.29
21431.	Jun (jjjun)	7	99.77	125.09	6	85.71
21432.	Justin (jjallday13)	7	109.46	123.84	5	71.43
21433.	Christopher (jingping)	7	96.92	112.45	2	28.57
21434.	jim (jimbosenior)	7	88.81	100.56	2	28.57
21435.	Jimbo (jimboolio)	7	38.52	40.42	0	0.00
21436.	Jessica (jessicapeng)	7	114.37	125.38	4	57.14
21437.	Jenerikk (jenerikk)	7	89.72	104.51	1	14.29
21438.	jeff (jeffdujon)	7	103.26	120.64	2	28.57
21439.	Jecong (jecong)	7	83.49	100.89	2	28.57
21440.	Jeffrey (jebbythepanda)	7	112.92	126.00	3	42.86
21441.	Jay (jdpthota)	7	92.80	101.39	2	28.57
21442.	jA_eur0 (ja_eur0)	7	105.05	119.46	4	57.14
21443.	Jay (jay_rush)	7	80.00	89.08	5	71.43
21444.	Jayden (jayden_1)	7	62.36	72.11	1	14.29
21445.	Jhun Chester (jaycel19)	7	76.33	94.15	1	14.29
21446.	Jason (jasonfong06)	7	80.76	91.70	3	42.86
21447.	Jasdeep (jasdeepp21)	7	40.43	45.52	0	0.00
21448.	Jake (jarljake)	7	74.02	80.88	0	0.00
21449.	James (jamesvereen)	7	69.55	75.68	2	28.57
21450.	Jakob (jakob170201)	7	57.16	63.22	0	0.00
21451.	Nirav Jain (jainnirav88)	7	65.98	70.70	2	28.57
21452.	Hello (jadensmith7)	7	102.80	114.86	1	14.29
21453.	jacie (jackieblackie3)	7	44.63	49.30	0	0.00
21454.	Conner (jabronee)	7	105.43	111.55	1	14.29
21455.	Bad (iwillgetbetterattyping)	7	70.47	79.13	2	28.57
21456.	Ivo (ivosu_10)	7	64.42	74.63	2	28.57
21457.	Ivan (ivansucksattyping)	7	108.85	130.11	4	57.14
21458.	zn (ittahb)	7	100.56	117.45	3	42.86
21459.	Ichirou (itskotami)	7	69.34	78.03	2	28.57
21460.	Jay-Ar (itsjerr)	7	78.97	99.77	2	28.57
21461.	Allan (itsgam3tyme)	7	98.06	105.41	3	42.86
21462.	Everett (istorm_light)	7	101.98	110.42	6	85.71
21463.	iStealthy (istealthy)	7	115.03	138.84	6	85.71
21464.	Tyler (isharity)	7	86.03	92.62	3	42.86
21465.	Isc (isc30)	7	71.31	80.56	2	28.57
21466.	ironjill (ironjill)	7	89.05	98.59	4	57.14
21467.	iRqx (irex_)	7	101.02	108.75	5	71.43
21468.	Aidan (ireallylovehockey)	7	88.27	99.05	1	14.29
21469.	Matt (iproz)	7	90.22	98.41	2	28.57
21470.	Quang (ionlyvayne)	7	83.83	101.67	4	57.14
21471.	Invincibolos (invincibolos)	7	70.10	82.53	2	28.57
21472.	David (inspectahmellow)	7	81.08	96.02	3	42.86
21473.	indian_lad365 (indian_lad365)	7	60.65	67.10	1	14.29
21474.	Eli (incarnis1)	7	103.57	113.66	2	28.57
21475.	Anshorullah (imugetsu6)	7	86.05	102.25	2	28.57
21476.	Imme (immevdb)	7	78.03	81.23	3	42.86
21477.	Your Mom (imgonnalose69)	7	132.60	141.30	6	85.71
21478.	iluvv (iluvv)	7	90.95	94.30	0	0.00
21479.	Waaa (iiblazed)	7	59.85	64.50	1	14.29
21480.	fuc (ihumpdogs)	7	75.85	80.47	3	42.86
21481.	Kenneth (iflippy)	7	114.74	134.16	3	42.86
21482.	Bob (ieatyou1)	7	71.44	91.82	0	0.00
21483.	Benjamin (idioticben05)	7	103.08	114.05	4	57.14
21484.	icon (iconicck)	7	81.43	93.08	1	14.29
21485.	Stella (iceeigloo)	7	76.53	91.08	2	28.57
21486.	iaxx (iaxx)	7	114.95	131.69	3	42.86
21487.	Ian (ian_k_john)	7	70.62	89.96	0	0.00
21488.	Helen (iamhelenkeller)	7	74.28	78.59	1	14.29
21489.	Ben (hutben)	7	91.65	107.36	4	57.14
21490.	Hunt (huntzhang)	7	81.51	96.84	5	71.43
21491.	Trần Khải Hưng (hunglc...	7	52.77	58.18	2	28.57
21492.	Hossein (hossein_nas)	7	89.19	103.81	4	57.14
21493.	air (hopeberries)	7	81.81	103.18	4	57.14
21494.	Pham (hitpointsss)	7	95.87	112.23	1	14.29
21495.	himanshu (himanshukamani)	7	27.00	30.95	3	42.86
21496.	himaji (himaji)	7	70.91	81.64	2	28.57
21497.	DvorakRacer (higginsishere)	7	103.46	120.27	3	42.86
21498.	Hamza (hhaammzzaa)	7	49.59	60.56	1	14.29
21499.	Henry (hezzmasterflash)	7	42.50	53.06	0	0.00
21500.	HennesseyDrew (hennydrew)	7	89.51	104.09	2	28.57
21501.	Henry (henburger)	7	86.41	99.17	0	0.00
21502.	deckard (hell_bovine)	7	104.32	112.37	4	57.14
21503.	Victor (helixidron)	7	117.87	137.34	3	42.86
21504.	helios (helios69)	7	62.55	72.28	0	0.00
21505.	John (helion_)	7	65.84	69.52	2	28.57
21506.	Kushagr (heavenclaw)	7	34.43	36.78	0	0.00
21507.	vineet (headspace_men)	7	76.98	87.41	3	42.86
21508.	Hazem (hazemmy)	7	73.66	80.34	1	14.29
21509.	Hatcheco (hatcheco)	7	67.41	77.32	2	28.57
21510.	Mehedi Hasan Emo (hasanemo654)	7	71.61	79.77	2	28.57
21511.	Harrius (harrius)	7	95.30	109.00	1	14.29
21512.	Ignas (harord)	7	49.61	55.01	3	42.86
21513.	HARN0LD (harn0ld)	7	80.01	87.39	1	14.29
21514.	Harm (harm_)	7	79.75	84.91	6	85.71
21515.	Hari (hari_prasath_25)	7	55.42	61.37	2	28.57
21516.	Xcentrick (hardiksince1987)	7	46.21	56.73	0	0.00
21517.	benhalfpap (happypappy21)	7	123.53	131.53	3	42.86
21518.	Harrison (happyg)	7	110.69	124.54	4	57.14
21519.	Bish (haogy101)	7	80.76	93.31	4	57.14
21520.	HASG (hamzaelgarhy)	7	30.56	34.64	1	14.29
21521.	Hamschi (hamschi)	7	74.81	82.02	3	42.86
21522.	hahaha (hahaha6969)	7	85.21	101.09	2	28.57
21523.	Harry (h3h3pul4t0r)	7	133.87	139.02	4	57.14
21524.	Tájpolósch (gunnhallur)	7	84.00	90.48	3	42.86
21525.	Jamie (gumboll)	7	78.62	87.82	6	85.71
21526.	jeremy (grrmee)	7	87.19	94.18	3	42.86
21527.	Gray (grayhollow)	7	82.56	94.82	3	42.86
21528.	Siddhartha (gravito12345)	7	94.43	108.93	3	42.86
21529.	Rocco (grapefruit95)	7	73.66	80.40	0	0.00
21530.	Gracie (graciemyers123)	7	78.22	88.73	4	57.14
21531.	Elias (gottabefast)	7	125.26	137.17	4	57.14
21532.	Tylor (goofy_goober2006)	7	54.29	67.30	0	0.00
21533.	Gonzalo (gonzalocl1024)	7	49.96	59.91	0	0.00
21534.	Gold_Borg (gold_borg)	7	44.46	58.14	5	71.43
21535.	Konnie (goldentiny)	7	52.91	61.67	1	14.29
21536.	lucas (godofthegods111)	7	53.19	58.04	1	14.29
21537.	godofpainTR (godofpaintr)	7	85.16	99.10	7	100.00
21538.	Gmlord (gmlord)	7	66.88	83.75	1	14.29
21539.	Tiago (glinski)	7	67.47	79.50	2	28.57
21540.	johnni (gleaned)	7	83.80	93.60	1	14.29
21541.	Gislaa (gislaaa)	7	96.00	103.33	3	42.86
21542.	Gio (giniguy)	7	88.34	98.66	3	42.86
21543.	NinjR (gingerninjr)	7	105.98	115.99	1	14.29
21544.	Gilson (gilsoncav)	7	53.42	58.53	1	14.29
21545.	GidbinN (gidbinn)	7	82.31	88.95	3	42.86
21546.	Gaby's (ggaby)	7	38.60	44.05	0	0.00
21547.	gabriel (gfox66)	7	96.38	104.54	6	85.71
21548.	George (georgecook)	7	51.82	62.61	0	0.00
21549.	C:\cmd (geodev)	7	52.57	62.27	3	42.86
21550.	James (gemvoo)	7	95.10	109.62	4	57.14
21551.	Gerry (gchenfc)	7	98.18	103.49	3	42.86
21552.	Grant (gbuff)	7	87.24	94.80	1	14.29
21553.	gavin (gavyoung)	7	30.85	35.86	2	28.57
21554.	Gav (gav576)	7	123.26	141.02	4	57.14
21555.	Dennis (gardpm)	7	90.14	106.67	5	71.43
21556.	Gabboxl (gabboxl)	7	60.15	61.71	1	14.29
21557.	D (g1ddriver)	7	70.16	75.84	0	0.00
21558.	Vaeciar (fusionn)	7	101.34	115.63	3	42.86
21559.	furzoz (furzoz)	7	95.95	105.95	3	42.86
21560.	funny (funnybus)	7	81.93	100.71	3	42.86
21561.	Anh (fujiwarakazuki)	7	93.37	105.06	0	0.00
21562.	jaacouub (fsnxward)	7	111.06	123.22	3	42.86
21563.	Pedrovski (frosteye)	7	51.00	60.31	5	71.43
21564.	Frisk00 (frisk00)	7	85.88	105.93	2	28.57
21565.	Weeb (fredfaye)	7	76.33	84.20	0	0.00
21566.	Vlad (foxonwave)	7	70.07	76.67	2	28.57
21567.	hola (foocaaat)	7	80.34	94.51	3	42.86
21568.	Georgia (fobpatdmcr)	7	54.57	63.01	1	14.29
21569.	Fliqqr (fliqqr)	7	89.25	95.17	2	28.57
21570.	fajar (fjr123)	7	19.51	32.42	0	0.00
21571.	FireHydra (firehydra)	7	51.09	52.86	1	14.29
21572.	Winsharp (fimannax)	7	68.54	82.63	3	42.86
21573.	Vishal (fieryhydra)	7	86.02	102.50	4	57.14
21574.	Fideon (fideon)	7	113.84	133.33	4	57.14
21575.	FHVirus (fhvirus)	7	73.58	87.81	1	14.29
21576.	Few (fewhakko)	7	81.42	93.06	1	14.29
21577.	untechno (fersist)	7	120.42	134.31	3	42.86
21578.	Ferc (ferco)	7	53.44	66.24	2	28.57
21579.	FeN11x (fen11x)	7	112.81	125.04	4	57.14
21580.	Felix (feliksen)	7	80.00	88.60	2	28.57
21581.	Feela (feela)	7	53.83	59.97	0	0.00
21582.	Steve (feedthejoe)	7	78.58	85.42	1	14.29
21583.	FEDERICO (fedecochi)	7	68.20	71.13	3	42.86
21584.	Tyrone (fastesthackertyper)	7	115.64	132.63	4	57.14
21585.	Farzaan (farzaan)	7	45.07	48.74	1	14.29
21586.	FartESport (fartesport)	7	58.29	69.57	3	42.86
21587.	Free Palestine (farmahorro)	7	105.41	119.43	2	28.57
21588.	@fahmi_2504 (fahmiramadhan)	7	80.65	87.89	0	0.00
21589.	Dave (fadedave)	7	79.80	88.63	5	71.43
21590.	Ian (exeboi)	7	72.37	81.54	1	14.29
21591.	e (ex21424)	7	99.33	108.35	3	42.86
21592.	Teez (evofury)	7	81.47	89.43	3	42.86
21593.	E (etyperacer)	7	78.98	88.92	2	28.57
21594.	Erly (erlynorbel)	7	78.82	86.03	5	71.43
21595.	irand (eppyprime)	7	69.69	78.22	2	28.57
21596.	deez (epicguy69)	7	51.97	57.61	0	0.00
21597.	Ramya (envisage)	7	62.74	70.31	1	14.29
21598.	Dusa (enjdusan)	7	85.13	95.77	1	14.29
21599.	Jason (energetichay)	7	116.63	136.38	3	42.86
21600.	Emin (eminspeedtyper)	7	91.47	108.61	3	42.86
21601.	Francis (emeritusninoy)	7	108.72	117.53	4	57.14
21602.	Emek (emekc)	7	81.07	97.40	3	42.86
21603.	Diego (el_villas)	7	74.00	82.95	1	14.29
21604.	Elmo (elmotlk)	7	76.04	83.37	1	14.29
21605.	ekoth (ekoth)	7	89.09	98.97	3	42.86
21606.	Striker09125 (eiren233)	7	71.58	77.32	2	28.57
21607.	Miles (eightmiles27)	7	89.36	103.69	3	42.86
21608.	Hsu (eh643027)	7	76.09	84.75	1	14.29
21609.	EenPotjeMetJam (eenpotjemet...	7	79.72	87.81	2	28.57
21610.	Marcia (eedoit)	7	73.95	79.23	3	42.86
21611.	Ed (edwinl707)	7	74.46	84.49	3	42.86
21612.	Raf (edorableraf)	7	74.31	84.72	3	42.86
21613.	Edigar (edigar)	7	48.68	55.06	0	0.00
21614.	Ed (edfed)	7	60.20	82.46	2	28.57
21615.	Liz (easwans)	7	97.03	119.14	1	14.29
21616.	Suyog (earthisflat)	7	92.27	104.73	0	0.00
21617.	Luis (ealjkl)	7	58.64	65.38	3	42.86
21618.	anagolr (eagle0523)	7	127.62	136.94	6	85.71
21619.	Dylan Smith (dylanfromwinni...	7	105.39	119.66	4	57.14
21620.	Duong (duong_n)	7	89.59	117.32	1	14.29
21621.	andrew (duncan01)	7	70.39	77.11	4	57.14
21622.	Dulappy (dulappy)	7	83.11	89.25	2	28.57
21623.	Jason (duckyboi)	7	92.24	100.94	4	57.14
21624.	daniel (dsong56)	7	100.89	113.23	2	28.57
21625.	Terminator (dr_nefarious)	7	97.44	111.06	5	71.43
21626.	Samad (dr_drakonix)	7	89.17	98.19	2	28.57
21627.	drowez1 (drowez1)	7	96.56	109.11	2	28.57
21628.	Eshelmen (drguru)	7	102.44	112.79	4	57.14
21629.	light (drawyeh)	7	86.42	94.69	3	42.86
21630.	Joakim (draghman)	7	74.25	107.32	6	85.71
21631.	Ali (dracius16)	7	100.85	115.26	2	28.57
21632.	Andrea (dr3vv)	7	66.67	75.03	3	42.86
21633.	Don (dpease7894)	7	139.14	149.05	5	71.43
21634.	Do (dothanhtungnb602)	7	56.61	58.93	0	0.00
21635.	Dr.D (donghuh601)	7	84.47	99.24	2	28.57
21636.	Dominus (dominuslucifer)	7	101.95	111.97	5	71.43
21637.	Dominic (dominiccarroll)	7	132.77	151.08	3	42.86
21638.	Guy (doge_btw)	7	91.28	103.09	3	42.86
21639.	Peter (doc_chungles)	7	91.82	108.04	1	14.29
21640.	Dman27 (dman27)	7	68.26	73.26	4	57.14
21641.	djchicken (djchicken)	7	64.39	74.42	1	14.29
21642.	Ali (divine_typer)	7	59.34	69.82	1	14.29
21643.	Dilhan (disgruntled_lemon)	7	68.63	77.57	4	57.14
21644.	soup (dirtsoup)	7	73.62	85.25	0	0.00
21645.	dimcho (dimisoma12)	7	46.00	51.92	0	0.00
21646.	Dewi (dibdabdebby)	7	57.85	64.25	7	100.00
21647.	Alaa (diamondtda)	7	78.91	87.99	2	28.57
21648.	māvi (dhsnxz)	7	68.89	73.80	1	14.29
21649.	Dexter (dexterkun16)	7	63.37	79.79	2	28.57
21650.	yo (demailman)	7	115.46	131.05	4	57.14
21651.	follow (deleonhle)	7	132.74	145.94	4	57.14
21652.	Riley (dedalus)	7	42.09	53.39	1	14.29
21653.	debois (debois)	7	84.21	96.43	3	42.86
21654.	Veros (deadtwinkz)	7	48.85	57.41	3	42.86
21655.	Dylan (dddking)	7	107.96	119.34	4	57.14
21656.	Davr (davr)	7	68.54	75.67	2	28.57
21657.	David (davgoeck)	7	66.08	73.70	3	42.86
21658.	Darkmacsek9 (darkmacsek9)	7	61.64	78.43	0	0.00
21659.	John (danred12344)	7	84.17	96.93	5	71.43
21660.	daniel (daniel8028)	7	89.83	104.06	4	57.14
21661.	Daniel (danguydudebro)	7	96.59	108.14	7	100.00
21662.	Danyal (danazeem)	7	65.50	76.85	5	71.43
21663.	Deyl (daleaparejado)	7	83.39	94.28	3	42.86
21664.	Dakeku (dakeku123)	7	110.06	120.76	5	71.43
21665.	dag (dagweg)	7	56.71	64.66	0	0.00
21666.	Daffa (daffagusmara31)	7	84.64	90.19	2	28.57
21667.	Jeremy (daddystravinsky)	7	108.30	132.03	3	42.86
21668.	Elia (d0inky)	7	76.10	85.91	1	14.29
21669.	d0bu (d0bucookie)	7	92.34	111.39	3	42.86
21670.	David (cydmium)	7	84.40	92.97	3	42.86
21671.	nixon (cxboy)	7	74.52	83.36	7	100.00
21672.	🍓 (crustyyy)	7	38.23	41.01	0	0.00
21673.	Matthew (crucifix13)	7	104.92	116.16	3	42.86
21674.	Daniel (crossfittypist)	7	128.43	140.59	4	57.14
21675.	Joseph (cronul)	7	84.63	96.14	4	57.14
21676.	Oliver (crocell)	7	68.15	78.91	2	28.57
21677.	Cristian (cristian0017)	7	76.35	82.74	1	14.29
21678.	crisna (crisnaxx)	7	41.33	46.13	1	14.29
21679.	Tony (creampuffy)	7	99.43	123.38	3	42.86
21680.	Raphael (crazydrmad)	7	64.85	81.98	2	28.57
21681.	CrazyConrad (crazyconrad)	7	72.15	82.64	5	71.43
21682.	Kayli (crackerjap)	7	93.69	98.46	6	85.71
21683.	Nima (cosmocrat)	7	113.74	129.92	3	42.86
21684.	coraline (coraline19)	7	73.38	83.91	2	28.57
21685.	day (const_bored)	7	55.44	73.18	4	57.14
21686.	conjae (conjae)	7	95.70	106.14	4	57.14
21687.	Colt (coltthenark)	7	93.88	107.73	3	42.86
21688.	⁤ (collin_)	7	56.14	62.88	3	42.86
21689.	Coels (collie321)	7	72.12	98.28	4	57.14
21690.	cold_blood (cold_blood)	7	49.84	52.51	0	0.00
21691.	Collin (code_gs)	7	94.69	102.42	4	57.14
21692.	Henry (codaassasin)	7	128.44	141.20	3	42.86
21693.	Cobra (cobra03)	7	101.28	115.45	3	42.86
21694.	sand (cloudth)	7	69.30	80.99	1	14.29
21695.	Clickau (clickau)	7	87.28	90.88	1	14.29
21696.	George (cleaves)	7	71.37	78.71	1	14.29
21697.	Clarb (clarb)	7	75.99	86.98	2	28.57
21698.	CK (ckokobean)	7	99.22	120.75	6	85.71
21699.	tstats[Cisco516] (cisco516)	7	74.58	82.53	1	14.29
21700.	Chuse (chuse)	7	80.73	86.41	2	28.57
21701.	chumchumlol (chumchumlol)	7	85.23	90.24	3	42.86
21702.	Chuby_j (chuby_j)	7	76.89	86.03	7	100.00
21703.	Chronical (chronical_)	7	131.61	142.34	4	57.14
21704.	(chromehearts)	7	125.68	135.58	6	85.71
21705.	Chris (chriss_maoo)	7	79.74	98.75	5	71.43
21706.	Choosecake (choosecake)	7	77.97	87.56	1	14.29
21707.	stephen (chonky_boi)	7	60.14	68.16	1	14.29
21708.	CHKR (chkr)	7	87.21	94.53	2	28.57
21709.	Harishraj (chintubro)	7	85.42	92.36	1	14.29
21710.	Chezhiyan (chezhiyan)	7	76.61	86.48	2	28.57
21711.	Chris (chee_ms)	7	97.30	106.97	1	14.29
21712.	mew (cheeboard)	7	103.24	110.14	4	57.14
21713.	Cory (chamblin)	7	109.87	116.98	3	42.86
21714.	ASAP LiL Fat Chalsy (chalscc)	7	71.32	79.18	1	14.29
21715.	Chadgoomba (chadgoomba)	7	71.04	89.42	1	14.29
21716.	cbdm (cbdm)	7	78.72	95.08	0	0.00
21717.	CARL (carlkwan)	7	102.01	113.55	4	57.14
21718.	Kamjue (camweb_01)	7	43.58	46.51	1	14.29
21719.	Calen (calen64)	7	89.02	96.87	5	71.43
21720.	Caleb (caleb1243)	7	99.26	109.72	1	14.29
21721.	van (cakeblanket)	7	102.70	110.40	2	28.57
21722.	Caffeine (caffeinereptile)	7	53.96	59.59	1	14.29
21723.	Wesley (c3tangies)	7	89.04	97.23	2	28.57
21724.	by (by_law)	7	56.56	64.55	3	42.86
21725.	David (butterdawg)	7	83.27	86.98	2	28.57
21726.	Maun (bubblojoe)	7	71.48	77.11	0	0.00
21727.	Julia (bskdjewels)	7	93.93	108.10	3	42.86
21728.	Ben (brokenace)	7	68.63	83.74	6	85.71
21729.	Brojo (brojokm)	7	55.29	59.84	0	0.00
21730.	Brian (briankusuma)	7	53.23	61.68	2	28.57
21731.	Luca (brentspiner)	7	61.02	68.52	3	42.86
21732.	Brennan (brennanfisher)	7	69.50	82.18	1	14.29
21733.	Brandon (brandondodododo)	7	95.18	102.61	1	14.29
21734.	Brandon (brandoncc)	7	61.33	78.87	2	28.57
21735.	Wayne (boucherwayne78)	7	75.24	87.88	6	85.71
21736.	bowei (botheburp)	7	63.80	70.46	1	14.29
21737.	Boshi (boshiwastaken)	7	89.93	102.69	7	100.00
21738.	0902bo (boowie27)	7	44.16	47.85	0	0.00
21739.	Space Cowboy (booqueefius69...	7	108.67	135.16	5	71.43
21740.	Bongos (bongos_h2o)	7	51.67	61.99	0	0.00
21741.	Boncho (bochl1n)	7	98.51	114.12	5	71.43
21742.	Bluey (blu_ey)	7	87.72	97.46	1	14.29
21743.	Christopher Szabo (bluepizza2)	7	56.04	68.96	1	14.29
21744.	Alex (blueninja11103)	7	86.08	102.51	1	14.29
21745.	晴 (blorfo)	7	44.47	46.30	0	0.00
21746.	blobfish (blobfishk)	7	85.20	94.16	1	14.29
21747.	Cdrc (blo5)	7	68.58	85.51	0	0.00
21748.	Aakash (blaze_type)	7	49.83	54.99	1	14.29
21749.	Blast (blast_craft)	7	72.24	78.63	2	28.57
21750.	tstats[blannk] (blannk)	7	41.57	56.84	0	0.00
21751.	Bladehunter (bladeyz)	7	57.15	67.24	1	14.29
21752.	BK (bk21)	7	80.59	88.69	1	14.29
21753.	⠀⠀⠀ (bioluminescent)	7	89.33	99.67	2	28.57
21754.	Alex (bigbrian123)	7	74.14	78.12	0	0.00
21755.	Aidan (biccythiccy)	7	117.39	124.07	5	71.43
21756.	Bhumika (bhumika111)	7	25.32	27.27	2	28.57
21757.	betterscramblelikeanegg (be...	7	89.44	99.68	2	28.57
21758.	Alfred (bestluxeu)	7	83.98	88.85	2	28.57
21759.	Brutale (benvan)	7	82.26	91.53	4	57.14
21760.	(benkemal)	7	78.29	83.55	3	42.86
21761.	Beksultan (beksultan2001)	7	55.49	65.69	0	0.00
21762.	William (beholder92)	7	82.63	99.48	2	28.57
21763.	Brad (beardedbradtv)	7	106.28	116.52	7	100.00
21764.	beansnboges (beansnboges)	7	81.78	97.15	2	28.57
21765.	Blake (bcdelrey)	7	83.71	91.84	2	28.57
21766.	Keong (baygonstroberi)	7	73.37	85.13	3	42.86
21767.	baxis (baxis)	7	61.97	66.80	0	0.00
21768.	Jonathan (baldunker1)	7	73.10	79.71	1	14.29
21769.	mohammad (ballisticfpz)	7	66.49	71.37	0	0.00
21770.	Dario (baldoius)	7	97.49	113.25	7	100.00
21771.	Badral (badralz)	7	84.50	90.14	6	85.71
21772.	Ahmed (backslashero)	7	85.53	95.45	3	42.86
21773.	ai fachri (a_ifachri)	7	60.19	67.16	2	28.57
21774.	azef (azef)	7	65.89	70.09	3	42.86
21775.	John (azaza909)	7	130.25	147.14	5	71.43
21776.	ayoub50 (ayoub50)	7	82.06	89.97	3	42.86
21777.	Andrew (axi_andrew)	7	79.68	88.11	1	14.29
21778.	CapooLife (awesomevincent)	7	70.74	89.72	1	14.29
21779.	B (awadf)	7	40.15	45.67	1	14.29
21780.	Andre (avmoura)	7	74.16	96.49	1	14.29
21781.	Avinash (avee_nash)	7	62.25	73.06	1	14.29
21782.	Austin (austins350)	7	129.04	142.17	3	42.86
21783.	Aidan (attan090)	7	70.28	79.41	1	14.29
21784.	Atlasov (atlasnik)	7	21.42	23.78	1	14.29
21785.	Atira (atirakun)	7	94.58	106.65	4	57.14
21786.	Atiqur (atiqrr)	7	40.06	44.65	1	14.29
21787.	Aaron (atg2142)	7	96.37	114.41	1	14.29
21788.	astrid (astridtherat)	7	60.47	76.33	1	14.29
21789.	Asta (astadweller)	7	80.03	105.85	4	57.14
21790.	Aslan (aslanchan7)	7	78.42	87.15	1	14.29
21791.	TheChosenOne (askthewizard)	7	104.49	119.80	3	42.86
21792.	askryuzaki (askryuzaki)	7	92.03	112.84	5	71.43
21793.	Ashot (ashotmovsisyan)	7	37.30	41.21	0	0.00
21794.	Ashish (ashish14)	7	62.55	71.79	1	14.29
21795.	Rohan (ashavijaysukne)	7	64.47	72.68	1	14.29
21796.	Heemy (asdfm)	7	86.90	106.61	3	42.86
21797.	ArtyGaming (artygaming)	7	104.52	116.99	7	100.00
21798.	Arthur (arthur_007)	7	67.25	79.15	1	14.29
21799.	Artemis (artemyx)	7	77.65	86.21	5	71.43
21800.	arrantfox (arrantfox)	7	42.50	48.79	2	28.57
21801.	. (__random__)	7	92.20	103.03	2	28.57
21802.	damn (_victor667_)	7	55.93	65.76	0	0.00
21803.	Dewey (_dewey)	7	108.43	114.06	2	28.57
21804.	Federico (_cali)	7	99.78	112.45	4	57.14
21805.	Alex (_alwang_)	7	77.83	89.12	2	28.57
21806.	Ales (_ales)	7	103.05	111.37	4	57.14
21807.	Zimri (zygnus)	7	111.24	133.26	4	57.14
21808.	Zyan25 (zyan2525)	7	78.27	84.26	6	85.71
21809.	Hans (zozo800)	7	70.36	76.21	0	0.00
21810.	joe (zoybls)	7	63.07	75.77	0	0.00
21811.	zoomfrog (zoomfrog)	7	95.54	104.62	3	42.86
21812.	HollowAri (zokkuu)	7	65.03	70.72	1	14.29
21813.	ziolson (ziolo1)	7	66.16	81.41	2	28.57
21814.	e (zimboboys)	7	96.91	103.31	3	42.86
21815.	jack (zero18)	7	73.99	79.36	1	14.29
21816.	Khanon (zero1010_)	7	61.53	69.61	2	28.57
21817.	Hopelezz (zerloth)	7	85.98	97.59	1	14.29
21818.	Loong (zenloong)	7	94.58	100.84	3	42.86
21819.	Zed (zedhabibi)	7	59.44	64.52	6	85.71
21820.	Zeddy (zeddyx)	7	90.15	99.18	4	57.14
21821.	Zchob (zchob)	7	70.82	77.31	5	71.43
21822.	Neeraj (zapidox)	7	42.35	48.05	1	14.29
21823.	Zajd (zajd36)	7	105.34	114.52	3	42.86
21824.	Zaid (zaid_ansari)	7	47.99	54.72	1	14.29
21825.	Ho (zahid11704023)	7	43.05	49.77	1	14.29
21826.	Dwi (yvbinjk)	7	77.39	95.27	3	42.86
21827.	Rataro (yuugokku)	7	79.86	97.29	1	14.29
21828.	Michael (yt_m1gamer2020)	7	65.59	71.76	3	42.86
21829.	Aaron (yoyoyonono)	7	106.82	120.28	3	42.86
21830.	Sasuke (yosasuke)	7	103.89	120.84	4	57.14
21831.	yian (yian31415)	7	68.98	74.87	3	42.86
21832.	Yenthe (yenthefromghent)	7	43.94	47.18	2	28.57
21833.	Yeldos (yeldosmanap)	7	76.44	80.53	2	28.57
21834.	Rohan (yeetarted)	7	103.44	109.45	4	57.14
21835.	Sam (ye3et)	7	64.96	67.42	1	14.29
21836.	Yaye (yaye2002)	7	29.52	34.47	2	28.57
21837.	Yatin (yatin18)	7	53.85	58.46	2	28.57
21838.	Yashvir (yashvir_kothari)	7	36.89	41.83	2	28.57
21839.	XxDarkSIdexX (xxdarksidexx)	7	30.67	42.46	2	28.57
21840.	Eli (xutt)	7	74.13	85.84	6	85.71
21841.	reduce (xreduce)	7	150.44	163.72	7	100.00
21842.	Steve (xenoxinius)	7	104.09	114.56	5	71.43
21843.	Barton (xbarton)	7	101.12	107.24	0	0.00
21844.	Jacob (xavior_x)	7	93.81	100.00	4	57.14
21845.	Jake (wyol)	7	71.74	77.83	2	28.57
21846.	Alex (wu2481632)	7	124.21	134.39	4	57.14
21847.	Gerlat (wtcher1066)	7	53.21	57.79	1	14.29
21848.	yung (woahthereyungman)	7	67.27	88.61	0	0.00
21849.	Wo1v3r (wo1v3r)	7	113.37	120.62	3	42.86
21850.	Wissa (wissaa)	7	36.33	47.37	2	28.57
21851.	wabi (wisabi)	7	109.43	123.80	7	100.00
21852.	Willie (williewho)	7	77.83	89.60	0	0.00
21853.	Wikedtik (wikedtik)	7	101.88	107.37	1	14.29
21854.	glo (whytho_)	7	92.84	102.78	1	14.29
21855.	Llihcon (whoflayslikeme)	7	84.97	89.42	2	28.57
21856.	Sarp (whitechocolatee)	7	69.65	75.99	3	42.86
21857.	Dots (wheremydots)	7	85.20	101.81	1	14.29
21858.	N3gativeZero (whatsupbrandon)	7	85.03	106.44	3	42.86
21859.	Wesley (wesilii)	7	103.14	115.49	3	42.86
21860.	Warren (warlover94)	7	93.58	101.12	0	0.00
21861.	Damian (waninggibbous)	7	70.76	73.86	3	42.86
21862.	Wallace (wallacetwo)	7	99.12	104.72	4	57.14
21863.	Walker (walkersutton)	7	91.06	116.01	3	42.86
21864.	Wacky (wakcy)	7	84.69	101.41	4	57.14
21865.	SRW (waifuthebest)	7	36.37	43.20	0	0.00
21866.	WaffleAbs (waffleabs)	7	88.64	105.28	1	14.29
21867.	Chris (w1ndow)	7	115.14	130.51	3	42.86
21868.	Varun (vslala)	7	83.45	94.94	2	28.57
21869.	​ (vonunov)	7	144.33	164.03	2	28.57
21870.	thach (vngoct1)	7	68.98	79.18	0	0.00
21871.	Vlada (vlaki)	7	74.30	82.40	4	57.14
21872.	Patrick (violaissimmo)	7	94.20	104.66	3	42.86
21873.	Villads (vilmk)	7	35.96	42.64	0	0.00
21874.	Viktor (viktro_touch_type)	7	86.03	95.44	1	14.29
21875.	Vivek (viivek)	7	114.71	131.04	5	71.43
21876.	NO (veryaveragetyper)	7	59.44	63.19	2	28.57
21877.	Hello (venox11)	7	50.03	57.26	3	42.86
21878.	Darcy (vendus13)	7	60.55	70.42	1	14.29
21879.	Dias (vdios)	7	65.47	70.89	3	42.86
21880.	Revil (vasat401)	7	43.28	48.83	0	0.00
21881.	Amara (vainguardian29)	7	45.69	53.44	0	0.00
21882.	Eva (vagabionda)	7	64.37	70.41	1	14.29
21883.	Narkotik (vacban)	7	83.22	96.84	1	14.29
21884.	Ikhbayar (u_mad_bruh_ikhee)	7	66.22	69.75	1	14.29
21885.	uwunation (uwunation)	7	99.29	109.24	3	42.86
21886.	Usurious (usurious_disc730)	7	88.58	99.43	6	85.71
21887.	usu (usufails)	7	65.77	75.78	1	14.29
21888.	datmeko (uralbeking)	7	80.60	86.83	2	28.57
21889.	undeclared (undeclared)	7	104.71	130.83	6	85.71
21890.	Ultrabars- (ultrabars)	7	65.90	94.79	0	0.00
21891.	Uksza (uksza)	7	74.54	93.15	1	14.29
21892.	Tomo (tzxb018)	7	84.36	92.88	1	14.29
21893.	Mohaimenul (typun)	7	31.20	37.67	0	0.00
21894.	typo11 (typo11)	7	58.04	67.57	2	28.57
21895.	mu (typetypetypetypetype)	7	48.66	56.53	0	0.00
21896.	Nibir (typer_de_random)	7	94.76	99.43	2	28.57
21897.	Christian (typeger)	7	116.20	132.72	5	71.43
21898.	kyel (txkyel)	7	87.24	91.33	1	14.29
21899.	TuxKnight (tuxknight)	7	64.39	73.77	1	14.29
21900.	Tuomas (tumaas)	7	84.34	93.45	3	42.86
21901.	yuan (ttkomalake)	7	34.31	37.41	0	0.00
21902.	Tom (ttaffy)	7	97.77	112.93	2	28.57
21903.	Tycho (tspider4)	7	94.09	114.46	2	28.57
21904.	Ahmad (truemagix)	7	49.51	53.77	1	14.29
21905.	Always (tromin)	7	103.01	120.73	3	42.86
21906.	Triz (triz)	7	111.87	125.87	6	85.71
21907.	_trillbits_ (trillbits)	7	62.36	66.87	1	14.29
21908.	tran (tranwantdie)	7	92.79	105.74	3	42.86
21909.	Tomas (tomas_649)	7	52.72	61.73	0	0.00
21910.	Tumarbek (tom4ke)	7	58.53	67.92	1	14.29
21911.	János (tokumeikun)	7	64.73	77.99	1	14.29
21912.	Michael (todfelton)	7	59.60	64.53	0	0.00
21913.	Tj0027 (tj0027)	7	39.14	43.81	0	0.00
21914.	Tim (timmaayyt)	7	71.10	86.30	0	0.00
21915.	Tim (tigothy)	7	95.89	111.92	2	28.57
21916.	PianOreo (thunderoreoz)	7	105.25	122.36	6	85.71
21917.	Thunder (thunder2910)	7	74.30	83.17	2	28.57
21918.	thummachart (thummachart)	7	55.76	61.91	0	0.00
21919.	Thomas (thomastran02)	7	73.90	84.27	0	0.00
21920.	Virginia (thomas11)	7	76.53	88.27	2	28.57
21921.	The Ro Driver (the_ro_driver)	7	76.87	92.27	2	28.57
21922.	David (the_pursuit)	7	102.72	118.36	7	100.00
21923.	Willow (the_kirin_master)	7	106.09	132.64	6	85.71
21924.	Hali (the_holy_hali)	7	61.18	67.79	7	100.00
21925.	Elias (the_dovah)	7	63.95	70.04	0	0.00
21926.	Derek (thewarrior_13th)	7	71.91	84.58	1	14.29
21927.	Joe (therunner09)	7	98.37	107.42	3	42.86
21928.	Alex (therodge)	7	63.62	76.47	1	14.29
21929.	Jesse (thepaperman)	7	48.95	57.55	4	57.14
21930.	Nam (thenewdawn97)	7	46.49	55.32	1	14.29
21931.	thelegendary08 (thelegendar...	7	77.81	85.36	4	57.14
21932.	Andrew (thedeathlyhallows)	7	122.77	142.17	4	57.14
21933.	TheDasher (thedasherz)	7	54.02	61.00	1	14.29
21934.	thatguy (thatguy577)	7	53.73	59.78	1	14.29
21935.	thatchipz (thatchipz)	7	77.53	90.88	4	57.14
21936.	BEST 54 wpm (terass)	7	33.18	37.55	2	28.57
21937.	Tentic (tentic)	7	99.02	108.18	5	71.43
21938.	Tellenar (tellenar)	7	82.36	100.00	2	28.57
21939.	moyu (teledodol)	7	70.27	86.32	3	42.86
21940.	Tea (teawee)	7	63.59	73.30	2	28.57
21941.	Troy (tdserapio)	7	100.62	108.22	5	71.43
21942.	Nurlan (tasmaev)	7	27.05	30.54	1	14.29
21943.	venus (taroxtaroxtaro)	7	101.89	127.88	5	71.43
21944.	Tarneem (tarneem)	7	73.38	85.76	3	42.86
21945.	Cory (tarisant)	7	136.49	148.05	7	100.00
21946.	Tanwa (tanwa)	7	71.42	83.53	1	14.29
21947.	tanami (tanami)	7	130.19	154.79	7	100.00
21948.	Tamuna (tamuna314)	7	58.30	61.79	1	14.29
21949.	Slow (tal4565)	7	49.02	59.93	0	0.00
21950.	B (tajooki)	7	87.16	105.37	3	42.86
21951.	Ahmed (taftaf)	7	69.68	80.93	2	28.57
21952.	Tachibana (tachibanayui)	7	60.83	79.17	2	28.57
21953.	Ruiji (taburnalluigi)	7	49.66	65.68	4	57.14
21954.	TeeCee (taboka)	7	36.80	44.45	1	14.29
21955.	Tom (t0mas_colemak)	7	77.85	90.98	2	28.57
21956.	Luke (synthsequence)	7	97.74	105.93	3	42.86
21957.	Symawi (symawi)	7	73.11	82.84	1	14.29
21958.	ed (sxxos)	7	79.35	88.26	3	42.86
21959.	sentim3ntal1 (sweet_malaak)	7	84.88	97.78	1	14.29
21960.	Sway (swaycuisway)	7	106.54	122.22	2	28.57
21961.	Zihaku (swarmfirehd)	7	62.94	74.83	5	71.43
21962.	Maggie (swagmag)	7	85.26	96.60	2	28.57
21963.	Kartswag (swagkid)	7	100.40	109.29	5	71.43
21964.	svime (svime)	7	87.48	111.91	3	42.86
21965.	Chibichan (supersam317)	7	100.77	110.70	4	57.14
21966.	Ashish (superman_11)	7	58.08	63.14	1	14.29
21967.	Drew (supercoolgamer2)	7	31.64	45.15	0	0.00
21968.	sirloc (sunsinghny19)	7	90.91	96.34	5	71.43
21969.	sumukha_puranik (sumukha)	7	62.00	73.24	0	0.00
21970.	suleman (suleman33)	7	101.30	126.05	5	71.43
21971.	Subeesh (subeesh18)	7	70.84	76.99	2	28.57
21972.	EMILYMYGODDESS (crlsh_)	7	88.75	102.60	5	71.43
21973.	Struedelcat (struedelcat)	7	119.39	131.99	4	57.14
21974.	Martin (stroj)	7	71.93	92.01	2	28.57
21975.	stoozy (stoozy)	7	90.46	96.92	2	28.57
21976.	rat (stinkypissboy)	7	93.40	112.05	6	85.71
21977.	Steven (stevie03)	7	108.49	127.12	3	42.86
21978.	Stephanie (stephycatz69)	7	51.45	64.50	0	0.00
21979.	Adriel (stephencarry)	7	94.70	113.70	1	14.29
21980.	steli2 (steli2)	7	111.26	127.07	5	71.43
21981.	Ben (steamhawk)	7	44.15	57.42	1	14.29
21982.	Star (star_sailorx)	7	112.46	133.25	4	57.14
21983.	starscr3am (starscr3am)	7	45.02	50.24	0	0.00
21984.	Robin (stapler8)	7	107.22	124.52	4	57.14
21985.	Sourav (srax)	7	97.96	114.80	3	42.86
21986.	squidite (squidite)	7	59.45	74.20	1	14.29
21987.	Tom (spritelad)	7	86.94	95.91	3	42.86
21988.	oliver (spou)	7	113.95	122.31	4	57.14
21989.	Lucius (spirituslucius)	7	44.45	53.26	0	0.00
21990.	Krystin (spetz)	7	75.13	83.69	2	28.57
21991.	Martin (speedonthestreet)	7	83.29	89.86	7	100.00
21992.	speedguy1 (speedguy1)	7	83.92	89.35	4	57.14
21993.	Spanner (spanner77)	7	107.52	112.93	2	28.57
21994.	Daniel (spades_syn)	7	59.01	66.50	2	28.57
21995.	Jacob (soolseem)	7	93.16	105.03	1	14.29
21996.	dhoanqa (sombowde)	7	72.90	80.88	0	0.00
21997.	Soham (sohammukherjee2011)	7	79.54	93.22	2	28.57
21998.	Soerth (soerth)	7	61.99	65.39	0	0.00
21999.	Snow (snowjack)	7	81.40	91.98	2	28.57
22000.	Carlos (snorlax7652)	7	52.18	78.27	4	57.14
22001.	tstats[sneakyturtle333634] ...	7	72.75	77.12	2	28.57
22002.	Jan (smilingjan)	7	84.23	96.91	1	14.29
22003.	Baszucki_Files (slownoobtyper)	7	123.27	138.12	4	57.14
22004.	77 (slithernoah)	7	63.35	77.05	1	14.29
22005.	Aidan (slippp3r)	7	75.76	83.61	1	14.29
22006.	Peter (slapchop18)	7	127.96	134.92	5	71.43
22007.	Sklort (skl0rt)	7	76.52	90.80	2	28.57
22008.	Kevin (skillz9600)	7	72.90	84.57	2	28.57
22009.	Bubly (skelpadderidderen)	7	55.16	72.81	0	0.00
22010.	SG Keyboard Warrior (singap...	7	100.44	120.56	3	42.86
22011.	Silas (silvanus)	7	70.77	74.59	2	28.57
22012.	Timmy (sillytimmy)	7	98.87	113.46	4	57.14
22013.	Silly (sillygeeses)	7	77.20	84.99	2	28.57
22014.	516 (sig_sauers)	7	85.47	99.28	4	57.14
22015.	Chara (sig_num)	7	83.45	89.94	3	42.86
22016.	SighingSlider (sighingslider)	7	80.86	90.84	3	42.86
22017.	Sigurdur (siggi84)	7	62.84	69.10	5	71.43
22018.	Jed (shreyasgm)	7	109.68	118.85	4	57.14
22019.	Shrek Of Justice (shrek_of_...	7	113.81	127.95	4	57.14
22020.	. (shrekenberg)	7	122.72	137.22	3	42.86
22021.	Jonathan (shoopdasoup)	7	97.09	133.50	6	85.71
22022.	a (shibss)	7	87.85	100.10	3	42.86
22023.	Shelyn (shelynxj)	7	79.55	84.81	3	42.86
22024.	Shaleen (shaleenx)	7	91.26	97.49	1	14.29
22025.	shaik (shahul_shaik)	7	78.95	88.30	2	28.57
22026.	Shahriar (shahriar_shojib)	7	50.96	59.36	0	0.00
22027.	Nick (serpuns)	7	53.00	60.25	2	28.57
22028.	Daniel (sergiogahyrof)	7	81.26	91.69	4	57.14
22029.	Enrico (serafino89)	7	63.49	71.39	2	28.57
22030.	Klein (senserox)	7	64.47	71.18	2	28.57
22031.	sedney (sedneyl)	7	55.16	62.94	0	0.00
22032.	Screen (screendoor)	7	79.46	87.53	0	0.00
22033.	Joshua (scpectre)	7	110.00	123.17	3	42.86
22034.	DrCharlesS (scpdrcs)	7	59.17	64.65	2	28.57
22035.	pi (schi678)	7	110.19	119.55	4	57.14
22036.	Sawyer (sawyer_)	7	75.73	84.67	4	57.14
22037.	Saniya (sashimisan_)	7	72.40	79.03	1	14.29
22038.	Sang Sabil (sangsabil217)	7	59.09	67.01	1	14.29
22039.	Sam (sandwhales)	7	56.74	65.24	3	42.86
22040.	Olof (sammipk)	7	97.56	116.87	5	71.43
22041.	Sam (samhsmith)	7	79.47	86.29	3	42.86
22042.	sameer (sameerlol)	7	118.30	129.28	4	57.14
22043.	Samo (sakra)	7	56.38	69.37	1	14.29
22044.	Saeed (saeedfx)	7	55.90	65.90	0	0.00
22045.	sachin (sachin1234502)	7	42.80	46.07	0	0.00
22046.	Sabyasachi (saba10000)	7	48.75	56.54	0	0.00
22047.	ryouinuma (ryouinuma)	7	75.01	82.12	0	0.00
22048.	ryderrt (ryderrt)	7	55.48	76.31	0	0.00
22049.	Ryan (ryanm42)	7	96.00	115.87	3	42.86
22050.	Holly (runningnurse)	7	72.39	86.88	2	28.57
22051.	Sourav (rubberboa)	7	94.99	99.63	1	14.29
22052.	Rex (rrrreeexx)	7	80.64	94.30	2	28.57
22053.	Rotala (rotala_macrandra)	7	96.19	106.34	3	42.86
22054.	rota (rota22)	7	75.66	80.79	1	14.29
22055.	rosina (rosina_24)	7	82.73	90.24	1	14.29
22056.	Ozan Can (romuyloyloy)	7	58.70	65.89	1	14.29
22057.	Craving (romboowner)	7	93.50	100.25	2	28.57
22058.	Justin (rogreat)	7	102.97	117.10	4	57.14
22059.	Rockfeller (rock_messi)	7	49.39	56.39	0	0.00
22060.	Jan (robi21mlg)	7	83.66	97.21	5	71.43
22061.	road_to_150wpm (road_2_150wpm)	7	136.73	147.45	5	71.43
22062.	Redox (riyaushino)	7	91.85	101.67	2	28.57
22063.	riswan (riswan_1212)	7	37.26	41.58	0	0.00
22064.	Riptide (riptidetheta)	7	91.07	107.47	3	42.86
22065.	Ri (rijizin)	7	63.57	69.93	1	14.29
22066.	Loz (rightytypey)	7	92.18	108.69	2	28.57
22067.	R Dizzle (ridzilla)	7	109.27	126.14	2	28.57
22068.	Patrick (rick_pat)	7	85.96	96.45	5	71.43
22069.	Radu (rhadoo611)	7	70.59	83.19	2	28.57
22070.	Derek (rexyoda)	7	49.92	59.75	2	28.57
22071.	Paul (retropixel99)	7	96.85	107.34	1	14.29
22072.	Rex (redrex)	7	85.45	96.29	1	14.29
22073.	RedEye (redeye)	7	96.99	112.63	3	42.86
22074.	Lam (rebmal101)	7	71.11	78.45	4	57.14
22075.	Matthew (realmtd)	7	66.74	80.11	2	28.57
22076.	Harold (realmagilla)	7	81.55	102.04	6	85.71
22077.	Griz (realgrizzle123)	7	97.38	107.46	1	14.29
22078.	Aaron Martin (reala)	7	37.55	39.14	1	14.29
22079.	Reagan (reagss)	7	71.63	85.39	3	42.86
22080.	Jeff (rcmaximus)	7	66.50	76.45	1	14.29
22081.	M (razorneck)	7	65.10	73.64	2	28.57
22082.	RAPdawg (rapdawg530)	7	111.55	128.78	3	42.86
22083.	Komol Kunty Rajib (rajib_ra...	7	49.47	54.31	0	0.00
22084.	roadto120 (raiyan2423)	7	99.38	109.36	3	42.86
22085.	Rain (rainliofficial)	7	95.08	108.87	3	42.86
22086.	raider (raider93)	7	48.30	57.16	0	0.00
22087.	Rahil (rahilu14)	7	104.13	118.09	6	85.71
22088.	youtube.com/TechieDheeraj (...	7	68.19	72.01	1	14.29
22089.	really cute ;) (qwnnnnnnn)	7	64.53	74.50	2	28.57
22090.	Joshuasdf (qwertoid)	7	115.23	122.30	5	71.43
22091.	Type (quic_qwerty)	7	85.12	93.38	2	28.57
22092.	QuicoDel8 (quico)	7	71.91	77.65	1	14.29
22093.	Qubz (qubz)	7	73.22	83.15	1	14.29
22094.	Martina (qkmartina)	7	82.09	99.53	1	14.29
22095.	Pyrouge (pyrouge)	7	105.79	117.22	5	71.43
22096.	Putte (puttepowertyper)	7	43.14	53.09	0	0.00
22097.	putss (putssimply)	7	97.79	110.24	3	42.86
22098.	Puss (pussboi)	7	94.18	118.75	4	57.14
22099.	the solution to pollution i...	7	127.93	184.40	5	71.43
22100.	Ian (pugami)	7	63.98	76.88	3	42.86
22101.	ptsd (ptsd92)	7	70.24	79.18	1	14.29
22102.	ulreich (prozeal_)	7	77.31	88.18	1	14.29
22103.	Omar (prospart)	7	73.20	76.35	2	28.57
22104.	Sahil (prosahil)	7	59.05	77.11	1	14.29
22105.	Abir (proabir)	7	54.81	62.09	0	0.00
22106.	Pranav (preyneyv)	7	108.57	133.32	5	71.43
22107.	lukas (preston_frag)	7	47.88	55.34	0	0.00
22108.	precarious (preciousgravy)	7	175.62	191.68	4	57.14
22109.	Prasad (prasad1999)	7	50.43	56.63	1	14.29
22110.	Pranman (pranman123)	7	90.32	94.69	6	85.71
22111.	M A T I A S (praise_duarte)	7	147.33	178.53	5	71.43
22112.	Bear (pr0d19y)	7	84.84	89.43	1	14.29
22113.	tstats[potlid43] (potlid43)	7	76.47	91.57	2	28.57
22114.	POZ (poooz)	7	44.95	49.30	0	0.00
22115.	Nigerian (poobear_)	7	100.26	125.97	3	42.86
22116.	Slueben (poijn)	7	97.68	117.80	6	85.71
22117.	pogfatherz (pogfatherz)	7	93.04	98.73	3	42.86
22118.	Patrick (pjtimmon)	7	65.69	72.08	2	28.57
22119.	Parker (pistolpeterulez)	7	44.35	51.33	1	14.29
22120.	Lidia (pinguinthecity)	7	65.06	117.56	6	85.71
22121.	Ryan (pingu51472)	7	112.18	124.08	3	42.86
22122.	pineapple (pineappleink)	7	84.94	96.30	5	71.43
22123.	Mathias (pijaye)	7	76.66	90.03	2	28.57
22124.	Kercy (phoenixgod213)	7	65.92	75.33	5	71.43
22125.	Arnav (phoenixcrusher369)	7	93.71	105.77	3	42.86
22126.	Philip (philip79)	7	34.90	37.22	0	0.00
22127.	pheck (pheck_)	7	52.35	59.14	2	28.57
22128.	Anish (phantom2201)	7	51.58	57.63	2	28.57
22129.	Eli (peytoneli)	7	106.87	114.22	2	28.57
22130.	Petersoon (peterson_brasil)	7	53.04	61.74	1	14.29
22131.	prison mate pete (petermh)	7	118.48	152.98	5	71.43
22132.	Davids (petally)	7	96.54	108.32	4	57.14
22133.	( ' - ' ) (pengun)	7	71.07	79.26	4	57.14
22134.	Keqings Left Pinky (penguin...	7	106.54	120.26	4	57.14
22135.	pear (pearuchiha)	7	55.65	63.90	1	14.29
22136.	Pawaox (pawaox)	7	117.33	135.84	4	57.14
22137.	Colin (pathetic_worm)	7	69.57	75.73	2	28.57
22138.	Pavel (patcm)	7	94.54	106.66	0	0.00
22139.	Nathaniel (pastafarianjew)	7	71.24	83.38	1	14.29
22140.	pastabooth (pastabooth)	7	97.03	115.68	5	71.43
22141.	Papa (papawadee)	7	106.63	113.25	2	28.57
22142.	Pan (pan_grammoun)	7	52.98	58.63	1	14.29
22143.	Denys (owlydesigner)	7	73.50	81.86	1	14.29
22144.	Ovidiu (ov_ant)	7	67.35	82.40	3	42.86
22145.	Overpriced (overpriced)	7	98.72	104.14	1	14.29
22146.	Oussama (oussamanh)	7	76.13	81.06	3	42.86
22147.	eye8 (othereye)	7	71.68	85.06	1	14.29
22148.	Jack (orka_qwerty)	7	99.80	122.40	1	14.29
22149.	orangeoldfish (orange_oldfish)	7	134.99	153.78	6	85.71
22150.	Meredith (onemoremerry)	7	92.63	104.53	1	14.29
22151.	omegadeath88 (omegadeath88)	7	93.59	110.02	1	14.29
22152.	papryczan (olgi69)	7	82.33	91.55	3	42.86
22153.	Owen (ojt_11)	7	53.35	57.37	2	28.57
22154.	Wx (oh_hi)	7	78.92	92.84	2	28.57
22155.	OhmFreeTime (ohmmeejaa25)	7	58.36	68.11	2	28.57
22156.	David (ogwoohoo)	7	86.69	96.30	1	14.29
22157.	Ognjennad (ognjennad)	7	95.65	104.79	3	42.86
22158.	DIego (ogeid)	7	68.68	72.77	1	14.29
22159.	oddrationale (oddrationale)	7	70.70	82.87	1	14.29
22160.	S (nyansyde)	7	80.68	90.91	0	0.00
22161.	Nyambat (nyambat)	7	75.30	81.84	2	28.57
22162.	Nuwan (nuwang69)	7	66.40	78.52	0	0.00
22163.	Noxcoma (noxcoma_)	7	67.66	79.50	4	57.14
22164.	Victor (notvector)	7	129.66	145.40	5	71.43
22165.	Noriphe (noriphe)	7	81.51	92.10	2	28.57
22166.	Chad (noodlestrings)	7	71.64	92.70	1	14.29
22167.	din (nonquitdondoe)	7	113.77	138.15	7	100.00
22168.	toni (noilly)	7	97.60	121.93	2	28.57
22169.	Vi (nocivi38)	7	64.31	67.65	6	85.71
22170.	Stig (no1irishstig)	7	71.16	93.29	5	71.43
22171.	Vanja (njavex)	7	50.82	59.97	2	28.57
22172.	Nishanth (nishanth_s)	7	63.52	71.25	1	14.29
22173.	Nil (niljovanovic)	7	60.17	68.39	1	14.29
22174.	Nikhil (niks_2012)	7	53.10	60.84	1	14.29
22175.	Nikki (niknak13)	7	95.17	117.43	1	14.29
22176.	Daniel (niggusted)	7	123.56	135.68	7	100.00
22177.	Nico (nico_e)	7	92.32	114.61	4	57.14
22178.	Niconii (nicopai_)	7	72.51	80.62	3	42.86
22179.	Nicole (nicoleogden)	7	106.95	114.03	5	71.43
22180.	Sebastian (nichtmonti)	7	81.71	101.71	1	14.29
22181.	Jason (nhtiger)	7	87.53	105.42	2	28.57
22182.	* (ngong19)	7	105.92	125.61	1	14.29
22183.	Himanshu (neutron_star)	7	64.46	69.47	0	0.00
22184.	nether (nethersynth)	7	128.47	158.21	3	42.86
22185.	makaio (neosifr)	7	107.62	135.36	3	42.86
22186.	Joseph (neonjc)	7	126.43	143.06	5	71.43
22187.	Nehal (nehaldamania)	7	76.66	83.83	4	57.14
22188.	Nechmo (nechmo111)	7	56.01	63.94	0	0.00
22189.	Nathaniel (nebuejin)	7	80.18	87.04	1	14.29
22190.	Nebula (nebakki)	7	85.09	104.04	4	57.14
22191.	jeffery (nctu_jeffery)	7	51.57	54.91	0	0.00
22192.	Naziman (naziman)	7	57.48	62.98	2	28.57
22193.	Nazar Berkimbay (nazar1005)	7	65.08	74.36	2	28.57
22194.	Ryan (nayrx14)	7	92.96	110.29	3	42.86
22195.	Nayely (nayelytyperacer)	7	74.96	96.47	1	14.29
22196.	nayan (nayan268)	7	56.74	60.79	2	28.57
22197.	Joseph (naughtyboy1337)	7	91.19	101.29	1	14.29
22198.	Nate (nate11)	7	104.95	113.94	3	42.86
22199.	Temirlan (nalrimet)	7	59.08	67.01	1	14.29
22200.	Nahin (nahin_r)	7	53.19	55.77	0	0.00
22201.	miyu (naevis)	7	77.62	87.40	0	0.00
22202.	nabil (nabl)	7	94.37	108.49	2	28.57
22203.	Mickey (m_qwerty)	7	101.13	109.32	2	28.57
22204.	Sagar (mystic0570)	7	46.77	54.53	0	0.00
22205.	Hải (mymomismad)	7	105.95	118.97	4	57.14
22206.	moca (mxca)	7	48.50	56.63	1	14.29
22207.	Joshua (mvpalmighty)	7	84.70	94.24	1	14.29
22208.	MustardNuts (mustardnuts)	7	61.61	76.90	2	28.57
22209.	Museum (museum25)	7	81.82	92.56	1	14.29
22210.	Murphy (murphsmurf)	7	81.71	87.54	3	42.86
22211.	Munyoudoum (munyoudoum)	7	84.07	93.88	1	14.29
22212.	Muffin (muffinboi5)	7	71.20	85.58	7	100.00
22213.	Muffin (mufff)	7	53.69	72.70	3	42.86
22214.	Peter (mubida23)	7	67.63	77.99	2	28.57
22215.	Mike (mtwomey)	7	61.91	71.88	2	28.57
22216.	M$NEYMAIZE (msneymaize)	7	87.08	105.97	3	42.86
22217.	ur boy (msinghh)	7	108.54	125.00	2	28.57
22218.	matthew (mshau)	7	108.52	124.73	5	71.43
22219.	brian (mr_ritz)	7	40.97	45.28	1	14.29
22220.	Mrs.lechuga (mrslechuga)	7	103.22	121.61	6	85.71
22221.	BigRocks (mrpluto23)	7	58.15	65.68	2	28.57
22222.	Roar (raor) (mrmcmurple)	7	80.76	97.86	2	28.57
22223.	Richard (mrm3man)	7	87.77	97.74	2	28.57
22224.	Lovre (mrlovre)	7	72.47	77.93	1	14.29
22225.	Ronalds (mrbonis)	7	94.53	101.10	4	57.14
22226.	Jimmy (motivatorman)	7	91.22	98.14	3	42.86
22227.	Mokegang420 (mokegang420)	7	120.15	130.28	4	57.14
22228.	Moghazi (moghaazi)	7	54.52	57.47	0	0.00
22229.	Moe (moetez1)	7	75.58	82.91	3	42.86
22230.	M (mma05)	7	62.01	76.14	1	14.29
22231.	k (mkoo)	7	85.69	97.31	3	42.86
22232.	Dimitar (mitronix)	7	45.83	58.62	1	14.29
22233.	mithilesh (mithilesh3110)	7	75.31	82.42	2	28.57
22234.	Mitchell (mitchell807273)	7	93.90	113.03	2	28.57
22235.	🚗💨 (miredirex)	7	126.76	143.55	4	57.14
22236.	spectating (minhxuan2507)	7	150.77	187.12	7	100.00
22237.	Ming (mings7)	7	78.74	93.41	3	42.86
22238.	milord (milordbruh)	7	64.87	76.22	5	71.43
22239.	MikeB (mikebfromdk)	7	88.98	107.44	1	14.29
22240.	Lux (miintyonyt)	7	64.20	67.53	2	28.57
22241.	Miilo (miilo_)	7	64.69	80.96	4	57.14
22242.	Mighty (mighty_kurac)	7	95.41	106.72	6	85.71
22243.	micah (mickeylmao)	7	86.36	102.57	3	42.86
22244.	Mike (mhaimowitz)	7	87.35	91.89	2	28.57
22245.	Muaz (mfone)	7	51.08	66.08	1	14.29
22246.	Mark (mesm)	7	96.93	114.34	2	28.57
22247.	Lauren (merpling)	7	101.25	113.31	5	71.43
22248.	Ribub (mercury_millpond)	7	102.03	110.44	3	42.86
22249.	Dragon (menacingdragon)	7	108.07	118.27	6	85.71
22250.	Melody (melody313)	7	106.52	111.76	3	42.86
22251.	Salman (meistr)	7	67.43	83.15	0	0.00
22252.	Mehmed (mehmed_)	7	45.62	54.48	1	14.29
22253.	Mees (meeszon)	7	82.20	89.61	2	28.57
22254.	Seny (mdeekay)	7	99.10	112.81	3	42.86
22255.	mcshizney (mcshizney)	7	76.41	91.63	1	14.29
22256.	꧁༒☬刀Ξ℣ł₦ ☬�...	7	87.08	104.07	3	42.86
22257.	Josef (mcblyat2)	7	93.06	103.77	2	28.57
22258.	mazer (mazer706)	7	107.09	116.10	4	57.14
22259.	Mayreel (mayreel)	7	130.00	151.62	7	100.00
22260.	Bilal (maxty)	7	44.57	56.16	1	14.29
22261.	S (mavzero)	7	42.68	48.99	0	0.00
22262.	Matt (mattyice445)	7	94.94	102.35	3	42.86
22263.	Matt (mattsanruk)	7	77.37	89.41	2	28.57
22264.	Matt (mattrmel)	7	90.50	117.89	3	42.86
22265.	Justin (maticulous)	7	89.72	106.16	4	57.14
22266.	Mathfeli (mathfeli)	7	42.67	45.75	0	0.00
22267.	SparklMastr (mastrsparkl)	7	111.08	124.96	3	42.86
22268.	Manvik (mastikhorgamer)	7	80.68	89.74	2	28.57
22269.	Daniel (masterfiregg)	7	101.66	125.37	7	100.00
22270.	Andre (mastergamernerd)	7	92.26	101.84	1	14.29
22271.	Massi (massi_goat)	7	107.37	119.52	3	42.86
22272.	Masquerade (masq_uerade)	7	60.91	78.23	2	28.57
22273.	Martin (martinmadis)	7	80.99	92.53	2	28.57
22274.	Mark (markisimo)	7	64.99	74.27	1	14.29
22275.	Mark (mark69420)	7	60.96	68.18	1	14.29
22276.	Marissa (marissalim)	7	80.87	93.73	2	28.57
22277.	Mardon (mapukhuanna)	7	56.13	60.84	1	14.29
22278.	mandryx (mandryx)	7	55.33	63.62	1	14.29
22279.	mandar (mandar139)	7	61.44	70.05	0	0.00
22280.	MamyPoko (mamypoko)	7	106.71	113.62	6	85.71
22281.	scopersz (scopersz)	6	54.90	66.33	1	16.67
22282.	Scooty2Hooty (scooty2hooty)	6	47.67	50.80	1	16.67
22283.	ScarlettSu (scarlettsu)	6	56.28	68.74	2	33.33
22284.	Sebastian (sayferfordyce)	6	88.64	102.34	3	50.00
22285.	Isaac (saxxie)	6	96.46	106.81	6	100.00
22286.	Sat (satwargamer)	6	45.49	52.39	1	16.67
22287.	Satvik (satty010)	6	37.85	40.91	0	0.00
22288.	Sarah (sarahsyg)	6	73.89	80.33	2	33.33
22289.	Sapah (sapah)	6	102.85	118.95	3	50.00
22290.	santol (santol69)	6	104.98	120.03	4	66.67
22291.	Sam (samwilkie)	6	85.67	104.18	2	33.33
22292.	Ben (samuraiknuth)	6	106.47	120.29	5	83.33
22293.	sammy (sammysosa151)	6	69.70	98.79	1	16.67
22294.	Sam (sammy3118)	6	68.18	70.65	0	0.00
22295.	Sam (sama13)	6	44.80	51.12	1	16.67
22296.	Sam (sam629)	6	79.08	94.38	4	66.67
22297.	Samantha (sam7597)	6	105.30	116.96	4	66.67
22298.	Sam (sam22258)	6	48.99	58.59	0	0.00
22299.	DickK (saltybokchoy)	6	113.78	131.00	6	100.00
22300.	SaIidat (salidat)	6	49.29	56.43	1	16.67
22301.	saladie (saladie)	6	93.08	111.18	4	66.67
22302.	Samy (sakashi96)	6	50.72	55.92	0	0.00
22303.	Anna (sajtiann)	6	54.90	60.87	1	16.67
22304.	Sagnik (sagniks)	6	67.33	86.11	4	66.67
22305.	Alisher (saegl)	6	73.11	90.83	4	66.67
22306.	shahriar (sadid007)	6	32.81	35.69	0	0.00
22307.	Kieran (sackerpunch)	6	48.73	57.12	2	33.33
22308.	adder (sabienadderley03)	6	65.77	80.46	0	0.00
22309.	Winson (s1nc3d4rk_)	6	57.73	66.20	2	33.33
22310.	Ryan (rypenguin219)	6	97.97	108.66	1	16.67
22311.	Ryan (rybruh)	6	61.05	71.01	0	0.00
22312.	ref (rwef)	6	120.41	131.24	3	50.00
22313.	Alex (running_wind)	6	75.25	85.79	0	0.00
22314.	mp3hunters.com (rubyist)	6	109.26	120.79	2	33.33
22315.	Ryan (rtblast70)	6	77.39	84.28	1	16.67
22316.	RAVINDER (rsainichd)	6	63.13	69.21	2	33.33
22317.	Rachel (rrachell)	6	111.55	122.24	5	83.33
22318.	Rema1000 (rqsxxth)	6	75.87	94.39	3	50.00
22319.	numba 1 (royalocean5)	6	129.02	139.74	5	83.33
22320.	Rosie (rosepose90)	6	87.52	101.03	1	16.67
22321.	Cristiano (ronaldo_is_back)	6	44.06	52.47	0	0.00
22322.	Rokas (rokasspeedy)	6	37.79	44.56	0	0.00
22323.	Tyler (rockinrollo)	6	96.26	109.65	3	50.00
22324.	Raj (rocket_boyz)	6	33.97	41.69	0	0.00
22325.	RoboDom711 (robodom711)	6	59.45	71.09	0	0.00
22326.	Robochu (robochu)	6	69.68	78.81	2	33.33
22327.	Robo (robo0110101)	6	66.59	74.37	3	50.00
22328.	Connor (robin_hearts)	6	91.53	96.28	3	50.00
22329.	Robin (robinkim2020)	6	78.73	95.01	1	16.67
22330.	Robert (roberty579)	6	77.08	87.21	1	16.67
22331.	Graham (rizyyyy)	6	86.27	101.50	6	100.00
22332.	Rikard (rikardny)	6	98.76	112.79	3	50.00
22333.	Rico (ricoencabo)	6	101.88	123.06	4	66.67
22334.	Justin (ribena_ais)	6	88.64	98.92	3	50.00
22335.	rey (reyreyes)	6	82.26	88.09	3	50.00
22336.	Rex (rexsauce)	6	109.57	123.45	2	33.33
22337.	Runar Eskild (reskild)	6	48.15	54.13	0	0.00
22338.	Kamil (replikant)	6	102.03	110.77	6	100.00
22339.	movingpoopscary (renzyr12)	6	89.58	98.18	3	50.00
22340.	Ren (reniyuh)	6	65.99	72.83	2	33.33
22341.	relative (relativemadlad)	6	88.54	95.20	0	0.00
22342.	Reefer (reefer_rr)	6	85.73	107.76	2	33.33
22343.	Red (redromel)	6	82.90	92.21	5	83.33
22344.	Floris (redmachine)	6	85.74	90.34	1	16.67
22345.	Redempt1on (redempt1on)	6	93.49	102.60	3	50.00
22346.	Lily (redborne24)	6	40.50	43.94	1	16.67
22347.	aracely (rawracelyy)	6	69.22	79.86	1	16.67
22348.	Aneesh (rationaliguana99)	6	68.31	71.91	2	33.33
22349.	Dust (rathard)	6	97.95	115.55	4	66.67
22350.	Jacob (randomtown)	6	40.03	46.97	1	16.67
22351.	Ramram (ramram01)	6	69.89	76.84	2	33.33
22352.	RamenWizard (ramenwizard)	6	103.67	118.55	3	50.00
22353.	RamBow (rambowrice)	6	54.12	62.53	0	0.00
22354.	Ralph (ralph7c2)	6	66.05	75.74	0	0.00
22355.	Rakhymzhan (rakhymzhan01)	6	29.65	31.48	0	0.00
22356.	rainbowcow (rainbowcoww)	6	83.74	105.06	2	33.33
22357.	radu (radu215)	6	68.94	79.98	0	0.00
22358.	Anton (racketen)	6	92.31	108.44	2	33.33
22359.	R3TURN (r3turn777)	6	89.13	102.66	3	50.00
22360.	Owen (qwert8143)	6	65.60	75.50	4	66.67
22361.	quibby (quibbytm)	6	97.22	109.90	4	66.67
22362.	Gusti (gustilks15)	6	55.48	60.19	2	33.33
22363.	aera (qkrdlfk)	6	42.99	49.10	0	0.00
22364.	pwoi (pwoi)	6	81.83	99.71	3	50.00
22365.	Qing Chi (pumbinking)	6	55.52	60.29	1	16.67
22366.	PuiPui (puipuicar)	6	60.87	73.47	1	16.67
22367.	Kristel (pugspark)	6	51.65	57.88	0	0.00
22368.	Patrick (ptarka05)	6	75.56	87.83	2	33.33
22369.	Jesse (psychoticcooki)	6	63.75	67.78	2	33.33
22370.	Proximitynow (proximitynow)	6	90.43	115.54	3	50.00
22371.	Protocol (protocol93344)	6	42.22	54.06	2	33.33
22372.	Luka (propalica)	6	101.67	110.69	5	83.33
22373.	Professor (professorprotons)	6	74.41	82.13	4	66.67
22374.	YT (pri3t4iz)	6	44.18	55.57	0	0.00
22375.	prevolt (prevolt)	6	93.98	105.76	4	66.67
22376.	Pratik (pratikwadhai)	6	47.17	52.78	2	33.33
22377.	pqpqlaowosjkd (pqpqlaowosjkd)	6	90.57	96.24	3	50.00
22378.	PPTheJoker (pp_the_joker)	6	33.73	40.06	0	0.00
22379.	💨💨💨 (ppraisethesun)	6	64.33	67.90	1	16.67
22380.	Posty (postymaloney)	6	73.92	79.46	0	0.00
22381.	Positive (positiv)	6	47.96	56.46	1	16.67
22382.	Bill (porousrock)	6	93.05	99.76	0	0.00
22383.	M (poptropica979)	6	109.46	124.96	2	33.33
22384.	Phuwit (pooweeh)	6	38.14	42.43	5	83.33
22385.	Andrew (poor_hobo)	6	74.87	81.45	0	0.00
22386.	dick (pools2)	6	100.41	112.37	5	83.33
22387.	._. (pookao19)	6	60.71	68.46	4	66.67
22388.	Quentin (pompomlam)	6	70.50	95.19	4	66.67
22389.	Pluto (pluto_the_typer)	6	45.62	48.11	0	0.00
22390.	Placebo (placebo_ct)	6	73.95	79.85	1	16.67
22391.	PRINCE (pk226894)	6	71.29	75.98	1	16.67
22392.	Tyler (pixel_ty)	6	91.89	101.63	1	16.67
22393.	Hafizh (pislm)	6	73.14	84.56	1	16.67
22394.	Jake (pinkclifford_typing)	6	91.49	114.72	2	33.33
22395.	A (pinebug)	6	77.77	84.73	1	16.67
22396.	Atiar (pigonantibiotics)	6	46.56	49.92	0	0.00
22397.	Pico (pico8)	6	43.65	47.54	0	0.00
22398.	Madie (picassy)	6	85.51	92.12	5	83.33
22399.	Joseph (peterepeat)	6	101.17	103.47	0	0.00
22400.	Pete (pete2015)	6	66.34	70.78	0	0.00
22401.	Thomas (pentaa)	6	90.65	96.74	3	50.00
22402.	PenguinTypist (penguinfun)	6	115.35	130.17	3	50.00
22403.	MuiePonta (pelerin)	6	74.84	90.20	1	16.67
22404.	Steven (peebsdasavage)	6	64.02	72.65	0	0.00
22405.	Pawi (pawiboy36)	6	131.63	152.13	3	50.00
22406.	paul (paulzzzz)	6	58.98	68.92	1	16.67
22407.	Angus (patroc1us)	6	76.05	81.96	1	16.67
22408.	Pasquiggles (pasquiggles)	6	41.78	48.91	0	0.00
22409.	Param (paramt)	6	110.82	120.15	6	100.00
22410.	Parafinico (parafinico)	6	63.55	69.27	3	50.00
22411.	Ethan (paprikapp)	6	47.51	62.13	0	0.00
22412.	Kurtis (pandabear4774)	6	90.02	102.40	3	50.00
22413.	Tyson (pajarito)	6	95.60	106.67	5	83.33
22414.	PAFxd (pafxd)	6	90.95	108.33	3	50.00
22415.	P1qo (p1qo)	6	65.86	76.88	2	33.33
22416.	powder (p0wder)	6	58.37	64.47	0	0.00
22417.	Owen (owenc1272)	6	108.11	122.28	1	16.67
22418.	Owen (owen12)	6	76.02	94.50	2	33.33
22419.	Akira (oven_bunny)	6	41.97	52.46	1	16.67
22420.	Chase (otumo)	6	89.86	103.20	3	50.00
22421.	Otamurod (otamurod_2003)	6	27.15	30.33	0	0.00
22422.	Splint (osamabinsmokin)	6	87.28	103.24	2	33.33
22423.	N (ortizn)	6	114.33	127.58	6	100.00
22424.	Orlando (orlandor3)	6	109.26	124.35	3	50.00
22425.	Tom (originaliteit)	6	82.72	90.31	2	33.33
22426.	Scott (oooops)	6	128.04	133.30	4	66.67
22427.	iice (oofr)	6	74.13	84.53	0	0.00
22428.	Zams0 (oofman666)	6	92.70	98.89	3	50.00
22429.	Ooflord (ooflord)	6	64.82	86.33	1	16.67
22430.	onlyskee (onlyskeelol)	6	55.41	61.64	2	33.33
22431.	Billy (onlychance)	6	63.75	74.61	4	66.67
22432.	Barry (oniyxx)	6	76.12	81.18	1	16.67
22433.	stav (onions127)	6	50.11	59.77	2	33.33
22434.	임아라 (onglaxynx)	6	58.25	61.30	1	16.67
22435.	¹°”ˆ˜¨ 𝐎ϻ ¨˜ˆ...	6	62.52	73.04	2	33.33
22436.	not (omgtheworst)	6	107.00	123.04	6	100.00
22437.	omar (omar_sabry)	6	38.32	42.74	2	33.33
22438.	Om3G4 (om3g4)	6	91.16	113.41	3	50.00
22439.	okki (okkiniikko)	6	83.97	92.81	2	33.33
22440.	Kat (oh_that_one_person)	6	81.55	100.00	2	33.33
22441.	Ollie (oham)	6	93.23	114.02	2	33.33
22442.	Oddpie (oddpie)	6	58.98	65.84	0	0.00
22443.	Hanseol (observance)	6	87.45	101.31	1	16.67
22444.	Adam (oadaam)	6	81.95	89.80	3	50.00
22445.	Nyxxiee (nyxxiee_)	6	75.15	81.54	3	50.00
22446.	Nathan (nxthantypes)	6	94.68	110.97	3	50.00
22447.	Nurzhalgas (nurzhalgas_)	6	28.86	32.68	0	0.00
22448.	Nick (ntst22)	6	97.65	109.53	2	33.33
22449.	NRM (nrm87)	6	88.36	102.90	1	16.67
22450.	vice versa (no_dice)	6	104.94	135.54	3	50.00
22451.	Hydro (noynyt)	6	73.01	87.08	5	83.33
22452.	(notcayden)	6	127.32	140.13	3	50.00
22453.	Noori (noori_)	6	54.70	64.25	0	0.00
22454.	P (noobstreamer)	6	69.97	87.32	1	16.67
22455.	Skrub (nonametomake)	6	110.34	136.12	1	16.67
22456.	NixNox (nixnox)	6	88.44	101.32	4	66.67
22457.	John (nixne)	6	122.18	137.54	4	66.67
22458.	Nitowl12_ (nitowl12)	6	65.60	73.65	2	33.33
22459.	Niteesh (niteeshguptha)	6	73.13	81.37	1	16.67
22460.	Marc (ninja221100)	6	81.65	94.77	2	33.33
22461.	Nikan (nikan20)	6	69.21	78.38	0	0.00
22462.	NIght (nightyin)	6	51.80	55.38	2	33.33
22463.	Night (nightvc)	6	87.23	96.89	3	50.00
22464.	Adin (nightmarexe)	6	112.13	130.92	3	50.00
22465.	Nicholas (nicktanasianman)	6	108.94	128.08	3	50.00
22466.	nick (nickderp)	6	124.33	137.45	5	83.33
22467.	Nice (nicekcoc)	6	99.81	114.79	6	100.00
22468.	Karma (nexus48)	6	96.54	114.40	3	50.00
22469.	Newman (newmanhere)	6	86.15	91.96	2	33.33
22470.	Matthew (neweleven)	6	103.87	121.51	4	66.67
22471.	Iura (newbeginnings)	6	118.90	129.03	2	33.33
22472.	Victor (newbeavictoryhase)	6	111.91	124.64	4	66.67
22473.	rogov (netherking1357)	6	79.11	97.80	1	16.67
22474.	Jozef (neophyx)	6	50.84	60.31	2	33.33
22475.	neil (neil_da_nub)	6	109.70	120.06	4	66.67
22476.	shitron (nefaeria)	6	78.43	93.13	2	33.33
22477.	Ned420 (ned420)	6	33.39	36.92	2	33.33
22478.	nebula (nebula1402)	6	98.16	103.76	4	66.67
22479.	David (nayzr)	6	56.86	58.69	0	0.00
22480.	Nathan (natehobo)	6	67.54	73.01	1	16.67
22481.	Nasir (nasirkabir)	6	68.86	84.70	0	0.00
22482.	Napples (napples181)	6	128.84	139.82	4	66.67
22483.	Nanos (nanos)	6	87.72	100.88	1	16.67
22484.	Ruben (nando520024)	6	78.73	88.76	1	16.67
22485.	Nadchen (nadchen)	6	106.77	110.71	4	66.67
22486.	Xun (n1ko9471)	6	52.53	59.46	0	0.00
22487.	kira (mysticpupper)	6	103.73	124.10	6	100.00
22488.	darsh0106 (mynamekaa)	6	78.76	84.13	1	16.67
22489.	holymama (mykeyboardcrash)	6	47.58	53.54	0	0.00
22490.	Mussie (mussietl)	6	57.50	63.68	1	16.67
22491.	Caroline (murungu)	6	89.82	102.50	1	16.67
22492.	Kebob (murikk)	6	95.43	107.67	2	33.33
22493.	Steven (muppo)	6	116.77	128.49	1	16.67
22494.	Mukesh (mukesh05)	6	37.74	41.50	0	0.00
22495.	N/A (mudatoxicity)	6	94.93	109.10	5	83.33
22496.	Mudathir (mudathir)	6	65.11	74.38	2	33.33
22497.	Komail (mr_broodbuck)	6	99.07	109.46	4	66.67
22498.	蔡 (mrzz)	6	51.15	59.61	0	0.00
22499.	Matt (mrwizard487)	6	66.53	68.93	2	33.33
22500.	mrweissguy (mrweissguy)	6	56.86	58.65	0	0.00
22501.	tomas (mrtomaspl)	6	81.05	89.82	2	33.33
22502.	Mo (mrmo)	6	105.61	125.74	5	83.33
22503.	Mejster (mrmejster)	6	60.11	68.26	2	33.33
22504.	Mihael (mrki141)	6	66.87	71.71	2	33.33
22505.	TacticalT8R (mrcardmont)	6	68.24	79.97	1	16.67
22506.	Jeff (mrblurbyyt)	6	98.17	103.09	3	50.00
22507.	big peepee man (mravocadoman)	6	99.44	116.60	5	83.33
22508.	Pepe (mrandersonneo)	6	78.43	89.43	0	0.00
22509.	Morris (mqrr)	6	73.44	86.86	1	16.67
22510.	S (moxeemango)	6	66.59	75.77	3	50.00
22511.	Zach (morcheeba)	6	88.01	97.87	2	33.33
22512.	MOP (moplock2093)	6	85.76	96.75	4	66.67
22513.	Sarawr (mooneclipsedragon)	6	75.64	80.39	1	16.67
22514.	malis (monmalis)	6	47.45	55.04	0	0.00
22515.	Theo (monkeytheo)	6	44.89	48.81	1	16.67
22516.	Carlos (mongrelion)	6	106.52	113.90	5	83.33
22517.	The Dude A-Rides (monesta)	6	55.67	66.21	4	66.67
22518.	momchil (momchils6)	6	54.25	67.28	6	100.00
22519.	Moist (moist_bread)	6	99.49	104.74	3	50.00
22520.	Josh (moistking)	6	69.03	84.75	2	33.33
22521.	Soliman (moaazsolomon)	6	65.74	76.96	0	0.00
22522.	no (mmineo10)	6	78.56	87.76	2	33.33
22523.	mmills18 (mmills18)	6	52.43	63.05	0	0.00
22524.	Marcus (mizormarcus)	6	99.07	112.78	4	66.67
22525.	Cat (misslittlequack)	6	64.33	78.22	0	0.00
22526.	ANne (missinglevi)	6	73.25	86.69	6	100.00
22527.	Missamig (missamig)	6	109.59	118.22	3	50.00
22528.	Mirek (miras_ms)	6	43.01	47.31	1	16.67
22529.	Minjae (minjaesong)	6	122.06	130.19	5	83.33
22530.	Churro (minishcap)	6	72.02	79.61	3	50.00
22531.	Jeff (mingij)	6	64.75	72.03	1	16.67
22532.	Mina (minamark)	6	21.51	24.23	2	33.33
22533.	Milos (miloskonjarnik)	6	78.58	82.96	2	33.33
22534.	Milan (milanmalik)	6	90.77	96.10	1	16.67
22535.	Michael (mike_racer)	6	105.96	135.79	5	83.33
22536.	Michael (mikeyargueta)	6	61.81	72.42	2	33.33
22537.	Mike (mike1835)	6	69.95	75.45	2	33.33
22538.	midtrac (midtrac)	6	87.03	96.36	4	66.67
22539.	Midnight (midnight510)	6	57.61	61.33	0	0.00
22540.	Michael (michhael)	6	116.66	130.74	2	33.33
22541.	Michalosnup (michalosnup)	6	29.93	35.49	2	33.33
22542.	Micaldos (micaldos)	6	75.40	85.02	2	33.33
22543.	Mia (mia_pie)	6	72.89	83.34	1	16.67
22544.	Homie (metrically)	6	97.27	113.27	4	66.67
22545.	Shadow (methehero_)	6	32.64	39.49	0	0.00
22546.	Mercury (mercuryqs)	6	62.07	65.00	1	16.67
22547.	Mercers (mercerslegend)	6	91.50	124.39	4	66.67
22548.	Milán (meooohun)	6	75.17	85.93	2	33.33
22549.	Menke (menkveld)	6	38.08	44.14	0	0.00
22550.	Melvin (melli06)	6	126.53	136.87	3	50.00
22551.	melanie (melanxi)	6	71.61	89.10	2	33.33
22552.	agyon (meikaina)	6	91.93	135.87	0	0.00
22553.	Ahmed (meguta)	6	71.18	83.43	2	33.33
22554.	medkha (medkhabt)	6	73.54	81.63	2	33.33
22555.	asdf (meagar)	6	102.42	113.76	3	50.00
22556.	Manan (mdoshi)	6	71.81	81.52	1	16.67
22557.	McMurdo42 (mcmurdo42)	6	47.54	56.49	1	16.67
22558.	Kenny (mckennythekid)	6	84.46	99.45	1	16.67
22559.	mcbtay (mcbtay)	6	107.91	123.37	5	83.33
22560.	Tod (mbollinger9)	6	67.30	75.03	3	50.00
22561.	Max (maxed0utt)	6	70.34	87.98	0	0.00
22562.	Max (maxaldo)	6	63.01	77.67	2	33.33
22563.	Mav (mavert)	6	58.00	62.51	2	33.33
22564.	Matthew (mattyssss)	6	82.55	89.95	6	100.00
22565.	Mattia (mattiasalvetti)	6	58.01	62.99	2	33.33
22566.	MatiPati (matipati)	6	55.40	71.70	1	16.67
22567.	Mateie (mateie)	6	81.57	91.16	1	16.67
22568.	Matteo (matbon01)	6	93.17	96.47	4	66.67
22569.	Master21 (master217994)	6	49.18	55.65	1	16.67
22570.	Muhammad (masonomar)	6	50.61	54.19	3	50.00
22571.	Cristian (marutabeibi)	6	73.57	77.15	5	83.33
22572.	Martine (martinee)	6	86.89	101.03	2	33.33
22573.	Markas (markas_123)	6	36.25	40.55	1	16.67
22574.	Mark (mark427)	6	84.72	96.58	2	33.33
22575.	MarioCrafter (mariocrafter101)	6	85.29	98.64	1	16.67
22576.	Mario (mario241)	6	55.72	66.04	1	16.67
22577.	Marek (marekc256)	6	74.51	86.20	3	50.00
22578.	Marco (marcotheboy)	6	142.00	161.45	6	100.00
22579.	Manel (manuelp)	6	57.42	64.83	1	16.67
22580.	Amanuel (mannyioi)	6	72.44	78.42	4	66.67
22581.	manhhuy01 (manhhuy01)	6	71.70	78.52	3	50.00
22582.	fuad036 (fuad036)	6	75.16	78.77	6	100.00
22583.	Radek (fssx)	6	100.86	116.57	2	33.33
22584.	fre (fre_24)	6	67.11	76.99	2	33.33
22585.	Ryan (fretmo)	6	94.61	107.26	1	16.67
22586.	James (freetheguy2)	6	93.09	96.98	1	16.67
22587.	keeganchan (forcherie3)	6	129.82	150.15	2	33.33
22588.	Fogli (fogli)	6	58.26	66.27	2	33.33
22589.	Micah (flyinmnkys)	6	67.19	76.58	0	0.00
22590.	Felix (flashy123)	6	111.17	119.39	1	16.67
22591.	godofchin (fiyet)	6	89.41	96.86	1	16.67
22592.	Fish (fishtent)	6	121.47	132.59	4	66.67
22593.	Simon (fishmango)	6	77.75	90.70	3	50.00
22594.	Fishcat (fishcat)	6	82.45	93.69	2	33.33
22595.	Y (firewatermelon)	6	66.11	78.10	0	0.00
22596.	dewgong (fingerlocked)	6	86.69	97.60	1	16.67
22597.	Jory (filkyjory)	6	74.47	80.20	2	33.33
22598.	Filip (filiplass)	6	107.56	114.53	6	100.00
22599.	deohanz (fierywormz)	6	102.39	109.44	3	50.00
22600.	Felipe (felipflop)	6	75.99	78.41	3	50.00
22601.	SpleF (felipeadn)	6	82.48	92.07	3	50.00
22602.	Fat (fattyfatboi)	6	76.74	85.96	3	50.00
22603.	Phoexv (fathih)	6	61.31	74.58	0	0.00
22604.	Jonas (fanibu)	6	73.33	78.99	1	16.67
22605.	FangAbi (fangabi)	6	70.00	79.79	1	16.67
22606.	Jason (falminfingaz)	6	114.19	127.33	1	16.67
22607.	John (fakelicense)	6	71.76	77.55	2	33.33
22608.	Fahrin (fahrin93)	6	53.71	58.29	6	100.00
22609.	Ahmad (fadedxtc)	6	59.51	67.85	0	0.00
22610.	Francisco (faac98)	6	84.26	87.21	2	33.33
22611.	Mars (ezfastboi)	6	67.13	78.10	1	16.67
22612.	Alex (extreme360)	6	104.99	113.76	3	50.00
22613.	Mark (exec_prod)	6	75.51	82.70	1	16.67
22614.	Jared (excline)	6	79.66	84.53	2	33.33
22615.	Hadriel (evo_echo)	6	45.37	54.66	1	16.67
22616.	(evestay)	6	130.98	147.14	4	66.67
22617.	Evan (evanr10190)	6	86.06	92.87	3	50.00
22618.	Anthony (euthanasia_)	6	88.68	98.16	1	16.67
22619.	E (eunice20)	6	75.37	80.66	3	50.00
22620.	Ilya (ethar)	6	64.85	68.82	2	33.33
22621.	Ethan (ethaaaaaaaaaan)	6	93.20	111.34	2	33.33
22622.	suchir (eternalzx)	6	68.48	75.87	2	33.33
22623.	Esther (esthersanti1600)	6	120.09	148.13	5	83.33
22624.	Eshwar Reddy (eshwar_god)	6	69.92	76.25	1	16.67
22625.	Juver (escoltajuverf)	6	65.07	77.15	1	16.67
22626.	Erwin (erwinisgoodenough)	6	110.21	122.68	6	100.00
22627.	fast (ersontio)	6	69.18	72.31	1	16.67
22628.	No quitting mid race (ersatz)	6	138.45	144.41	5	83.33
22629.	Ernie (ernievc)	6	67.99	74.25	2	33.33
22630.	eric (erictheass3)	6	78.87	85.99	1	16.67
22631.	undefined (epsylon)	6	66.45	99.50	0	0.00
22632.	Epoi (epoi_311)	6	56.17	66.81	0	0.00
22633.	Joe (eoj05)	6	82.88	95.50	2	33.33
22634.	Bleh (entropian)	6	98.36	110.15	4	66.67
22635.	Emir (emirthetyper)	6	109.58	114.14	5	83.33
22636.	EmiNation | (emingamer)	6	116.55	134.02	4	66.67
22637.	Eli (emeyer9)	6	88.76	101.85	3	50.00
22638.	Elvis (elvisnator)	6	98.84	111.96	2	33.33
22639.	Elo (elovvv)	6	128.16	152.52	6	100.00
22640.	ellie (elllllzzz)	6	43.05	48.68	0	0.00
22641.	Proximo (elliotkoh)	6	99.69	113.35	3	50.00
22642.	Elizur Daniel (elizur_daniel)	6	56.18	64.12	2	33.33
22643.	Robert (elitists)	6	73.38	99.84	1	16.67
22644.	Elisa (elisac00)	6	99.96	111.87	3	50.00
22645.	Elfuun (elfuun)	6	104.50	119.63	4	66.67
22646.	SBD (eleets)	6	51.26	60.46	0	0.00
22647.	Ariana (electorch)	6	79.87	86.73	1	16.67
22648.	eiphosa (eiphosa)	6	64.81	72.54	3	50.00
22649.	ninja (ehsaas)	6	64.60	70.76	2	33.33
22650.	Evan (eflem32)	6	87.81	100.24	2	33.33
22651.	Eduardo (eduojeda55)	6	51.75	58.17	0	0.00
22652.	Edison (eddie_boy)	6	68.42	82.33	0	0.00
22653.	wuz (echang95)	6	113.98	138.46	2	33.33
22654.	Adi (ech0star)	6	106.15	118.12	0	0.00
22655.	Evan (ebilton)	6	62.11	72.12	1	16.67
22656.	Darnell (dw_doc)	6	54.23	60.59	1	16.67
22657.	dnwin (duukki)	6	75.08	93.65	2	33.33
22658.	Du (dukuch)	6	98.82	115.47	2	33.33
22659.	Ben (dukedukeduke)	6	56.46	64.01	5	83.33
22660.	Þorsteinn (duddij)	6	82.79	94.65	2	33.33
22661.	Duck (ducklist)	6	62.87	77.49	3	50.00
22662.	Osian (dubzzy0)	6	72.82	85.94	2	33.33
22663.	Rudy III (dther99)	6	86.62	95.57	4	66.67
22664.	Dhruv (droxx76)	6	83.10	109.82	2	33.33
22665.	Kobe (dreamer21)	6	53.56	56.84	0	0.00
22666.	Drewski (drdrewski)	6	110.60	137.95	2	33.33
22667.	Travis (drather)	6	62.48	66.85	3	50.00
22668.	Micah (dramaticpineapple47)	6	83.55	94.07	2	33.33
22669.	drakcorian (drakcorian)	6	85.44	98.62	3	50.00
22670.	YosuaFranly (dragonunik18)	6	52.66	61.22	1	16.67
22671.	Eric (doze11)	6	80.55	92.12	4	66.67
22672.	Spencer (doucwhatic)	6	56.35	61.54	1	16.67
22673.	Donton (donton)	6	79.21	85.96	2	33.33
22674.	Dongwoo (dongwoo0504)	6	95.84	102.85	5	83.33
22675.	Pyraq (dokson)	6	95.95	106.75	1	16.67
22676.	Benjamin (dokdo_korea)	6	101.86	111.91	3	50.00
22677.	babe (doggosnutsack)	6	80.28	92.03	2	33.33
22678.	Dodoli (dodoli)	6	50.20	58.98	0	0.00
22679.	Doctor (doctorina)	6	77.97	91.20	0	0.00
22680.	Rose (dkranzberg)	6	97.65	109.34	1	16.67
22681.	DJPIXEL (dj_pixel_)	6	80.81	94.11	1	16.67
22682.	Tyler (djfjt93)	6	87.98	103.48	0	0.00
22683.	dorianmodemusic (djdorian1)	6	114.71	124.57	4	66.67
22684.	Diva (divaoxhd)	6	83.95	90.38	1	16.67
22685.	Boi (disnoob)	6	112.91	125.22	3	50.00
22686.	Dingus (dingus2000)	6	103.34	107.89	2	33.33
22687.	Dimitar (dimitard)	6	122.93	140.97	4	66.67
22688.	Elias (dillenn)	6	79.33	84.88	2	33.33
22689.	Digital (digitalrico)	6	102.22	123.99	4	66.67
22690.	digimastersp (digimastersp)	6	75.39	81.68	5	83.33
22691.	James Li (diffkey)	6	82.24	97.75	3	50.00
22692.	Slick Willy (dick_snapper)	6	80.18	84.99	2	33.33
22693.	Dhwaj (dhwxj)	6	59.56	67.16	4	66.67
22694.	Dhiva (dhivaa)	6	88.46	95.04	2	33.33
22695.	dhia (dhia1)	6	37.07	45.00	0	0.00
22696.	Dharma (dharmatycoon)	6	86.74	98.10	1	16.67
22697.	dey (deyy)	6	54.52	66.97	1	16.67
22698.	Davis (dey1234)	6	91.69	106.04	1	16.67
22699.	ronaldo (devildodo)	6	64.46	69.38	2	33.33
22700.	Dominc (devdominic)	6	76.02	95.00	1	16.67
22701.	Riley (detectiverocket)	6	61.42	68.04	1	16.67
22702.	Desmond (desmond012)	6	90.58	97.97	3	50.00
22703.	Jonas Heitz (der_junker)	6	64.87	78.16	1	16.67
22704.	derftastic (derftastic)	6	89.96	102.51	2	33.33
22705.	dennerrr (dennymin)	6	106.36	124.67	5	83.33
22706.	Denis (denisjames)	6	59.17	65.44	0	0.00
22707.	Pog (deftst)	6	105.30	145.78	1	16.67
22708.	Decent (decent_dvorak)	6	33.51	45.76	1	16.67
22709.	Noah (dead_dogs)	6	77.18	89.22	0	0.00
22710.	Deadlocz (deadlocz)	6	65.27	77.91	1	16.67
22711.	David (daychow)	6	70.27	86.51	2	33.33
22712.	Jack (dasher11)	6	89.21	98.84	0	0.00
22713.	Darren (darren)	6	37.01	41.32	0	0.00
22714.	Darkos (darkoser0)	6	64.72	73.03	3	50.00
22715.	Darkness_ (darkness_)	6	59.28	65.42	2	33.33
22716.	Swapnil (darklonewolf)	6	53.80	56.81	1	16.67
22717.	intermediate 2029 (darkis99)	6	130.83	147.02	3	50.00
22718.	Rikrish (dardbador)	6	77.15	83.47	1	16.67
22719.	Daniel (danyroza)	6	76.68	91.84	1	16.67
22720.	Danya (danya_z)	6	56.81	63.64	4	66.67
22721.	Daniel (danielnmr)	6	105.67	123.79	6	100.00
22722.	Dani (dani321456)	6	52.51	57.55	4	66.67
22723.	Charlie (dangdude)	6	56.80	60.78	0	0.00
22724.	Mr (dacookieboy)	6	106.05	116.13	4	66.67
22725.	den (d3niska)	6	118.69	131.94	2	33.33
22726.	Bruce (cybwong)	6	82.30	90.13	4	66.67
22727.	Chan (cy0309)	6	32.07	34.48	0	0.00
22728.	Marek (cxmu03)	6	70.98	79.05	0	0.00
22729.	abhimanyu (cvfz)	6	101.32	114.29	2	33.33
22730.	cuddly (cuddly_poetatoe)	6	66.38	72.36	0	0.00
22731.	GodIsGood (cruz989)	6	71.63	81.27	1	16.67
22732.	Alan (creamedpants)	6	56.15	67.28	5	83.33
22733.	Tristan (crazy_bisket)	6	76.04	84.65	3	50.00
22734.	Trivendram (crazyzoker)	6	40.98	55.13	0	0.00
22735.	eileen (crazyteal1)	6	65.07	73.65	1	16.67
22736.	Sam (crapslock)	6	108.05	113.67	3	50.00
22737.	Junior (corpseslayer)	6	62.46	66.85	3	50.00
22738.	Conner (conmanb)	6	92.81	108.28	4	66.67
22739.	Conner (conbrad33)	6	52.20	65.92	2	33.33
22740.	Melisa (colorsunimaginable)	6	66.20	72.84	3	50.00
22741.	sofL (colemak_is_poggers)	6	106.11	113.25	3	50.00
22742.	Danny (colby_brian)	6	114.37	121.31	4	66.67
22743.	colaclanth (colaclanth)	6	107.77	118.37	1	16.67
22744.	Coeburn (coeburn)	6	64.50	69.36	3	50.00
22745.	Code (codename47)	6	90.31	96.55	3	50.00
22746.	cmyang (cmyang)	6	54.22	67.37	2	33.33
22747.	Josh (cloudworks)	6	103.23	124.34	2	33.33
22748.	tstats[clob1414] (clob1414)	6	85.45	95.72	1	16.67
22749.	Clement (clementid)	6	55.29	59.39	2	33.33
22750.	ciber (cibernike)	6	71.08	74.67	3	50.00
22751.	SayGex (ch_alex)	6	75.05	91.35	2	33.33
22752.	Kyle (chynkii)	6	83.54	97.02	3	50.00
22753.	Christopher (chrizopaz)	6	75.99	87.13	2	33.33
22754.	Chris (chrdex789)	6	85.17	97.37	1	16.67
22755.	chopsueyrice (chopsueyrice)	6	101.23	109.21	2	33.33
22756.	Lamonte (chinpo)	6	83.57	97.74	1	16.67
22757.	ChiefSec (chiefsec)	6	83.62	104.65	5	83.33
22758.	Judah (chewyglue)	6	61.66	72.09	0	0.00
22759.	༘🐈ᯓ⌇🐾 ₊⁺�...	6	65.94	75.45	2	33.33
22760.	Che (cherry3330)	6	87.67	97.24	4	66.67
22761.	Big Daddy (chef_yeet)	6	75.49	82.76	2	33.33
22762.	Pro (cheater_0)	6	102.42	110.99	3	50.00
22763.	Charlotte (chazish)	6	87.02	93.01	2	33.33
22764.	Juan (chayanneofficial)	6	67.86	73.04	1	16.67
22765.	Chawin (chawintree)	6	116.61	127.58	4	66.67
22766.	四百二十 (chapuix)	6	89.71	102.91	4	66.67
22767.	ChaosRelik (chaosrelik)	6	47.31	51.03	1	16.67
22768.	chanden (chanden)	6	133.48	144.92	5	83.33
22769.	kevqiii (chairccc)	6	61.68	73.60	4	66.67
22770.	Chaicow (chaicow)	6	124.59	140.97	1	16.67
22771.	CF (cfoodc)	6	70.27	79.24	3	50.00
22772.	emma (certifiedberries)	6	51.26	55.55	1	16.67
22773.	Charlie (celzuk)	6	97.64	114.67	3	50.00
22774.	Claudia (cdnnnn)	6	52.73	65.36	0	0.00
22775.	Connor (cbec32)	6	83.85	91.90	3	50.00
22776.	Gaurab (catinpajamas)	6	85.79	99.86	2	33.33
22777.	Isabelle (catgirl_007)	6	46.48	48.95	0	0.00
22778.	Annie (caroullri6)	6	45.55	53.07	0	0.00
22779.	Austin (captan535)	6	58.66	67.87	2	33.33
22780.	Joemama (captainpj)	6	88.00	108.08	2	33.33
22781.	Caothu (caothunet)	6	60.18	66.90	1	16.67
22782.	Charles (candydaniel)	6	110.09	132.42	3	50.00
22783.	Cameron (camicazz475)	6	97.10	102.41	3	50.00
22784.	Noah (cadhp)	6	98.62	118.61	2	33.33
22785.	Byran (byran_tech)	6	101.26	121.67	4	66.67
22786.	BusinessMan (businessman4)	6	67.78	72.40	5	83.33
22787.	bullyjuice (bullyjuice)	6	93.00	116.05	2	33.33
22788.	Hiroshi (buhiroshi0205)	6	89.33	102.06	3	50.00
22789.	bbb (bugbearbey)	6	55.36	62.80	0	0.00
22790.	NOkia (bruhmomemtum)	6	72.84	78.20	2	33.33
22791.	bruhlollol (bruhlollol)	6	95.79	102.46	3	50.00
22792.	bruhhhelpla (bruhhhelpla)	6	89.77	104.95	2	33.33
22793.	bwian (brianschao)	6	119.79	131.46	4	66.67
22794.	bRIAn (brianlebrian)	6	96.40	108.86	0	0.00
22795.	Bremerton (bremerton)	6	97.07	111.43	6	100.00
22796.	Klobásník (boumex)	6	53.26	61.03	0	0.00
22797.	my mom (botmon99)	6	72.31	82.30	3	50.00
22798.	Gina (borbinon)	6	82.66	92.12	3	50.00
22799.	K3VIN (bootunstoppable)	6	98.29	103.36	1	16.67
22800.	BootleDootle (bootledootle)	6	68.85	81.14	1	16.67
22801.	Jonah (booshie)	6	95.74	117.78	4	66.67
22802.	. (boop_69)	6	64.12	78.64	3	50.00
22803.	Bone (bonezybeats)	6	101.53	119.55	3	50.00
22804.	Bom (bom_dia)	6	60.30	72.66	4	66.67
22805.	BOKATHINGYMABOB (bokathingy...	6	68.94	84.81	2	33.33
22806.	Boikom (boikom)	6	66.12	70.60	0	0.00
22807.	Hampus (bogge_)	6	59.58	61.98	1	16.67
22808.	bmwsauber (bmwsauber)	6	25.06	27.53	0	0.00
22809.	Ben (bmj774)	6	71.13	79.72	0	0.00
22810.	Jayden (bluuser)	6	45.08	52.59	0	0.00
22811.	Benjamin (blaptypes)	6	108.90	119.25	5	83.33
22812.	Luke (blame_luke)	6	66.25	89.08	2	33.33
22813.	Vu Huy (blaccod)	6	59.90	66.43	0	0.00
22814.	Bla (blablabla_)	6	63.77	73.04	0	0.00
22815.	Brandon (bkavanaugh6)	6	65.98	75.66	1	16.67
22816.	Biswajit (biswajit_maity)	6	50.47	55.38	0	0.00
22817.	Big (big_peen_budhai)	6	45.09	49.75	1	16.67
22818.	Abhinav (bigweeb69)	6	73.34	79.48	0	0.00
22819.	Hung (biggestahung)	6	50.06	55.56	0	0.00
22820.	Bibek (bibek_khyaju)	6	52.20	63.40	0	0.00
22821.	Bendik (bibben)	6	88.55	93.27	3	50.00
22822.	Edbert (berted)	6	92.56	100.45	0	0.00
22823.	Ben (benwarner)	6	59.12	65.60	2	33.33
22824.	Johnnieboy (bently5102)	6	97.36	114.29	5	83.33
22825.	Ben (benjikimchi)	6	88.81	98.38	3	50.00
22826.	ben (benaiah8)	6	37.53	45.64	0	0.00
22827.	BEGMB (begmb)	6	49.86	59.67	6	100.00
22828.	Yoshi (beegyoshifan)	6	92.65	101.40	1	16.67
22829.	Ryan (beefsoup)	6	92.35	103.92	3	50.00
22830.	TardPancake (beastowner69)	6	77.87	90.01	2	33.33
22831.	OMEGALUL (bearingsea)	6	89.55	97.81	2	33.33
22832.	Bayu (bayoudra)	6	62.48	73.24	3	50.00
22833.	bayarhuu (bayarhuu14)	6	38.50	45.85	0	0.00
22834.	Almat (bassaroff)	6	37.98	44.94	0	0.00
22835.	Cog (baritune)	6	101.07	107.35	3	50.00
22836.	Brandon (bardnon)	6	104.36	108.60	4	66.67
22837.	Cooper (bannanaman9000)	6	83.97	88.87	1	16.67
22838.	Michael (bannable_)	6	109.92	116.14	0	0.00
22839.	BadxX (badxx)	6	71.36	79.99	3	50.00
22840.	bacon (bacnv)	6	31.68	40.43	0	0.00
22841.	Blake (backflip25)	6	103.49	110.92	1	16.67
22842.	Babblecat (babblecat)	6	52.12	59.67	0	0.00
22843.	aztiokir (aztiokir)	6	111.93	128.74	6	100.00
22844.	Clayton (azpinballer)	6	82.45	96.13	2	33.33
22845.	ayush (ayush_raj)	6	51.35	57.77	1	16.67
22846.	Ayush (ayush729p)	6	74.31	78.57	4	66.67
22847.	Saeasd (axol578)	6	90.43	101.09	2	33.33
22848.	hock siong (axiang2000)	6	53.45	64.64	1	16.67
22849.	lex (axemzo)	6	98.66	110.17	1	16.67
22850.	Mister_ (axad007)	6	73.13	85.54	1	16.67
22851.	Awzzz (awzzz)	6	108.68	122.84	1	16.67
22852.	Praveen (awesomeroks)	6	106.58	123.01	2	33.33
22853.	Awaken (awaken_)	6	77.76	86.74	4	66.67
22854.	AW50M3 (aw50m3)	6	52.15	61.41	0	0.00
22855.	Joseph (avoirjoseph)	6	76.85	82.35	4	66.67
22856.	autzmn (autzmn)	6	102.30	127.25	3	50.00
22857.	autism (autismboy)	6	103.03	106.47	4	66.67
22858.	author (authorrr)	6	70.85	81.81	5	83.33
22859.	NongAugust (augustzuz)	6	46.29	54.44	3	50.00
22860.	Troy (atheropods)	6	102.61	117.94	4	66.67
22861.	Astro (astro_here)	6	45.88	51.53	1	16.67
22862.	Astroe (astroe)	6	83.07	93.04	5	83.33
22863.	Tin (asianzhang)	6	101.96	117.12	2	33.33
22864.	Zi (asianzealand)	6	96.50	113.19	3	50.00
22865.	Ashraz (ashraz)	6	47.11	56.66	0	0.00
22866.	Ashmie (ashmie)	6	69.28	76.24	0	0.00
22867.	lowkeynotash (ashleer)	6	98.42	104.11	3	50.00
22868.	AAAA (asdkjfn)	6	99.65	104.37	2	33.33
22869.	Amethyst (artesoscuras)	6	105.80	125.62	3	50.00
22870.	Arshavir (arshavir777)	6	44.96	48.89	0	0.00
22871.	Angelica (arrico128)	6	58.50	65.19	2	33.33
22872.	Aristeu (aristeu)	6	64.35	69.50	0	0.00
22873.	Charvin (archavint)	6	83.21	99.27	2	33.33
22874.	Jacqui (applejakkes)	6	56.90	62.58	1	16.67
22875.	Apol (apolmiguel)	6	106.24	114.02	3	50.00
22876.	PATH (aperson2003)	6	74.93	83.80	0	0.00
22877.	xAnzord (anzord)	6	89.11	91.67	1	16.67
22878.	Benedict (anzagta)	6	79.97	93.92	3	50.00
22879.	Sha (anything_goes)	6	161.35	166.37	3	50.00
22880.	ilysm (angelkiro)	6	117.04	123.12	6	100.00
22881.	Andy (andyyy68)	6	128.83	141.43	6	100.00
22882.	Andy (andytypeslol)	6	72.09	77.45	1	16.67
22883.	Andrew (andrewgoat)	6	117.76	137.72	1	16.67
22884.	Andrea (andrea144)	6	49.41	55.79	1	16.67
22885.	Andororo (andororo)	6	73.93	76.72	0	0.00
22886.	Anch (anch159)	6	151.47	160.57	5	83.33
22887.	Amirata (amiratak88)	6	73.01	75.48	2	33.33
22888.	Amin (aminarman)	6	72.07	75.72	3	50.00
22889.	El cote (alyeet)	6	67.93	84.87	2	33.33
22890.	Alvin (alvinarsyh)	6	65.16	67.92	1	16.67
22891.	Rafa (alphadog69)	6	53.57	59.78	0	0.00
22892.	Jimwell (alohaxjim)	6	71.28	81.75	1	16.67
22893.	Cal (almostpoetic)	6	89.97	97.52	1	16.67
22894.	Allagance (allagance)	6	92.04	99.09	3	50.00
22895.	Ali (alimron)	6	47.83	56.51	1	16.67
22896.	alibaba (alibaba_)	6	65.00	71.45	1	16.67
22897.	Alex (alex_lele)	6	60.75	73.47	1	16.67
22898.	Alexander (alexxela12345)	6	84.21	94.54	5	83.33
22899.	Auguto (alegato)	6	40.34	44.81	0	0.00
22900.	Cristi (alecucristi)	6	66.03	72.58	0	0.00
22901.	Alan (alan186)	6	74.48	86.15	0	0.00
22902.	ash (akx_sh)	6	53.92	68.76	4	66.67
22903.	Akrish (akrish)	6	83.28	91.29	3	50.00
22904.	Akiro (akiroooo)	6	88.88	103.30	1	16.67
22905.	Akisa (akisarazbu)	6	92.85	97.16	5	83.33
22906.	Andreas (ak9729)	6	58.89	69.40	1	16.67
22907.	Adrian (ajwong123)	6	86.83	92.81	0	0.00
22908.	rei (airyuki)	6	81.77	90.04	1	16.67
22909.	aimas (aimas)	6	46.35	48.76	1	16.67
22910.	Luna (aicaya)	6	90.86	96.11	1	16.67
22911.	Alex (ahouse101)	6	97.56	113.53	3	50.00
22912.	Ahnaf (ahnaf_goku)	6	63.06	68.22	3	50.00
22913.	Adam (agbell)	6	57.45	67.60	1	16.67
22914.	Agate (agate)	6	42.15	48.91	0	0.00
22915.	Sulaiman (agarasulaiman)	6	53.64	59.30	0	0.00
22916.	Afra (afra_666)	6	72.68	77.98	1	16.67
22917.	Arefin (afrabby)	6	45.72	47.05	0	0.00
22918.	Jeff (aeoiuf)	6	104.55	115.78	3	50.00
22919.	Soap (adventuroussoap)	6	35.97	40.05	1	16.67
22920.	Baris (adrik009)	6	94.59	108.99	3	50.00
22921.	Aditya (aditya1024)	6	45.94	48.46	0	0.00
22922.	Adarsh (adimall)	6	59.47	65.69	3	50.00
22923.	Jason (addictedtobacon)	6	88.32	106.61	4	66.67
22924.	Adavidapa (adavidapa)	6	54.02	57.40	4	66.67
22925.	Adarsh (adarshtopno)	6	84.46	88.65	2	33.33
22926.	kelvin (actualcarton782)	6	82.57	102.85	3	50.00
22927.	Adam (acidcypher)	6	73.25	81.27	2	33.33
22928.	Ace (acepilot22)	6	92.67	102.58	2	33.33
22929.	uks4nddl3 (accuracy2)	6	156.74	166.09	5	83.33
22930.	Alex (acblackburn)	6	66.70	77.90	1	16.67
22931.	Ahsin (abid1)	6	46.77	52.95	1	16.67
22932.	Abhilash (abhilash_kumar)	6	44.95	57.01	1	16.67
22933.	Abhi (abhib22)	6	166.97	176.33	6	100.00
22934.	Aaron (aaronec2)	6	77.62	85.88	0	0.00
22935.	Aalpesh (aalpesh)	6	83.10	86.95	3	50.00
22936.	aaaaaaa (aaaaaaayyy)	6	74.80	98.88	2	33.33
22937.	s a d b o y (a51nx)	6	112.74	117.63	2	33.33
22938.	Joe (9ighty)	6	60.43	73.37	1	16.67
22939.	Colin (8_wpm)	6	74.39	78.54	2	33.33
22940.	M7moudGadallah (7ooda)	6	61.02	65.42	2	33.33
22941.	... (7mza)	6	61.98	65.04	2	33.33
22942.	6hwh6 (6hwh6)	6	86.31	96.78	3	50.00
22943.	Shagato (5hagat0)	6	58.68	61.56	1	16.67
22944.	200wpmgrind (200wpmgrind)	6	80.71	90.55	3	50.00
22945.	Sean (157644)	6	66.52	72.03	0	0.00
22946.	Zach (11037)	6	98.34	108.00	1	16.67
22947.	keyboard (0001wpm)	6	88.78	98.35	1	16.67
22948.	J (crazjayz)	6	101.74	118.37	2	33.33
22949.	Daniar (kasdan23)	6	36.26	38.90	0	0.00
22950.	Thang (dominhthang)	6	51.81	63.19	0	0.00
22951.	Meyah (toxikk29)	6	66.95	76.46	3	50.00
22952.	Josh (joshtreimer)	6	62.71	67.70	0	0.00
22953.	Kith (kithford)	6	78.54	81.30	2	33.33
22954.	farge (hongmeiling)	6	58.44	67.38	5	83.33
22955.	Vivian (bibian420)	6	82.68	94.25	2	33.33
22956.	MrMeatBalls (mrmeatballs)	6	47.45	66.10	1	16.67
22957.	josh (5625jj)	6	73.79	83.50	2	33.33
22958.	Atticus (sofaboii)	6	37.49	39.24	0	0.00
22959.	Charles Francis (cfl_23)	6	62.52	69.72	1	16.67
22960.	levon (levonskyway)	6	77.32	85.17	3	50.00
22961.	Elias (eliasburs)	6	77.19	80.18	1	16.67
22962.	abc (abca123j12o3i)	6	67.16	71.96	0	0.00
22963.	David (whyischo)	6	89.23	102.50	3	50.00
22964.	tReby (treby08)	6	49.75	55.09	2	33.33
22965.	Endrianus (endrianusgohan)	6	85.83	99.91	2	33.33
22966.	maxwell (macyq)	6	50.90	60.46	2	33.33
22967.	Dan (danphm)	6	92.16	116.28	5	83.33
22968.	taco (tacopichu)	6	98.10	101.21	1	16.67
22969.	Greg (kotsmile)	6	46.73	52.00	1	16.67
22970.	Dw (unrandom)	6	90.19	98.82	4	66.67
22971.	melodie (melodiexu)	6	115.01	145.33	3	50.00
22972.	SpxwnDev (sghqz)	6	76.79	82.05	2	33.33
22973.	Dalton (shazam253)	6	76.13	86.84	1	16.67
22974.	cubebuc (cubebuc)	6	82.81	96.28	2	33.33
22975.	Jrident (jrident)	6	100.72	107.66	6	100.00
22976.	Michael (viperman99)	6	86.12	101.88	1	16.67
22977.	Paco (alphagamer4828)	6	69.26	74.27	3	50.00
22978.	sofi (madisofian)	6	57.66	65.27	0	0.00
22979.	RED_X000 (red_x000)	6	62.98	72.46	1	16.67
22980.	Erik (eldrazic)	6	51.59	55.74	3	50.00
22981.	snupis (sasore_)	6	77.10	83.05	1	16.67
22982.	Baibhav (otaku977)	6	45.69	49.62	4	66.67
22983.	Aidan (aida12n)	6	63.94	68.85	3	50.00
22984.	max (bluespongecake)	6	62.71	71.74	1	16.67
22985.	Aidando (profquif)	6	79.66	92.42	2	33.33
22986.	Jason (agent7x)	6	83.70	91.64	3	50.00
22987.	Finn (finnjo)	6	89.92	97.94	3	50.00
22988.	Billie (shig_186)	6	42.30	46.52	5	83.33
22989.	bread (spaghette)	6	80.69	99.29	5	83.33
22990.	Thomas (thomascookiehead)	6	66.32	77.28	1	16.67
22991.	G0og (acoostic)	6	80.91	85.86	1	16.67
22992.	Joda (fruitsnakuh)	6	64.41	73.57	1	16.67
22993.	OWL (owl_noob)	6	30.88	35.54	0	0.00
22994.	Amy (sxooter777)	6	60.08	71.31	2	33.33
22995.	Kohnsagrado (kohnsagrado)	6	79.37	85.76	5	83.33
22996.	puffinmuffin (puffiinmuffin)	6	34.45	41.13	1	16.67
22997.	Pen (aavian00)	6	73.03	79.08	3	50.00
22998.	aringq (aringq)	6	93.22	102.37	5	83.33
22999.	sydeth (sydeth)	6	66.36	76.54	5	83.33
23000.	Amir (amir265)	6	84.84	94.05	2	33.33
23001.	Pranav (spacejet13)	6	51.29	57.87	0	0.00
23002.	FX (golden_tiara)	6	91.48	100.23	1	16.67
23003.	jared, (yeu0401)	6	100.62	112.34	6	100.00
23004.	Lauren (rynnicole)	6	70.49	75.58	6	100.00
23005.	just typing (ekkology)	6	65.37	74.93	2	33.33
23006.	David (handsome_mango)	6	75.50	90.85	0	0.00
23007.	Bartoszek1 (bartoszek_1)	6	62.86	65.74	2	33.33
23008.	Nathan (ngong123)	6	112.37	124.25	2	33.33
23009.	Gian (maxpain2000)	6	93.26	101.85	2	33.33
23010.	pricklydoughnut (pricklydou...	6	66.59	82.00	1	16.67
23011.	Donovan (djdon774)	6	79.62	86.67	3	50.00
23012.	Cameron (cammikens)	6	63.74	77.98	4	66.67
23013.	jogn (ccaian)	6	100.28	119.77	3	50.00
23014.	Aditya (gaming_zilla)	6	54.55	63.20	2	33.33
23015.	Akash (akash126)	6	32.46	37.71	2	33.33
23016.	XIII_siren (xiii_siren)	6	66.93	77.35	4	66.67
23017.	Nova (noviepovie)	6	56.87	59.02	3	50.00
23018.	Devang (thegoat89)	6	77.66	86.76	3	50.00
23019.	Edrick (itsthatoneguy)	6	61.47	69.47	0	0.00
23020.	yes (huskeygg)	6	85.80	103.29	0	0.00
23021.	em (eeopkc)	6	111.67	115.29	3	50.00
23022.	Utsab (utsabghmr)	6	71.33	80.16	0	0.00
23023.	H5665m (qpowiepwoiqepoikljs...	6	43.97	59.64	0	0.00
23024.	Sard (advblack7)	6	85.73	93.69	2	33.33
23025.	Amery Dawn (amerydawn)	6	42.40	51.95	1	16.67
23026.	gre114 (gre114)	6	49.11	54.69	2	33.33
23027.	Mavvy (luckyidk)	6	55.62	71.89	1	16.67
23028.	Matthew (matthewke10)	6	108.86	129.63	5	83.33
23029.	Freddy (k4ppacino)	6	92.60	108.18	1	16.67
23030.	Lajaj (lajaj)	6	39.82	43.39	1	16.67
23031.	DuhKoeYah (duhkoetah_1)	6	51.58	62.21	1	16.67
23032.	Allogica (allogica)	6	65.72	73.53	1	16.67
23033.	Ryan (ry_lie)	6	64.91	74.46	1	16.67
23034.	Jensly (bungie0000)	6	74.48	84.42	1	16.67
23035.	ravx (ravx00)	6	50.22	53.45	0	0.00
23036.	Matúš (naimakka)	6	51.10	59.11	3	50.00
23037.	SeniorPoopypants (pantspooper)	6	79.89	87.19	2	33.33
23038.	Blitzs (blitzs)	6	55.36	59.48	1	16.67
23039.	Yng_kul (typebota_code_43)	6	45.93	50.16	0	0.00
23040.	Dante (dantitos)	6	72.88	83.37	3	50.00
23041.	Karnav (karnav_thakur)	6	75.45	77.27	1	16.67
23042.	Mayar (mayar_refaat)	6	37.26	43.63	0	0.00
23043.	Jordan (jmb777)	6	52.45	65.72	0	0.00
23044.	Yuvraj (yuvi08)	6	51.93	55.49	0	0.00
23045.	Steven (stevenwonlee)	6	103.33	112.25	5	83.33
23046.	Lucas (lucas_69)	6	77.94	90.65	1	16.67
23047.	p (masterzedd)	6	38.14	40.89	0	0.00
23048.	Cadence (pyromage)	6	114.23	123.87	3	50.00
23049.	ReezFreeze (reezfreeze)	6	58.13	64.71	1	16.67
23050.	Federico (brokenplayer)	6	49.16	53.36	2	33.33
23051.	Bruno (neptoon)	6	73.49	84.43	1	16.67
23052.	Anthimos (anthimoskal21)	6	55.77	63.76	0	0.00
23053.	beastron2 (beastron2)	6	87.53	126.44	2	33.33
23054.	Evanb (longstone)	6	62.80	66.82	0	0.00
23055.	Sean (prophetol)	6	63.37	73.31	1	16.67
23056.	Funky (funkybuddha)	6	63.44	69.72	0	0.00
23057.	Catherine (omgitzcattxo)	6	94.56	122.80	5	83.33
23058.	Lasith (z1nc0r3)	6	62.46	68.05	2	33.33
23059.	Bronzy (bronzy)	6	120.49	128.15	5	83.33
23060.	mario (mario__23)	6	25.45	27.87	0	0.00
23061.	Alfredo (thezombiezone)	6	76.86	86.57	3	50.00
23062.	SeungHyeon (hacanna42)	6	88.41	102.74	3	50.00
23063.	Rebecca (rebeccak0128)	6	64.99	72.78	1	16.67
23064.	Marcus (s95073)	6	40.87	43.47	1	16.67
23065.	FOR BYRON (kesner)	6	71.51	80.38	1	16.67
23066.	Alison (cinnabonbon)	6	93.93	102.53	3	50.00
23067.	neil (porpuz)	6	61.48	63.28	3	50.00
23068.	Vincent (vincema)	6	42.23	47.72	1	16.67
23069.	Joaquin (purplepizzazz)	6	78.16	89.27	4	66.67
23070.	henrynguyen2162 (jet404)	6	104.35	135.00	2	33.33
23071.	Muhammad (mkr3)	6	46.68	55.22	0	0.00
23072.	Nabeel (muhnab)	6	60.12	70.19	1	16.67
23073.	Avish (avish233)	6	56.35	64.21	1	16.67
23074.	Mcsteve (mcsteve)	6	36.36	40.83	0	0.00
23075.	kasper (flits16)	6	72.67	78.65	2	33.33
23076.	Rachel (jrachrob)	6	79.11	95.35	0	0.00
23077.	Abhishek (abhi_bana)	6	52.98	67.91	0	0.00
23078.	Ankit (ankityadav)	6	38.90	43.78	0	0.00
23079.	Nate (liquidcrafter)	6	70.54	78.44	1	16.67
23080.	Benjamin (benny_makes_music)	6	50.27	60.54	1	16.67
23081.	Yusuf (yamr7n)	6	47.88	56.61	4	66.67
23082.	Neo (neovanni)	6	101.56	115.11	2	33.33
23083.	Jason (jasonee)	6	73.95	90.27	1	16.67
23084.	Dominique (tinker_13)	6	62.45	67.59	0	0.00
23085.	Curious Beats (curious_beats)	6	86.57	96.60	1	16.67
23086.	zVintrix (vintrix)	6	81.39	96.88	2	33.33
23087.	elbie (twonangs)	6	58.09	71.63	2	33.33
23088.	Jason (jtsao22)	6	104.11	141.09	4	66.67
23089.	Sean (wtfseanscool)	6	116.65	124.53	5	83.33
23090.	Jamoliddin (farid5266)	6	24.83	26.62	2	33.33
23091.	Grogu (wozi)	6	78.32	91.74	0	0.00
23092.	Tornado (tornadoradon)	6	38.69	42.83	1	16.67
23093.	Sean Francis Kilem (seansty...	6	71.29	82.50	6	100.00
23094.	ℤℍ (zhulal)	6	35.17	40.58	1	16.67
23095.	hackarre (hackarre)	6	73.44	80.18	0	0.00
23096.	rongquan (rongquan)	6	84.03	98.62	2	33.33
23097.	adam (craker365)	6	42.03	52.80	0	0.00
23098.	Gopal (gopalloharnew)	6	47.31	50.86	0	0.00
23099.	dragontec12 (dragontec12)	6	34.84	39.82	0	0.00
23100.	gabrielallba (rielgbrl)	6	83.91	90.84	2	33.33
23101.	Andrew (anhrab)	6	79.05	86.07	1	16.67
23102.	yoda (sahxls)	6	74.45	85.51	1	16.67
23103.	Hugman (hugoweck)	6	36.32	43.30	0	0.00
23104.	taiga (pptaiga)	6	73.52	78.99	2	33.33
23105.	sniperdonlung (sniperdonlung)	6	85.92	95.10	5	83.33
23106.	Niklas (neoon)	6	80.50	85.70	1	16.67
23107.	Jerry (jerryni1996)	6	108.33	113.05	3	50.00
23108.	Joe (sokonama)	6	67.66	74.43	1	16.67
23109.	Mario (eryngium)	6	59.59	64.14	2	33.33
23110.	Carlos Emanuel (ocaarl)	6	30.79	38.29	2	33.33
23111.	Reaper (satanreaper)	6	79.34	91.51	2	33.33
23112.	Anisha (anisha_)	6	35.80	38.08	0	0.00
23113.	Jairo (lukario0037)	6	24.43	27.14	1	16.67
23114.	Simon (angelwoodie)	6	65.92	78.87	1	16.67
23115.	Jade (wxnderschon)	6	61.74	67.34	0	0.00
23116.	Raz (razzlel)	6	59.48	66.04	1	16.67
23117.	ella (ellsies10)	6	89.82	96.36	3	50.00
23118.	vicissic (sahhdude)	6	66.78	78.58	3	50.00
23119.	Soren (grilledkiwi)	6	48.92	55.78	0	0.00
23120.	Jonathan (peludo_jamon)	6	96.99	104.28	5	83.33
23121.	Ales (alestypes)	6	102.45	117.95	4	66.67
23122.	Steuart (sturtt)	6	95.77	113.83	3	50.00
23123.	lightninguy (lightninguy)	6	61.15	71.70	1	16.67
23124.	Sakuta (sakuta1)	6	102.92	115.64	5	83.33
23125.	The (malthelegend104)	6	57.86	83.94	1	16.67
23126.	Malvin (malleballen)	6	83.96	100.26	2	33.33
23127.	Malia (maliuhh)	6	71.66	81.77	0	0.00
23128.	Maia (maia_egg)	6	83.13	96.14	2	33.33
23129.	Magykti (magykting)	6	106.68	122.54	3	50.00
23130.	maghet (maghet)	6	66.53	72.59	3	50.00
23131.	George (madfang)	6	74.65	91.23	1	16.67
23132.	Gaurav (machinepainter)	6	52.29	54.35	1	16.67
23133.	M3D7 (m3d7)	6	69.70	82.32	3	50.00
23134.	Miguel (m1ggy01)	6	73.07	85.18	1	16.67
23135.	David (m0zlik)	6	84.67	95.34	0	0.00
23136.	Gianni (lxarduinixl)	6	65.20	72.44	0	0.00
23137.	Lunar (lunar3clipse)	6	55.56	66.32	0	0.00
23138.	Giorgio (luigi123mad)	6	99.87	112.55	2	33.33
23139.	Gunjan (lucifergd192)	6	58.23	64.50	0	0.00
23140.	Alek (lucazoom)	6	88.45	105.38	3	50.00
23141.	Lucas (lucasfah)	6	98.63	106.23	2	33.33
23142.	Jacob (lowkdr)	6	59.52	65.71	1	16.67
23143.	lost.zombie (lostzombie)	6	75.69	80.83	3	50.00
23144.	Phil (lordphil3)	6	94.31	117.74	3	50.00
23145.	Alex (longliveharambe)	6	88.25	97.40	2	33.33
23146.	Lolli (lollo2000)	6	72.27	81.03	1	16.67
23147.	輸是個甚麼東西 (lodg...	6	60.25	69.63	0	0.00
23148.	IIIKTG (lllktg)	6	63.90	73.70	0	0.00
23149.	hideki (llawlietswaifu)	6	62.29	72.50	1	16.67
23150.	LittleTub (littletub)	6	106.04	132.12	3	50.00
23151.	Lila (littlebaddiebcwhynot)	6	49.47	56.95	1	16.67
23152.	Andrew (littleangels37)	6	76.18	91.85	3	50.00
23153.	shamppo (literallyatyper1)	6	99.53	122.22	3	50.00
23154.	Aritra (liquidator)	6	89.46	98.05	4	66.67
23155.	Marcel (lingman)	6	87.06	101.27	2	33.33
23156.	Nikola (limuncovek)	6	56.70	63.80	0	0.00
23157.	Limited (limited_atonement)	6	122.38	132.97	4	66.67
23158.	Lilmanband (lilmanband)	6	82.81	96.69	4	66.67
23159.	Chris (lilchrisbmw)	6	118.55	134.26	5	83.33
23160.	lilbaxtian (lilbaxtian)	6	56.58	61.09	0	0.00
23161.	Lizzie (lfilart)	6	102.94	116.33	2	33.33
23162.	LePetitPili (le_petit_pili)	6	36.21	39.60	6	100.00
23163.	a (levelupself)	6	94.68	103.69	4	66.67
23164.	Zafir (lethalpuppy)	6	86.54	108.71	3	50.00
23165.	Kaleb (leonenthedk)	6	78.55	88.77	2	33.33
23166.	Lance (lenzzyyy)	6	92.64	111.50	3	50.00
23167.	Lengboii (lengboii)	6	36.81	55.86	2	33.33
23168.	Lena (lena2020345)	6	87.80	97.19	1	16.67
23169.	nikimii (lemontrees)	6	97.22	107.23	2	33.33
23170.	ahmed (lelarino1)	6	89.49	102.91	2	33.33
23171.	Ken (leei)	6	87.93	107.82	2	33.33
23172.	Lê Việt Bảo (lebao)	6	86.79	98.91	1	16.67
23173.	Idk (ldk_howtobreathe)	6	70.48	76.86	4	66.67
23174.	Layo (layopro)	6	63.44	77.37	0	0.00
23175.	Sebastian (lavaca)	6	54.45	66.60	0	0.00
23176.	Andreas (latteinator)	6	86.01	102.41	1	16.67
23177.	Travis (lath)	6	93.79	103.48	1	16.67
23178.	Justin (laskov)	6	73.21	81.19	0	0.00
23179.	LaShawn (lashawnious)	6	79.69	98.71	2	33.33
23180.	Ian (langabriel)	6	58.59	71.25	6	100.00
23181.	Tom (lambertsfan5858)	6	71.04	79.38	2	33.33
23182.	Luis (lalm07)	6	79.22	87.55	0	0.00
23183.	Fish (labia_majora)	6	84.92	93.67	2	33.33
23184.	kim (kyunreal)	6	67.61	74.94	2	33.33
23185.	kyeroh (kyeroh)	6	110.62	119.17	4	66.67
23186.	wojtek (kwojtek14)	6	131.74	136.20	4	66.67
23187.	Kushagra (kushagra_doodoo)	6	97.19	106.03	6	100.00
23188.	Jake (kuch13)	6	70.87	76.80	1	16.67
23189.	llarin (krypton1an)	6	91.72	102.90	3	50.00
23190.	Krypto (krypto406)	6	85.38	95.60	2	33.33
23191.	KroNox (kronoxver)	6	66.33	80.00	3	50.00
23192.	Kris (krislee2202)	6	50.18	58.36	1	16.67
23193.	kristian (kriskris15)	6	69.33	72.40	1	16.67
23194.	Kriso (krischoo276)	6	106.03	124.11	4	66.67
23195.	Peter (kraivyne)	6	81.42	91.00	1	16.67
23196.	nizar (konizar)	6	65.44	73.10	0	0.00
23197.	petr (koleno)	6	46.14	53.09	0	0.00
23198.	Daniel (kohrt)	6	64.64	76.90	1	16.67
23199.	ez (kobe2605)	6	117.39	123.50	4	66.67
23200.	knownymous (knownymous)	6	73.54	85.11	1	16.67
23201.	Abhinav (knovelgen)	6	79.57	85.36	1	16.67
23202.	Jonas (knochen)	6	68.57	74.37	1	16.67
23203.	(kloodah)	6	87.64	107.03	0	0.00
23204.	Tuan (kllerman25620)	6	83.60	100.88	2	33.33
23205.	Kelli (klandry80)	6	96.38	116.08	2	33.33
23206.	Kevin (kjax)	6	92.21	108.08	4	66.67
23207.	CrisWick (kizzu137)	6	95.00	109.46	3	50.00
23208.	Kiva (kivattt)	6	98.71	113.12	3	50.00
23209.	Mile (kiticmile69)	6	48.02	58.27	1	16.67
23210.	Kyryll (kiruxaker)	6	63.10	69.93	1	16.67
23211.	Kirragy (kirragy)	6	95.91	104.84	1	16.67
23212.	kion (kionkun1)	6	90.90	94.71	2	33.33
23213.	Benjamin (kingtutking)	6	110.08	115.92	3	50.00
23214.	Avatar 2 (kingkiller)	6	76.90	92.15	2	33.33
23215.	Kinasho (kinasho)	6	90.51	95.18	0	0.00
23216.	Rimka (kiingofkebab)	6	51.87	57.25	1	16.67
23217.	Emmanuel (khwarz)	6	85.21	95.81	1	16.67
23218.	abdul (khoir359)	6	81.13	84.97	0	0.00
23219.	KillerK (khanhp4)	6	97.10	109.88	2	33.33
23220.	Khalifa (khalifa47)	6	36.71	40.38	1	16.67
23221.	kev (kev_wins_again)	6	110.09	126.44	5	83.33
23222.	Keviism (keviism)	6	84.06	89.21	4	66.67
23223.	Kevin (kevb0)	6	84.43	98.84	1	16.67
23224.	Ket (ket93)	6	104.35	118.67	5	83.33
23225.	Dominic (kerbalnaught)	6	86.53	92.73	3	50.00
23226.	moni (kenma_k0zume)	6	42.83	47.44	0	0.00
23227.	kemosaf (kemosaf)	6	89.54	95.55	5	83.33
23228.	Kalle (kekeldur1)	6	101.35	123.57	2	33.33
23229.	Keencar (keencar)	6	95.22	108.53	2	33.33
23230.	kcor (kcorism17)	6	66.34	70.94	1	16.67
23231.	Katie (katie2096)	6	92.90	102.06	1	16.67
23232.	Kate (katehashope)	6	98.11	112.37	2	33.33
23233.	Kary (karygerxd)	6	62.46	73.19	0	0.00
23234.	kanai (kanai)	6	96.16	106.80	0	0.00
23235.	Kaizo (kaizokuooji)	6	61.84	68.09	1	16.67
23236.	Zach (kaito_zach)	6	70.75	77.33	0	0.00
23237.	Máté (kadmate)	6	52.32	58.67	1	16.67
23238.	bigdaddy (kaden_)	6	81.26	92.83	1	16.67
23239.	k (kabirpuri)	6	114.24	127.13	3	50.00
23240.	Brett (kaaji03)	6	53.33	62.04	0	0.00
23241.	jzbor (jzbor)	6	57.84	62.06	0	0.00
23242.	Jyxmix (jyxmix)	6	112.52	119.24	3	50.00
23243.	Mr. Presidentus (jyg108)	6	95.69	109.09	3	50.00
23244.	Jerry (jwu56)	6	98.26	107.42	4	66.67
23245.	Jason (jwatkins)	6	101.98	112.66	1	16.67
23246.	justvoid (justvoid0)	6	52.26	55.92	1	16.67
23247.	Sam (june_waves)	6	72.55	80.27	1	16.67
23248.	FREE PALESTINE (junaidbaloch)	6	103.72	119.54	5	83.33
23249.	Julia (julezreid)	6	82.39	99.69	0	0.00
23250.	707 (jujutsu_sorcerer)	6	87.05	104.50	2	33.33
23251.	jSteez (jsteez)	6	90.14	100.10	3	50.00
23252.	J (jrequa)	6	77.55	86.67	3	50.00
23253.	yoy (joy000)	6	105.11	135.00	1	16.67
23254.	Joceline (josmanga1)	6	60.27	68.77	0	0.00
23255.	Josiah (josiah_wi2)	6	92.86	121.29	3	50.00
23256.	Josh (joshsmith29)	6	37.13	48.36	0	0.00
23257.	Jospeh (joseph_blota)	6	50.58	57.05	0	0.00
23258.	nice (josephldot)	6	72.71	81.89	6	100.00
23259.	Jordan (jordybird7)	6	97.51	116.46	3	50.00
23260.	joorie (joorie)	6	118.02	131.21	3	50.00
23261.	Jonas (jonxasbro)	6	58.96	68.98	0	0.00
23262.	Jonathan (jonna1308)	6	59.21	70.27	0	0.00
23263.	Jonhan (jonhan)	6	105.15	115.22	6	100.00
23264.	Jon (jonathanloh02)	6	93.80	108.46	1	16.67
23265.	Luka (jomanji)	6	108.75	113.40	3	50.00
23266.	ur mom (jolly_retard6666)	6	59.15	69.30	2	33.33
23267.	jobe (jojojobebebe)	6	65.30	74.13	2	33.33
23268.	John (johnho)	6	97.42	132.40	3	50.00
23269.	jooonyh (johnfast)	6	45.38	55.20	0	0.00
23270.	Joe (joegung77)	6	122.66	136.53	3	50.00
23271.	JC (joco302)	6	110.92	126.68	1	16.67
23272.	j (jj_weeb)	6	99.64	107.16	3	50.00
23273.	JjMiReLeS (jjmireles)	6	63.71	70.15	0	0.00
23274.	Mariam (jishko)	6	41.34	47.31	0	0.00
23275.	Jirafa (jirafious)	6	49.49	57.91	1	16.67
23276.	Jindro (jijolindo)	6	68.52	91.41	2	33.33
23277.	Joni (jiipee)	6	49.52	58.35	0	0.00
23278.	jetmyy (jetmyy)	6	102.43	105.85	2	33.33
23279.	Jess (jessdiritowhale)	6	57.46	66.35	0	0.00
23280.	Jerson (jersonpogikaayo)	6	60.28	67.99	0	0.00
23281.	jesper (jeppe_p)	6	60.13	70.88	1	16.67
23282.	potato (jellaye)	6	97.54	123.40	3	50.00
23283.	Tanapat (jekkiechan)	6	112.33	119.55	3	50.00
23284.	Jeffreypaul (jeffreypaul)	6	51.17	54.67	1	16.67
23285.	Jeff (jeffracersf)	6	93.67	105.10	3	50.00
23286.	Jeeb (jeebmaster9000)	6	81.06	96.88	2	33.33
23287.	Matthew (jconne3646)	6	86.53	95.42	2	33.33
23288.	Jon Clarence (jclh127)	6	106.31	126.75	2	33.33
23289.	Justin (jchen1923)	6	91.05	98.03	6	100.00
23290.	John (jcboss10)	6	73.15	82.62	2	33.33
23291.	Jay (jaykimchi)	6	109.42	128.49	3	50.00
23292.	Jason (jason_1)	6	51.03	60.63	1	16.67
23293.	Jason (jasonjat)	6	101.98	121.98	2	33.33
23294.	Jasjit (jasjit)	6	43.34	55.60	0	0.00
23295.	apolcube (japollopntr77)	6	53.23	64.22	0	0.00
23296.	Jamie (jamie_b818)	6	68.56	81.75	3	50.00
23297.	Jakob (jaker8024)	6	76.99	86.64	3	50.00
23298.	Evan (jahad)	6	109.98	124.54	2	33.33
23299.	Jaemeriiaa (jaemeriiaa)	6	75.53	88.69	1	16.67
23300.	B1gjake1 (jacobone)	6	74.83	79.63	0	0.00
23301.	jake (jacobchh)	6	98.78	110.17	3	50.00
23302.	Jack (jacksaff)	6	70.02	78.25	1	16.67
23303.	Jalil (jac28088788)	6	85.59	94.11	4	66.67
23304.	Jasmine (j12mapatac)	6	98.90	119.24	2	33.33
23305.	so (i_am_sov)	6	64.28	74.82	3	50.00
23306.	iwayway (iwayway)	6	81.15	90.61	0	0.00
23307.	Type (iwant2typefaster)	6	70.51	80.50	1	16.67
23308.	Valliappan (its_me04)	6	53.54	60.22	0	0.00
23309.	ItsTurbo (itsturbo)	6	94.16	109.20	1	16.67
23310.	Ahmad (itsahmd25)	6	88.05	106.32	3	50.00
23311.	gia (issgua)	6	69.45	81.65	2	33.33
23312.	Daniel (isnakolah)	6	55.94	61.47	0	0.00
23313.	cloudwalker (ismailkhan78642)	6	58.89	66.35	2	33.33
23314.	Isaac (isjfw)	6	69.10	83.84	1	16.67
23315.	Isaac (isaacmnz2)	6	63.21	70.23	1	16.67
23316.	Isaac (isaackane)	6	64.89	80.76	1	16.67
23317.	Fenix (isaac.hermens@gmail....	6	98.46	104.36	2	33.33
23318.	Wojciech (irth)	6	97.15	104.74	4	66.67
23319.	Irish (irishgallowglass)	6	97.80	110.48	2	33.33
23320.	Iris (iris)	6	100.53	115.23	1	16.67
23321.	jrnc (intellimouseftw)	6	104.58	114.63	1	16.67
23322.	Spencer (instaflip)	6	48.67	52.49	0	0.00
23323.	Adam I (innesxam)	6	34.28	37.89	0	0.00
23324.	Iniquity (iniquityqt)	6	100.37	107.44	1	16.67
23325.	Sam (indecisam)	6	56.86	62.23	2	33.33
23326.	Inakoto (inakoto)	6	108.21	117.84	4	66.67
23327.	Knob (im_a_nob)	6	74.15	87.24	1	16.67
23328.	Tom (imtp)	6	92.94	99.83	1	16.67
23329.	Rake (imrakhat)	6	58.54	74.71	5	83.33
23330.	Joenutz (improvise101)	6	79.08	91.71	2	33.33
23331.	Imp (impm)	6	92.30	99.41	3	50.00
23332.	ImEhCanadian (imehcanadian)	6	98.47	112.02	3	50.00
23333.	Joe (imatschoolrn123)	6	62.71	66.52	0	0.00
23334.	ilham (ill_hum)	6	54.04	61.83	0	0.00
23335.	Iranian (iliveiniran)	6	66.21	70.76	2	33.33
23336.	ildgaf (ildgaf)	6	75.07	82.35	0	0.00
23337.	jason (ihatewyoming)	6	47.80	62.44	4	66.67
23338.	Igor (igorfardoc)	6	63.00	67.02	1	16.67
23339.	Martin (ightbet)	6	86.55	93.51	5	83.33
23340.	jonas (idoseggs)	6	82.63	91.95	0	0.00
23341.	idk (idkxdxd)	6	43.54	46.27	2	33.33
23342.	Icy (icyexitium)	6	92.43	98.90	2	33.33
23343.	Icy (icyblack)	6	74.18	82.61	0	0.00
23344.	Farhan (ichinewbi)	6	95.08	111.95	4	66.67
23345.	IceTea (iceteaxxd)	6	81.45	88.78	1	16.67
23346.	Ian (ic0d)	6	64.16	75.21	0	0.00
23347.	Ibrahim (ibro_foreal)	6	73.86	76.59	0	0.00
23348.	Parker (iamrex)	6	85.14	92.37	5	83.33
23349.	dev (hyprstitious)	6	66.39	78.73	2	33.33
23350.	Charlie (hypotrance)	6	84.82	98.43	2	33.33
23351.	Dustin (hyper_explosive)	6	45.02	50.09	0	0.00
23352.	hy0605 (hy0605)	6	59.70	65.19	1	16.67
23353.	Lukas (husafasamus)	6	71.96	80.88	0	0.00
23354.	Michael (humormike)	6	67.28	72.25	3	50.00
23355.	HumanUnknown (human_unknown)	6	68.87	80.78	3	50.00
23356.	Shishank (hulk98)	6	71.78	82.30	1	16.67
23357.	Harrison (hs676)	6	51.67	65.93	2	33.33
23358.	snails (hovermind)	6	136.40	145.44	6	100.00
23359.	Housefly (housefly)	6	40.34	48.10	0	0.00
23360.	Daniil (hotdan28)	6	17.12	18.92	1	16.67
23361.	Jack (horton_hears_a_j3w)	6	57.46	65.47	2	33.33
23362.	Horphex (horphex)	6	80.83	89.68	1	16.67
23363.	Hong Yi (hongyi8877)	6	72.01	81.57	2	33.33
23364.	Jon (hongatory)	6	76.86	84.05	0	0.00
23365.	aman (honeytyper)	6	47.43	51.20	0	0.00
23366.	Homie (homie39)	6	52.07	58.04	1	16.67
23367.	Ayaz (holografick)	6	81.17	83.65	2	33.33
23368.	Vinh (hi_ugly)	6	73.96	84.68	3	50.00
23369.	jimmy (hireraprk)	6	93.92	98.66	3	50.00
23370.	Himanshu (himanshupander)	6	60.34	68.40	2	33.33
23371.	Wilson (hilson_we)	6	77.88	83.21	0	0.00
23372.	Hikmat (hikmat)	6	54.71	59.44	0	0.00
23373.	hibbobibbo (hibbobibbo)	6	100.17	114.01	1	16.67
23374.	Edmund (hhy1996)	6	54.87	64.05	2	33.33
23375.	Nathan (hewittdallas)	6	92.25	103.73	1	16.67
23376.	luigi420 (heroofthevillage)	6	74.77	81.66	2	33.33
23377.	Seymour (heroofnow)	6	105.43	111.24	4	66.67
23378.	Geo (heroic_librarian)	6	53.74	59.51	1	16.67
23379.	THE ONE PIECE IS REAL (herm...	6	116.29	120.63	6	100.00
23380.	BEN (hermanatorpc)	6	111.47	125.21	2	33.33
23381.	HeliuMz (heliumz)	6	58.49	65.13	2	33.33
23382.	Zuramaru (helena_meta)	6	100.89	112.75	3	50.00
23383.	Viktor (heizu)	6	57.54	73.52	0	0.00
23384.	Colby (heebiejeebies)	6	94.24	112.30	3	50.00
23385.	Aechbie (hb69)	6	66.79	76.66	1	16.67
23386.	Hayden (haydenism114)	6	55.89	59.26	1	16.67
23387.	Hunter (hawsonn)	6	97.99	109.53	3	50.00
23388.	Hasan (hasanpranto)	6	62.24	67.15	1	16.67
23389.	Jonathan (happyspartan)	6	60.50	63.98	3	50.00
23390.	Hannah (hanthetyper)	6	59.21	74.74	0	0.00
23391.	Hansol (hansol)	6	140.05	160.25	3	50.00
23392.	OhioMewing (hannoobz)	6	60.68	68.68	2	33.33
23393.	Hammy (h4mmy)	6	83.69	89.34	2	33.33
23394.	Shaun (h0giebear)	6	68.33	73.74	2	33.33
23395.	Gyuri (gyuri)	6	80.67	84.43	3	50.00
23396.	Xul (gyrofluff)	6	80.73	94.37	4	66.67
23397.	Jeb (gwenigale)	6	99.54	108.83	4	66.67
23398.	Ryan (gurkenglas9)	6	75.55	84.24	1	16.67
23399.	Mr (gunottam)	6	69.15	77.26	1	16.67
23400.	g (gunner69)	6	48.83	53.92	1	16.67
23401.	Adrian (guncr4ft3r)	6	102.53	114.74	3	50.00
23402.	Geo (gsampoerna3)	6	72.56	75.37	0	0.00
23403.	glowred (greytime)	6	48.17	52.97	1	16.67
23404.	Ben (greentshirtboy)	6	102.84	119.36	4	66.67
23405.	Matthew (greatbun)	6	89.36	94.53	2	33.33
23406.	gray (grayg52)	6	69.69	76.79	2	33.33
23407.	grasstang (grasstang)	6	113.62	138.61	4	66.67
23408.	twoheadedboy (grapes_2005)	6	85.21	95.94	0	0.00
23409.	you (gotten)	6	80.12	91.16	2	33.33
23410.	Trevon (goodwithfingers)	6	89.76	95.05	3	50.00
23411.	Goodly (goodlytexas)	6	43.16	60.12	0	0.00
23412.	JT (gonroz)	6	65.04	74.78	1	16.67
23413.	Nico (gomifune)	6	81.67	88.00	0	0.00
23414.	BOss (goldere)	6	107.02	127.45	3	50.00
23415.	GodOfTheMetal (godofthemetal)	6	86.82	92.32	3	50.00
23416.	Goatinator (go4tinator)	6	93.84	100.38	2	33.33
23417.	Sisyphus (gnurlbash)	6	82.91	86.21	1	16.67
23418.	Jack (gleesonj)	6	86.43	95.21	6	100.00
23419.	Gita (gist23)	6	68.66	88.02	2	33.33
23420.	Alex (gincat)	6	71.74	79.54	1	16.67
23421.	ghostway (ghostway)	6	53.99	66.17	0	0.00
23422.	Caleb (ghostlyaardvark)	6	58.76	61.53	0	0.00
23423.	Eliotas (ghostisghost)	6	71.00	86.79	6	100.00
23424.	ghostdrain (ghostdrain)	6	107.14	112.32	2	33.33
23425.	A (getsavaged)	6	70.61	76.58	4	66.67
23426.	tstats[general_iroh] (gener...	6	64.68	71.57	2	33.33
23427.	Dios (gembili666)	6	46.39	53.93	6	100.00
23428.	John (gelwg1)	6	79.38	92.17	3	50.00
23429.	Liam (gearupman)	6	62.01	71.39	0	0.00
23430.	Gaurvanshi (gaurvanshi)	6	51.96	55.15	0	0.00
23431.	Applesauce (garbagetm)	6	99.76	110.93	0	0.00
23432.	Glory (gaminglory)	6	73.46	84.45	1	16.67
23433.	Gage (gagedorl)	6	74.93	90.86	1	16.67
23434.	gabe (gaberhone)	6	83.78	90.45	1	16.67
23435.	gavin (ga123reee)	6	25.45	28.57	1	16.67
23436.	edisonhussey (furox)	6	98.59	105.49	3	50.00
23437.	Connor (fumania)	6	81.07	88.92	2	33.33
23438.	_____ (___i__)	6	38.32	42.28	2	33.33
23439.	Silver (_silver_)	6	35.86	39.92	0	0.00
23440.	_i_am_flash (_i_am_flash_)	6	84.22	92.76	0	0.00
23441.	Joshua (_f1shy_)	6	75.68	85.51	1	16.67
23442.	Derek (_de_re_k_)	6	75.17	83.59	1	16.67
23443.	Adam (_adamart_)	6	63.85	73.82	0	0.00
23444.	Fox (zzhenry)	6	118.43	145.34	4	66.67
23445.	David (zybazoubek)	6	45.33	56.70	0	0.00
23446.	Zvezdi (zvezdityper)	6	58.20	63.28	0	0.00
23447.	zurakin (zurakin)	6	64.30	70.52	2	33.33
23448.	ZULU (zultrixz)	6	75.77	82.78	2	33.33
23449.	Nikita (zubrailx)	6	45.11	49.17	0	0.00
23450.	Zack (zt44king)	6	84.22	89.85	2	33.33
23451.	Ab (zoro_ab)	6	62.07	70.07	1	16.67
23452.	Aidan (zoreoam)	6	120.41	137.60	5	83.33
23453.	zonked (zonked)	6	78.40	85.15	2	33.33
23454.	pitch (znxxx)	6	62.92	67.77	0	0.00
23455.	Shivansh (zneth)	6	53.96	61.57	1	16.67
23456.	Zachary (zminuk)	6	96.73	104.77	3	50.00
23457.	Zisos (zisos78)	6	67.04	76.04	3	50.00
23458.	glow2:wave: selling 3k shar...	6	88.72	96.55	4	66.67
23459.	John (zidis)	6	50.24	57.55	1	16.67
23460.	Anthony (zhengant)	6	114.08	127.84	3	50.00
23461.	Ramazan (zheksenov)	6	75.48	88.08	2	33.33
23462.	Zeztix (zeztix)	6	83.39	92.32	2	33.33
23463.	Cozmin (zethy03)	6	97.07	107.81	4	66.67
23464.	Kevin (zerstu)	6	122.02	134.24	6	100.00
23465.	Jovan (zer0neon)	6	87.52	95.83	3	50.00
23466.	Zaley (zaleykane)	6	97.37	117.32	5	83.33
23467.	guy (zagu)	6	77.16	78.91	2	33.33
23468.	Echo (zaffir)	6	95.79	108.52	2	33.33
23469.	Zack (zack_mitkin)	6	86.34	99.22	0	0.00
23470.	Zac (zackiey)	6	46.59	53.44	2	33.33
23471.	Zach (zachstarattack)	6	88.56	101.50	4	66.67
23472.	Zachery (zacca113)	6	87.89	95.02	2	33.33
23473.	Yvess (yvessu)	6	54.50	63.16	0	0.00
23474.	yuvirayz (yuvirayz)	6	101.74	110.63	3	50.00
23475.	Yuval (yuvalsaricov)	6	69.32	74.10	0	0.00
23476.	yuhaocooper (yuhaocooper)	6	98.52	107.08	1	16.67
23477.	Euan (you_an)	6	63.90	68.05	3	50.00
23478.	Sock (yourlocalsock)	6	99.58	113.16	4	66.67
23479.	Yann (yooaaooy)	6	95.37	104.90	5	83.33
23480.	Nioex (yokytra)	6	98.97	112.31	2	33.33
23481.	Yogi (yogivaleja)	6	72.57	88.17	1	16.67
23482.	Efilio (yodigarcia)	6	93.24	101.46	3	50.00
23483.	Yasir (ykhan9514)	6	98.71	109.10	6	100.00
23484.	Caleb (yjcc)	6	74.94	93.52	1	16.67
23485.	abv (yexela)	6	65.76	76.76	1	16.67
23486.	yeogi (yeogi)	6	71.84	77.70	0	0.00
23487.	Yeeric (yeeric)	6	89.70	98.74	0	0.00
23488.	Leo (yasuomaster)	6	105.10	114.93	3	50.00
23489.	WhysoSussy? (yasqueen)	6	65.08	72.99	4	66.67
23490.	YanSay (yansay)	6	78.70	86.26	1	16.67
23491.	Julianna (yannamoo8)	6	79.73	95.95	2	33.33
23492.	Seany (yaboiseanyt)	6	44.67	54.70	0	0.00
23493.	Rez (xymomelum93)	6	93.78	99.76	2	33.33
23494.	leem (xpar65)	6	62.16	65.43	2	33.33
23495.	Galatia (xisnyang)	6	96.66	106.69	1	16.67
23496.	Alan (xilog)	6	68.34	79.38	0	0.00
23497.	xDuskii (xduskii)	6	90.23	106.31	3	50.00
23498.	Massimo (xasaza7)	6	93.27	111.78	3	50.00
23499.	Ashley (wyq_ashley)	6	51.16	62.55	0	0.00
23500.	Tomas (wtfxdc)	6	65.94	72.80	1	16.67
23501.	W (world_hello)	6	109.69	118.36	1	16.67
23502.	alcoholnotfree (wonwoohu)	6	54.81	65.26	2	33.33
23503.	Wolfen (wolfenshroud)	6	95.27	107.88	2	33.33
23504.	Wojtek (wojtexpl)	6	103.79	116.06	3	50.00
23505.	Alex (wizardoftime)	6	54.15	59.92	0	0.00
23506.	Will (will_to_type)	6	50.81	60.75	0	0.00
23507.	William (willyutoo)	6	62.15	64.62	0	0.00
23508.	William (williamforrester)	6	89.46	100.68	2	33.33
23509.	will (will7460)	6	57.08	62.03	0	0.00
23510.	Wild (wildwolfas)	6	67.81	72.64	0	0.00
23511.	Francois (wildwolf34)	6	33.51	35.98	0	0.00
23512.	Whispie (whispie_)	6	117.10	120.53	4	66.67
23513.	Jo (whiffking)	6	134.79	149.52	3	50.00
23514.	Uni (whenuniqueusername)	6	77.63	87.48	0	0.00
23515.	Poonpipob (wheatley001)	6	85.84	91.71	1	16.67
23516.	Adam (whalsey1)	6	102.58	108.83	1	16.67
23517.	wel (welneco)	6	93.75	103.39	6	100.00
23518.	weeed (weeed)	6	71.67	82.19	1	16.67
23519.	Jakub (wasiul)	6	110.26	120.70	4	66.67
23520.	Bingy (waesoph)	6	107.70	121.26	1	16.67
23521.	brandon (wadawdawdw)	6	110.02	122.14	1	16.67
23522.	vverbov22 (vverbov22)	6	77.27	88.58	3	50.00
23523.	Daniel (vugla1994)	6	85.89	93.92	1	16.67
23524.	Vteawt (vteawt)	6	72.01	79.66	3	50.00
23525.	vrush (vrush05)	6	59.01	63.18	0	0.00
23526.	Minh (votinh1210)	6	61.39	65.63	1	16.67
23527.	(vivector)	6	127.06	139.32	4	66.67
23528.	Vishal (vishalnehra)	6	96.32	99.66	1	16.67
23529.	Vishal (vishal2376)	6	33.15	41.05	0	0.00
23530.	david (vinegar__)	6	82.56	92.93	2	33.33
23531.	Victor (victorhz)	6	116.84	127.80	4	66.67
23532.	Veseyron (veseyron)	6	61.89	69.33	1	16.67
23533.	Vesa (vesaninja)	6	71.19	83.46	2	33.33
23534.	Veraxanity (veraxanity)	6	113.90	123.32	5	83.33
23535.	_Wapi_ (veqisgay)	6	67.75	71.59	2	33.33
23536.	Vince (venvince)	6	81.88	110.12	3	50.00
23537.	Ved (ved619)	6	91.17	95.63	2	33.33
23538.	Jonathan (vczne)	6	102.85	122.27	2	33.33
23539.	Varun (varun170)	6	33.95	39.05	1	16.67
23540.	Virgil (vanvirgil_)	6	50.84	59.38	1	16.67
23541.	Jimmy (vancouver_canada)	6	72.27	81.44	1	16.67
23542.	singhvaibhav100@gmail.com (...	6	90.10	94.03	1	16.67
23543.	Aiden (urmom696969)	6	61.77	77.43	1	16.67
23544.	urbadheehee (urbadheehee)	6	68.11	79.46	1	16.67
23545.	Moth (unleashed_furai)	6	94.54	109.14	4	66.67
23546.	John (unikmask)	6	83.41	91.14	2	33.33
23547.	Harry (undeadkiller112)	6	61.04	73.61	2	33.33
23548.	umbercuc (umbercuc)	6	48.90	54.12	0	0.00
23549.	Jose (ultra_instinct_joss)	6	89.75	113.98	6	100.00
23550.	duebdab (ultraduebdab)	6	58.36	76.96	2	33.33
23551.	ugi (ugiex)	6	46.96	58.87	1	16.67
23552.	ufoludek (ufoludek)	6	106.04	117.71	3	50.00
23553.	sren (uchiha_itachi347)	6	35.71	41.21	2	33.33
23554.	Marcie (u53rn4m374k3n)	6	83.38	90.13	3	50.00
23555.	Thomas (t_chow)	6	109.43	125.81	2	33.33
23556.	u03 (u03_colemak)	6	101.02	113.31	1	16.67
23557.	Ty (ty_clark19)	6	56.96	72.10	2	33.33
23558.	Henry (typingtaxi)	6	74.57	80.11	2	33.33
23559.	Hans (typer_error)	6	77.05	83.22	2	33.33
23560.	j_ (typeracerjay1)	6	86.29	95.21	2	33.33
23561.	Tommy (txmmy)	6	63.31	75.24	1	16.67
23562.	Tweethashtag (tweethashtag2...	6	42.17	48.07	1	16.67
23563.	chicken (turborider4)	6	55.14	59.63	1	16.67
23564.	TunaFish026 (tunafish026)	6	33.77	38.08	1	16.67
23565.	ten (ttennnnnnnnn)	6	31.93	34.29	1	16.67
23566.	boss (tsukuyo)	6	76.55	84.25	1	16.67
23567.	call me hani (tsmal3rb)	6	70.36	76.65	3	50.00
23568.	Kurowa (treefighterh)	6	101.79	124.98	6	100.00
23569.	Torunn (torunntrost)	6	57.01	62.75	6	100.00
23570.	Tommy (tortipous)	6	101.22	117.79	4	66.67
23571.	Topu (topuraihan)	6	64.27	73.27	0	0.00
23572.	mdnh (tongil123)	6	60.54	65.19	0	0.00
23573.	mike (tonbae)	6	68.90	83.39	1	16.67
23574.	tom (tommmy6)	6	57.76	70.28	0	0.00
23575.	Tom (tomllic)	6	55.19	63.80	2	33.33
23576.	Ania (to16nks)	6	53.31	60.79	0	0.00
23577.	Timothy (tmoux)	6	97.78	120.98	1	16.67
23578.	Tristan (tmanthetyper)	6	39.13	45.02	0	0.00
23579.	Tinn (tinncann)	6	60.89	83.07	4	66.67
23580.	Suspicious Food Tin (timotc)	6	81.25	90.83	1	16.67
23581.	Temir (timchis_13)	6	61.70	73.41	1	16.67
23582.	Krazy (tilatik)	6	76.62	86.69	0	0.00
23583.	Tiku (tiku888)	6	54.80	66.80	1	16.67
23584.	Tigran (tigranhakobyan)	6	79.77	90.24	3	50.00
23585.	Droxe (tierelutz)	6	99.22	105.16	4	66.67
23586.	ThySpoon (thyspoon)	6	85.48	95.99	0	0.00
23587.	Marc (thygreat)	6	63.12	71.39	6	100.00
23588.	Ma (thyassasin98)	6	100.16	106.27	3	50.00
23589.	Thun (thun10121)	6	63.25	76.79	1	16.67
23590.	Torsten (thorman42)	6	129.70	147.40	3	50.00
23591.	Procrastinator (the_procras...	6	136.74	151.37	4	66.67
23592.	The_King (the_king111)	6	67.59	76.73	0	0.00
23593.	Brydon (the_blackfish)	6	74.11	80.90	1	16.67
23594.	Robin (thetamtm)	6	106.66	117.24	4	66.67
23595.	Ya boi (thesmores)	6	96.28	116.23	2	33.33
23596.	Simon (thesherlocklayout)	6	77.78	84.45	1	16.67
23597.	IM-Z (therealxenogen)	6	80.78	163.72	1	16.67
23598.	Pro (theproplayer1278)	6	47.94	52.38	0	0.00
23599.	Pizza (thepizzaman2013)	6	90.73	102.00	2	33.33
23600.	accurate (thenormalracer)	6	92.58	107.78	1	16.67
23601.	Mohit (themp3dark)	6	75.45	82.12	3	50.00
23602.	TMW98 (themostwanted98)	6	83.99	94.15	0	0.00
23603.	melon (themelongirl)	6	49.95	55.88	0	0.00
23604.	random (thelastprime)	6	120.59	134.88	1	16.67
23605.	Kevin (thehobokid)	6	103.63	115.72	1	16.67
23606.	XPmain (thehashtag)	6	75.57	84.63	2	33.33
23607.	hilmi (thefroggy)	6	64.30	66.14	1	16.67
23608.	The (thedetails)	6	85.22	93.96	2	33.33
23609.	Natalie (thebestaround0509)	6	72.87	94.76	4	66.67
23610.	Mario (tennisiscool)	6	69.37	80.34	2	33.33
23611.	Michael (tempt)	6	67.26	72.36	1	16.67
23612.	Temflakes (temflakes403)	6	98.45	116.73	3	50.00
23613.	telmac (telmacblack)	6	90.94	97.83	2	33.33
23614.	Marshall (tekuin)	6	102.34	113.04	2	33.33
23615.	(teinej)	6	68.72	75.03	4	66.67
23616.	Kaelib (teegka01)	6	70.53	80.90	1	16.67
23617.	Teddy (teddyhol)	6	88.15	101.00	2	33.33
23618.	TearyPanda (tearypanda)	6	125.50	139.42	6	100.00
23619.	teabiscuit (teabiscuit1)	6	116.42	124.30	1	16.67
23620.	Tyler (tdude212)	6	76.64	87.04	2	33.33
23621.	Taylorlum3 (taylorlum3)	6	58.43	75.99	0	0.00
23622.	Tammie (tamxd)	6	85.78	97.50	2	33.33
23623.	Tahsun Rahman (tahsun)	6	51.68	63.04	3	50.00
23624.	tareq (tabrar2010)	6	74.86	93.29	1	16.67
23625.	Sami (t1sami)	6	80.41	86.72	1	16.67
23626.	Tomas (t0mcuhhh)	6	59.24	76.53	1	16.67
23627.	antos (szybkipisaczelo)	6	40.00	44.69	2	33.33
23628.	Syrgak (syrgak)	6	46.78	52.19	0	0.00
23629.	Blank (sydale)	6	67.77	85.18	2	33.33
23630.	sweetyukibo (sweetyukibo)	6	80.65	91.47	0	0.00
23631.	Sweet Wort (sweetwort)	6	96.89	107.35	4	66.67
23632.	Ming (swamis)	6	102.34	116.87	3	50.00
23633.	Pheakdey (swagmav69)	6	67.23	73.03	1	16.67
23634.	Svoleas (svoleas)	6	55.84	61.17	1	16.67
23635.	sven (svenac20)	6	76.96	87.71	2	33.33
23636.	𝙺𝚊𝚒𝚝𝚊𝚕�...	6	96.70	118.03	1	16.67
23637.	Penguin (superpenguin9)	6	79.76	89.94	3	50.00
23638.	Marcel (supermarcel10)	6	78.49	94.28	4	66.67
23639.	Billy (super1ha1)	6	67.22	74.05	1	16.67
23640.	sunfishho (sunfishho)	6	103.40	110.15	4	66.67
23641.	sumuttaja (sumuttaja)	6	87.94	95.26	4	66.67
23642.	junior (sukachik3n)	6	104.07	113.46	1	16.67
23643.	subol (subolroy)	6	32.71	38.93	0	0.00
23644.	Subh (subhyj)	6	95.61	105.35	2	33.33
23645.	CallMeBea (callmebea)	6	50.79	63.02	0	0.00
23646.	James (strocode)	6	59.85	67.98	0	0.00
23647.	Straubrey (straubrey)	6	77.75	92.54	2	33.33
23648.	StorMBasilisK (stormbasilisk)	6	86.66	98.31	1	16.67
23649.	Lyanne (stiftvilt)	6	63.30	69.36	0	0.00
23650.	stibitzer (stibitzer)	6	80.45	85.79	2	33.33
23651.	Steve (stevehawk)	6	78.41	90.30	6	100.00
23652.	sterling (sterling17)	6	66.60	75.72	3	50.00
23653.	that (stepbro)	6	67.12	71.96	1	16.67
23654.	Stella (stellakitty7)	6	92.24	101.13	2	33.33
23655.	Stef (stefmx)	6	83.97	89.02	3	50.00
23656.	Mike (std_psyit_abd)	6	69.52	77.94	2	33.33
23657.	Stazenko (stazenko)	6	45.89	50.35	0	0.00
23658.	Atiruj (starwp)	6	71.91	82.64	5	83.33
23659.	Bob (starre)	6	86.71	96.20	1	16.67
23660.	Staris (starix)	6	46.47	56.17	0	0.00
23661.	i cant type (stan1)	6	90.28	105.17	3	50.00
23662.	Stam (stammm)	6	91.65	100.32	2	33.33
23663.	thpenther (sspenkerr)	6	90.58	99.50	2	33.33
23664.	Iver Andreas (ssk1ppy)	6	50.16	55.10	2	33.33
23665.	Jouii (squigglysploosh)	6	50.90	61.24	2	33.33
23666.	Squabbi (squabbi)	6	82.07	93.06	0	0.00
23667.	spuffin (spuffin)	6	108.58	121.40	5	83.33
23668.	buljangnan (springrolls)	6	142.10	148.14	5	83.33
23669.	420Benny (splergie)	6	80.67	87.44	2	33.33
23670.	Speed (speed_demon_123)	6	88.13	107.24	2	33.33
23671.	TBSTACK (speedytypister)	6	69.19	73.46	0	0.00
23672.	Jayden (speedxer)	6	81.35	86.37	3	50.00
23673.	Owen (spectrixbruh)	6	75.14	90.72	1	16.67
23674.	Colby (sparklesdudley)	6	68.21	81.74	1	16.67
23675.	Spaghetti (spaghetti_au_pot)	6	107.28	124.20	4	66.67
23676.	Sorgair (sorgair)	6	127.71	142.77	4	66.67
23677.	Sophus (sophustypelikesheit)	6	88.43	109.23	1	16.67
23678.	Sophie (sophboph)	6	94.29	107.00	4	66.67
23679.	casadaro (solocro)	6	56.01	61.94	0	0.00
23680.	soeliphilia (soeliphilia)	6	95.59	105.52	3	50.00
23681.	Nishant (soccermaniac95)	6	94.16	105.60	2	33.33
23682.	TC (snowboardnw)	6	88.36	107.25	1	16.67
23683.	Ruka (snijders)	6	63.56	76.09	2	33.33
23684.	Etesam (smogchalk)	6	87.17	101.50	3	50.00
23685.	Dian (slyr77)	6	111.01	118.21	1	16.67
23686.	Joseph (slurpherpderp)	6	107.75	139.70	3	50.00
23687.	Andre (slimas9)	6	51.11	53.95	0	0.00
23688.	Skystrike7 (skystrike7)	6	73.21	90.09	2	33.33
23689.	travis (skyrevolutionz)	6	86.91	104.47	2	33.33
23690.	skyler (skyblake01)	6	115.23	122.41	3	50.00
23691.	Worn_out (sks2k0001)	6	72.01	76.85	6	100.00
23692.	Darren (skootskii)	6	74.91	91.46	2	33.33
23693.	Skooma (skoomtastic)	6	80.97	96.27	2	33.33
23694.	SkepticalBubble (skepticalb...	6	64.37	68.76	2	33.33
23695.	skanda (skandarajeev)	6	100.12	114.33	5	83.33
23696.	Inkus (sinuema)	6	99.36	125.79	4	66.67
23697.	$insy (sinsy)	6	113.25	126.73	4	66.67
23698.	Andrew (sinnuroko)	6	70.08	77.35	3	50.00
23699.	Nomis (simsslabimbum)	6	56.46	64.12	1	16.67
23700.	Jayzee (simpy_nimble)	6	75.66	92.11	5	83.33
23701.	Simon (simonskos)	6	61.55	64.78	3	50.00
23702.	Anuar (silver_anubis)	6	62.84	67.68	2	33.33
23703.	smile (silversky666)	6	69.99	93.02	1	16.67
23704.	SilverFox (silverfox13)	6	93.81	99.77	2	33.33
23705.	Jaidyn (siimba)	6	37.92	44.46	2	33.33
23706.	Sam (shy_shy_tomato)	6	80.56	100.24	0	0.00
23707.	Milton (shurikenronlojd)	6	62.25	76.93	3	50.00
23708.	sohyameow (shoyameow)	6	33.70	35.90	0	0.00
23709.	Angi (shorti_74)	6	56.44	64.12	1	16.67
23710.	Guillermo (shneme)	6	89.09	104.33	0	0.00
23711.	Eduardo (shleepez)	6	107.02	118.11	2	33.33
23712.	Jayden (shiakose)	6	77.07	86.19	3	50.00
23713.	Shia (shiaushio)	6	94.07	108.61	2	33.33
23714.	Alex (shemet)	6	71.98	84.65	0	0.00
23715.	Shekhar (shekharchikara)	6	86.13	94.81	2	33.33
23716.	Yousif (sheibani)	6	77.68	86.02	1	16.67
23717.	Sheckla (sheckla)	6	104.18	116.77	4	66.67
23718.	Shashikanth Reddy (shashika...	6	51.33	59.73	0	0.00
23719.	Sharaf (sharaf)	6	60.11	68.23	0	0.00
23720.	Shantnu (shantnu)	6	91.09	99.18	1	16.67
23721.	Shan (shanrauf)	6	125.55	146.62	1	16.67
23722.	Shalz (shalzin)	6	48.93	59.79	2	33.33
23723.	shay (shaaaay)	6	107.68	122.51	5	83.33
23724.	Simon (sgoldins)	6	84.27	93.32	1	16.67
23725.	USS Freedom (sfmqur)	6	62.65	66.98	2	33.33
23726.	Adam (sfdcoderaz)	6	96.70	106.92	3	50.00
23727.	ruth116 (sezzag)	6	85.39	88.80	2	33.33
23728.	Sophie (seulrene)	6	96.46	107.74	2	33.33
23729.	Axel (setomi)	6	105.30	117.24	4	66.67
23730.	Serious (seriousryu)	6	99.14	103.33	3	50.00
23731.	SeppahBaws (seppahbaws)	6	75.87	91.02	1	16.67
23732.	Gene (senseieggroll)	6	84.51	96.85	1	16.67
23733.	Duy (senacen)	6	67.63	76.56	1	16.67
23734.	Samuel (semmelknoedel)	6	53.08	62.53	1	16.67
23735.	Semi (semi805)	6	76.62	79.92	1	16.67
23736.	Max (selfmelody)	6	73.25	81.43	2	33.33
23737.	Sela (selawolf)	6	33.69	38.68	0	0.00
23738.	Sebastian (sebipagura)	6	123.66	136.50	3	50.00
23739.	Sean (seanzie)	6	114.61	133.88	1	16.67
23740.	Corbin (sealcircle)	6	58.26	66.83	2	33.33
23741.	CJ (seajayyy)	6	70.39	84.62	0	0.00
23742.	Meowzer (sd_surfer4)	6	113.81	147.71	2	33.33
23743.	lei (__lwan)	5	70.81	82.30	3	60.00
23744.	Peter (_vroom_vroom_vroom_)	5	64.21	71.44	1	20.00
23745.	TQ (_tq_)	5	117.76	123.20	5	100.00
23746.	Sebastien (_stigson)	5	78.78	88.12	1	20.00
23747.	Alex (_solace)	5	129.09	136.65	5	100.00
23748.	Měkš (_kysel_)	5	37.77	42.82	0	0.00
23749.	David (zzandland)	5	117.36	124.14	3	60.00
23750.	zyx3D (zyx3d)	5	54.18	59.96	0	0.00
23751.	kent (zxcvbnmqwertyuiopasdf...	5	105.09	123.29	4	80.00
23752.	zsolesz71 (zsolesz71)	5	58.81	71.38	1	20.00
23753.	Zechariah (zs1l3nt)	5	51.80	68.15	2	40.00
23754.	Zovar (zovar)	5	84.28	91.94	2	40.00
23755.	Freddy (zoower)	5	97.86	104.34	2	40.00
23756.	sofia (zoophyy)	5	62.66	83.25	3	60.00
23757.	Lewis (znake)	5	137.80	140.57	3	60.00
23758.	ZJG11 (zjg1)	5	63.68	73.84	2	40.00
23759.	Katie (zippolighter)	5	74.49	79.06	0	0.00
23760.	Jeremy (ziney)	5	70.18	91.03	2	40.00
23761.	Robin (zeyphros)	5	90.79	99.67	2	40.00
23762.	R4g3 (zepyxlofficial)	5	64.46	71.72	1	20.00
23763.	zeon (zeon000)	5	88.74	111.06	2	40.00
23764.	Alexander (zenkarb)	5	70.24	75.53	3	60.00
23765.	Abuumin (zemonix)	5	115.64	141.29	2	40.00
23766.	zeffxy (zeffxy)	5	58.57	68.83	2	40.00
23767.	Lorenzu (zecim)	5	85.81	95.11	2	40.00
23768.	yuukinoe (zaxavien)	5	126.25	143.12	4	80.00
23769.	zayden (zaydenz12)	5	44.51	55.42	0	0.00
23770.	oli (zanthen)	5	50.27	55.75	4	80.00
23771.	Dixie (zanarkind)	5	91.33	104.93	1	20.00
23772.	Yuki (yuuuukii)	5	90.17	99.89	1	20.00
23773.	Yuseph (yuseph)	5	108.16	129.07	1	20.00
23774.	Ved (yur_amma_on_me)	5	61.03	68.84	5	100.00
23775.	Shapes (yshapes)	5	107.20	123.97	4	80.00
23776.	Youssef (youssef1781)	5	84.97	99.56	2	40.00
23777.	YourBroChris (yourbrochris)	5	94.76	113.22	3	60.00
23778.	Coco (yordle)	5	60.97	69.33	1	20.00
23779.	Yonas (yonasthenerd)	5	88.86	94.55	2	40.00
23780.	Yohann (yohann27)	5	60.44	63.53	0	0.00
23781.	Y (yinted)	5	68.84	73.98	0	0.00
23782.	yet (yettoname)	5	43.93	50.16	0	0.00
23783.	Ding (yesisd)	5	81.54	86.48	1	20.00
23784.	Yerry (yerryracer)	5	101.91	117.52	1	20.00
23785.	prithee peace (yeeyeeyeet)	5	73.62	81.78	0	0.00
23786.	pica123 (yeeboi)	5	94.74	100.00	3	60.00
23787.	yash (yashhh)	5	62.01	71.18	2	40.00
23788.	Yana (yanafaisal)	5	70.68	77.96	2	40.00
23789.	yamax (yamax)	5	63.79	70.22	0	0.00
23790.	Jack (yackpancakes)	5	70.08	76.35	2	40.00
23791.	Yersin (y3r51n)	5	56.53	67.80	2	40.00
23792.	xxneoxx (xxneoxx)	5	89.68	95.67	0	0.00
23793.	Leo (xxlxx)	5	64.57	67.45	1	20.00
23794.	XxJrebzxX (xxjrebzxx)	5	47.03	51.35	0	0.00
23795.	Daniel (xuanzang44)	5	89.18	103.72	1	20.00
23796.	Sander (xtyseth)	5	111.38	131.03	4	80.00
23797.	Max (xsrvmy)	5	94.78	103.35	1	20.00
23798.	Ryan (xryann_)	5	99.46	104.62	1	20.00
23799.	Fábio (xred13)	5	106.92	115.30	4	80.00
23800.	aCOLEMAK-ist (xphoenixgod)	5	57.09	62.91	0	0.00
23801.	Ximiz (ximiz)	5	71.06	77.40	1	20.00
23802.	J (xiji)	5	65.48	72.74	0	0.00
23803.	IG/FB @ Jivuls (xhyperize)	5	110.51	127.37	3	60.00
23804.	XGRAPHIC (xgraphic)	5	57.92	64.58	5	100.00
23805.	Daniel (xdanielx456)	5	84.42	92.07	2	40.00
23806.	indo_itu_gampang (xcloretg)	5	113.35	127.48	3	60.00
23807.	xavier (xavierguertin)	5	68.31	73.77	1	20.00
23808.	Xavier (xavasx)	5	75.87	83.97	2	40.00
23809.	Tiffany (xaelium)	5	116.36	125.42	1	20.00
23810.	Jim (wrldsmine)	5	114.68	120.88	3	60.00
23811.	emma (wooemma)	5	72.96	91.94	2	40.00
23812.	woni (woni)	5	56.62	71.39	0	0.00
23813.	Himeko (woahhhhhhhhh)	5	87.84	103.23	5	100.00
23814.	WizzzyTM (wizzzytm)	5	41.35	45.02	0	0.00
23815.	Witox (witho567)	5	89.30	94.73	1	20.00
23816.	bleh (wisdoom)	5	69.94	76.44	0	0.00
23817.	TetraVoltX (wing_x)	5	63.94	69.03	1	20.00
23818.	Matthew (windowsmasherx5)	5	100.20	111.62	2	40.00
23819.	Willem (wilm)	5	49.99	54.68	0	0.00
23820.	Will (will_colemak)	5	108.94	117.10	3	60.00
23821.	Will (willist)	5	105.15	117.52	3	60.00
23822.	s (wildbanana3000)	5	124.37	127.22	3	60.00
23823.	Wiktor (wiktorelka)	5	63.75	71.33	2	40.00
23824.	Isaiah (wijiisaiah)	5	110.82	124.59	0	0.00
23825.	WHH (whitehoodhacker)	5	85.59	95.36	3	60.00
23826.	Chicken (werdenbot)	5	76.32	88.74	1	20.00
23827.	Evan (war_king)	5	47.52	53.10	1	20.00
23828.	Xiangyu (wangxiangyu)	5	61.49	66.80	2	40.00
23829.	Austin (walktomordor)	5	128.25	139.49	1	20.00
23830.	Waflr (waflr)	5	77.37	81.37	1	20.00
23831.	Max (wafflless)	5	91.30	93.78	1	20.00
23832.	wael (wael64)	5	86.09	88.17	0	0.00
23833.	Wicho (w1ch0)	5	81.21	90.23	0	0.00
23834.	V (vvww)	5	74.89	85.30	1	20.00
23835.	Vuxe (vuxee2)	5	52.08	58.27	0	0.00
23836.	Ricky (vricky)	5	93.09	101.79	1	20.00
23837.	Colin (vondazel1)	5	91.53	104.79	2	40.00
23838.	Boris (voidnothing)	5	98.64	112.13	2	40.00
23839.	Russell (voidborn)	5	77.82	90.66	1	20.00
23840.	Vlad (vladungu56)	5	42.30	49.07	2	40.00
23841.	Vlad (vladiu5an)	5	86.84	97.44	1	20.00
23842.	rotivo (vitor999)	5	73.48	80.61	0	0.00
23843.	Craig (vitalagendas)	5	100.45	113.81	1	20.00
23844.	AB (vital26)	5	78.66	88.95	0	0.00
23845.	Vinnie (vinniethegooch)	5	107.12	118.59	2	40.00
23846.	Vinh (vinhpham8598nt)	5	140.12	148.17	3	60.00
23847.	vinc4n (vinc4n)	5	76.10	82.33	1	20.00
23848.	vii (viixivii0)	5	79.68	83.61	0	0.00
23849.	Lois (vieze_rat)	5	75.71	83.59	0	0.00
23850.	Vi (vichea)	5	60.55	65.93	4	80.00
23851.	Rinat (veryshortnamewithspa...	5	125.36	130.04	5	100.00
23852.	Vashni (vashek03)	5	66.28	84.15	1	20.00
23853.	Vally (vallyofagility)	5	83.88	95.98	1	20.00
23854.	val (valerieso)	5	85.03	87.18	4	80.00
23855.	vaimelio (vaimelio)	5	48.02	57.28	1	20.00
23856.	Usman (usmanfatal)	5	69.64	74.43	1	20.00
23857.	urchin (urchinonquit)	5	153.58	166.93	5	100.00
23858.	urbad (urbadlolgetgood)	5	74.02	84.22	1	20.00
23859.	Kariem (unpluggedzors)	5	100.69	110.84	2	40.00
23860.	Jens (unlols)	5	72.54	79.80	2	40.00
23861.	L (unlucky_luca)	5	73.88	83.48	2	40.00
23862.	undeadclicker (undeadclicker)	5	65.22	71.87	0	0.00
23863.	Maverick Jan (umbracato)	5	110.28	112.99	2	40.00
23864.	Kieran (ultimatescienceboy)	5	27.37	30.81	1	20.00
23865.	Gerard (ultimagnusv2)	5	100.67	107.57	1	20.00
23866.	Olivia (uglyratt)	5	56.31	61.96	1	20.00
23867.	ugur (u280)	5	44.72	46.42	0	0.00
23868.	Keshav (typingtitan)	5	61.20	72.56	0	0.00
23869.	olivia (typie06)	5	34.99	43.50	0	0.00
23870.	Akshat (typeracer107)	5	38.99	45.25	0	0.00
23871.	slow typist (typehero22)	5	72.10	80.29	1	20.00
23872.	Dylan (typedylan)	5	83.04	91.37	3	60.00
23873.	Hand (typedhype)	5	54.74	60.43	1	20.00
23874.	Mr T (tycho77)	5	71.49	73.76	0	0.00
23875.	Shriyash (tybaazi)	5	57.10	64.12	2	40.00
23876.	Txemi (txemi)	5	41.63	45.35	0	0.00
23877.	twikel (twikel)	5	67.26	73.27	2	40.00
23878.	Tuxtampa (tuxtampa)	5	86.07	94.75	5	100.00
23879.	Tuuli (tuulensilli)	5	76.00	82.74	1	20.00
23880.	dayy (turtlestan)	5	63.84	72.04	2	40.00
23881.	Bayram (turkmen)	5	52.58	56.27	1	20.00
23882.	TurboThiems (turboo_)	5	71.48	77.26	2	40.00
23883.	Tuguldur (tugulduruuu)	5	68.35	73.84	2	40.00
23884.	Ben (tt_ben)	5	116.91	121.39	4	80.00
23885.	tsunamibro (tsunamibro)	5	96.75	109.34	3	60.00
23886.	dotMPEG (tsirotinsky)	5	81.23	86.94	3	60.00
23887.	TrueShot (trueshotvr)	5	57.22	62.77	1	20.00
23888.	darn it (tricks_got)	5	52.54	69.81	3	60.00
23889.	Luke (tric331)	5	80.08	94.52	1	20.00
23890.	Treffig (treffig)	5	65.52	70.74	2	40.00
23891.	TRAraazze (traraazze)	5	91.14	104.33	1	20.00
23892.	Kevin (toofpaste)	5	55.25	65.23	0	0.00
23893.	Tomás (tom_cor)	5	52.28	53.55	0	0.00
23894.	Toby (toby_)	5	94.70	105.03	3	60.00
23895.	Tobias (tobiast)	5	53.55	57.92	0	0.00
23896.	ToSteR (toastedberd)	5	80.03	85.46	1	20.00
23897.	Terrence (tjwz)	5	90.93	103.11	0	0.00
23898.	Toastie (tjmck)	5	96.72	104.65	4	80.00
23899.	TJ (tjasmus)	5	107.22	118.73	5	100.00
23900.	a (tinle1307)	5	117.17	128.07	3	60.00
23901.	Timoteo (timoteothegreatest)	5	94.99	107.40	1	20.00
23902.	Timmy (timmy127)	5	73.74	77.16	1	20.00
23903.	Tima (tima_geek02)	5	48.01	59.64	3	60.00
23904.	MiNTy (thriller24)	5	114.29	121.80	4	80.00
23905.	Matthew (thooorin)	5	79.80	85.19	3	60.00
23906.	Tyler (thizzpwnt)	5	128.10	142.50	4	80.00
23907.	Archie (the_real_ace)	5	76.22	81.68	1	20.00
23908.	mongs (theworstyuki)	5	58.96	71.62	4	80.00
23909.	The Teacher (theteacher1)	5	60.42	75.84	2	40.00
23910.	Katherine (theown13)	5	49.30	55.09	0	0.00
23911.	theoryofawesome (theoryofaw...	5	72.78	78.69	2	40.00
23912.	minion (theminiongod21)	5	103.10	112.90	2	40.00
23913.	TheMatsValk (thematsvalk)	5	85.47	94.21	0	0.00
23914.	The (theking2004p1y)	5	63.32	72.78	1	20.00
23915.	Kayson (theengineer101)	5	55.14	58.64	0	0.00
23916.	Lupi (thedogz)	5	96.05	102.98	2	40.00
23917.	Zach (thecursedones)	5	90.61	93.57	1	20.00
23918.	Martin (thechuchutrain99)	5	42.16	46.13	0	0.00
23919.	Travis (theboxiestbox)	5	92.19	103.16	1	20.00
23920.	Amir (thebluebear)	5	66.95	78.79	0	0.00
23921.	Ben (thebkway)	5	85.17	92.84	0	0.00
23922.	the1466 (the1466)	5	73.89	80.65	1	20.00
23923.	U (tgod12345)	5	117.79	130.05	5	100.00
23924.	Jetsada (tertul44)	5	53.85	57.79	1	20.00
23925.	Jason (terminatorer)	5	107.60	118.25	2	40.00
23926.	no (tempotutor)	5	94.79	100.61	1	20.00
23927.	Banh Bao (teezy1)	5	54.27	61.55	0	0.00
23928.	TechnoTurtle (technoturtle)	5	63.89	69.52	5	100.00
23929.	Chance (tdskittles)	5	54.67	56.38	1	20.00
23930.	Tdaddy (tdaddy)	5	42.91	53.11	0	0.00
23931.	Larry (tcaer)	5	122.24	135.85	3	60.00
23932.	Ahmed (taymour77)	5	52.26	61.28	1	20.00
23933.	Tanuj (tanuj2552)	5	71.45	74.49	0	0.00
23934.	issac (tanthanhkaka)	5	62.94	67.86	1	20.00
23935.	takaki (takaki216)	5	54.30	62.00	2	40.00
23936.	T (taison13)	5	70.53	80.05	1	20.00
23937.	Calvin (taintedducky)	5	120.59	138.55	3	60.00
23938.	Taiken (taiken)	5	107.10	117.55	4	80.00
23939.	Tactics Typer (tacticstyper)	5	43.40	51.23	1	20.00
23940.	L (t3rraa)	5	109.21	117.67	3	60.00
23941.	Szymon (szymii112)	5	60.45	72.36	3	60.00
23942.	Tom (synikalle)	5	90.24	95.65	2	40.00
23943.	Michael (symmbowl)	5	109.35	111.83	3	60.00
23944.	sam (swissnetizen)	5	96.25	105.89	4	80.00
23945.	swirly (swirlybump)	5	87.20	98.19	2	40.00
23946.	Harriet (swipathetypa)	5	83.34	93.49	1	20.00
23947.	VillePille (surpoz)	5	81.21	89.20	1	20.00
23948.	Unai (supernax)	5	97.11	108.89	3	60.00
23949.	Izad (superlative)	5	84.84	94.38	3	60.00
23950.	SuperFire92 (superfire92)	5	109.28	115.88	4	80.00
23951.	JJ (sunnyxiao29)	5	81.18	85.60	2	40.00
23952.	sunny (sunnyx23)	5	80.27	93.55	2	40.00
23953.	Sumnima (sumnimal)	5	63.23	69.49	2	40.00
23954.	Sulaymon (sulaymon)	5	43.57	44.90	1	20.00
23955.	Robin (sulami)	5	90.67	98.89	3	60.00
23956.	Buddhist Missionary (sucpikle)	5	64.80	69.28	1	20.00
23957.	Sub (subtilklokkismann)	5	86.50	104.96	0	0.00
23958.	Steven (styledaddy)	5	83.48	86.27	1	20.00
23959.	Alex (stupidbtch67)	5	59.23	63.00	0	0.00
23960.	avery (stridersword)	5	96.96	107.60	3	60.00
23961.	Nirajan (strategist02)	5	95.51	110.39	1	20.00
23962.	Stitch (stitch2)	5	54.25	63.83	0	0.00
23963.	Colin (sticklin10)	5	100.82	105.71	1	20.00
23964.	Matthew (steviewonderful)	5	62.36	67.50	2	40.00
23965.	Stephanie (stephanie83)	5	52.39	58.42	1	20.00
23966.	Stefan (stefan_150)	5	45.06	47.19	2	40.00
23967.	Evan (stars6413)	5	112.43	117.18	3	60.00
23968.	Stadics (stadics)	5	105.44	116.78	1	20.00
23969.	Sri (sriistired)	5	51.34	55.76	0	0.00
23970.	Squock (squock)	5	80.01	92.31	1	20.00
23971.	Gian Carlo (squishygian)	5	65.07	72.68	0	0.00
23972.	Spridic (spridic)	5	97.03	102.41	3	60.00
23973.	Miguel (spideyj)	5	86.38	96.06	2	40.00
23974.	No (speedracetypist)	5	124.82	140.67	4	80.00
23975.	speedboi (speedboi11307)	5	67.16	74.33	1	20.00
23976.	esc (spectroplayer)	5	73.37	81.92	2	40.00
23977.	Nazar (spartypro)	5	71.20	86.37	1	20.00
23978.	shishir (spark__)	5	52.19	54.34	1	20.00
23979.	Spare (spare1)	5	92.87	101.50	2	40.00
23980.	Shontay (spacestayshon)	5	84.69	99.51	1	20.00
23981.	Dylan (spacedroplet)	5	56.75	60.87	0	0.00
23982.	Jakub (sovly)	5	54.96	61.81	1	20.00
23983.	Soroush (soroush_xyz)	5	59.26	70.06	0	0.00
23984.	Soqii (soqii)	5	96.30	104.49	5	100.00
23985.	SONIC (sonic_hyper)	5	81.19	96.11	2	40.00
23986.	Sonbeat (sonbeat_94)	5	48.42	59.81	0	0.00
23987.	fastjohnny72 (soggylemon)	5	88.86	108.00	3	60.00
23988.	Soft (soft_hand)	5	78.44	92.11	1	20.00
23989.	Denis (soaresden)	5	72.36	82.51	2	40.00
23990.	Snowpheasant (snowpheasant)	5	64.50	77.78	2	40.00
23991.	Alnoor (snowkoan)	5	104.94	112.51	2	40.00
23992.	Snoozeds (snoozeds)	5	53.32	63.87	0	0.00
23993.	Thomas (sniped_)	5	70.97	83.66	2	40.00
23994.	Eli (smoothautumn78)	5	61.24	68.53	1	20.00
23995.	CA (smallgoldfish)	5	33.50	36.84	1	20.00
23996.	joe biden (slowtyper_222)	5	109.62	119.22	4	80.00
23997.	Halgh (sloofer)	5	69.50	74.22	4	80.00
23998.	Slime (slime_reaper)	5	54.85	68.28	2	40.00
23999.	Sleepy (sleepy_torch)	5	89.36	96.38	1	20.00
24000.	Bricks (skyzeroblade)	5	55.07	68.15	5	100.00
24001.	Serhii (skyiea)	5	148.66	158.86	4	80.00
24002.	Sahil (skulltroxx)	5	90.24	96.30	3	60.00
24003.	Ryan (skulliex)	5	56.17	68.19	1	20.00
24004.	Nikita (skorlupka)	5	60.12	65.11	1	20.00
24005.	S (skonzer)	5	98.26	103.97	0	0.00
24006.	Skoma (skomawolf)	5	88.63	94.46	1	20.00
24007.	Aron (skillervv)	5	117.11	123.71	4	80.00
24008.	Jord (skaterjord)	5	105.50	115.03	0	0.00
24009.	Logan (sircrazy)	5	65.19	74.17	1	20.00
24010.	Siracha (sirachaman)	5	83.30	92.18	2	40.00
24011.	SIR (sirbabyboycheeks1449)	5	24.99	27.69	1	20.00
24012.	Sin (sin_x)	5	39.78	46.61	0	0.00
24013.	Shaikh (sinosco)	5	82.85	91.95	1	20.00
24014.	sinexus (sinexus)	5	73.73	80.60	4	80.00
24015.	Scotth (simurgh101)	5	66.89	76.99	2	40.00
24016.	Simon (simnetz)	5	94.36	105.00	2	40.00
24017.	simbacaned (simbacaned)	5	98.71	123.09	2	40.00
24018.	Ralph (silyy097)	5	86.12	102.32	0	0.00
24019.	Silver (silverknights1)	5	120.46	134.79	4	80.00
24020.	Ivy (sil80)	5	52.15	53.57	2	40.00
24021.	Sihaubl (sihabul)	5	41.13	45.01	1	20.00
24022.	sidd (siddvader)	5	95.86	104.69	1	20.00
24023.	Rodrigo (sicutdeux)	5	76.43	87.52	0	0.00
24024.	Shvilesh (shvilesh)	5	59.99	75.51	1	20.00
24025.	Chris (shumtlc27)	5	88.46	97.42	1	20.00
24026.	Shugoshin (shugoshin)	5	67.22	78.11	1	20.00
24027.	ShricZ (shricz)	5	78.93	86.57	5	100.00
24028.	Shourya (shourya_goddesh)	5	78.18	86.80	1	20.00
24029.	shootagain (shootadiditagain)	5	105.15	118.72	0	0.00
24030.	jeffrey (shocky147)	5	95.76	103.10	1	20.00
24031.	Mitchell (shlo)	5	81.67	92.08	1	20.00
24032.	Ryan (shiroeraiyn)	5	124.40	146.05	4	80.00
24033.	Shaun (shinypanda)	5	66.68	81.13	4	80.00
24034.	abraham (shewdiebro)	5	108.61	121.94	2	40.00
24035.	Joshua (shenazki)	5	85.04	92.23	1	20.00
24036.	Phil (sheffield712)	5	91.82	107.02	1	20.00
24037.	Stefan (sheffbee)	5	69.78	75.79	0	0.00
24038.	Sheep (sheeplmao)	5	63.06	68.64	1	20.00
24039.	Steven (shb123)	5	105.15	135.54	3	60.00
24040.	shashvat (shashvatsawar)	5	69.91	83.39	5	100.00
24041.	SharkTed (sharkted)	5	107.16	129.05	5	100.00
24042.	Sharjil (sharjil2k02)	5	58.85	69.25	0	0.00
24043.	Sharifa (sharifajpg)	5	75.60	81.40	3	60.00
24044.	Shankar (shankar1190)	5	66.70	78.30	0	0.00
24045.	S (sh19)	5	69.23	79.76	4	80.00
24046.	Sevy (sevytiglao)	5	89.15	109.41	0	0.00
24047.	Sam (sevans_)	5	61.85	69.65	1	20.00
24048.	Seth (sethicz109)	5	48.52	58.18	1	20.00
24049.	Serguk (serguk)	5	73.03	79.04	2	40.00
24050.	Sen (sen_1257)	5	52.59	58.53	0	0.00
24051.	𝒚𝒂 𝑨𝒍𝒍𝒂�...	5	89.83	96.39	0	0.00
24052.	don (seichan_04)	5	80.16	89.55	1	20.00
24053.	seema (seema1607)	5	43.34	51.39	1	20.00
24054.	Michal (sedmilhar)	5	50.97	54.33	2	40.00
24055.	Alex (sebvettel5)	5	84.38	91.63	2	40.00
24056.	Sebastian (seba2500)	5	83.00	87.62	1	20.00
24057.	sean (sean_p_k)	5	61.75	64.95	0	0.00
24058.	Sean (seansdb6)	5	84.50	88.58	3	60.00
24059.	Dmitry (scrinium)	5	59.41	64.91	2	40.00
24060.	Aloïs (scribbleempire)	5	119.65	136.08	4	80.00
24061.	Ian (arlybadgamer)	5	88.30	91.62	1	20.00
24062.	Ari (arihsieh)	5	64.40	70.61	0	0.00
24063.	arijan (arijan)	5	126.74	161.82	2	40.00
24064.	Adam (aren23)	5	49.83	56.67	0	0.00
24065.	Kevin (ardioc)	5	74.68	81.78	1	20.00
24066.	ARC6 (arc_6)	5	56.54	66.08	0	0.00
24067.	AR4444 (ar4444)	5	105.60	123.72	2	40.00
24068.	We (aquadye)	5	105.85	120.43	3	60.00
24069.	Antek (apilat)	5	113.89	119.20	2	40.00
24070.	Mohammad Anwaar Ul Hassan (...	5	41.00	45.93	1	20.00
24071.	Anupam (anupampandey)	5	32.77	37.04	0	0.00
24072.	Antón (antoonn_07)	5	46.85	52.90	0	0.00
24073.	Anthony (anthonyk)	5	90.82	99.38	0	0.00
24074.	anshika (anshi_ka)	5	44.87	54.18	0	0.00
24075.	vikalimo (anoba)	5	92.84	99.15	1	20.00
24076.	David (annefrankisdead)	5	60.05	73.65	0	0.00
24077.	Syd (angryscreech)	5	70.83	75.98	3	60.00
24078.	Andry (andry60351)	5	79.25	83.96	0	0.00
24079.	Andre (andretx)	5	113.98	140.08	3	60.00
24080.	Md. Anamul (anamul_31)	5	37.62	42.09	0	0.00
24081.	Swapneel (anactualdick)	5	39.13	45.33	1	20.00
24082.	hi cutie (an66atwork)	5	109.51	124.20	1	20.00
24083.	Amy (amysync)	5	73.98	82.42	3	60.00
24084.	amogus (amogusimposterr)	5	88.90	112.20	1	20.00
24085.	Alex Miller (amiller13)	5	81.50	99.37	4	80.00
24086.	Houtan (amdbluee)	5	61.14	71.15	2	40.00
24087.	Amazing (amazingabu)	5	42.45	54.17	3	60.00
24088.	Andrew (alz2)	5	97.66	111.87	2	40.00
24089.	Alexis (alt04)	5	92.37	97.81	0	0.00
24090.	alpha (alpha_stream)	5	95.43	103.90	0	0.00
24091.	Ryan (alphaorionis)	5	112.90	120.61	4	80.00
24092.	Alpha147258 (alpha147258)	5	82.59	96.78	1	20.00
24093.	Allison (allche208)	5	83.58	94.53	0	0.00
24094.	ALEXUNDER (alex_under667)	5	78.82	95.47	3	60.00
24095.	Alex (alex_the_flash)	5	55.15	66.00	1	20.00
24096.	Alexander (alexkingen)	5	97.16	102.11	4	80.00
24097.	Alex (alexisstillalive)	5	85.71	91.26	4	80.00
24098.	Aleeya (alemm5293)	5	24.04	30.17	0	0.00
24099.	ADF (aldf)	5	88.96	98.82	1	20.00
24100.	albert (albert_d)	5	122.81	133.16	5	100.00
24101.	nerond (alambek)	5	70.50	88.19	2	40.00
24102.	MAB (al00)	5	72.32	73.44	1	20.00
24103.	Singam (akshay_singam)	5	32.82	39.99	0	0.00
24104.	Akimbo (akimboshara)	5	51.49	56.81	0	0.00
24105.	askela (akiii)	5	57.10	67.11	0	0.00
24106.	Akash Atmaram Main (akashma...	5	41.34	47.08	0	0.00
24107.	akshay (akannaa19)	5	54.70	60.28	1	20.00
24108.	Vroom Vroom (ajgriffy)	5	121.73	133.89	2	40.00
24109.	Aimz (aimz123)	5	91.88	104.64	2	40.00
24110.	Aidian (aidothepro)	5	60.59	69.32	1	20.00
24111.	Aidan who just types (aidnb...	5	70.02	74.90	1	20.00
24112.	Aibar (aiburito)	5	65.61	74.59	1	20.00
24113.	Wasim (ahsaanfd1)	5	65.76	80.84	0	0.00
24114.	A S (ahmad1shmd)	5	28.49	34.36	2	40.00
24115.	Alex (ahed1)	5	79.56	88.32	2	40.00
24116.	alex (agogalex)	5	97.00	115.62	3	60.00
24117.	Aki (agidaman)	5	100.22	109.18	2	40.00
24118.	Golden guy (aggressor2007)	5	87.66	94.31	3	60.00
24119.	Sherlock (agatecard)	5	90.43	99.97	2	40.00
24120.	Aftab (aftab535)	5	51.00	60.45	1	20.00
24121.	apark (aesenix)	5	120.13	151.67	3	60.00
24122.	Naruto_Uzumaki (aeochs)	5	46.65	50.37	5	100.00
24123.	AdventureStorm (adventurest...	5	86.14	92.79	2	40.00
24124.	Adur (adurto)	5	49.23	58.05	2	40.00
24125.	Dio (adroid28)	5	54.56	62.42	0	0.00
24126.	Robin (adraqi)	5	85.67	91.99	1	20.00
24127.	Hey (adksljfaslkfjsaf)	5	85.36	98.11	3	60.00
24128.	Aditya (aditya23112002)	5	62.65	66.42	1	20.00
24129.	Aditya (adi20raj)	5	99.70	108.50	2	40.00
24130.	adham (adham123)	5	67.41	76.13	0	0.00
24131.	Adarsh (addyempire)	5	88.93	96.18	1	20.00
24132.	adamski (adast1337)	5	82.02	109.25	2	40.00
24133.	YG Adam (adamallerton12)	5	159.45	168.59	0	0.00
24134.	Alonna (acannoy)	5	97.71	111.99	2	40.00
24135.	absorb (abvorb)	5	95.42	103.30	2	40.00
24136.	Abn0rmalzzz (abn0rmalzzz)	5	88.19	92.94	0	0.00
24137.	Abhinav (abhinav199920)	5	22.21	27.18	0	0.00
24138.	abdullah (abdullah_foysal)	5	46.85	52.28	0	0.00
24139.	Aaron Huang (aaronslept)	5	94.67	106.54	1	20.00
24140.	Ahmad (aalay5558)	5	79.46	92.55	3	60.00
24141.	Abdelrahman (aabounegm)	5	80.80	89.87	5	100.00
24142.	Asharab (8krinkels)	5	106.25	119.79	1	20.00
24143.	hades (83hades)	5	79.36	93.72	0	0.00
24144.	Leo (80_wpm)	5	67.19	71.77	2	40.00
24145.	7NNS7 (7nns7)	5	70.35	85.92	2	40.00
24146.	Wang (69wangjiaming69)	5	78.12	87.70	3	60.00
24147.	abe (404abe)	5	82.25	90.83	1	20.00
24148.	ELectr8c (3l3ctr1c)	5	67.80	81.13	2	40.00
24149.	Kevin (2erhabanana)	5	126.19	139.25	4	80.00
24150.	Ntusekho (2cmngadi)	5	53.89	64.24	0	0.00
24151.	Darryl (250wpm)	5	114.42	124.08	5	100.00
24152.	PheniX (2504435)	5	61.78	66.98	2	40.00
24153.	Joyce (20emilywang20)	5	101.58	112.91	2	40.00
24154.	Ikramuzzaman (2017331054)	5	75.28	82.53	1	20.00
24155.	SpeedKing (1t2t3t4t)	5	80.38	88.14	2	40.00
24156.	Icy (1see_1cy)	5	94.02	104.03	1	20.00
24157.	R3d (1ch1g0)	5	47.72	55.24	1	20.00
24158.	Jakob (1awesomeblossom)	5	50.40	56.71	0	0.00
24159.	Harrison (160810601)	5	101.18	108.39	4	80.00
24160.	Knight (14_knights)	5	82.22	103.21	2	40.00
24161.	Arman (148038)	5	64.69	69.26	0	0.00
24162.	13grainbreads (13grainbreads)	5	78.89	82.56	1	20.00
24163.	Andrew (123andrewli)	5	99.05	106.07	3	60.00
24164.	Giorgi (0_alien)	5	100.89	120.59	1	20.00
24165.	Bono (sp000neyarc123)	5	70.33	78.26	3	60.00
24166.	hemanth (hemanthyt)	5	39.93	44.67	0	0.00
24167.	Mohniish (mohniish)	5	38.04	42.81	0	0.00
24168.	Mary (fufu778)	5	64.33	70.76	1	20.00
24169.	Jacob (3rdkira)	5	80.71	96.88	3	60.00
24170.	oralfuntime (oralfuntime)	5	72.34	80.67	1	20.00
24171.	スピード　モンスタ...	5	74.91	83.59	1	20.00
24172.	Brian (canama)	5	80.09	89.11	1	20.00
24173.	AdriDraino (adridraino)	5	78.74	86.38	5	100.00
24174.	Carol (myersca_718)	5	56.47	69.32	0	0.00
24175.	ssefjg (ssefjg)	5	78.58	85.42	1	20.00
24176.	Supreme (gogogogogogo)	5	51.65	56.92	1	20.00
24177.	Space (spaceusername)	5	61.26	74.25	4	80.00
24178.	Dejan (mortle2)	5	79.64	88.26	3	60.00
24179.	kenzoku (bubbles0989)	5	60.19	66.37	2	40.00
24180.	m (mbregg)	5	105.10	111.10	1	20.00
24181.	Zed (zeddyboy)	5	96.98	107.90	2	40.00
24182.	Wicked (wickedwizard01)	5	71.68	86.42	1	20.00
24183.	Tarun (c2tarun)	5	92.83	105.32	1	20.00
24184.	Cath (phamduongthu15)	5	37.95	42.50	1	20.00
24185.	Sam (saldag)	5	65.10	66.14	1	20.00
24186.	Tabi (tabitopsy)	5	44.25	51.15	0	0.00
24187.	Juddas (juddas)	5	37.02	39.58	0	0.00
24188.	MrXzurg (sheehanrafif_)	5	41.94	47.54	0	0.00
24189.	Akash (xvergil)	5	79.54	92.87	1	20.00
24190.	Yassine (alcatrax_x)	5	109.13	118.03	2	40.00
24191.	Shawn (shawn02)	5	90.71	98.79	2	40.00
24192.	vane (spvlh)	5	28.76	32.77	1	20.00
24193.	Sylus Lock (nczeneth)	5	52.02	62.98	2	40.00
24194.	Jonathan (olympic4)	5	97.88	102.40	1	20.00
24195.	exeSyth (exesyth)	5	40.77	43.25	1	20.00
24196.	Spoofii (spoofii)	5	85.63	110.36	1	20.00
24197.	Bojan (skender)	5	54.51	64.76	0	0.00
24198.	Khian (khian_21pogi)	5	64.43	69.59	3	60.00
24199.	catsea (lullabbye)	5	82.63	89.23	2	40.00
24200.	animeber (animeber)	5	97.18	118.50	4	80.00
24201.	Takeshi (dr4z3n)	5	108.84	116.14	3	60.00
24202.	big (bigbuddha)	5	73.99	80.59	2	40.00
24203.	attu22 (ogattu)	5	119.00	137.55	4	80.00
24204.	IntellectualPotato (intelle...	5	74.87	87.46	1	20.00
24205.	Omar (omaro_ib)	5	80.51	90.28	0	0.00
24206.	Lana (poopfrog)	5	69.65	75.83	2	40.00
24207.	Luan (holdy)	5	75.86	80.55	3	60.00
24208.	Autismo (aut1smo)	5	70.66	77.54	2	40.00
24209.	Amer (qedady)	5	47.28	51.47	1	20.00
24210.	Joshua (jsmooth2121)	5	47.36	52.79	0	0.00
24211.	VandronRKD (vandronrkd)	5	111.36	119.62	2	40.00
24212.	Alex (alaxe)	5	89.76	107.63	0	0.00
24213.	Naveen (navi_kane)	5	53.10	56.11	1	20.00
24214.	grey (brianshits)	5	67.98	73.56	1	20.00
24215.	Ahmed (ahmedsamy_4664)	5	36.30	40.98	2	40.00
24216.	it's Gucci (itsgucci)	5	74.57	78.53	2	40.00
24217.	George (telosme)	5	61.47	64.48	2	40.00
24218.	Supawat (tamsri)	5	82.06	100.84	2	40.00
24219.	Rdawk (rdawk99)	5	65.05	70.65	0	0.00
24220.	Noah (kibitzers)	5	81.26	84.68	1	20.00
24221.	Finn (finndg)	5	67.32	76.12	1	20.00
24222.	Kenma (lovekenma)	5	90.11	92.46	2	40.00
24223.	Villiie (villiie)	5	35.09	37.12	0	0.00
24224.	Hugo (bofibofi)	5	46.88	50.81	0	0.00
24225.	K2 (k_twobit)	5	100.62	117.47	2	40.00
24226.	buzz (juzzbuzz)	5	105.51	114.01	5	100.00
24227.	Lewis (doomboy98)	5	89.69	102.86	2	40.00
24228.	Tim (kingofracer)	5	85.52	99.39	1	20.00
24229.	Sloth (intriguedsloth)	5	64.73	71.23	2	40.00
24230.	Mohammad (boilingcold)	5	78.32	87.82	1	20.00
24231.	Jordy (jordygm)	5	42.19	54.82	1	20.00
24232.	Alejandro (olojondro)	5	84.48	98.28	1	20.00
24233.	Lars (onedayoumay)	5	26.56	27.39	0	0.00
24234.	nawara (_nc_)	5	50.22	59.63	0	0.00
24235.	Alex (alexxishere)	5	66.91	84.68	1	20.00
24236.	Alberto (ajbananaminion)	5	63.40	74.27	2	40.00
24237.	Kieran (asianend)	5	88.16	108.86	4	80.00
24238.	_KillerTears (killertears)	5	41.78	45.31	1	20.00
24239.	Caitlyn (marbledcake78)	5	35.10	39.97	0	0.00
24240.	Bryan (bryanvu93)	5	101.08	128.14	2	40.00
24241.	Tom (tomwrld999)	5	43.81	46.05	0	0.00
24242.	Daniel (audiopromaster2)	5	106.65	116.13	2	40.00
24243.	Master (yuoseefanmu)	5	70.42	76.28	0	0.00
24244.	pika (pikanotjx)	5	49.61	55.21	0	0.00
24245.	AIR (airtwothousand)	5	73.46	79.20	0	0.00
24246.	Ixora (ixo_ra)	5	79.80	87.59	2	40.00
24247.	Bianca (morningstar_abba)	5	78.97	92.97	4	80.00
24248.	Luciano (lucianom)	5	49.20	54.83	0	0.00
24249.	Lai (neutrogena)	5	115.97	133.12	3	60.00
24250.	Flame (flame_eddie)	5	85.38	92.05	3	60.00
24251.	Alonso (rralonn)	5	49.61	54.41	1	20.00
24252.	HowieY (roadto100)	5	99.55	108.42	3	60.00
24253.	Tsu (andso_rise8824)	5	64.63	75.70	0	0.00
24254.	Tom (smileykorean)	5	95.67	114.54	3	60.00
24255.	Isaiah (isatti)	5	50.48	59.72	0	0.00
24256.	William (astronaut98)	5	104.57	117.10	4	80.00
24257.	John (tommyismad)	5	96.52	105.89	3	60.00
24258.	DoNWoLF (donwolf)	5	59.49	64.08	1	20.00
24259.	Jago (akskgaksh)	5	49.41	52.12	0	0.00
24260.	Nishiora (astroit)	5	103.19	108.79	2	40.00
24261.	leno (len0)	5	70.63	76.91	2	40.00
24262.	Giancarlo (chiqui2000)	5	57.65	62.88	2	40.00
24263.	Noor (noorquacker)	5	100.86	110.73	0	0.00
24264.	akhil (akhilc47)	5	69.59	72.93	1	20.00
24265.	Matzi (skaug)	5	46.41	50.80	0	0.00
24266.	MrEWhite (mrewhite)	5	94.66	99.22	2	40.00
24267.	Valter (valtiniho)	5	68.61	73.54	2	40.00
24268.	tariqul (tariqul)	5	38.19	44.93	0	0.00
24269.	Saadmann (saadmann)	5	61.53	68.42	1	20.00
24270.	Michele (razgriz_1)	5	50.25	54.22	0	0.00
24271.	prem (prembarri)	5	34.63	39.07	0	0.00
24272.	Sri (srivb70)	5	81.24	93.72	2	40.00
24273.	Santa (santasanta)	5	85.12	99.59	5	100.00
24274.	Lil (lilnuts)	5	62.71	67.68	1	20.00
24275.	Ak (a_cake_k)	5	67.24	79.86	0	0.00
24276.	Tibster (tiberius87)	5	78.09	90.03	3	60.00
24277.	Nosam (nosam1261)	5	44.09	54.72	1	20.00
24278.	Arek (arkadiuszu_krocej)	5	92.63	101.34	2	40.00
24279.	Donux (donux)	5	41.05	45.11	0	0.00
24280.	Jay (hellhunter)	5	94.34	107.89	2	40.00
24281.	Mark (merkii)	5	66.01	76.69	2	40.00
24282.	Nathan (kolacheater)	5	105.89	131.86	4	80.00
24283.	Steve (hollasch)	5	86.55	98.41	4	80.00
24284.	Brian (briandreed)	5	96.75	105.12	3	60.00
24285.	lim (limjunan)	5	36.67	38.29	0	0.00
24286.	kerwiwii (kerweni)	5	56.15	61.36	0	0.00
24287.	Nelson (nelsonhh)	5	56.45	62.43	1	20.00
24288.	Abdulmalek (abdulmalek69)	5	55.67	68.90	1	20.00
24289.	bigbogie (hxrxs)	5	77.94	86.32	1	20.00
24290.	Epic (amdryzen95950x)	5	57.93	65.45	0	0.00
24291.	mrgila69 (d1sc0rd_m4n)	5	39.88	45.37	0	0.00
24292.	Agustin (picklerickm4ster_69)	5	48.49	52.00	1	20.00
24293.	Eduard (mistersirr)	5	76.39	87.40	2	40.00
24294.	Hello (im_a_snail)	5	52.11	59.22	0	0.00
24295.	Benjamin (benjamingmb)	5	55.89	57.83	2	40.00
24296.	Justice (justice9659)	5	53.07	58.15	1	20.00
24297.	jack (masterkratos)	5	47.61	58.12	0	0.00
24298.	jssepinkman (jssepinkman)	5	74.01	81.39	1	20.00
24299.	Emma (emjulu)	5	92.02	103.17	1	20.00
24300.	78_18 (flynnforthewin)	5	58.80	63.70	1	20.00
24301.	Simon (donracer)	5	81.35	90.97	1	20.00
24302.	Shin (jopang)	5	59.70	70.69	1	20.00
24303.	ray (rayzx)	5	65.30	74.30	0	0.00
24304.	Leah (leahloo)	5	62.82	71.80	0	0.00
24305.	Andrew (ajcajc)	5	29.32	33.95	0	0.00
24306.	Adit Gupta (qwv1)	5	48.51	55.75	1	20.00
24307.	⠀___🐌⠀ (valdizney)	5	88.96	104.22	2	40.00
24308.	Luna (pix100)	5	58.87	63.01	4	80.00
24309.	Fran (raisinfran)	5	35.44	40.63	0	0.00
24310.	MINO (manuper)	5	75.38	84.82	0	0.00
24311.	Siomayu (siomayu)	5	84.30	89.73	0	0.00
24312.	Mike (ketakun)	5	95.45	117.40	5	100.00
24313.	Martin (manpluskeys)	5	65.36	73.50	1	20.00
24314.	zeggsy (zeggsy)	5	54.75	62.68	0	0.00
24315.	Joe (funnypear)	5	59.66	74.48	0	0.00
24316.	ayoung (theicychickennugget)	5	95.50	109.61	3	60.00
24317.	Geri (geri_cs)	5	83.75	88.11	2	40.00
24318.	Anton (90mer)	5	51.52	56.10	0	0.00
24319.	Akkoza (akkoza)	5	99.69	118.41	2	40.00
24320.	Sage (s4je)	5	88.83	92.80	2	40.00
24321.	N0PuLS3 (nopulse)	5	64.45	70.28	1	20.00
24322.	Andrew (jeffdamoose)	5	87.57	105.39	5	100.00
24323.	Edmar (yoedmar)	5	115.03	132.72	5	100.00
24324.	kuwl (kuwlman)	5	78.41	90.02	1	20.00
24325.	Shantel (typer_racer12345)	5	72.68	80.54	3	60.00
24326.	Carol (lo_o_o_ol)	5	50.78	53.31	1	20.00
24327.	Trinity (sop0rific)	5	95.65	106.47	4	80.00
24328.	JustTimoCraft (justtimocraft)	5	88.96	93.78	2	40.00
24329.	F (hfrx)	5	46.69	50.73	1	20.00
24330.	Meap (meapme)	5	45.86	48.15	2	40.00
24331.	Sri (waaz)	5	83.65	93.13	1	20.00
24332.	Angel (angel_v1)	5	31.47	32.80	1	20.00
24333.	Maddie (maddiejo37)	5	31.12	35.63	1	20.00
24334.	XRed (xred001)	5	43.22	51.18	1	20.00
24335.	Othman (nero27)	5	48.32	50.72	1	20.00
24336.	Jay (jayryan1823)	5	50.85	54.74	0	0.00
24337.	Jerms (jerms575)	5	49.76	56.15	0	0.00
24338.	JedOo (jedoo)	5	34.40	38.14	0	0.00
24339.	Armagnac (lhason)	5	89.82	98.86	0	0.00
24340.	MT (thethai)	5	89.13	93.10	1	20.00
24341.	Zain (zainfds)	5	45.76	52.56	0	0.00
24342.	Jake (hidragg)	5	90.71	95.21	2	40.00
24343.	Foxight (foxight)	5	86.13	91.81	2	40.00
24344.	Kobuljon (kobuljon)	5	35.79	40.95	1	20.00
24345.	Mohammed (nomaan447)	5	25.11	28.63	0	0.00
24346.	Frederick (carolinar7)	5	73.80	78.16	1	20.00
24347.	Ejaculator (ibeatandscream)	5	28.25	35.37	1	20.00
24348.	Sam (sam5566)	5	50.97	56.54	1	20.00
24349.	Jaden (jayby18)	5	90.36	98.52	1	20.00
24350.	James (a_watermelown)	5	51.74	53.44	0	0.00
24351.	kaptaan (dodger_x)	5	51.34	61.36	0	0.00
24352.	Aleyshanime (jocelynwirawan_5)	5	25.00	27.55	2	40.00
24353.	jad (jadabbas)	5	57.14	65.89	2	40.00
24354.	ever (nothing_here)	5	67.42	81.18	1	20.00
24355.	Ghost (internet_ghost)	5	41.68	46.55	2	40.00
24356.	thisisname (somenickname)	5	60.89	65.44	0	0.00
24357.	Cirmotlan (cirmotlan)	5	80.11	87.76	1	20.00
24358.	Nathan (nattys86)	5	77.19	85.81	1	20.00
24359.	Reynante (perwisyoboy_0309)	5	51.62	55.97	2	40.00
24360.	John (jdaye)	5	84.49	89.27	1	20.00
24361.	Wim (circuit_phaser)	5	56.02	62.23	1	20.00
24362.	Danny (danielkim762)	5	64.26	74.61	0	0.00
24363.	Connor (connor11son)	5	70.76	76.40	2	40.00
24364.	Dustin (lonnie_stud)	5	50.52	55.18	0	0.00
24365.	rcolinmichael (rcolinmichael)	5	62.16	73.66	2	40.00
24366.	Emmet (eedesr)	5	39.46	52.57	0	0.00
24367.	Stepan (steppy9)	5	58.33	67.46	2	40.00
24368.	Khing (khairo_j1)	5	94.09	99.37	5	100.00
24369.	noa (noapejic)	5	48.93	52.46	1	20.00
24370.	Ja0-X (ja0_x)	5	71.00	73.37	0	0.00
24371.	han (muming)	5	54.59	58.86	0	0.00
24372.	Deprest (deprest_jesus)	5	45.44	56.04	0	0.00
24373.	pabin (pabin_sh)	5	55.01	63.75	2	40.00
24374.	Sami (krimzy)	5	61.63	65.31	4	80.00
24375.	Ossian (ossiank)	5	43.19	45.33	2	40.00
24376.	lordy123 (lordy123)	5	55.28	63.33	2	40.00
24377.	syd (syddakid)	5	59.13	66.42	1	20.00
24378.	Cheeseperson (cheeseyman)	5	30.78	36.53	1	20.00
24379.	Christian (theonehue)	5	97.03	110.84	4	80.00
24380.	swich (swich11)	5	77.30	87.02	1	20.00
24381.	Denis (denisbelmondo)	5	104.03	109.38	1	20.00
24382.	Jan (jan__)	5	53.67	70.64	2	40.00
24383.	arpan (arpan2048)	5	46.95	50.71	2	40.00
24384.	Jonathon Lansink (jlansink15)	5	133.45	145.36	5	100.00
24385.	chocolate (stratonov16)	5	63.11	64.25	5	100.00
24386.	Sam (migrantaxis)	5	53.71	58.78	1	20.00
24387.	Vishal (vis_hal)	5	70.45	81.60	0	0.00
24388.	grace (_gr4c3g_)	5	64.26	74.39	2	40.00
24389.	Joe (schlegs88)	5	73.62	78.88	2	40.00
24390.	Connor (schellc)	5	93.01	100.62	2	40.00
24391.	Sawataro (sawatar_o)	5	63.53	73.32	0	0.00
24392.	Jaden (sasmiku)	5	64.16	70.74	1	20.00
24393.	Arjun (sarjunt)	5	86.31	92.20	2	40.00
24394.	:(: (sara_ks)	5	113.45	127.04	3	60.00
24395.	Aren (sarckelle)	5	78.03	83.51	5	100.00
24396.	Sanh (sanhnguyennt)	5	68.24	73.70	3	60.00
24397.	Sam (sam_a17)	5	46.86	57.14	0	0.00
24398.	Sam (samz19)	5	74.50	85.34	1	20.00
24399.	Sam (samuel_h)	5	64.19	73.71	1	20.00
24400.	samuel (samuelfung123)	5	114.21	124.70	2	40.00
24401.	Sam (sam313)	5	90.62	96.10	1	20.00
24402.	sauce (sam0the0samurai)	5	50.16	52.24	0	0.00
24403.	Omar (salthesloth)	5	36.07	42.30	3	60.00
24404.	Salmonax (salmonax)	5	114.87	127.37	3	60.00
24405.	Celine (salamiii)	5	116.09	132.51	2	40.00
24406.	Typing McQueen (sakram07)	5	92.98	100.26	3	60.00
24407.	Kite (saizuchi)	5	95.02	104.68	5	100.00
24408.	Maxim (saipade)	5	71.32	76.27	2	40.00
24409.	Sah (sahsooh)	5	68.79	74.17	2	40.00
24410.	SaggiSponge (saggisponge)	5	154.12	168.68	5	100.00
24411.	Candelaria (sadtrash)	5	92.27	98.32	2	40.00
24412.	TaxKween (sadiek)	5	101.21	108.31	4	80.00
24413.	David (saddj001)	5	97.77	114.68	5	100.00
24414.	STOIC (sachindra_111)	5	64.30	74.45	1	20.00
24415.	Rzn (rzn_)	5	77.55	91.82	0	0.00
24416.	Red (rzhvnbrg)	5	71.83	81.84	5	100.00
24417.	Ryu (ryusong)	5	112.40	125.83	2	40.00
24418.	Ryen (ryenwang)	5	73.00	81.24	2	40.00
24419.	Ryan (ryanylee02)	5	76.35	84.50	1	20.00
24420.	Ryan On (ryanon0127)	5	80.77	87.63	2	40.00
24421.	Ruicky8 (ruicky8)	5	102.01	117.87	3	60.00
24422.	RG18 (rudolphgaming18)	5	98.06	111.80	1	20.00
24423.	Rudy (rudiferr)	5	91.78	101.82	2	40.00
24424.	Ivo (ruberiot)	5	44.95	49.89	0	0.00
24425.	R (rswow)	5	50.04	59.03	0	0.00
24426.	rryann (rrrrryannnnnn)	5	74.89	77.90	0	0.00
24427.	Bobby (rradhak1)	5	113.76	121.82	4	80.00
24428.	roy (roylimas)	5	68.25	69.73	1	20.00
24429.	Dean (routerboy6126)	5	60.48	71.72	0	0.00
24430.	Rosie (rosiem)	5	98.14	105.01	4	80.00
24431.	roodley (roodley)	5	92.62	103.36	2	40.00
24432.	Orm Tammemäe (romex123)	5	75.35	83.40	2	40.00
24433.	Ammo (rokudoku)	5	68.54	72.49	0	0.00
24434.	rohaya (rohaya)	5	73.50	79.30	1	20.00
24435.	Rohan (rohanji)	5	58.88	67.31	3	60.00
24436.	Roham (rohamhasbadaim)	5	116.94	133.63	4	80.00
24437.	inhalement (roger4190)	5	133.60	155.92	3	60.00
24438.	Robert (robertdchiodo)	5	89.07	98.16	0	0.00
24439.	DarkInstinct (road_to_ultra...	5	37.19	44.74	0	0.00
24440.	dabbytabby (roadto110wpm)	5	56.14	60.61	0	0.00
24441.	fishy (roadto135wpm)	5	108.87	117.28	4	80.00
24442.	Roachel (roacheljang)	5	72.66	83.54	2	40.00
24443.	Ash (rndmash)	5	45.51	48.14	1	20.00
24444.	r (rmeev_)	5	54.17	71.00	1	20.00
24445.	___.rishii.____ (rishikesh_...	5	30.56	33.24	1	20.00
24446.	(discord: risheek.) (risheek7)	5	68.42	80.04	2	40.00
24447.	Rishan (rishancredo)	5	68.18	78.62	1	20.00
24448.	RSN (risan_rsn)	5	41.97	52.73	2	40.00
24449.	Ripshawryan (ripshawryan)	5	74.27	83.20	3	60.00
24450.	rieru (rieru)	5	64.30	71.91	2	40.00
24451.	R (richigro)	5	40.83	53.66	2	40.00
24452.	Based (riceater)	5	82.04	86.24	4	80.00
24453.	Riadath (riadath)	5	63.32	67.14	0	0.00
24454.	rhombus (rhombus3)	5	120.40	126.68	4	80.00
24455.	Dank Memes (rezzex)	5	67.73	72.65	2	40.00
24456.	Reyan (reyanman)	5	65.87	70.48	2	40.00
24457.	Alex (revl8er)	5	89.41	99.10	0	0.00
24458.	PMD_cLark* (revenge1)	5	48.90	55.58	0	0.00
24459.	Retsu (retsu_s)	5	50.68	60.86	0	0.00
24460.	reicy (reicy794)	5	70.01	76.13	1	20.00
24461.	refrshrs (refrshrs)	5	81.80	86.54	0	0.00
24462.	RecoH86 (recoh86)	5	110.82	126.91	2	40.00
24463.	@diegosalasix (reclamadcr)	5	75.95	82.39	0	0.00
24464.	Reason (reasonspecter)	5	105.27	116.74	3	60.00
24465.	Елдынбек (realkotak)	5	35.67	39.61	0	0.00
24466.	Kaleb (realkaleb)	5	118.35	123.60	5	100.00
24467.	Ryan (rchoi34)	5	101.84	108.23	2	40.00
24468.	Rawan (rbadri)	5	52.53	63.47	1	20.00
24469.	Rafli (razorndasmu)	5	76.21	90.19	1	20.00
24470.	Rayhan (rayhanihsan)	5	60.86	66.26	2	40.00
24471.	Rexza (rawr2002)	5	60.34	63.47	2	40.00
24472.	Ravi (raviivar)	5	61.27	68.41	1	20.00
24473.	Roei (rapidroei)	5	109.67	117.22	3	60.00
24474.	Pog (randomguy2005)	5	105.51	117.55	3	60.00
24475.	Amadej (ramadox)	5	64.11	69.36	1	20.00
24476.	Raj (raj_37)	5	73.97	83.88	1	20.00
24477.	Rajshekar (rajshekar__)	5	59.31	61.69	0	0.00
24478.	Rajinikanth (rajini_macbook)	5	96.54	103.63	0	0.00
24479.	Rajat (rajatbhatnagar)	5	77.38	91.47	2	40.00
24480.	Raizen (raizou)	5	89.73	104.19	2	40.00
24481.	Kenzo (raindropping)	5	87.19	100.01	3	60.00
24482.	Zack (raichubuddy)	5	93.26	116.48	1	20.00
24483.	Rahul (rahul1q)	5	76.93	89.24	2	40.00
24484.	Rafae (rafae110)	5	68.25	79.09	1	20.00
24485.	Rasmus (r4zoth)	5	93.63	101.50	3	60.00
24486.	Joe (qwertyuiop4)	5	79.83	85.90	1	20.00
24487.	Rafael (qwertyspade)	5	120.24	129.16	3	60.00
24488.	ad (quqquqqqu)	5	88.22	97.06	2	40.00
24489.	new (quitting101)	5	84.57	94.47	2	40.00
24490.	Eric (queeric)	5	90.16	101.27	5	100.00
24491.	cryo. (quaintoutcast)	5	75.78	84.86	4	80.00
24492.	Not the chosen (qrota_1)	5	68.06	74.68	1	20.00
24493.	qiqete (qiqete)	5	60.34	64.37	0	0.00
24494.	Annilese (qingkang)	5	69.85	79.71	1	20.00
24495.	Paul (qdozaq)	5	66.06	72.97	1	20.00
24496.	Evan (qasem_soleimani)	5	82.88	96.98	1	20.00
24497.	Jack (putridllama)	5	75.66	80.70	0	0.00
24498.	Puskar (puskar_pandey)	5	56.68	61.71	3	60.00
24499.	chris (pumpino)	5	67.25	80.32	0	0.00
24500.	Alex (pugnation)	5	89.88	98.33	1	20.00
24501.	The (pseudotypist)	5	91.60	104.65	1	20.00
24502.	proxer05 (proxer05)	5	32.65	34.87	2	40.00
24503.	Protoclasm (protoclasm)	5	92.93	101.24	3	60.00
24504.	Pro Star (prostar1)	5	49.68	56.40	0	0.00
24505.	Fabio (prosfearme)	5	110.09	124.22	1	20.00
24506.	Matthew (programcrazy)	5	80.22	97.57	2	40.00
24507.	Basliel Z (prince_bz)	5	60.38	73.48	0	0.00
24508.	Pranav Abraham (pranavabe)	5	96.69	118.74	2	40.00
24509.	saurabh (practisemore)	5	68.38	76.83	2	40.00
24510.	duckg (poweryourmind)	5	49.52	59.25	1	20.00
24511.	Nathan (potatosaurus)	5	91.28	99.72	2	40.00
24512.	Ed (positrone)	5	68.39	73.20	2	40.00
24513.	Dominic (porvoolink)	5	74.04	84.69	2	40.00
24514.	Nate (poppafig)	5	93.34	100.37	5	100.00
24515.	Poop (poopeey)	5	56.48	61.15	1	20.00
24516.	Kyle Me (poledancerz)	5	115.45	126.51	3	60.00
24517.	Simone (pointy_)	5	78.28	86.52	0	0.00
24518.	Youxun (poe0oeo0iie9)	5	69.20	73.10	0	0.00
24519.	Poonnawich (pnwkrdsup)	5	79.30	88.32	2	40.00
24520.	pluto (plut0_)	5	97.53	112.25	2	40.00
24521.	PlusJ (plusj)	5	76.35	86.76	2	40.00
24522.	cecilia (plumerias)	5	106.08	119.79	3	60.00
24523.	Xavier (plourde27)	5	104.15	118.21	3	60.00
24524.	Michael (pixelatedmike)	5	86.97	94.76	2	40.00
24525.	PixelatedFungus (pixelatedf...	5	116.65	130.09	5	100.00
24526.	Pi (pilover)	5	103.26	111.23	2	40.00
24527.	mione (pikapals16)	5	68.72	83.37	2	40.00
24528.	daneil (piggasauwus)	5	103.95	114.56	4	80.00
24529.	Jordan (pigeye123)	5	57.91	66.79	1	20.00
24530.	tstats[pianisthassan] (pian...	5	94.55	102.57	0	0.00
24531.	pp (phlyingturtle)	5	85.51	93.94	2	40.00
24532.	David (phawkes21)	5	92.92	106.54	2	40.00
24533.	PH23NIX (ph23nix)	5	113.71	120.15	3	60.00
24534.	Paul (pgailey)	5	48.20	52.56	0	0.00
24535.	Allen (pfzhengs)	5	113.48	130.16	4	80.00
24536.	Petros (petros2711)	5	44.43	48.72	1	20.00
24537.	Berry (peter_parker15)	5	99.71	104.98	1	20.00
24538.	Maya (periiwrinkles)	5	96.67	103.22	0	0.00
24539.	Me (perfectaim)	5	109.03	116.63	1	20.00
24540.	Peppa (peppa_24)	5	67.84	80.82	1	20.00
24541.	Emil (pepepls)	5	92.02	96.05	2	40.00
24542.	Byron (peace942)	5	76.77	79.94	0	0.00
24543.	Pearl (pcaton94)	5	35.00	40.81	0	0.00
24544.	Pawel (pawelpro)	5	114.54	122.37	5	100.00
24545.	paper2222 (paper2222)	5	96.75	108.97	0	0.00
24546.	rosie (paparosie)	5	75.24	82.19	3	60.00
24547.	Paolo (paolo23)	5	63.52	66.16	1	20.00
24548.	PANTIOS (pantios)	5	41.34	54.31	0	0.00
24549.	Alex (pancaxee)	5	62.05	71.99	1	20.00
24550.	Pallav (pallav123goyal)	5	83.42	94.08	2	40.00
24551.	PaleWhale (palewhale)	5	53.17	60.17	1	20.00
24552.	Joshua (pachathighceps)	5	78.22	94.11	2	40.00
24553.	Ozma (ozma0foz)	5	96.13	105.09	3	60.00
24554.	Left (ozcelllist)	5	126.23	137.67	5	100.00
24555.	OverTheRocks (overtherocks)	5	52.74	64.04	1	20.00
24556.	Other_Pigeon (otherpigeon)	5	98.36	105.91	1	20.00
24557.	JAK (osraild)	5	83.65	88.53	0	0.00
24558.	Osian (osian)	5	82.24	97.82	2	40.00
24559.	Osama (osama_alkhodairy)	5	69.56	75.38	2	40.00
24560.	Blank (orzlyxd)	5	43.51	51.72	1	20.00
24561.	Orr (orr10c)	5	86.72	102.45	5	100.00
24562.	orphysca (orphysca)	5	86.91	96.48	1	20.00
24563.	Orestis (orestisdr)	5	66.84	68.97	1	20.00
24564.	oussama (oredshadow)	5	23.65	25.62	0	0.00
24565.	Kostas (orange_inc)	5	103.75	115.15	3	60.00
24566.	Onny (onny_gwozed)	5	66.15	77.62	1	20.00
24567.	oni (onigiri_)	5	60.53	66.01	3	60.00
24568.	Erik (onezero_)	5	76.16	89.23	1	20.00
24569.	Oncom (oncomlz)	5	62.51	81.77	1	20.00
24570.	Christina (omqchristi)	5	69.13	78.27	1	20.00
24571.	woland (omario42)	5	90.74	112.68	2	40.00
24572.	Olli (olzi)	5	60.60	75.57	1	20.00
24573.	Olvi73 (oliverck73)	5	57.85	65.06	1	20.00
24574.	Oktoroden (oktoroden)	5	81.98	91.82	0	0.00
24575.	aloysius (okitkat)	5	53.49	71.70	0	0.00
24576.	O (oking167)	5	45.46	49.43	0	0.00
24577.	ojaswi (ojaswi)	5	64.34	67.48	3	60.00
24578.	Jed (oh_no_yes)	5	61.07	65.67	0	0.00
24579.	senz (offsets)	5	70.72	76.63	0	0.00
24580.	Elijah (officialhajile)	5	98.03	101.21	3	60.00
24581.	鐘 (obarisk)	5	67.11	69.97	2	40.00
24582.	Fahad (obakfahad)	5	61.42	68.66	1	20.00
24583.	Oatseveryday (oatseveryday)	5	58.75	65.71	1	20.00
24584.	n_bob (n_bob)	5	92.32	94.07	2	40.00
24585.	Nils (nw13)	5	54.14	55.32	2	40.00
24586.	Nutel (nutel65)	5	64.11	67.53	0	0.00
24587.	Nunya (nunyab)	5	114.35	133.51	3	60.00
24588.	Abby (numberonethumbtack)	5	55.69	67.14	1	20.00
24589.	Nugsky (nugsky)	5	50.43	55.55	1	20.00
24590.	Esli (no_name0312)	5	49.65	51.46	1	20.00
24591.	Bricen (nowyouseeme1233)	5	86.76	95.57	2	40.00
24592.	Real (not_available_name)	5	109.62	115.28	2	40.00
24593.	Victor (notoriousvic)	5	62.08	75.81	2	40.00
24594.	Lil J (notlilj)	5	74.93	87.41	0	0.00
24595.	James (nothisisjames)	5	110.82	114.78	2	40.00
24596.	Stephen (nothamlet)	5	88.37	105.93	3	60.00
24597.	Darin (notdvu)	5	96.82	125.12	2	40.00
24598.	Nordaxion (nordaxion)	5	115.08	129.29	2	40.00
24599.	Plutonium (nooter_booter)	5	81.21	91.23	0	0.00
24600.	Justine (noob3tc)	5	80.24	88.88	1	20.00
24601.	nongginga (nongginga)	5	51.79	58.09	0	0.00
24602.	Ongasm (nong321)	5	83.13	96.93	1	20.00
24603.	Bailey (nob0dy)	5	86.45	93.62	1	20.00
24604.	Noa (noamax)	5	95.22	101.86	3	60.00
24605.	Noam (noamaster88)	5	114.99	120.94	2	40.00
24606.	DarkShadowSage (nlopez20)	5	76.82	94.83	0	0.00
24607.	Issac (njchicken)	5	103.79	123.66	0	0.00
24608.	( ˙꒳​˙ ) (nizuu)	5	100.47	120.27	2	40.00
24609.	Nisse (nissevex)	5	104.77	115.23	1	20.00
24610.	Nirved (nirved_06)	5	50.68	55.88	0	0.00
24611.	Miras (ninth_hokage)	5	58.84	68.75	2	40.00
24612.	Jose (nino1)	5	79.43	89.14	1	20.00
24613.	Seth (ninjashark121)	5	113.08	120.55	3	60.00
24614.	Nils (nil0y)	5	61.80	67.80	0	0.00
24615.	Mykola (nikoliazekter)	5	82.30	85.81	3	60.00
24616.	Nikola (nikola5056)	5	85.05	94.88	2	40.00
24617.	Nikhil (nikhilaii93)	5	81.59	85.93	1	20.00
24618.	nika (nika07)	5	86.46	90.58	0	0.00
24619.	Athul (night_shark)	5	60.65	69.48	1	20.00
24620.	TYPESTARS (nightprobe)	5	128.52	136.88	4	80.00
24621.	Night (nighterror)	5	84.12	91.61	3	60.00
24622.	nielrenned (nielrenned)	5	95.08	98.29	3	60.00
24623.	nicole (nicoleyee)	5	85.61	89.44	0	0.00
24624.	Nicholas (nickowski)	5	84.26	98.44	0	0.00
24625.	tony (nickjonaz)	5	88.46	96.92	4	80.00
24626.	ნიცკა ✌ (nickga...	5	139.45	146.04	5	100.00
24627.	Nicholas (nicholasozarka)	5	61.08	67.81	1	20.00
24628.	Daniel (nicedanmonkey)	5	90.60	97.55	1	20.00
24629.	Nicole (nhixon)	5	70.49	76.46	2	40.00
24630.	ngmnm (ngmnm)	5	58.39	63.23	1	20.00
24631.	Nezgar (nezgar)	5	80.78	85.03	2	40.00
24632.	Newtotyping (newtotyping07)	5	56.74	64.63	0	0.00
24633.	vanhoghe (newbgenjiboy)	5	97.48	106.69	0	0.00
24634.	Sven (nevslehcim)	5	59.57	71.30	1	20.00
24635.	Michael (nevado247)	5	106.77	120.17	3	60.00
24636.	csnormie (nerfedcookie)	5	125.55	143.94	5	100.00
24637.	Notorious (neodivin)	5	80.63	93.72	2	40.00
24638.	Emilio (nenglara)	5	67.37	94.92	0	0.00
24639.	Nemika (nemika)	5	96.20	106.42	2	40.00
24640.	niamh (neemogozoom)	5	82.78	106.72	0	0.00
24641.	Necredibly (necredibly)	5	69.80	74.33	1	20.00
24642.	Filip (necr0nz)	5	103.43	127.14	2	40.00
24643.	Balazs (nb666)	5	85.84	93.88	1	20.00
24644.	nac (naxx_colemak)	5	123.05	156.25	1	20.00
24645.	Nasufp (nasufp)	5	12.21	22.01	0	0.00
24646.	Muhammed (naseebnex)	5	45.02	48.73	0	0.00
24647.	Naren (narenr2005)	5	59.73	63.90	0	0.00
24648.	Narberal (narberal)	5	35.47	43.15	0	0.00
24649.	Kovács (namox22)	5	39.22	42.34	0	0.00
24650.	ching (nameiso)	5	61.72	72.86	1	20.00
24651.	Joe (naman189089)	5	53.47	58.90	1	20.00
24652.	Nakul (nakush)	5	44.81	47.02	0	0.00
24653.	Naidru (naidru)	5	112.51	133.42	2	40.00
24654.	Troy (n1x377)	5	119.77	132.19	5	100.00
24655.	NZ (n0tninjaz)	5	107.72	117.22	3	60.00
24656.	Aryan (n00bzz)	5	57.32	64.26	0	0.00
24657.	Mickey (m_dvorak)	5	85.41	102.10	1	20.00
24658.	m_1_1_m (m_1_1_m)	5	60.91	73.54	1	20.00
24659.	Jon (mystikj)	5	108.97	119.47	2	40.00
24660.	bob (mypotatoflies)	5	86.51	92.43	1	20.00
24661.	Mylow (mylow)	5	121.89	132.04	3	60.00
24662.	Myles (myles_morris)	5	85.50	90.18	1	20.00
24663.	B (mxnxmoon)	5	50.47	54.19	0	0.00
24664.	Marcus (mwcx)	5	101.83	104.91	4	80.00
24665.	murdershards (murdershards)	5	89.34	96.97	2	40.00
24666.	bhufsianm (muhfiasbin)	5	56.97	60.28	1	20.00
24667.	Brody (mudspud)	5	60.56	70.07	1	20.00
24668.	Patches (mr_bear101)	5	87.57	98.22	1	20.00
24669.	brett (mru_uward)	5	26.98	30.53	0	0.00
24670.	Lin (mrtuxg)	5	70.44	70.98	0	0.00
24671.	Jumz (mrpaperman)	5	110.37	124.04	2	40.00
24672.	Bjoern (mrmuetze)	5	81.40	85.81	1	20.00
24673.	Just a (mrmuawa)	5	125.35	134.47	3	60.00
24674.	Kellan (mrkt59)	5	49.45	52.92	1	20.00
24675.	Aniket (mrjerry1q98)	5	59.78	66.54	0	0.00
24676.	Roberto (mrgarri)	5	104.28	111.80	4	80.00
24677.	Jared (mrfatguy227)	5	110.37	118.71	2	40.00
24678.	zarkasi (mozar)	5	55.78	67.61	1	20.00
24679.	mouni (mouni576)	5	48.73	59.14	1	20.00
24680.	MouldyBaguette (mouldybague...	5	69.78	74.41	0	0.00
24681.	MostPassiveUser (mostpassiv...	5	63.77	68.04	2	40.00
24682.	disgusting pig (morytain)	5	102.96	108.99	1	20.00
24683.	Mohamed (momo5482)	5	47.26	56.02	0	0.00
24684.	Mohit (mohitisgreat)	5	87.21	93.49	4	80.00
24685.	MOhI (mohi9731)	5	31.53	36.94	0	0.00
24686.	Mohamed (mohamed_ayman)	5	84.51	89.03	1	20.00
24687.	Mohamed (mohamedafify)	5	68.02	74.15	0	0.00
24688.	Moazzem Hossain (moazzemh222)	5	41.69	43.92	0	0.00
24689.	Matthew (mjthekandyman)	5	85.02	102.58	2	40.00
24690.	mjlambrechtje (mjlambrechtje)	5	83.97	88.68	0	0.00
24691.	manoj (mjbx)	5	40.15	43.13	0	0.00
24692.	Mizule (mizule)	5	56.39	60.49	1	20.00
24693.	Mitchell (mitchellmisayah)	5	86.48	93.95	3	60.00
24694.	mischgu (mischgu)	5	76.47	81.63	3	60.00
24695.	julia (misailuj)	5	49.48	56.05	2	40.00
24696.	MI (misabic)	5	51.20	53.61	1	20.00
24697.	Jacob (mini_gaunt)	5	93.88	96.40	0	0.00
24698.	150 how? (minidraco)	5	91.07	103.51	2	40.00
24699.	mineschweppes (minescheppes)	5	103.03	121.06	2	40.00
24700.	Michael (mikey2312)	5	78.59	101.12	2	40.00
24701.	Ryan (mikeeei)	5	94.85	101.22	2	40.00
24702.	mikaanz (mikaanz)	5	65.74	73.13	2	40.00
24703.	Mihir (mihir1125)	5	103.47	109.47	2	40.00
24704.	Mike (migpok35)	5	102.59	117.34	5	100.00
24705.	Microwism (microwism)	5	78.79	88.40	2	40.00
24706.	Michae; (michaeldamianus)	5	90.60	113.45	1	20.00
24707.	michael (michaelabdi)	5	81.66	87.22	2	40.00
24708.	jan (micaelaishot123)	5	110.42	118.57	3	60.00
24709.	Me (me_myself)	5	77.92	87.13	1	20.00
24710.	Max (mexx_)	5	73.25	89.50	2	40.00
24711.	Mexikorn (mexikorn)	5	94.54	108.57	0	0.00
24712.	Daniel (metalspork)	5	122.88	131.14	5	100.00
24713.	Seyed Mostafa (meshkati)	5	79.30	89.72	1	20.00
24714.	Merwin (merwin_samuel)	5	55.93	59.21	1	20.00
24715.	Mert (mertle)	5	87.31	90.74	0	0.00
24716.	marvin (mendelmarvin1)	5	40.67	43.81	0	0.00
24717.	memesthatsucc (memesthatsucc)	5	69.33	80.05	1	20.00
24718.	Meitou (meitou)	5	68.65	83.46	4	80.00
24719.	Mehul (mehulraj69)	5	27.64	28.60	0	0.00
24720.	Mehul (mehulparmar459@gmail...	5	67.15	71.62	1	20.00
24721.	💵 (mebank)	5	69.78	74.80	0	0.00
24722.	Maddie (mdjjones)	5	66.12	68.86	0	0.00
24723.	MB (mbmasher)	5	135.30	155.21	3	60.00
24724.	Shoaib Akbar (ma_boi619)	5	85.20	91.63	4	80.00
24725.	Patrick (maxmad53)	5	64.63	69.43	1	20.00
24726.	Max (maxlikesstuff)	5	87.74	92.58	3	60.00
24727.	Max (maximyss)	5	102.21	109.17	2	40.00
24728.	マット (mat_rusty)	5	87.24	90.98	1	20.00
24729.	Matthew (mattyb_)	5	83.49	90.92	3	60.00
24730.	Matthew (matthuwu)	5	76.76	80.98	4	80.00
24731.	Matthew (matthew_sellens)	5	45.67	56.02	1	20.00
24732.	Matthew (matthewmob)	5	98.67	117.36	2	40.00
24733.	Matt (mattdaddy27)	5	81.45	85.07	1	20.00
24734.	matej (matejck)	5	95.24	103.48	1	20.00
24735.	MasterDebater (masterdebate...	5	116.93	125.56	4	80.00
24736.	Espen Oliver (masterabsinthe)	5	77.38	89.65	4	80.00
24737.	Mashrur (mashrur45)	5	79.51	87.39	1	20.00
24738.	madi (marstooswag)	5	51.53	55.30	4	80.00
24739.	マロン (marron)	5	66.47	75.41	1	20.00
24740.	Marko (markosc523)	5	65.32	75.31	2	40.00
24741.	Zach (markertassel)	5	81.56	93.16	0	0.00
24742.	Martin (marh1694)	5	49.33	58.88	3	60.00
24743.	Federico (marche96)	5	36.75	43.67	1	20.00
24744.	marce (marcelojraj)	5	92.89	104.14	0	0.00
24745.	Manu (manuuuuuuu)	5	52.53	55.81	3	60.00
24746.	Yvette (mamachoi)	5	41.39	44.23	0	0.00
24747.	Nicholas (fryingpan)	5	115.65	135.05	2	40.00
24748.	James (frozenoblivion)	5	70.54	80.47	0	0.00
24749.	Nutalie (frostybeep)	5	100.64	107.84	4	80.00
24750.	Derf (fredboi)	5	87.14	111.62	2	40.00
24751.	Logan (freamish)	5	109.40	121.22	3	60.00
24752.	FraYo (frayo)	5	74.14	80.18	2	40.00
24753.	Santiago (forero)	5	81.56	88.45	1	20.00
24754.	fordatab (fordatab)	5	64.96	100.84	2	40.00
24755.	OBsole (footcandilight)	5	92.46	95.33	1	20.00
24756.	Rosencrantz (foolbright)	5	78.03	92.59	1	20.00
24757.	Frank (floturcocantsee)	5	101.75	114.23	2	40.00
24758.	RUDRANSH! (flame_ethnic)	5	72.87	85.70	2	40.00
24759.	seth (firewolf_2001)	5	86.53	93.37	1	20.00
24760.	Julien (fioul)	5	79.74	86.48	3	60.00
24761.	Fionnan (fionnanos2000)	5	70.02	86.55	1	20.00
24762.	Michael (fiftyfingers)	5	92.19	105.35	4	80.00
24763.	Max (ficko)	5	68.44	72.69	0	0.00
24764.	Halis (fezira)	5	81.29	91.29	0	0.00
24765.	fer (ferreginaa)	5	51.83	61.01	0	0.00
24766.	Femiiiiiiiiii (femiboom)	5	73.35	83.11	0	0.00
24767.	alnexus (felipxkillerbr)	5	96.14	103.67	1	20.00
24768.	Felipe (felipe2896)	5	62.74	79.39	1	20.00
24769.	Fearless (fearless_soul)	5	61.80	79.57	3	60.00
24770.	Youssef (fcijuniorr01)	5	51.47	57.83	5	100.00
24771.	Yan Yan (fatheryanyan)	5	47.61	52.06	1	20.00
24772.	ZeRandom (fastnt)	5	82.66	91.90	4	80.00
24773.	Faorle (faorle)	5	95.13	112.97	0	0.00
24774.	fang (fangyibkk)	5	62.24	71.85	0	0.00
24775.	Fang (fango_)	5	94.95	104.82	5	100.00
24776.	Fammis (fammis)	5	79.22	106.83	2	40.00
24777.	Fahrenheit (fahrenhite)	5	92.59	108.09	1	20.00
24778.	Fadeaway (fadeaway286)	5	68.37	83.27	2	40.00
24779.	Fabian (fabiangubler)	5	74.45	80.47	2	40.00
24780.	tstats[f6rz9d] (f6rz9d)	5	46.10	51.26	0	0.00
24781.	flats (f1ats)	5	59.55	66.51	3	60.00
24782.	Vidur (f0rs4k3n)	5	49.89	51.67	1	20.00
24783.	Ezequiel (ezk84)	5	66.88	75.11	0	0.00
24784.	Garrett (ezekiel6430)	5	46.32	51.63	0	0.00
24785.	EzBeau (ezbeau)	5	92.09	100.78	2	40.00
24786.	eyosias (eyosi_sol)	5	44.93	53.05	3	60.00
24787.	OoOoOoOoOoOoO (extralen)	5	39.01	45.47	0	0.00
24788.	Exojay (exojay)	5	115.76	120.46	4	80.00
24789.	Matthew (exiamu)	5	98.46	111.10	3	60.00
24790.	Evening (eveningtaco)	5	106.83	129.98	3	60.00
24791.	Ethan (ethanangg)	5	82.02	90.55	4	80.00
24792.	Pixelking251 (espk251)	5	99.42	117.31	2	40.00
24793.	eroblaze (eroblaze)	5	62.72	68.91	0	0.00
24794.	Erin (erinchipppppppp)	5	82.62	88.11	2	40.00
24795.	eric_colemak (eric_colemak)	5	93.45	99.87	3	60.00
24796.	eqqi (eqqidvorak)	5	68.31	71.36	1	20.00
24797.	Robert (epicsauce32)	5	93.82	101.26	3	60.00
24798.	Duy (epicbrick)	5	67.16	80.53	1	20.00
24799.	enton (enton420)	5	85.19	91.45	3	60.00
24800.	trashbin (ennoch)	5	87.62	95.16	3	60.00
24801.	Vlad (engurararazov)	5	64.65	68.69	0	0.00
24802.	Ender (endermood)	5	59.89	64.38	1	20.00
24803.	Emma (emmaish)	5	86.78	91.33	3	60.00
24804.	Jeff (ekuplosion)	5	108.56	120.31	5	100.00
24805.	eigo (eigo)	5	56.79	60.84	0	0.00
24806.	EHHH (ehhh_)	5	86.90	96.55	2	40.00
24807.	zeyad (egyptian_1211)	5	56.46	61.44	1	20.00
24808.	egg (egg_soup)	5	95.27	100.36	2	40.00
24809.	Alex (eggstreme)	5	109.28	115.64	4	80.00
24810.	David (ebiswick)	5	94.70	102.25	2	40.00
24811.	Aslan (dzhindzholia)	5	71.47	79.49	1	20.00
24812.	D (dylanite13)	5	64.10	72.63	2	40.00
24813.	Kelvin (duongkelvin75)	5	72.22	74.15	2	40.00
24814.	กูคือความ...	5	74.37	79.77	1	20.00
24815.	Duncan (dungrimm)	5	68.94	75.81	3	60.00
24816.	vanessa (dumdimsum)	5	111.59	119.67	2	40.00
24817.	Abhinav (dudeja55)	5	45.35	51.75	0	0.00
24818.	duc (duchihi)	5	64.15	68.41	1	20.00
24819.	Gabriel (dsgab)	5	88.49	102.76	2	40.00
24820.	DryGer (dryger27_)	5	63.92	72.18	0	0.00
24821.	dryeab (dryeab)	5	56.06	65.47	5	100.00
24822.	drake (drunk3n)	5	69.25	74.47	1	20.00
24823.	Archer (drugzy)	5	57.35	63.97	1	20.00
24824.	DrSnackary (drsnackary)	5	102.94	121.34	0	0.00
24825.	Dan (drimilyon)	5	97.40	108.23	1	20.00
24826.	Dawid (dresik)	5	91.13	99.32	3	60.00
24827.	Travis (drdream23)	5	107.17	118.95	2	40.00
24828.	Kaloyan (doublelv)	5	75.78	80.47	2	40.00
24829.	double (doubleliftisgod)	5	87.28	96.82	0	0.00
24830.	Doubledealer (doubledealer)	5	93.88	106.39	3	60.00
24831.	Dorito (doritochip)	5	93.28	103.15	1	20.00
24832.	Leif :3 (dopotsl)	5	80.71	90.48	1	20.00
24833.	Ziwei (dongryeollee)	5	118.16	131.07	3	60.00
24834.	Domking (domking)	5	81.14	92.79	2	40.00
24835.	Frederik (dobobay)	5	100.65	116.14	2	40.00
24836.	Duong (dnx04)	5	68.13	78.22	0	0.00
24837.	Peter (dletastar4)	5	99.19	105.17	3	60.00
24838.	Ali (djsum)	5	97.17	113.45	0	0.00
24839.	CrispTea (distance)	5	145.73	161.47	5	100.00
24840.	Dom (disfordom)	5	121.40	145.73	5	100.00
24841.	Timothy (disapointing)	5	102.31	114.98	3	60.00
24842.	Debdip Das (dipto_debdip)	5	55.52	57.94	0	0.00
24843.	deepika (dips26)	5	37.93	41.69	0	0.00
24844.	Dimituri (dimituri)	5	83.41	94.62	1	20.00
24845.	dmitrijs (dhmitry)	5	97.68	109.84	5	100.00
24846.	Deranged (de_ranged)	5	74.81	81.22	2	40.00
24847.	Quinn (dewdrive101)	5	84.12	93.13	1	20.00
24848.	Andrew (dewdew7)	5	104.85	113.22	3	60.00
24849.	Albert (devmood)	5	69.70	73.04	3	60.00
24850.	me (devilsdaily)	5	70.05	79.42	1	20.00
24851.	Javokhir (developer_007)	5	65.21	73.90	2	40.00
24852.	DetectiveRegen (detectivere...	5	73.76	82.36	0	0.00
24853.	Jamie (destroyer_of_words)	5	89.33	120.03	0	0.00
24854.	Omar (desouky22)	5	53.86	59.76	1	20.00
24855.	jayden (dershlibob)	5	75.49	81.81	2	40.00
24856.	Derrick (derrickha)	5	112.01	135.87	1	20.00
24857.	Micha (derpeus)	5	85.43	97.19	1	20.00
24858.	Derex (derexd)	5	120.12	139.48	3	60.00
24859.	GD (degeemon21)	5	85.76	94.34	3	60.00
24860.	Heaven (defintelynotjah)	5	140.59	152.55	5	100.00
24861.	deez (deez_nuits)	5	38.72	42.00	0	0.00
24862.	Diego (decoarguello)	5	43.54	47.75	0	0.00
24863.	Deasy (deasnataly)	5	93.30	104.83	0	0.00
24864.	migs12345 (deanfanboy)	5	93.42	105.22	1	20.00
24865.	Andrew (ddrone)	5	84.72	88.06	1	20.00
24866.	Daniel (dax1536c)	5	49.53	55.79	0	0.00
24867.	david (davideman4)	5	58.92	66.99	1	20.00
24868.	Davelkling (davelkling)	5	103.76	115.73	3	60.00
24869.	Peder (darthpejder)	5	64.73	69.05	3	60.00
24870.	Ignacio (darkylove)	5	81.39	96.48	5	100.00
24871.	Alejandro (darkian)	5	98.32	110.84	0	0.00
24872.	Nyx (darkforrest)	5	54.13	62.28	2	40.00
24873.	Dan (danvnbls)	5	57.91	66.85	0	0.00
24874.	Dani (danisoltesz)	5	77.58	83.25	3	60.00
24875.	Daniel (daniel1353)	5	74.59	87.30	3	60.00
24876.	Dant (dancal22)	5	87.66	94.81	2	40.00
24877.	coin (damasterofcoin)	5	92.65	102.26	1	20.00
24878.	daghag (daghag)	5	80.43	88.23	1	20.00
24879.	Dylan (dabair1)	5	72.76	79.19	1	20.00
24880.	vehemore (d4bb3r)	5	97.49	120.72	2	40.00
24881.	Dmitry (d1pj_123)	5	37.96	40.16	2	40.00
24882.	Daniel (d0eza)	5	108.55	121.78	3	60.00
24883.	Vanisse (cyphen)	5	65.27	69.70	4	80.00
24884.	Cynthia (cynbin)	5	91.43	100.14	0	0.00
24885.	cee (cxelle)	5	92.87	104.73	3	60.00
24886.	DucNguyen (cuberates)	5	99.27	117.17	1	20.00
24887.	cuago (cuago)	5	77.85	95.08	2	40.00
24888.	Cryo (cryotalis)	5	141.30	151.00	4	80.00
24889.	Craig (crvig)	5	100.91	111.75	4	80.00
24890.	Courtney (croy726)	5	71.71	80.84	4	80.00
24891.	meme (crimsonvava)	5	79.17	93.91	1	20.00
24892.	Arnav (cricketman360)	5	82.04	92.20	3	60.00
24893.	Kevin (crazycranberry)	5	93.76	102.25	1	20.00
24894.	Kareem (crashhadback)	5	94.41	118.38	2	40.00
24895.	Warren (craggles)	5	106.17	113.41	5	100.00
24896.	Cuong (cqtshadow)	5	64.02	73.75	1	20.00
24897.	Santi (coyang)	5	70.26	74.88	0	0.00
24898.	Count (countlizzard)	5	72.02	81.64	0	0.00
24899.	cottonaudie (cottonaudie)	5	61.56	69.07	3	60.00
24900.	Corny (cornyy)	5	84.82	96.60	2	40.00
24901.	Steven (corilx)	5	85.04	90.43	0	0.00
24902.	Corey (coreygallagher1194)	5	70.75	77.26	1	20.00
24903.	Nguyen (corei9001)	5	77.22	82.62	0	0.00
24904.	Michael (coppinslinger)	5	94.63	101.74	2	40.00
24905.	Jhoe (cookiemeeps)	5	85.89	94.46	1	20.00
24906.	slr (con_d_oriano1)	5	91.40	118.44	1	20.00
24907.	connie (conniexlee)	5	113.35	121.90	4	80.00
24908.	Jotaro (commandercuber)	5	107.67	110.36	2	40.00
24909.	123 (colemak163)	5	93.33	95.95	0	0.00
24910.	Cole (colejay)	5	83.49	93.76	2	40.00
24911.	Jake (coike2323)	5	71.60	82.67	1	20.00
24912.	Shahzada (coderssalim)	5	53.50	59.06	1	20.00
24913.	Cod3 (cod3_catz)	5	79.83	88.58	1	20.00
24914.	Manikandan (cmkrss)	5	39.47	46.54	1	20.00
24915.	Sree (clyublexx)	5	67.84	76.79	1	20.00
24916.	clpz (clpz)	5	83.68	87.58	4	80.00
24917.	clock (clockw0rk)	5	94.30	101.84	3	60.00
24918.	Brody (clocktoc)	5	100.06	109.22	2	40.00
24919.	Alfred (cliserkad)	5	74.19	78.19	5	100.00
24920.	Virgil (clinz63)	5	80.99	84.55	1	20.00
24921.	clinkz (clinkkz)	5	46.54	49.09	0	0.00
24922.	Clay (clay10swag)	5	71.37	76.91	0	0.00
24923.	Chris (ckinto)	5	123.52	129.70	1	20.00
24924.	CJB314 (cjb314)	5	101.37	103.84	5	100.00
24925.	C (ciaram21)	5	47.67	51.13	1	20.00
24926.	Chuzz (chuzzilla)	5	121.90	141.41	3	60.00
24927.	Chris (chrisp3oh)	5	62.41	70.81	0	0.00
24928.	Smiggy (chillnye)	5	119.66	126.27	4	80.00
24929.	Chili (chilipaneer)	5	93.65	99.76	2	40.00
24930.	nick (chiefotto)	5	57.88	62.38	0	0.00
24931.	Chhilz (chhilz)	5	107.17	118.64	4	80.00
24932.	Chet (chetbaker)	5	122.90	137.20	4	80.00
24933.	Andrew (chessdoudou)	5	69.14	72.90	1	20.00
24934.	Cheesie (cheesie_muffin)	5	37.88	39.87	0	0.00
24935.	Nolan (cheesedog145)	5	68.93	77.30	0	0.00
24936.	Seymour (cheapsunglasses)	5	104.51	110.68	4	80.00
24937.	Che (che247)	5	87.84	90.53	1	20.00
24938.	Bilal (chaudhryb)	5	108.48	125.93	4	80.00
24939.	Mujahid (chaos_knight)	5	84.80	91.43	1	20.00
24940.	Challenger (challenger21008)	5	44.59	45.90	0	0.00
24941.	Chacho (chacho12)	5	54.28	57.89	2	40.00
24942.	bubu (cgfu)	5	87.14	94.40	4	80.00
24943.	Tarik (cevapmaster)	5	90.22	112.81	5	100.00
24944.	cdolivera (cdolivera)	5	104.28	114.02	2	40.00
24945.	Mateusz (ccre)	5	92.95	102.11	2	40.00
24946.	choco (cchoki)	5	123.54	132.57	2	40.00
24947.	Cathleen (cathleenavrilian)	5	54.90	62.14	0	0.00
24948.	Cody (catchytyper)	5	89.85	101.74	0	0.00
24949.	Casey (caseyjnguyen)	5	93.71	100.71	3	60.00
24950.	Carsyn (carsynw)	5	57.99	63.27	1	20.00
24951.	Edgar (carrot9510)	5	72.75	81.38	5	100.00
24952.	capmc88 (capmc88)	5	88.03	106.31	1	20.00
24953.	Cant (cant_code)	5	89.97	108.55	1	20.00
24954.	Ian (call_me_lan)	5	94.83	109.83	1	20.00
24955.	Callum (callum__)	5	73.10	91.41	0	0.00
24956.	char (calcifer_6)	5	70.76	79.31	4	80.00
24957.	Caketin (caketin_cat)	5	90.97	103.74	2	40.00
24958.	Isaac (caelstrasza)	5	113.25	120.00	0	0.00
24959.	cab (cab23)	5	110.75	122.39	1	20.00
24960.	Caleb (cabona)	5	75.48	87.08	3	60.00
24961.	bweb (bweb)	5	62.94	84.11	1	20.00
24962.	Haytham (bwaredevoodoo)	5	58.04	80.20	1	20.00
24963.	Donn Justin (bulos19)	5	70.49	76.22	0	0.00
24964.	Edward (buitrungbao)	5	90.57	96.75	5	100.00
24965.	Budwecan (budwecan)	5	56.21	60.50	3	60.00
24966.	Marty (budmike54)	5	56.47	64.85	3	60.00
24967.	brr type man (brrrtypeman)	5	68.36	76.54	5	100.00
24968.	Brian (brianlii)	5	45.56	51.58	1	20.00
24969.	mesba (brgrkng)	5	95.08	102.30	3	60.00
24970.	Leroy (breezytwitch)	5	47.47	52.80	0	0.00
24971.	BranClown611 (brandenclown)	5	95.79	110.06	3	60.00
24972.	Bram (bramster007)	5	75.35	82.51	1	20.00
24973.	Boyang (boyangliuu)	5	71.99	76.03	1	20.00
24974.	bowlby (bowlby_)	5	92.32	103.07	3	60.00
24975.	Kaylin (boomba506)	5	86.34	92.83	3	60.00
24976.	Bob (bobychen)	5	82.97	92.81	1	20.00
24977.	Hailey (bobthetem)	5	90.40	109.38	2	40.00
24978.	N4aten (bobthebot)	5	81.13	98.78	2	40.00
24979.	BobSty (bobsty)	5	68.30	77.21	3	60.00
24980.	real_remi (bobbobbio)	5	68.18	87.34	1	20.00
24981.	B (bnowba)	5	89.97	106.38	2	40.00
24982.	Mohammadamin (bmz8880)	5	59.96	69.42	0	0.00
24983.	Blu (blu_mint)	5	62.82	69.23	1	20.00
24984.	Herin (bluxygurl)	5	82.95	96.54	2	40.00
24985.	blue (blueisblue)	5	47.24	54.08	1	20.00
24986.	bloodseeker (bloods33ker136)	5	67.99	81.20	1	20.00
24987.	Bloggo (bloggowo)	5	83.49	90.47	2	40.00
24988.	Blizzard (blizzardwindx)	5	95.95	102.49	1	20.00
24989.	Laith (blissterrz)	5	84.31	96.81	0	0.00
24990.	blinno (blinno)	5	77.38	100.25	5	100.00
24991.	Pink Guy (bleachuggr)	5	90.44	104.39	2	40.00
24992.	r (blazinrt)	5	67.14	72.24	2	40.00
24993.	Roger (blasticidin)	5	93.97	100.96	2	40.00
24994.	Blafl (blafl)	5	108.34	114.39	2	40.00
24995.	Bjorn (bjornbaboon)	5	112.03	129.40	3	60.00
24996.	BitBytez (bitbytez)	5	53.95	61.95	0	0.00
24997.	Marco (biomean)	5	66.61	77.37	1	20.00
24998.	Simp4turtles (bingoringo)	5	43.06	49.15	0	0.00
24999.	Brody (bingbongbottledong)	5	87.87	98.34	1	20.00
25000.	bigpapa (bigpapathapa)	5	68.30	75.18	2	40.00
25001.	Will (bigmac1time)	5	98.25	102.76	0	0.00
25002.	Agus (bigbangfuzion)	5	55.12	61.96	0	0.00
25003.	Seungil (biam83)	5	60.75	66.72	0	0.00
25004.	Brittany (bhunter9)	5	85.49	91.76	1	20.00
25005.	Be (be_wise)	5	102.82	109.98	0	0.00
25006.	Bethany (bethanyyyy114)	5	72.44	78.85	1	20.00
25007.	ben (benwestmercer)	5	93.75	99.94	1	20.00
25008.	Oskar (belmondziak)	5	58.08	64.18	1	20.00
25009.	Rebecca (beccaloveyou)	5	79.97	98.39	5	100.00
25010.	Daniel (beamenace)	5	97.01	106.21	2	40.00
25011.	Dvimrak (bchadwick87)	5	72.68	76.57	1	20.00
25012.	Borna (bborna)	5	89.21	97.06	2	40.00
25013.	bbbbb333 (bbbbb333)	5	83.86	87.66	5	100.00
25014.	B (batyrn)	5	88.37	106.10	4	80.00
25015.	niki (bateshot)	5	67.18	71.35	1	20.00
25016.	bassoon (bassoon_38)	5	105.83	118.57	4	80.00
25017.	Brayan (bassclefly)	5	44.43	48.82	1	20.00
25018.	FreePalestine (basel_mohamed)	5	73.74	83.86	1	20.00
25019.	Barok (bar_ok)	5	80.72	95.27	0	0.00
25020.	Bharath (bar_at_5)	5	37.71	48.41	0	0.00
25021.	bartosz34ek (bartosz34ek)	5	99.60	111.14	3	60.00
25022.	Jeff (bandihoot)	5	86.95	109.38	1	20.00
25023.	BananaLieutenant (bananalie...	5	100.63	104.06	2	40.00
25024.	Ethan (baldskeppyhalo)	5	76.19	79.84	0	0.00
25025.	Jack (balancedman)	5	63.49	77.38	0	0.00
25026.	Bailey (bailwillharr)	5	85.70	94.42	2	40.00
25027.	Ali (bahjatia)	5	107.75	114.45	4	80.00
25028.	Kon (bagelkat)	5	87.76	97.39	3	60.00
25029.	Vin (badboi14)	5	65.68	72.57	2	40.00
25030.	Brandon (bachasdas)	5	91.25	109.23	2	40.00
25031.	Erik (babyleaf)	5	97.59	112.72	1	20.00
25032.	shannon (babyface1718)	5	29.64	32.87	2	40.00
25033.	Ethan (babyjrprado)	5	72.72	84.16	0	0.00
25034.	babubhaiya (babubhaiya)	5	31.81	35.16	1	20.00
25035.	Dustin (a_drunk_carry)	5	102.35	111.87	1	20.00
25036.	Ayush (ayush011)	5	52.66	58.45	4	80.00
25037.	Ayman (ayman_isam)	5	49.21	57.85	1	20.00
25038.	Adi (ayhone)	5	98.61	109.35	4	80.00
25039.	Ay (aydint222)	5	117.01	132.83	4	80.00
25040.	Axlly (axlly)	5	47.04	51.20	0	0.00
25041.	Awalid (awalid)	5	83.30	90.68	2	40.00
25042.	Gōrudoai (auriculus1)	5	90.42	101.69	4	80.00
25043.	Aaron (atoponce)	5	86.20	94.38	2	40.00
25044.	Atahan (atahan)	5	82.04	92.17	2	40.00
25045.	Arjun (asterbot)	5	84.66	87.53	3	60.00
25046.	Bonjomon (asian_driver)	5	116.04	124.40	4	80.00
25047.	Kyle (asianshroudy)	5	75.86	83.46	2	40.00
25048.	Ashtrovex (ashtroflex)	5	58.01	75.19	5	100.00
25049.	Ash (ashsuper18)	5	35.09	38.82	0	0.00
25050.	Ashim (ashimghosh)	5	50.58	53.98	2	40.00
25051.	𝔸𝕤𝕖𝕖𝕞 (aseemg)	5	78.11	85.93	0	0.00
25052.	Manuel (asdfero)	5	109.25	117.63	5	100.00
25053.	asasel010 (asasel010)	5	64.72	72.54	0	0.00
25054.	Upendra (asarsh)	5	32.32	36.56	1	20.00
25055.	Arthur (arthur_morgan1899)	5	79.20	88.47	1	20.00
25056.	NotRyan (arthritispacked)	5	118.88	128.85	4	80.00
25057.	Ryan (arstar)	5	96.66	104.74	2	40.00
25058.	arsham (arsham11)	5	33.41	36.86	1	20.00
25059.	Rafael (arroxa)	5	102.96	124.22	2	40.00
25060.	Arman (aroman)	5	49.68	56.97	1	20.00
25061.	yusuf (maleky)	5	108.59	125.55	0	0.00
25062.	Malakai (malakaidunaway)	5	77.58	88.69	0	0.00
25063.	Norbert (makori)	5	60.48	67.83	1	20.00
25064.	THE OCKY WAYYYYY (makapoh57)	5	81.90	89.35	3	60.00
25065.	Joshua (magic_happened)	5	62.98	73.99	1	20.00
25066.	DJ (magentaisnice)	5	77.70	83.93	1	20.00
25067.	Max (maffiaboy65)	5	88.76	92.52	4	80.00
25068.	Matt (maffhoo)	5	92.75	117.01	2	40.00
25069.	MLM (madlittlemods)	5	82.01	86.84	2	40.00
25070.	Madi (madi_davey)	5	61.89	67.30	2	40.00
25071.	made (madestoel123)	5	78.32	84.79	1	20.00
25072.	Maddie (madd204)	5	50.50	54.67	0	0.00
25073.	Macen (macen)	5	113.58	121.08	4	80.00
25074.	none (lyuseg)	5	84.78	104.23	1	20.00
25075.	Psylo (lysergico)	5	212.20	218.72	2	40.00
25076.	Lydia (lydia_a)	5	40.85	44.15	1	20.00
25077.	Kensie (luxina)	5	94.00	112.39	0	0.00
25078.	Luvion (luvionjin)	5	71.85	77.36	1	20.00
25079.	Luke (lusouup)	5	61.94	74.16	1	20.00
25080.	lush (lush)	5	84.75	91.18	0	0.00
25081.	luqehr (luqehr)	5	39.36	40.93	0	0.00
25082.	Viktor (lunken42)	5	63.16	76.22	0	0.00
25083.	Devin (lundrity)	5	108.55	125.16	1	20.00
25084.	plantyoon (lunarboris)	5	73.38	85.81	2	40.00
25085.	Luke (luklear)	5	56.85	62.27	0	0.00
25086.	luke (lukehaoshuai)	5	105.53	119.11	1	20.00
25087.	Luisdi (luisdi)	5	69.79	77.70	1	20.00
25088.	Lokesh (lucky_21)	5	80.75	87.58	3	60.00
25089.	luckyone (luckyyone)	5	67.71	70.83	0	0.00
25090.	Lukas (lubeis)	5	67.32	76.89	1	20.00
25091.	Liam (ltrainferry)	5	76.46	88.36	1	20.00
25092.	qwerty (love2sing)	5	134.15	147.26	5	100.00
25093.	Louie (louietien)	5	111.49	130.71	4	80.00
25094.	Ivan (loui127)	5	46.54	51.56	0	0.00
25095.	Lotus (lotuspirate)	5	119.32	127.13	2	40.00
25096.	Lostleo2347 (lostleo_onytb)	5	37.45	42.04	1	20.00
25097.	Lonzo (lonzoballs)	5	75.39	83.39	0	0.00
25098.	lolouo (lolouo)	5	94.31	105.11	2	40.00
25099.	Kostya (lolopodo)	5	32.55	41.55	0	0.00
25100.	Jakob (lokiloki19)	5	103.48	140.21	1	20.00
25101.	Martin (lmaozedonggg)	5	71.90	80.90	0	0.00
25102.	Yuk (littleyuk)	5	102.38	111.12	2	40.00
25103.	liquidii (liqueady)	5	113.01	119.13	2	40.00
25104.	Ryan (lindaluhu)	5	63.04	75.45	2	40.00
25105.	Emil (lime123)	5	73.00	86.22	0	0.00
25106.	li (lilya)	5	69.52	80.78	3	60.00
25107.	rat (lilratbb)	5	62.23	77.63	1	20.00
25108.	Mark (lilpep_the_6th)	5	71.19	79.70	3	60.00
25109.	Lil (lildathrill)	5	67.81	77.57	1	20.00
25110.	Boss (likeaboss4579)	5	52.47	56.08	1	20.00
25111.	J. Dong (likelihood)	5	39.52	42.31	0	0.00
25112.	Light (lightmaster001)	5	50.95	53.06	1	20.00
25113.	John (lifeofacow)	5	80.10	91.35	2	40.00
25114.	Shiloh (lickington)	5	74.57	86.67	0	0.00
25115.	Lex (lex_g91)	5	91.38	112.73	2	40.00
25116.	whale (lewist)	5	95.81	106.66	3	60.00
25117.	Levi (levi5678)	5	67.40	88.13	1	20.00
25118.	Slow мΘşħΞ (letype613)	5	118.16	125.51	3	60.00
25119.	Lesya (lesyalackey)	5	78.18	85.71	1	20.00
25120.	Leon (leonthehandsome)	5	58.93	64.77	0	0.00
25121.	Leon (leonchen125)	5	79.29	98.54	3	60.00
25122.	James (lenny_mess)	5	73.27	79.98	1	20.00
25123.	Leitão (leitao_feliz)	5	51.09	57.97	1	20.00
25124.	Leigh (leightm)	5	68.34	85.00	3	60.00
25125.	Jim (legerity)	5	130.33	152.98	3	60.00
25126.	Bryan (legendarywind)	5	73.95	80.76	0	0.00
25127.	Lee (leemyoung)	5	52.44	61.49	1	20.00
25128.	LeeLoo (leeloooooooooooo)	5	42.30	48.52	0	0.00
25129.	Angus (leanangusbeef)	5	95.15	103.12	4	80.00
25130.	Lauren (lauren)	5	144.67	157.65	4	80.00
25131.	Jack (lankyfranky)	5	64.44	73.09	0	0.00
25132.	La (lafrans)	5	90.33	97.28	2	40.00
25133.	zaman (kzaman)	5	45.30	52.11	0	0.00
25134.	only 루비 (kxntzu)	5	89.25	96.51	1	20.00
25135.	KW (kwpl)	5	51.42	56.51	2	40.00
25136.	poptarts (kwakyunk)	5	100.48	116.46	3	60.00
25137.	Leo (kugiyasan)	5	60.03	71.36	1	20.00
25138.	Katie (ktdubbs93)	5	85.52	90.10	2	40.00
25139.	Krishna Kumar (krish_n_a)	5	50.94	52.38	0	0.00
25140.	Kamil (krimy225)	5	56.68	62.06	1	20.00
25141.	Dirk (kreefdirk)	5	57.41	63.25	0	0.00
25142.	Krampi (krampi)	5	116.82	137.58	5	100.00
25143.	kraklo (kraklo)	5	103.39	107.42	2	40.00
25144.	Amon (koutarou_amon)	5	110.05	129.04	2	40.00
25145.	Korone (koroneinugami)	5	44.20	49.32	1	20.00
25146.	Koosh (kooshatron)	5	62.65	66.48	3	60.00
25147.	Mark (kooliokek)	5	81.73	94.73	2	40.00
25148.	Sara (kookiebeagle)	5	102.71	110.28	3	60.00
25149.	konkord (konkord895)	5	64.11	68.13	2	40.00
25150.	Martin (kompik)	5	80.91	86.54	3	60.00
25151.	Komchan (komchan)	5	97.17	106.50	2	40.00
25152.	Jingyue (koalawjy)	5	94.35	110.95	1	20.00
25153.	Brandon (koalabearf)	5	90.07	100.28	2	40.00
25154.	backtozero (knuckledoritos)	5	96.81	105.55	2	40.00
25155.	Kor (kkoo)	5	32.44	35.09	0	0.00
25156.	masek (kiwollo)	5	51.85	61.13	0	0.00
25157.	Kiwi (kiwiiii)	5	80.15	89.82	1	20.00
25158.	Kittyman10 (kittyman10)	5	107.32	116.89	5	100.00
25159.	Kishore (kishorep1)	5	85.99	93.24	2	40.00
25160.	Nathan (kingdunlop)	5	59.01	62.73	1	20.00
25161.	King3131 (king3131)	5	66.64	73.54	2	40.00
25162.	Kinda (kindakind)	5	91.84	100.42	1	20.00
25163.	Akshat (kim375)	5	71.92	82.15	2	40.00
25164.	Kiluath (kiluath)	5	60.80	63.99	2	40.00
25165.	Kier (kierr12)	5	94.38	101.98	1	20.00
25166.	khasan (khasan)	5	39.70	42.24	0	0.00
25167.	Keyon (keyonhanjani)	5	85.22	99.62	4	80.00
25168.	Kevin (kevinthedon)	5	42.59	50.43	0	0.00
25169.	Kevin (kevinptt0323)	5	80.30	85.36	1	20.00
25170.	Kevin (kevinhuo8941)	5	91.30	104.90	1	20.00
25171.	Kyle (kevenmegevin321)	5	53.15	62.67	0	0.00
25172.	KevC (kevcarreon)	5	89.95	99.71	2	40.00
25173.	Måns (kethem)	5	74.33	92.79	1	20.00
25174.	kerdo (kerdoqt)	5	107.33	118.34	3	60.00
25175.	Keon (keonra)	5	61.46	66.00	0	0.00
25176.	kaka (kentuckle)	5	80.61	96.55	2	40.00
25177.	Kent (kent777)	5	116.99	129.18	2	40.00
25178.	KK (kemal_k)	5	59.35	66.80	2	40.00
25179.	Jesus (keeemstarr)	5	108.72	118.15	4	80.00
25180.	Kevin (kchoy)	5	131.94	148.01	3	60.00
25181.	Kayoro (kayoro_24)	5	52.34	60.48	1	20.00
25182.	Kayano (kayano_chi)	5	52.74	56.12	0	0.00
25183.	Kavika (kavika30)	5	89.35	98.19	1	20.00
25184.	Katie (katriarchy)	5	76.37	85.50	3	60.00
25185.	katie (katie2807)	5	86.17	100.91	1	20.00
25186.	kasuno (kasuno)	5	62.49	67.99	2	40.00
25187.	Emerson (kasai_moyasu)	5	89.88	96.38	2	40.00
25188.	Karmalegend (karmalegend)	5	93.06	95.96	1	20.00
25189.	Now you gonna see this is h...	5	55.37	63.93	1	20.00
25190.	kaqzea (kaqzea)	5	75.08	86.35	2	40.00
25191.	Kantel (kantel)	5	125.07	136.25	3	60.00
25192.	kalski (kalski)	5	106.05	111.99	2	40.00
25193.	Kaldius (kaldius)	5	72.24	85.77	0	0.00
25194.	kakujodai (kakujodai)	5	70.41	80.30	1	20.00
25195.	Kaintu (kaintu)	5	99.63	105.77	2	40.00
25196.	kaihq (kaihq)	5	52.26	58.78	1	20.00
25197.	Kostas (kael89)	5	95.89	99.62	1	20.00
25198.	Kacper (kacperkazan)	5	88.87	97.43	2	40.00
25199.	Jasper (kaasisbaas)	5	74.94	79.07	2	40.00
25200.	T (kaampachees)	5	56.17	62.75	0	0.00
25201.	Kirsty (k1rsty)	5	67.97	75.20	2	40.00
25202.	JONALD (jzwhale)	5	112.07	118.67	2	40.00
25203.	j (jyygl)	5	79.94	99.25	1	20.00
25204.	Jun (jyl6198)	5	114.45	121.66	4	80.00
25205.	Vix (jvixaychack)	5	92.43	102.17	1	20.00
25206.	noodle (just_a_noodle)	5	62.03	72.60	1	20.00
25207.	jupeti2 (jupeti2)	5	57.71	62.37	0	0.00
25208.	Jun (junpoe)	5	91.33	102.50	1	20.00
25209.	Junho (junebug14)	5	82.83	94.00	3	60.00
25210.	Juicy (juicypolez)	5	77.36	99.01	2	40.00
25211.	Zach (jugglinguy)	5	137.05	145.88	4	80.00
25212.	jude (jude17)	5	77.75	81.37	2	40.00
25213.	John (jstar218)	5	61.70	66.50	2	40.00
25214.	James (js921)	5	101.08	110.64	2	40.00
25215.	Jessie (jpoopknitting)	5	81.28	88.94	3	60.00
25216.	Jovan (jovannjt)	5	97.97	107.90	2	40.00
25217.	Joseph (josqu)	5	108.39	125.70	2	40.00
25218.	J (jossama)	5	77.25	80.71	1	20.00
25219.	Jordan (jordann31)	5	57.47	66.66	0	0.00
25220.	Jon (jonksig)	5	59.40	64.70	1	20.00
25221.	Jonato (jonato)	5	96.61	112.63	1	20.00
25222.	Jonathan (jonathankeyboard)	5	65.37	76.57	0	0.00
25223.	mika (jonassenghaas)	5	86.45	90.04	2	40.00
25224.	Jonas (jonas19)	5	74.38	84.15	1	20.00
25225.	no (jonah1357)	5	111.59	120.15	4	80.00
25226.	john (johnstamosfullhouse)	5	90.87	113.21	1	20.00
25227.	Josh (johnjena93045)	5	81.69	90.80	1	20.00
25228.	John666695 (john666695)	5	145.06	158.92	4	80.00
25229.	John (john62180)	5	96.29	112.23	3	60.00
25230.	Erik (joezuu)	5	99.77	106.74	3	60.00
25231.	Joe (joekerhd)	5	74.42	87.92	1	20.00
25232.	JOE (joe345)	5	75.78	93.74	0	0.00
25233.	Joseph (jnml19)	5	102.78	110.31	4	80.00
25234.	Joe (jj_zhaaaaang)	5	72.11	79.79	0	0.00
25235.	Jay (jjthomso_yt)	5	75.82	79.49	1	20.00
25236.	Jjy (jjoy12)	5	51.37	59.98	0	0.00
25237.	Jiuena (jiuena)	5	103.09	109.67	3	60.00
25238.	Jini (jinilee07)	5	101.61	114.58	3	60.00
25239.	Jim (jingon93)	5	106.58	117.95	5	100.00
25240.	jim (jimdocks)	5	79.92	102.60	2	40.00
25241.	Jesse (jesse0908)	5	53.70	58.84	0	0.00
25242.	JEM (jem5268)	5	82.54	99.28	1	20.00
25243.	ilmari (jejj)	5	64.10	75.68	0	0.00
25244.	Sam (jeff_the_pickle)	5	91.13	95.92	2	40.00
25245.	Jedidiah (jedidia60)	5	73.84	77.69	2	40.00
25246.	Jeffrey (jebbrey)	5	85.01	99.70	3	60.00
25247.	Justin (jauntsmirk)	5	58.72	62.47	0	0.00
25248.	Jasur (jasur_257)	5	42.81	47.86	1	20.00
25249.	Jason (jason534f)	5	88.57	100.61	4	80.00
25250.	JK17 (jaredkane17)	5	70.04	72.34	0	0.00
25251.	(jannis)	5	131.15	141.14	2	40.00
25252.	jame (jame_oxford_11)	5	38.88	42.52	2	40.00
25253.	Ilya (jamesakke)	5	57.23	60.64	1	20.00
25254.	Jahangir (jalom102)	5	52.06	55.78	0	0.00
25255.	Jannik (jako79)	5	45.07	48.81	2	40.00
25256.	Jake (jake360)	5	55.60	64.38	0	0.00
25257.	Jairel (jairel)	5	104.89	107.60	2	40.00
25258.	hotmama (jaggid)	5	106.68	115.84	1	20.00
25259.	Jason (jaeson813)	5	86.12	99.11	2	40.00
25260.	Jacob (jacobvaneyck)	5	91.89	107.19	1	20.00
25261.	Jacob (jacobf01)	5	88.01	95.17	1	20.00
25262.	Drift King (jackyyang09)	5	111.36	126.32	1	20.00
25263.	Jack (jackpropc)	5	106.21	118.74	2	40.00
25264.	Jackson (j4cks0n)	5	61.22	65.48	0	0.00
25265.	joshua ray (j2samodal)	5	75.43	80.29	2	40.00
25266.	Tom (i_hate_yext)	5	105.38	132.02	3	60.00
25267.	.kutty_guppy (i_am_a_tryhard)	5	65.45	69.19	3	60.00
25268.	Istaz (iztaz)	5	68.14	79.40	2	40.00
25269.	King (izhh)	5	80.74	90.01	2	40.00
25270.	Jake (izable)	5	112.86	132.07	3	60.00
25271.	Iya (iyaiyayoh)	5	54.72	61.45	0	0.00
25272.	Aleks (ixine)	5	80.08	86.55	2	40.00
25273.	kommit (iwanttokommitdead)	5	76.39	97.91	5	100.00
25274.	Ivysaur (ivysaureg)	5	115.36	130.74	4	80.00
25275.	Ivusin (ivusin)	5	74.90	82.12	0	0.00
25276.	osuplayer (ivbagbroke)	5	69.50	80.92	1	20.00
25277.	Ivan (ivasil)	5	77.76	82.43	1	20.00
25278.	Ali (its_alihosam)	5	62.91	71.37	3	60.00
25279.	ItsNo06 (itsno06)	5	73.12	80.73	0	0.00
25280.	Kevin (itsk3vin)	5	94.18	103.52	2	40.00
25281.	Jake (itsemerald)	5	67.27	73.66	0	0.00
25282.	Edrin (itsedrin)	5	76.86	84.17	2	40.00
25283.	Itamar K. (itakor9)	5	125.02	143.15	4	80.00
25284.	kuromi (istrying)	5	67.27	78.41	0	0.00
25285.	isham (isham)	5	65.12	71.82	1	20.00
25286.	isaac (isaac3416)	5	60.67	73.85	1	20.00
25287.	Irfan (irfanshaikh)	5	75.54	84.76	2	40.00
25288.	Alexander Miller (iowahawke...	5	53.34	57.67	1	20.00
25289.	Spruty (infrasix)	5	70.32	73.48	5	100.00
25290.	inaki333 (inaki333)	5	53.53	58.86	0	0.00
25291.	Toller (imthetoller)	5	96.03	103.26	4	80.00
25292.	impr0ving (impr0ving)	5	55.56	59.29	0	0.00
25293.	Mac (immaculatemac)	5	82.10	87.06	2	40.00
25294.	Jeremy (imleafing)	5	111.32	115.33	4	80.00
25295.	Jens (imcre4tiive)	5	76.70	95.82	1	20.00
25296.	Ilyanna (ilygoesboom)	5	124.02	129.39	5	100.00
25297.	ILUVpwny (iluvpwny)	5	88.77	104.02	2	40.00
25298.	Steve (ijustwanttotype)	5	72.06	77.84	1	20.00
25299.	meena (ifeellikeshemarmoore)	5	65.97	77.10	1	20.00
25300.	Dean (icysabr3)	5	89.06	98.98	2	40.00
25301.	Ice (icedevera)	5	92.67	101.03	4	80.00
25302.	Rajan (icecoldreaper07)	5	63.49	69.83	0	0.00
25303.	icebear (icebearnose)	5	61.15	64.39	1	20.00
25304.	william (iamzyva)	5	91.58	108.37	2	40.00
25305.	Marcus (h_mph)	5	78.74	87.35	0	0.00
25306.	Chris (hypernovachris)	5	72.93	77.16	1	20.00
25307.	tempo (hypergonzx)	5	90.86	98.26	2	40.00
25308.	HyattOcto (hyattocto)	5	139.88	165.68	3	60.00
25309.	Dan (hwip)	5	115.95	134.75	4	80.00
25310.	Hugh (huuugh18)	5	84.46	98.45	1	20.00
25311.	Hungry (hungry_stingray)	5	79.65	88.08	2	40.00
25312.	huhkdog (huhkdog)	5	43.49	52.37	1	20.00
25313.	Hubert (hubertle85639)	5	91.04	105.53	5	100.00
25314.	HubaFluba (hubafluba)	5	96.87	109.05	5	100.00
25315.	Dave (hottodogu)	5	77.92	86.95	1	20.00
25316.	0% (horiz0n)	5	71.60	76.62	3	60.00
25317.	vin (homeloverboy)	5	85.35	91.98	0	0.00
25318.	Alex (hollums)	5	113.41	119.30	2	40.00
25319.	Max (hoglimogli)	5	70.45	75.37	0	0.00
25320.	MHoang (hoang993007)	5	51.49	57.37	2	40.00
25321.	H (hkk09)	5	58.17	70.87	0	0.00
25322.	icanttypeaccuratelyconsiste...	5	121.36	129.75	2	40.00
25323.	Historical (historicalskink)	5	57.62	64.39	1	20.00
25324.	... (hirunaka)	5	47.49	53.03	2	40.00
25325.	xy (hihiki)	5	54.63	59.52	0	0.00
25326.	Yuki (hiavl)	5	111.88	120.37	1	20.00
25327.	Heper (hepersopon)	5	63.01	67.29	0	0.00
25328.	Henr1ES (henri2022)	5	61.75	68.83	0	0.00
25329.	henpenben (henpenben)	5	95.12	108.18	2	40.00
25330.	Luc (hellperson)	5	73.68	81.16	0	0.00
25331.	Helix (helix13_)	5	93.80	99.69	4	80.00
25332.	heawwi (heawwi)	5	66.11	71.93	2	40.00
25333.	H (hdawg187)	5	89.65	97.01	1	20.00
25334.	Hay3den_00 (hay3den_00)	5	83.18	91.02	2	40.00
25335.	Philipp (haxaffe)	5	75.27	79.60	2	40.00
25336.	Alice (hautecouturexx)	5	40.80	62.85	5	100.00
25337.	Hassan (hassanamoudi)	5	60.03	66.00	1	20.00
25338.	Sultan (hasanoji)	5	88.45	95.35	0	0.00
25339.	John (harrumph)	5	80.49	92.61	2	40.00
25340.	Harper (harpermh)	5	81.81	89.07	3	60.00
25341.	RasDingo (haroxdruiden)	5	96.84	110.40	3	60.00
25342.	harish (harishravi)	5	55.45	61.12	0	0.00
25343.	༼ʘ̚ل͜ʘ̚༽ (happyno)	5	116.30	131.65	1	20.00
25344.	happy15crazy (happy15crazy)	5	53.20	61.62	0	0.00
25345.	Jimmy (hapahunta)	5	68.14	84.66	0	0.00
25346.	Hannah (hannahkoh)	5	69.48	86.02	0	0.00
25347.	hamza (hamzacer)	5	29.83	35.50	0	0.00
25348.	John (hakabubu)	5	100.15	109.92	3	60.00
25349.	Haji (hajikoit1_)	5	67.25	80.66	0	0.00
25350.	hn (hahahana)	5	65.00	68.93	1	20.00
25351.	Haiman (h41man_01)	5	67.54	74.15	1	20.00
25352.	Gustavo (gustavo_caria)	5	77.34	89.36	1	20.00
25353.	Rushabh Kanadiya (guitarher...	5	71.67	81.90	5	100.00
25354.	Guilly (guiltykrow)	5	57.14	66.45	0	0.00
25355.	Tim (guiganator)	5	108.13	119.91	2	40.00
25356.	Guest (guest2703)	5	83.23	92.07	2	40.00
25357.	Tigran (grig_tigran)	5	51.97	54.11	1	20.00
25358.	Gregory (gregoryshen212)	5	105.90	113.43	2	40.00
25359.	Ritesh (greeaatt_successs)	5	69.31	73.70	2	40.00
25360.	Parker (grasshopper_weeb)	5	99.34	105.66	3	60.00
25361.	Jakub (grajak)	5	98.31	111.58	4	80.00
25362.	Daniel (goldncore)	5	86.21	101.71	2	40.00
25363.	Erik (goldfrankenstein)	5	104.51	112.71	0	0.00
25364.	Malt0 (godcream)	5	98.78	117.39	2	40.00
25365.	Georg (gmpfeifer)	5	65.35	73.67	0	0.00
25366.	George (gmorf)	5	73.19	79.48	1	20.00
25367.	Goven (gmbarrera)	5	83.10	99.94	0	0.00
25368.	gleb (glebusking)	5	75.79	80.72	0	0.00
25369.	glassnet (glassnet)	5	61.77	66.33	3	60.00
25370.	Griffin (girfster)	5	92.78	97.79	4	80.00
25371.	Andija (gingerpolk)	5	85.77	88.28	3	60.00
25372.	Gina (ginadoerp)	5	116.94	132.79	2	40.00
25373.	Jordon (gimp_jimmy)	5	89.39	98.56	3	60.00
25374.	Jmin (gillf)	5	44.94	48.57	0	0.00
25375.	melluwellu (giantme1on)	5	71.94	73.60	1	20.00
25376.	Ghazanfer (ghazanfer)	5	101.10	115.97	1	20.00
25377.	Arturo (gharlock)	5	89.79	105.29	2	40.00
25378.	Ghanem (ghanemzein)	5	61.23	68.37	0	0.00
25379.	Joseph (gh0stty)	5	51.64	56.20	0	0.00
25380.	Zachy (ggohpks)	5	96.39	103.67	3	60.00
25381.	Giles (gga_)	5	84.06	88.59	1	20.00
25382.	Geno (geno20)	5	124.47	134.04	3	60.00
25383.	Ahmed (gemmy2212)	5	68.55	77.41	4	80.00
25384.	hiva (gemje)	5	61.68	65.11	2	40.00
25385.	Geevar (geevar007)	5	52.69	56.34	0	0.00
25386.	Gary (garyboo)	5	112.59	127.58	0	0.00
25387.	Garrin (garrins)	5	100.04	111.71	2	40.00
25388.	Kristofer (gardeborg)	5	52.60	60.27	2	40.00
25389.	Ganesh (ganeshadsul)	5	47.63	53.46	2	40.00
25390.	Kenan (gamingkenan)	5	85.83	106.41	3	60.00
25391.	Vladimir (galaxygameryay)	5	93.07	101.01	5	100.00
25392.	Gajendra (gajutyper)	5	47.98	51.39	1	20.00
25393.	avishek (gaberiel0770)	5	51.05	55.74	1	20.00
25394.	gabbrueh (gabbrueh)	5	79.32	85.91	5	100.00
25395.	Whos (g3trekt)	5	92.81	105.27	5	100.00
25396.	Malik (maliksami)	4	60.36	67.73	1	25.00
25397.	Maria Julia (maju_matricardi)	4	66.39	77.51	0	0.00
25398.	Will (majorchaos)	4	90.94	101.40	1	25.00
25399.	majesticjojo (majesticjojo)	4	97.24	109.26	0	0.00
25400.	Mainey dawg (mainey)	4	90.64	102.98	1	25.00
25401.	maickel (maickelkuhhh)	4	46.07	50.19	0	0.00
25402.	Grag (mahavir)	4	95.53	110.38	2	50.00
25403.	Alex (magictrick)	4	105.31	106.96	1	25.00
25404.	Connor (magicsniper7)	4	60.94	64.71	1	25.00
25405.	magicsail (magicsail)	4	51.61	55.86	0	0.00
25406.	Magical (magical_yt)	4	89.69	96.84	4	100.00
25407.	Joseph (magical_gibus)	4	74.21	89.85	2	50.00
25408.	Mafuso (mafuso)	4	102.70	115.17	0	0.00
25409.	Moo (mafaraxas)	4	108.28	116.73	3	75.00
25410.	Madiyar (madi_k)	4	61.75	66.75	1	25.00
25411.	Marcus (mackan096)	4	91.36	105.61	3	75.00
25412.	Mahmoud (ma7moud7amdy)	4	35.74	42.15	4	100.00
25413.	Maciej (m4v3r)	4	85.50	90.87	3	75.00
25414.	M4K3 (m4k3801)	4	42.92	45.73	0	0.00
25415.	aaron (m0nk3man)	4	61.55	74.03	1	25.00
25416.	pyc (lznuscrfb)	4	41.28	43.90	0	0.00
25417.	Aris (lysaris)	4	48.22	49.93	0	0.00
25418.	Lynn (lynnkaek)	4	106.53	111.58	1	25.00
25419.	Luka (luxx_15)	4	74.03	79.63	2	50.00
25420.	Luukster (luukster)	4	56.90	62.33	0	0.00
25421.	Lukas (luqq)	4	61.22	65.03	3	75.00
25422.	Ele (luminelexx)	4	98.56	104.82	4	100.00
25423.	Luka (lukisav)	4	89.15	92.30	4	100.00
25424.	Abay (lukcy)	4	100.30	123.06	4	100.00
25425.	lufi (lufi148)	4	32.69	35.03	2	50.00
25426.	Lucia (luciloo)	4	54.30	58.61	1	25.00
25427.	Luca Plat (lucaplat)	4	59.13	66.04	1	25.00
25428.	Lucan (lucan616)	4	55.76	60.05	1	25.00
25429.	SAM (lsh66191239)	4	57.55	64.79	0	0.00
25430.	Thomas (lqserbeans)	4	107.33	121.90	2	50.00
25431.	Liz (lovelyliz)	4	48.74	53.78	0	0.00
25432.	lorenzo (lorenzo2131)	4	122.72	133.45	3	75.00
25433.	Dipendra (lord_jarvis)	4	55.90	67.63	1	25.00
25434.	Cheng Loke (lordwiz)	4	96.03	105.42	1	25.00
25435.	Lord (lordaizen707)	4	89.04	94.29	1	25.00
25436.	Loopy (loopyz)	4	72.66	85.71	2	50.00
25437.	Gus (lookitup)	4	109.18	127.71	1	25.00
25438.	Lowell (lolwel21)	4	63.17	67.07	2	50.00
25439.	lolswag420 (lolswag420)	4	59.08	61.87	2	50.00
25440.	Lokki (lokkicubes)	4	119.45	127.24	0	0.00
25441.	Aljaž (lojzetka)	4	76.35	84.65	1	25.00
25442.	Rafael (locher)	4	107.67	110.59	4	100.00
25443.	JL8 (liux888)	4	94.41	98.66	4	100.00
25444.	madelief (little_huchu)	4	74.68	83.03	2	50.00
25445.	Stephen (litedrizzle)	4	96.29	113.68	3	75.00
25446.	Sean (lirrnaiad)	4	94.47	104.18	3	75.00
25447.	Liquid (liquidlemon)	4	90.32	98.00	1	25.00
25448.	Linus (linusq)	4	95.70	107.50	1	25.00
25449.	Linkso (linkso)	4	45.99	48.80	0	0.00
25450.	lindsey (lindsey94)	4	75.44	79.66	0	0.00
25451.	Linda (lindanguyen_)	4	63.08	72.32	1	25.00
25452.	Sunpeng (limsunpeng07)	4	50.89	54.61	3	75.00
25453.	Leah (lilybethlily)	4	71.16	81.28	0	0.00
25454.	Abdo (lilpunishow)	4	76.50	83.81	4	100.00
25455.	Angus (lilchenchen)	4	41.44	45.52	0	0.00
25456.	Noah (lightsaber71)	4	48.25	64.48	1	25.00
25457.	Lightning (lightning486)	4	103.44	111.69	1	25.00
25458.	Light (lightneesan)	4	97.61	108.77	1	25.00
25459.	liam (liamtangg)	4	70.79	80.75	2	50.00
25460.	Logan (lgan)	4	74.33	92.95	4	100.00
25461.	Laura (lgmorse)	4	116.43	126.03	4	100.00
25462.	Leyton (leytons)	4	75.38	92.01	2	50.00
25463.	Luna (lewisw60)	4	120.55	132.21	2	50.00
25464.	leonissenbaum (leonissenbaum)	4	111.07	126.08	0	0.00
25465.	Lena (lena_lapa)	4	55.76	59.09	1	25.00
25466.	Mathieu (leginacl)	4	84.80	91.57	0	0.00
25467.	Lorenzo (leftovers1)	4	89.38	93.65	2	50.00
25468.	James (leeroy909)	4	73.43	83.91	0	0.00
25469.	Leeisateam (leeisateam)	4	90.07	100.68	1	25.00
25470.	Ledion (ledisad)	4	56.53	60.13	1	25.00
25471.	Lebaidin (lebaidin)	4	117.89	128.22	3	75.00
25472.	okyescool (lc0291)	4	104.45	120.81	3	75.00
25473.	Hasnat (lazy_zeus)	4	69.17	79.97	4	100.00
25474.	shaolin_scrub (laydbak)	4	89.76	95.02	3	75.00
25475.	Erick (laudato)	4	48.48	56.80	2	50.00
25476.	Douglas (lasdoug)	4	97.68	111.64	2	50.00
25477.	Vincent Jeremy (larcener)	4	52.39	58.81	3	75.00
25478.	Benedek (k_dot_b)	4	61.05	63.60	1	25.00
25479.	Kyle (kylegt)	4	64.98	70.56	1	25.00
25480.	Kushal (kushal_)	4	51.45	58.93	1	25.00
25481.	Peter (kushlord)	4	56.18	63.97	0	0.00
25482.	Nelson (kuribohno)	4	49.35	53.29	1	25.00
25483.	Aiden (kula_)	4	156.63	172.20	4	100.00
25484.	ken (kuanying)	4	70.78	76.60	0	0.00
25485.	Krisztian (ktypist_)	4	75.15	76.73	1	25.00
25486.	Kristian Emil (kruller)	4	78.29	83.51	2	50.00
25487.	Jared (krispyyrice)	4	66.40	70.72	0	0.00
25488.	Krish (krish987)	4	92.68	112.14	3	75.00
25489.	Kris (krilleliten)	4	62.19	69.79	0	0.00
25490.	kp (kp_7890)	4	54.22	66.98	1	25.00
25491.	Kenneth (kpphamdao)	4	85.09	97.34	3	75.00
25492.	KPeep (kpeep)	4	90.64	105.78	1	25.00
25493.	Yokubo (kontentlust)	4	62.55	64.72	1	25.00
25494.	kon (konkretzz)	4	78.23	90.03	1	25.00
25495.	rebecca (kona_coffee)	4	57.49	61.42	0	0.00
25496.	komkanit (komcal)	4	50.59	57.12	1	25.00
25497.	Loukas (koloz123)	4	81.08	86.83	2	50.00
25498.	Ned (kokainegun)	4	119.12	126.21	3	75.00
25499.	Koh (kohsuzu)	4	65.48	69.96	2	50.00
25500.	Armtz (knotavink)	4	87.69	93.90	2	50.00
25501.	VR-un (knight343)	4	48.32	52.44	2	50.00
25502.	Keno (kmoreland1)	4	87.68	101.19	1	25.00
25503.	Adam (kmine)	4	111.64	120.01	0	0.00
25504.	gavinc (klontz)	4	128.01	142.19	3	75.00
25505.	Klebb (klebbinet)	4	93.92	97.98	1	25.00
25506.	KJ (kjlaw)	4	61.24	64.36	1	25.00
25507.	Kirin (kirinichibannn)	4	90.32	91.56	3	75.00
25508.	kir (kiranv1584)	4	97.35	101.52	2	50.00
25509.	Kiran (kiran11621)	4	58.91	64.09	1	25.00
25510.	KiraThePerplexed (kiradonut)	4	55.56	60.44	1	25.00
25511.	roshan (kipislekker1)	4	67.08	68.56	3	75.00
25512.	weeb (king_of_rice)	4	68.03	74.49	2	50.00
25513.	Tristin (kingtdiggitty)	4	51.23	56.02	0	0.00
25514.	Kin (kinandra)	4	61.25	66.94	0	0.00
25515.	Arjun (killerps)	4	93.87	101.30	2	50.00
25516.	Alex (kietdjae)	4	55.93	56.99	1	25.00
25517.	Mohamed (kidjunky)	4	94.67	104.92	3	75.00
25518.	KW (kiawa88)	4	89.36	95.41	1	25.00
25519.	Kevin (khuang891)	4	94.96	110.57	2	50.00
25520.	Khoi (khoile9)	4	82.55	91.29	4	100.00
25521.	Khertz (khertz)	4	80.38	96.71	0	0.00
25522.	Khannen (khannen)	4	61.74	72.73	1	25.00
25523.	Kevslinger (kevslinger)	4	104.32	109.90	2	50.00
25524.	Kevin (kevinkim)	4	94.27	108.74	2	50.00
25525.	Kerubi (kerubii)	4	52.85	55.85	0	0.00
25526.	Joshua (kerpoof)	4	88.61	91.30	2	50.00
25527.	Kera (kera77)	4	93.50	108.30	2	50.00
25528.	Kenzie (kenziesupertoad)	4	77.90	85.39	3	75.00
25529.	ZMod (kenortinez)	4	85.86	101.75	2	50.00
25530.	Matthew (kelsier)	4	79.56	87.36	1	25.00
25531.	Kellan (kellan_)	4	53.21	58.29	1	25.00
25532.	Ayden (keetchi3)	4	132.65	145.32	3	75.00
25533.	Adam (kedgehog)	4	55.82	61.96	0	0.00
25534.	Kyle (kcoppola19)	4	131.25	135.96	3	75.00
25535.	kaytec (kaytec)	4	111.91	121.09	1	25.00
25536.	Kay (kaypinky)	4	71.71	89.24	2	50.00
25537.	7kay3lee7 (kayleelynette)	4	65.41	68.69	1	25.00
25538.	Kawisara (kawi_sk)	4	55.06	67.54	1	25.00
25539.	ron peasley (kat_dj)	4	77.16	86.88	3	75.00
25540.	Kathryn (katiehughesspaz)	4	116.52	153.22	3	75.00
25541.	kassionitro (kassionitro)	4	62.29	70.14	1	25.00
25542.	Karsmatic (karsmatic)	4	65.37	73.15	2	50.00
25543.	Kareem (kareemserry)	4	90.61	100.80	2	50.00
25544.	Kevin (kapoofin)	4	106.77	124.30	3	75.00
25545.	Georgi (kapi12666)	4	46.14	51.45	0	0.00
25546.	Daan (kantelaardaan)	4	81.57	92.05	3	75.00
25547.	Abdelrahman (kandiler)	4	61.44	64.81	1	25.00
25548.	David (kandar4)	4	97.84	111.59	1	25.00
25549.	Kaliarti (kaliarti)	4	76.18	86.41	1	25.00
25550.	uTo (kalabam)	4	30.39	34.14	2	50.00
25551.	Kaifishi (kaifishi)	4	37.72	54.27	1	25.00
25552.	Johnny (kadkalakooki)	4	65.00	74.30	0	0.00
25553.	Emily (kaasmier)	4	67.09	71.64	2	50.00
25554.	Haakon (kaarekul)	4	72.55	82.61	2	50.00
25555.	Tsurugi (k6kyoin)	4	73.89	90.57	2	50.00
25556.	Jay (jvmatt)	4	57.30	68.47	1	25.00
25557.	cmp (justinpark3046)	4	65.23	82.99	0	0.00
25558.	justin (justinjose2007007)	4	54.98	62.65	1	25.00
25559.	Yuriy (jurijo)	4	35.60	39.23	0	0.00
25560.	Jun (junisfast)	4	67.82	72.42	1	25.00
25561.	Hyunjun (junct127)	4	88.35	100.54	2	50.00
25562.	Jiahui (jumban)	4	136.69	146.33	3	75.00
25563.	JumbaHumba (jumbahumba)	4	98.92	101.86	2	50.00
25564.	Julia (julsaguaro)	4	86.55	94.08	2	50.00
25565.	Otroti (julianblow)	4	32.99	38.71	0	0.00
25566.	that guy (judewastaken)	4	100.16	105.49	1	25.00
25567.	Judar (judar)	4	77.50	81.21	4	100.00
25568.	Andrew (jucidy)	4	60.56	81.58	1	25.00
25569.	Zach (jubjub_lol)	4	51.39	54.29	0	0.00
25570.	Jack (jthomas720)	4	54.72	62.18	1	25.00
25571.	Jason (jthayer09)	4	122.66	128.46	4	100.00
25572.	Agent (jterzian2)	4	62.73	67.74	0	0.00
25573.	J (jsroo3)	4	78.30	79.75	1	25.00
25574.	Pablo (jsanc016)	4	89.14	92.17	1	25.00
25575.	Jeremy (jrmyh)	4	79.55	100.50	0	0.00
25576.	Josie (josuealfredo)	4	40.71	48.77	1	25.00
25577.	Jorgimtg (jorgimtheguy)	4	70.45	73.78	1	25.00
25578.	Joseph (jolow)	4	108.07	120.26	4	100.00
25579.	100 WPM Dream (jokubas1224)	4	59.54	70.72	0	0.00
25580.	MONKE (joker9336)	4	21.19	22.92	0	0.00
25581.	Josh (jojothewarrior)	4	111.46	140.70	4	100.00
25582.	Cole (jojjj5)	4	113.35	121.59	2	50.00
25583.	Jojj (jojjj)	4	51.32	54.98	1	25.00
25584.	Jon (jojinismafia)	4	55.41	64.45	0	0.00
25585.	john (john_end)	4	78.76	82.93	1	25.00
25586.	JAWN (johnsusername)	4	105.13	110.92	2	50.00
25587.	Rajiv (johnnymaboi)	4	109.87	120.88	3	75.00
25588.	Joe (joemama8144)	4	55.12	60.74	2	50.00
25589.	Jan (jmarrin)	4	66.50	76.78	0	0.00
25590.	Jayden (jmanspider09)	4	79.04	86.57	0	0.00
25591.	(jlpt)	4	123.50	134.12	2	50.00
25592.	Juan (jlah)	4	64.22	71.23	1	25.00
25593.	Kristian (jivkovk)	4	72.69	82.68	1	25.00
25594.	Michael (jimmychim)	4	111.27	123.08	4	100.00
25595.	Jimmy (jimjimr)	4	82.56	98.98	2	50.00
25596.	Jimmy (jimbozeubuen)	4	110.53	117.70	1	25.00
25597.	Terry (jiatinglu99)	4	71.08	73.18	0	0.00
25598.	Jesse (jholwell)	4	81.86	88.70	4	100.00
25599.	Jordan (jfilip56)	4	71.25	78.06	2	50.00
25600.	Jet (jetchung)	4	90.33	112.66	2	50.00
25601.	Jesse (jessechu)	4	84.95	94.20	1	25.00
25602.	Jesse (jesse1998114)	4	77.26	81.60	0	0.00
25603.	Jesper (jespersch)	4	83.01	89.32	1	25.00
25604.	jerry (jerrydang1)	4	74.08	84.85	2	50.00
25605.	Jay (jerdman)	4	53.44	60.68	1	25.00
25606.	J (jepster007)	4	96.64	106.33	3	75.00
25607.	:) (jeof05)	4	80.80	87.12	0	0.00
25608.	Jc (jcjcjc_1)	4	87.12	96.73	1	25.00
25609.	Camot (jcamot)	4	53.52	68.13	1	25.00
25610.	Delphi/Z (jbroman)	4	114.86	123.77	4	100.00
25611.	Jonathan (jbrich)	4	96.38	110.29	2	50.00
25612.	BE4ST (jb2k1)	4	103.35	107.73	2	50.00
25613.	Jayus (jayusi)	4	49.19	56.26	0	0.00
25614.	Jassy (jassy69)	4	73.48	79.58	1	25.00
25615.	Jacob (jasdfnam)	4	109.65	120.54	2	50.00
25616.	Jarvi (jarvireneil)	4	119.24	128.28	1	25.00
25617.	Jaron (jaronli)	4	84.18	103.24	0	0.00
25618.	janzen (janzenc)	4	96.04	102.62	2	50.00
25619.	Jan (janwalther)	4	52.54	54.73	1	25.00
25620.	jami (jamson)	4	61.39	67.12	1	25.00
25621.	James (jamesnar)	4	94.34	99.21	2	50.00
25622.	James (jamesarino)	4	95.16	103.28	2	50.00
25623.	James (james7739)	4	57.35	59.57	0	0.00
25624.	Jak (jak_man)	4	67.96	72.85	0	0.00
25625.	Chureerat (jaja_cw)	4	38.77	41.64	0	0.00
25626.	jacob (jacobn279)	4	56.36	69.99	2	50.00
25627.	jackens (jackens)	4	60.80	70.15	1	25.00
25628.	Jace (jaceypoop)	4	75.63	78.98	0	0.00
25629.	Jekamiah (j4k3y_yall)	4	70.73	78.02	0	0.00
25630.	Juan (j206)	4	80.86	102.48	2	50.00
25631.	Tess (i_miss_club_penguin)	4	87.02	111.96	3	75.00
25632.	JC (i_cannotbewon)	4	68.54	90.31	1	25.00
25633.	Tio (izero200)	4	78.13	88.05	0	0.00
25634.	Iverson (iverson28)	4	62.83	64.93	1	25.00
25635.	Patrik (itsuberrr)	4	114.58	118.14	1	25.00
25636.	omar (itsramo)	4	68.51	76.29	1	25.00
25637.	Itzopik :D (itsopik_trok)	4	30.17	37.69	0	0.00
25638.	Thịnh (itsmedio2110)	4	68.84	78.86	0	0.00
25639.	Andrew (itsmebrush)	4	68.62	81.09	1	25.00
25640.	Imaad (iszaffar)	4	71.49	80.01	4	100.00
25641.	Marissa (issa96)	4	58.68	65.16	0	0.00
25642.	workman (isoon_workman)	4	88.65	102.41	4	100.00
25643.	Ismail (isma3il)	4	68.45	77.90	2	50.00
25644.	IRUSN4F (irusnaf)	4	60.57	62.43	2	50.00
25645.	arman (invoker870)	4	81.42	95.66	4	100.00
25646.	Sazzad Hossain (invisible_r...	4	55.56	61.67	2	50.00
25647.	honey (intheswampwithshrek)	4	96.92	107.53	1	25.00
25648.	Nigel (intrexion)	4	118.61	131.91	4	100.00
25649.	asdf (intheoryno)	4	116.80	129.24	1	25.00
25650.	Ingo (ingo1337)	4	50.56	57.42	0	0.00
25651.	Dante (infern03)	4	107.39	120.73	2	50.00
25652.	indianpanda (indianpanda250)	4	91.14	94.55	1	25.00
25653.	Improwise (improwise)	4	46.81	57.01	2	50.00
25654.	Matthew (imhaisee)	4	58.24	62.05	3	75.00
25655.	sloth (illeatyou)	4	85.23	88.89	1	25.00
25656.	Ilham (ilhamahmad)	4	59.97	65.33	0	0.00
25657.	Kolya (iktm)	4	95.50	98.33	4	100.00
25658.	STÖCKHÖLM (ikea)	4	73.63	76.38	0	0.00
25659.	Kay Eugenia (ikay19)	4	97.66	100.10	2	50.00
25660.	The Wok(+1000 social credit...	4	98.94	106.07	1	25.00
25661.	IFTClerk (iftclerk)	4	90.96	102.46	1	25.00
25662.	Justin (idkman_69)	4	55.76	60.13	1	25.00
25663.	Tim (idiotaaa)	4	119.48	122.40	4	100.00
25664.	Aimcist (iconic03)	4	92.61	101.43	3	75.00
25665.	Olexsandr (icefih)	4	40.52	43.67	1	25.00
25666.	Ivan (ibanisanog)	4	83.56	102.75	2	50.00
25667.	Avijeet (iavijeet)	4	43.74	45.70	2	50.00
25668.	Samin Yasir Sahil (iamyrmthr6)	4	73.69	78.73	1	25.00
25669.	Vittal (iamvittaln)	4	61.73	67.43	0	0.00
25670.	iAmMichael (iammichael)	4	106.26	121.56	1	25.00
25671.	Kriss (iamkriss)	4	44.89	47.96	0	0.00
25672.	Astral (iamkoromon)	4	92.48	107.83	2	50.00
25673.	Andi (iacidna)	4	93.67	98.51	1	25.00
25674.	Hyenitye (hyenite)	4	89.66	108.32	1	25.00
25675.	peace (hydrorynex)	4	93.38	102.03	2	50.00
25676.	ODVB (hyclonic)	4	111.10	119.62	2	50.00
25677.	Half Blood (hwm007)	4	38.87	45.26	0	0.00
25678.	hwi (hwi_two)	4	97.01	104.00	2	50.00
25679.	Ali (huuu957)	4	67.35	72.06	1	25.00
25680.	Hữu Tiến (huutienbk)	4	62.88	68.24	0	0.00
25681.	Darko (huskycrafter)	4	103.15	109.33	3	75.00
25682.	Haley (hurley328)	4	54.45	59.14	1	25.00
25683.	HuntedSlayer (huntedslayer)	4	90.96	97.99	2	50.00
25684.	Cassie (humanalien)	4	54.42	60.31	1	25.00
25685.	Ben (hulkunleashed)	4	89.74	101.43	2	50.00
25686.	ht (htbs)	4	57.52	62.95	1	25.00
25687.	Chris (hotdogdaniel)	4	74.93	79.39	1	25.00
25688.	Horique (horique)	4	81.60	86.39	4	100.00
25689.	Khang (hophopkangaroo)	4	85.90	92.21	0	0.00
25690.	Sam (honeyteacakes)	4	123.75	140.42	4	100.00
25691.	Marco (holystorm)	4	103.66	110.40	1	25.00
25692.	Hockeypaul (hockeypaul)	4	69.73	76.52	0	0.00
25693.	Clifford (hlclifford)	4	76.16	85.93	2	50.00
25694.	Hjalmar (hjalmardur)	4	68.42	72.48	0	0.00
25695.	Pouyan (hitic)	4	99.08	111.01	2	50.00
25696.	HiScore (hiscore)	4	67.07	84.04	0	0.00
25697.	Billy (hines5791)	4	65.78	73.65	2	50.00
25698.	Hai (hiitshai)	4	63.57	74.06	1	25.00
25699.	WATB (hermandolezal)	4	51.49	53.91	0	0.00
25700.	Henxo (henzomaso)	4	67.48	86.33	1	25.00
25701.	R (hellothere1233)	4	71.73	77.93	1	25.00
25702.	peepee (hehehe_yup)	4	85.21	88.45	0	0.00
25703.	Josh (healingjoe)	4	101.73	106.13	3	75.00
25704.	Alex (headadmiral)	4	105.64	110.87	3	75.00
25705.	Hashem (hashem__)	4	62.71	64.88	0	0.00
25706.	harsh wardhan (harshsingh1703)	4	55.31	58.53	1	25.00
25707.	Love♥ (harshs99)	4	92.05	104.36	2	50.00
25708.	Harsh (harshretro)	4	48.35	50.70	0	0.00
25709.	Hardik (hardfight777)	4	32.24	33.65	1	25.00
25710.	Harashta (harashtaw)	4	83.56	92.94	2	50.00
25711.	Harrison (har150n)	4	99.84	119.19	0	0.00
25712.	Hamza (hamza8864)	4	93.47	102.02	3	75.00
25713.	Julie (hamcheese)	4	106.84	119.05	4	100.00
25714.	HalfaPencil (halfapencil)	4	92.39	95.52	2	50.00
25715.	Hai (haiphan)	4	43.62	53.39	0	0.00
25716.	Hai (haiender288)	4	82.11	88.99	2	50.00
25717.	Tài (haharious)	4	61.53	63.80	0	0.00
25718.	typo_racer (haffe)	4	72.18	84.52	0	0.00
25719.	Sully (habs_sully1)	4	67.53	72.99	1	25.00
25720.	HoangH7 (h7starlight)	4	66.97	74.54	0	0.00
25721.	Bryan (h0tl1nebl1ng)	4	97.27	105.70	2	50.00
25722.	Gustav (gurra73333)	4	73.55	86.20	0	0.00
25723.	Kristian (guraf)	4	81.01	86.52	1	25.00
25724.	Kanti (gunjique)	4	84.96	93.05	2	50.00
25725.	Evan (guin366)	4	109.73	114.34	0	0.00
25726.	Sean (guac_schmac)	4	67.09	79.07	2	50.00
25727.	Garry (gt_meister)	4	95.62	104.33	2	50.00
25728.	Micheal (gtukario)	4	65.33	72.63	0	0.00
25729.	gsus152 (gsus152)	4	122.42	143.36	3	75.00
25730.	Growtopia (growtopiagt)	4	62.82	72.68	2	50.00
25731.	groundbeaf (groundbeaf)	4	136.88	157.41	3	75.00
25732.	grotesque (grotesque986)	4	33.62	41.84	1	25.00
25733.	Fast (greytwa)	4	97.55	103.62	0	0.00
25734.	Brus (greksmek)	4	61.25	71.19	0	0.00
25735.	mat (greenode)	4	119.94	135.01	4	100.00
25736.	greefy (greefy)	4	106.53	117.62	1	25.00
25737.	Marko (greasy_feta_cheese)	4	75.39	81.54	1	25.00
25738.	Quan (graycard)	4	54.69	57.29	0	0.00
25739.	Granted (granted8)	4	104.00	112.96	1	25.00
25740.	greg (grant24)	4	81.33	96.94	0	0.00
25741.	Ryan (grampsu)	4	72.60	81.10	2	50.00
25742.	Gram (gramj_fw)	4	92.15	104.38	0	0.00
25743.	Mauricio (gotsicile)	4	88.62	93.06	2	50.00
25744.	Gordon (gorlee2013)	4	83.69	90.03	0	0.00
25745.	Googolplex (googolplex05)	4	81.63	89.11	4	100.00
25746.	Tan (goodrace4u)	4	30.81	36.10	0	0.00
25747.	Gonta (gonta_gokuhara)	4	47.51	51.93	0	0.00
25748.	gondaloz (gondaloz)	4	42.13	44.35	0	0.00
25749.	vincent (godofbokchoy)	4	70.27	75.48	2	50.00
25750.	T•rt•ise (gocool21)	4	77.77	87.09	0	0.00
25751.	GLX (glxep)	4	102.24	109.34	1	25.00
25752.	oswin (glitterji)	4	103.79	117.38	3	75.00
25753.	Glenn (glennthemaster)	4	85.43	93.59	0	0.00
25754.	Glass (glassda)	4	92.21	108.91	2	50.00
25755.	✨( ͡° ͜ʖ ͡°) (giuse...	4	112.58	123.61	3	75.00
25756.	Beanz (gilz242)	4	117.65	132.44	3	75.00
25757.	Gilbie (gilbie)	4	89.65	93.29	2	50.00
25758.	GIBBBBBBY (gibbous)	4	76.26	81.63	1	25.00
25759.	Retro (ghostggum)	4	85.35	92.93	3	75.00
25760.	Gahnou (ghanou09)	4	64.65	68.21	0	0.00
25761.	ggzor (ggzor)	4	85.61	87.94	0	0.00
25762.	Plosing13591 (ge_ge)	4	57.06	67.27	1	25.00
25763.	yun (genuak)	4	53.46	55.53	0	0.00
25764.	DIGITEI COM A BUNDA (gel4ever)	4	93.96	108.13	3	75.00
25765.	Gasp (gasps)	4	85.83	94.50	0	0.00
25766.	Garrett (garrettkc)	4	42.77	53.06	0	0.00
25767.	Jeremy (gamingbull)	4	97.37	100.53	2	50.00
25768.	Mallu (gaminfernofiend)	4	34.35	36.93	0	0.00
25769.	Game (game_works)	4	71.96	84.97	4	100.00
25770.	Galtorix (galtorix)	4	59.05	60.14	0	0.00
25771.	Mister Jones (galaxybiscuit)	4	88.23	111.03	2	50.00
25772.	galatia (galatia)	4	68.67	74.05	1	25.00
25773.	gak (gakman)	4	96.65	109.20	2	50.00
25774.	uecchi (gagputa)	4	65.76	70.16	2	50.00
25775.	Gagan Deep (gagan0123)	4	75.15	88.11	1	25.00
25776.	mohamed (gadmet)	4	61.50	73.24	0	0.00
25777.	Gabriel (gabrieltoledo)	4	54.47	57.01	0	0.00
25778.	Ozzie (ga05july)	4	96.21	106.24	1	25.00
25779.	armin (fx_skrrt)	4	122.80	136.45	1	25.00
25780.	Whiffing (fxdk)	4	104.75	128.11	3	75.00
25781.	Bethanoo (fuzomania)	4	74.79	76.40	0	0.00
25782.	Adelkaa (fuska007)	4	41.13	42.71	1	25.00
25783.	Jack (furcifer)	4	82.72	88.54	2	50.00
25784.	GusFring (funnyvalentine)	4	82.01	85.50	2	50.00
25785.	Jacktes (funnyperson)	4	101.94	117.85	3	75.00
25786.	scoopy (scoopyjohnson)	4	93.50	97.62	1	25.00
25787.	Noah (scone)	4	83.86	90.00	2	50.00
25788.	Scold (scold_)	4	71.88	83.71	1	25.00
25789.	Regan (schwett)	4	66.04	69.18	1	25.00
25790.	Schlomo (schlomon)	4	67.66	78.27	2	50.00
25791.	hassanal (scarymonstrs)	4	62.18	69.24	2	50.00
25792.	Jakub (sayunoka)	4	66.07	72.25	1	25.00
25793.	SaucySeas (saucy_seas)	4	106.91	116.94	2	50.00
25794.	Justin (saucypenguinwee)	4	99.16	105.16	3	75.00
25795.	Satvik (satvikbansal)	4	75.25	81.22	0	0.00
25796.	Sara (saramarie722)	4	90.37	99.10	2	50.00
25797.	sanvi (sanvi_exe)	4	50.94	54.76	0	0.00
25798.	Sean (sangpm)	4	72.63	82.14	3	75.00
25799.	Sanger (sanger)	4	98.27	112.75	2	50.00
25800.	sam (samxkl)	4	85.06	91.30	1	25.00
25801.	Samo (samothepro)	4	63.38	70.42	4	100.00
25802.	samore (samore)	4	118.36	137.95	4	100.00
25803.	Sam (samjm)	4	82.48	88.52	4	100.00
25804.	Sam (samdagoat32)	4	92.77	100.98	2	50.00
25805.	Sam (samag)	4	32.00	34.40	0	0.00
25806.	Sander (salamanderboi)	4	60.20	71.25	0	0.00
25807.	Elgeo (saladin_pulverz)	4	102.78	117.28	1	25.00
25808.	sakthi2021 (sakthi2021)	4	57.24	65.83	1	25.00
25809.	Saitama (saitama001)	4	43.70	46.36	0	0.00
25810.	Sai (sait3ja)	4	74.11	78.31	2	50.00
25811.	Saidul (saidul_islam)	4	56.74	64.20	1	25.00
25812.	Sageofidiocy (sageofidiocy)	4	74.94	80.57	0	0.00
25813.	sael (saeleths)	4	100.60	105.08	1	25.00
25814.	rararara (sadsatan)	4	41.57	46.98	0	0.00
25815.	Sadhav (sadhavsingh)	4	40.02	48.75	1	25.00
25816.	nya (saber_ye)	4	161.48	172.15	1	25.00
25817.	sanjul (s4njul)	4	88.48	93.76	1	25.00
25818.	Lorenzo (rynzen)	4	54.33	60.60	2	50.00
25819.	romeo (rxmeo)	4	91.30	104.43	1	25.00
25820.	Rupok (rupok_kuet)	4	36.13	44.37	1	25.00
25821.	RUPESH (rupeshdodiya123)	4	74.29	85.82	1	25.00
25822.	Rupert (rupert_6969)	4	58.16	61.51	0	0.00
25823.	Mac (rubixgeek101)	4	82.95	99.47	2	50.00
25824.	Ethan (rubiks3)	4	99.87	105.33	2	50.00
25825.	Renee (rtvhyde)	4	71.07	78.43	0	0.00
25826.	rosa (rtrindade)	4	41.67	44.30	0	0.00
25827.	rrrena (rrrena)	4	69.58	76.40	1	25.00
25828.	tstats[rrooyy] (rrooyy)	4	79.83	87.76	0	0.00
25829.	Alessio (rqidz)	4	66.17	77.84	4	100.00
25830.	Machoko (rpbeatizula18)	4	80.60	97.69	2	50.00
25831.	Matthew (rookie_avali)	4	63.29	81.50	0	0.00
25832.	Ronzingz (ronzingz)	4	98.19	111.31	3	75.00
25833.	Rodrigo (romendoin)	4	44.04	53.17	1	25.00
25834.	rope (rolnd)	4	88.40	97.90	1	25.00
25835.	poopoo (rogue_pp)	4	90.30	105.81	2	50.00
25836.	rodrigo (rodrigo_rocha)	4	29.25	31.69	0	0.00
25837.	Rod (rod22)	4	58.20	70.56	1	25.00
25838.	Rochak (rochak27)	4	39.42	44.79	0	0.00
25839.	Robby (robstersgaming)	4	105.45	112.50	3	75.00
25840.	robert1003 (robert1003)	4	86.07	89.40	1	25.00
25841.	Robby (robdog1)	4	71.01	83.04	1	25.00
25842.	Robert (rnschmidt)	4	96.64	104.75	1	25.00
25843.	rmanz (rmanz)	4	101.78	116.11	2	50.00
25844.	Rtyp (rktypes)	4	95.43	104.80	0	0.00
25845.	Fajar (rizqy96)	4	80.62	94.37	2	50.00
25846.	Rise (rise_again)	4	67.94	70.73	4	100.00
25847.	Алексей (risengod23)	4	39.03	42.29	2	50.00
25848.	RingereQQ (ringereqq)	4	60.55	66.79	4	100.00
25849.	Raul (rincindishes)	4	95.66	109.30	2	50.00
25850.	Cheesy (rikk_merp)	4	90.10	90.95	2	50.00
25851.	Rye (riett)	4	140.65	161.70	2	50.00
25852.	The One (ridick_the_one)	4	100.48	110.42	2	50.00
25853.	Rides (rides1283man)	4	105.04	136.43	4	100.00
25854.	Rider (rider2)	4	49.55	54.21	0	0.00
25855.	Ricky (rickyr)	4	100.83	113.97	1	25.00
25856.	Rick (rickdicker)	4	75.35	87.16	4	100.00
25857.	Brantley (rezxbl)	4	82.83	90.21	1	25.00
25858.	Gholamreza (rezadar)	4	45.40	51.81	0	0.00
25859.	Adrian (revertion)	4	57.13	70.09	2	50.00
25860.	Reuben (reureu)	4	105.22	121.43	1	25.00
25861.	ret (retiarius)	4	102.22	111.52	4	100.00
25862.	Requiem (requiemsolution)	4	87.40	93.25	1	25.00
25863.	Renkon (renkon)	4	124.97	138.90	4	100.00
25864.	Rad (renaissance_g)	4	54.35	58.60	0	0.00
25865.	Daniel (rektrobot)	4	66.81	73.58	0	0.00
25866.	Rejinten (rejinten)	4	43.58	47.86	1	25.00
25867.	Reggie (reggiedada)	4	72.63	79.97	2	50.00
25868.	reena (reenasmart21)	4	48.92	54.55	0	0.00
25869.	Brendan (reeeaver)	4	71.29	78.70	1	25.00
25870.	pP poopoo (red_five)	4	82.90	92.92	0	0.00
25871.	Ethan (redmac135)	4	106.18	112.63	2	50.00
25872.	Redheesh (redheeshrj)	4	45.27	49.33	0	0.00
25873.	Red (reddened)	4	160.54	170.77	4	100.00
25874.	Khang (rebels1)	4	58.59	65.30	0	0.00
25875.	reasonable (reasonablegoat)	4	63.31	67.19	0	0.00
25876.	Landon (realpizza)	4	68.10	72.69	2	50.00
25877.	(reallyam)	4	119.82	134.84	3	75.00
25878.	Sarah (realgirlgoodhands)	4	86.69	92.81	4	100.00
25879.	Pope (rcpope)	4	73.84	89.38	0	0.00
25880.	Archie (rchieallen)	4	84.44	102.10	0	0.00
25881.	Tamas (razor15)	4	49.53	52.76	0	0.00
25882.	Ravon (ravonhenson)	4	97.65	105.72	3	75.00
25883.	Ravi (ravi10000)	4	50.12	63.84	0	0.00
25884.	Rasea (rasea)	4	117.00	118.60	3	75.00
25885.	David (random_lee)	4	117.69	133.45	2	50.00
25886.	Random Guy (randompersonjci)	4	95.51	101.30	3	75.00
25887.	Random (randomhumanlmao)	4	94.84	106.02	1	25.00
25888.	ramoraros (ramoraros)	4	96.72	108.47	2	50.00
25889.	Ramon (rambo_290703)	4	43.77	46.55	0	0.00
25890.	Rakuuen (rakuuen)	4	59.75	65.45	1	25.00
25891.	rakibul hasan (rakibulhasan...	4	50.07	54.38	1	25.00
25892.	Rajashekar (rajashekar0203)	4	46.95	50.89	0	0.00
25893.	rainblizz (rainblizz)	4	73.07	75.65	1	25.00
25894.	vazhin (rahaaaa)	4	39.26	44.46	2	50.00
25895.	Rafsun (rafsunit)	4	94.09	99.98	2	50.00
25896.	Radoslav (radosaurus)	4	57.28	64.55	3	75.00
25897.	Bumbur (radekzadek)	4	55.57	66.57	1	25.00
25898.	Joshua (racingjsj)	4	59.05	65.40	0	0.00
25899.	Rachel (rachel_chu)	4	45.66	48.45	1	25.00
25900.	Mat (rabbitkiller38)	4	67.60	71.39	1	25.00
25901.	Clairvoyant (r2zenith)	4	61.07	68.33	0	0.00
25902.	quoc (quoclahn)	4	114.97	129.37	2	50.00
25903.	quiskit (quiskit)	4	55.04	60.00	1	25.00
25904.	Tom (quickfingerz)	4	85.82	99.86	2	50.00
25905.	cosette (queen_weeb)	4	32.63	34.88	0	0.00
25906.	Quintin (qt_parzival)	4	36.91	39.06	0	0.00
25907.	Qrip (qrip)	4	99.82	129.06	3	75.00
25908.	qrill (qrill)	4	68.08	74.42	1	25.00
25909.	pyotr (pyotrb)	4	73.43	77.52	3	75.00
25910.	Incinous (pxlla)	4	80.04	87.52	1	25.00
25911.	Chris (pwncyber)	4	91.51	102.21	3	75.00
25912.	putt12343 (putt12343)	4	79.43	86.87	1	25.00
25913.	Average Keyboard User (purp...	4	79.31	87.05	1	25.00
25914.	Hank (purplehank7)	4	75.74	78.17	0	0.00
25915.	Egor (psinka)	4	49.54	54.30	0	0.00
25916.	PseudoNoise (pseudonoise)	4	95.36	101.31	3	75.00
25917.	PruXy. (pruxy)	4	92.83	103.15	4	100.00
25918.	Andreas (prosurvival_321)	4	93.93	124.27	3	75.00
25919.	Prosper (prosperous)	4	81.10	89.12	1	25.00
25920.	proovend (proovend)	4	75.47	77.23	1	25.00
25921.	Maik (pronikolaidis)	4	80.61	83.55	3	75.00
25922.	Etan (probablylagging)	4	91.82	103.93	4	100.00
25923.	Anne (princess_lichen)	4	68.14	74.62	1	25.00
25924.	hello (prateekskl99)	4	63.81	70.79	1	25.00
25925.	Putu (pratamamp)	4	74.11	82.22	2	50.00
25926.	pc (prankster5546)	4	118.67	121.39	2	50.00
25927.	Pranav (pranavmurray)	4	50.91	53.79	0	0.00
25928.	Pranav (pranav0307)	4	66.31	68.26	0	0.00
25929.	Pragan (pragan)	4	57.28	63.78	0	0.00
25930.	Rafey (practicerace)	4	99.59	114.90	3	75.00
25931.	Joe (pp11thebest)	4	37.27	40.55	1	25.00
25932.	William (poutine08)	4	114.74	134.65	3	75.00
25933.	Poultry (poultryman)	4	86.73	90.65	4	100.00
25934.	Ro (posterd)	4	78.34	82.91	0	0.00
25935.	Lukas (poseidoncoder)	4	74.48	83.44	2	50.00
25936.	ponkl (ponkl)	4	108.26	114.90	4	100.00
25937.	Polom (polomfileni)	4	70.40	72.10	2	50.00
25938.	Online (polar_beans)	4	70.42	77.89	0	0.00
25939.	Plunker (plunker)	4	67.97	82.83	3	75.00
25940.	piimpj (pjcrowley)	4	108.23	120.86	0	0.00
25941.	^_^ (pippens_)	4	99.41	119.71	2	50.00
25942.	Piotrek (piotrek97)	4	52.48	57.81	1	25.00
25943.	Pintu (pintusingh26)	4	42.08	44.79	0	0.00
25944.	VJ (pinexpp1edeath)	4	65.69	73.12	0	0.00
25945.	Radeyz (pineapples2925)	4	100.70	113.53	0	0.00
25946.	♠Homer (pimpelkram)	4	69.77	79.79	1	25.00
25947.	Andy (pilotplater)	4	82.02	88.23	1	25.00
25948.	Cody (pikachuisyellow)	4	104.64	114.93	2	50.00
25949.	Andres (pickandres)	4	82.81	86.42	0	0.00
25950.	Pias (piasroy)	4	70.98	72.36	0	0.00
25951.	Bryan (pianudolores)	4	67.08	70.92	1	25.00
25952.	Tim (phrozact)	4	66.52	70.23	1	25.00
25953.	johan (pho777)	4	91.43	100.42	1	25.00
25954.	Alex (philister)	4	78.93	80.12	2	50.00
25955.	philip (philiptokareff)	4	113.81	119.96	4	100.00
25956.	Patrick (pheonix74)	4	80.51	84.39	2	50.00
25957.	PhazedAU (phazedau)	4	90.16	91.44	3	75.00
25958.	Tom (phantom74)	4	102.89	110.51	0	0.00
25959.	Elias (pgo_13)	4	47.29	61.83	1	25.00
25960.	Peter (peterhawthorne)	4	64.40	74.83	1	25.00
25961.	Nolan (pestanon23)	4	100.50	119.78	4	100.00
25962.	None of (perpetuity_0)	4	66.04	73.19	1	25.00
25963.	Alex (pentalex)	4	137.96	152.98	4	100.00
25964.	pen (penlume)	4	128.70	134.06	1	25.00
25965.	bjonk biggest fan (pengeuin)	4	84.71	93.17	1	25.00
25966.	Pegtor (pegtor)	4	88.78	109.93	1	25.00
25967.	Peter (peasqueak)	4	89.27	99.26	1	25.00
25968.	Pearson (pearsonsm)	4	76.48	93.66	2	50.00
25969.	Pingbang (pbb_want_to_sleep)	4	95.28	104.11	0	0.00
25970.	Abhi Baby (payalc)	4	50.20	58.06	0	0.00
25971.	Paw (pawan42)	4	88.60	94.61	2	50.00
25972.	PK (pavanuppari)	4	58.38	65.69	1	25.00
25973.	Patrick (patwang123)	4	120.82	124.80	3	75.00
25974.	aviad (patish)	4	68.56	70.04	2	50.00
25975.	G (pastachilli)	4	80.67	91.97	0	0.00
25976.	sid (parallelogrammed)	4	92.31	101.21	0	0.00
25977.	parag (paragparag)	4	70.20	78.70	1	25.00
25978.	Papa (papaosmurf)	4	85.43	93.77	0	0.00
25979.	Mr.Chow (panza_sancho)	4	68.95	77.99	0	0.00
25980.	Danica (pandanica)	4	71.15	77.39	1	25.00
25981.	Pana (pana1312)	4	71.02	72.17	1	25.00
25982.	Palaladin (palaladin)	4	90.70	102.44	3	75.00
25983.	Willie (paiswillie)	4	103.27	111.08	1	25.00
25984.	Pai Sho (paisho)	4	108.37	125.39	4	100.00
25985.	Paint (paintmeblue62)	4	90.52	96.94	1	25.00
25986.	James (paintballonu)	4	84.72	93.23	1	25.00
25987.	MIMSY (paddydingus)	4	85.92	99.26	2	50.00
25988.	Pacman (paco1978)	4	28.41	39.35	2	50.00
25989.	ozaninator (ozaninator)	4	84.16	93.22	2	50.00
25990.	Pavel (oxxxyd)	4	58.46	62.88	0	0.00
25991.	Neckkoooooo (otakgirl_)	4	50.16	50.97	0	0.00
25992.	Oussama (osmaxwell)	4	66.36	78.34	1	25.00
25993.	Prince Amir (orionic_arkhalis)	4	63.19	69.14	1	25.00
25994.	Reyes (oriim)	4	76.77	90.02	2	50.00
25995.	origix (origix)	4	67.11	71.02	3	75.00
25996.	ore (orezee)	4	82.65	87.40	1	25.00
25997.	harry (orekkles)	4	114.45	118.63	2	50.00
25998.	da imash ili da budesh (ord...	4	105.74	114.34	2	50.00
25999.	Aryan (ordinarytranquil)	4	54.00	62.76	1	25.00
26000.	matty (orange_hexagon)	4	31.89	33.78	0	0.00
26001.	Orange (orange29)	4	69.63	81.10	1	25.00
26002.	Chris (operationbegone)	4	61.03	67.61	0	0.00
26003.	onlycleansnipes (onlycleans...	4	90.49	106.88	3	75.00
26004.	Arinjay Salgia (onehandchamp)	4	41.12	44.66	0	0.00
26005.	omigumo (omigumo)	4	95.91	121.87	1	25.00
26006.	Omar (omareffat)	4	87.82	100.21	1	25.00
26007.	Omar Ahmed (omar947203)	4	31.29	33.00	2	50.00
26008.	Ollt (ollt)	4	59.57	68.29	0	0.00
26009.	Oliver (olliewests)	4	79.60	83.58	2	50.00
26010.	Olives (olives123)	4	68.83	80.75	0	0.00
26011.	Oldrock (oldrock)	4	38.92	44.63	0	0.00
26012.	Josh (okey101)	4	50.44	51.40	0	0.00
26013.	Lev (okaymoonstorm)	4	63.96	84.72	3	75.00
26014.	Oily (oilyoogway)	4	66.16	68.99	0	0.00
26015.	Oscar (oheim)	4	66.32	71.26	1	25.00
26016.	ogcoolpepper (ogcoolpepper)	4	78.93	82.04	0	0.00
26017.	VSwede (officialvswede)	4	67.13	76.22	0	0.00
26018.	Oehan (oehan)	4	76.18	83.83	0	0.00
26019.	Obstfliege (obstfliege)	4	67.02	70.53	0	0.00
26020.	ObsessiveDuck09 (obsessive_...	4	45.74	48.59	0	0.00
26021.	Alden (obeezy)	4	88.07	93.90	3	75.00
26022.	Nuttanun (nut_tun)	4	36.10	39.23	1	25.00
26023.	Nurti (nurti07)	4	35.89	42.01	0	0.00
26024.	Niccolo (nthperez)	4	106.38	112.78	2	50.00
26025.	Noz (nozrael)	4	52.60	59.22	1	25.00
26026.	Noximini (noximini)	4	99.14	103.49	2	50.00
26027.	Noel (nowellrl)	4	75.50	85.22	0	0.00
26028.	Viking (not_xp3og)	4	63.64	75.12	1	25.00
26029.	Hunter (nottitan)	4	68.87	73.25	2	50.00
26030.	Lynxi (notmystik_)	4	85.26	89.92	1	25.00
26031.	Minhquan (notminhquan)	4	72.84	79.34	0	0.00
26032.	John (notjohn5)	4	103.52	110.57	4	100.00
26033.	Emmett (notfunnyorange)	4	85.76	92.16	2	50.00
26034.	JOJ (not2gud)	4	85.06	90.56	2	50.00
26035.	Adler (nosynevada)	4	40.21	45.56	0	0.00
26036.	noonar (noonar)	4	91.52	97.97	3	75.00
26037.	Balraj (noob_racer_96)	4	87.41	93.79	0	0.00
26038.	Тагир (nonxfx)	4	44.40	49.84	1	25.00
26039.	Timothy (noma624)	4	81.40	86.48	2	50.00
26040.	Nolan (nolangreub)	4	88.78	101.80	3	75.00
26041.	Nolan (nolanelwood)	4	102.73	115.51	2	50.00
26042.	Noel (noel_svartsjo)	4	55.51	62.69	1	25.00
26043.	Noatak (noatak_)	4	115.23	144.34	2	50.00
26044.	Nathan (njd913)	4	72.84	82.31	1	25.00
26045.	Ruben (nitrosabre)	4	101.52	112.44	2	50.00
26046.	Rens (nismo_gtr)	4	90.77	94.40	0	0.00
26047.	Nishanth (nishanthswaminathan)	4	86.91	90.96	3	75.00
26048.	Niraj (nirajr4)	4	55.71	57.78	0	0.00
26049.	Scott (nikolasvallesteros)	4	84.40	90.61	3	75.00
26050.	niecia (nieecia)	4	56.35	63.93	1	25.00
26051.	Nicolai (nicolaimanev)	4	84.17	92.22	2	50.00
26052.	Nick (nicknyaumwe)	4	58.86	64.98	1	25.00
26053.	Nicelec (nicelec_1st)	4	48.04	60.59	0	0.00
26054.	NiarbOn (niarbon)	4	84.47	89.80	2	50.00
26055.	nh (nhvk)	4	57.03	62.06	0	0.00
26056.	LY (ngly)	4	137.46	150.08	4	100.00
26057.	alvin (nganinator)	4	76.99	88.33	1	25.00
26058.	Denis (netsa)	4	99.22	107.08	4	100.00
26059.	Carl (nerarith)	4	78.71	80.26	2	50.00
26060.	neotoky0 (neotoky0)	4	124.87	139.48	1	25.00
26061.	Daniel (neon95)	4	80.88	86.85	0	0.00
26062.	Slow (neolemon)	4	107.24	122.13	2	50.00
26063.	Glenn (nemenis)	4	63.72	73.62	0	0.00
26064.	Nemanja (nemanja6)	4	74.00	79.23	1	25.00
26065.	Nela (nelaach)	4	89.99	95.72	3	75.00
26066.	Jacob (necromuncher)	4	100.35	107.27	0	0.00
26067.	Nico (ncc5)	4	57.83	62.75	0	0.00
26068.	Navid (navid_rahman)	4	55.22	57.29	1	25.00
26069.	╰(▔∀▔)╯ (naufalm02)	4	82.58	91.86	3	75.00
26070.	Naol (naolchala)	4	47.61	58.71	1	25.00
26071.	Nae (naeakuma)	4	56.33	67.11	0	0.00
26072.	Justin (my_friend_justin)	4	82.56	84.59	1	25.00
26073.	Mytho (mythoskar)	4	89.97	94.58	3	75.00
26074.	Mythic (mythicsane)	4	88.27	90.97	0	0.00
26075.	Mysterious (mysteriousacadia)	4	65.11	75.33	0	0.00
26076.	mmlt (mvejlund)	4	76.56	80.48	0	0.00
26077.	mustang (mustang51)	4	92.17	103.24	2	50.00
26078.	Murali Prasanth (muralipras...	4	63.11	70.36	1	25.00
26079.	Mukklan (mukklan)	4	46.34	55.93	1	25.00
26080.	Mug (mugisabug)	4	68.92	74.90	1	25.00
26081.	Muffyn (muffyngg)	4	66.67	69.46	1	25.00
26082.	carline (muffintart)	4	107.72	111.69	1	25.00
26083.	희성 (mttprk)	4	94.58	104.40	2	50.00
26084.	AhmedSalem (mrtempo)	4	100.82	104.00	2	50.00
26085.	Nathan (mrsodacan)	4	104.94	113.01	4	100.00
26086.	dean (mrselndyfox)	4	54.31	57.44	1	25.00
26087.	Adarsh (mrr0b0t797)	4	72.00	73.78	1	25.00
26088.	Dat (mrpiggy123)	4	105.94	114.77	3	75.00
26089.	Simon (mrperson_)	4	81.67	91.86	1	25.00
26090.	Mrotaku (mrotaku)	4	140.09	156.19	3	75.00
26091.	Meerkat (mrmeerkat)	4	84.41	98.89	2	50.00
26092.	Mario (mrio)	4	62.26	71.85	1	25.00
26093.	Mrinmoy (mrinmoyss)	4	58.90	63.78	0	0.00
26094.	Adam (mrgrydzan)	4	102.46	120.92	1	25.00
26095.	Mr Grate (mrgrate)	4	80.96	93.69	2	50.00
26096.	Cizzo (mrcizzo)	4	108.37	133.39	2	50.00
26097.	Andy (mouldy_peanut)	4	114.56	118.91	1	25.00
26098.	Mouad (mouadmzn)	4	72.45	79.42	0	0.00
26099.	Moshmello (moshmello)	4	104.08	111.39	3	75.00
26100.	Moritz Klositz (moritz_klos...	4	69.78	72.46	1	25.00
26101.	Josué (morfeu_123)	4	61.03	65.09	2	50.00
26102.	Morgan (morche202)	4	88.15	97.50	1	25.00
26103.	Morty (moothemighty)	4	62.46	66.79	3	75.00
26104.	Ilhan (monzf)	4	67.64	101.23	4	100.00
26105.	Krisztian (monsteq)	4	99.73	105.63	1	25.00
26106.	Monish (monish2c)	4	65.14	69.19	1	25.00
26107.	Mihail (mondic)	4	60.69	63.07	0	0.00
26108.	molly (mollidae)	4	90.22	101.17	0	0.00
26109.	mohsencs (mohsencs)	4	43.71	50.94	2	50.00
26110.	Mohammad (mohammadrokib)	4	46.95	50.68	0	0.00
26111.	Mohamed (mohamednabil090)	4	23.24	25.57	2	50.00
26112.	allen (modeski)	4	72.08	86.83	2	50.00
26113.	Mnohem (mnohem)	4	63.59	72.37	2	50.00
26114.	M (mmanhar)	4	81.83	94.58	2	50.00
26115.	M (mjrzasa)	4	62.31	76.71	1	25.00
26116.	koren (mits321)	4	60.78	64.48	1	25.00
26117.	Ben (mister_ghillie)	4	104.30	115.74	1	25.00
26118.	Mykhailo (mishok)	4	83.51	87.99	0	0.00
26119.	mirnyz (mirnyz)	4	48.85	55.63	4	100.00
26120.	Park (miriampark7)	4	80.75	85.63	1	25.00
26121.	Guest (minusawpm)	4	106.68	113.66	2	50.00
26122.	deez (mintpurple)	4	56.66	60.67	0	0.00
26123.	Minerstove (minerstove)	4	87.79	106.44	2	50.00
26124.	Andrew (mikzzu)	4	121.54	127.34	3	75.00
26125.	michael (mikeyjohn)	4	91.13	103.25	1	25.00
26126.	Mike (mikedoel85)	4	94.45	101.20	0	0.00
26127.	Miguel (migsarm16)	4	77.31	88.04	3	75.00
26128.	Daniel (mickeyyaya)	4	68.35	81.68	0	0.00
26129.	Mike (michaelomh)	4	102.53	110.13	2	50.00
26130.	Wen-Yuan (michael1017)	4	52.91	58.27	0	0.00
26131.	Micah (micahlandry)	4	77.52	100.57	3	75.00
26132.	mgupta (mgupta1410)	4	66.90	69.12	1	25.00
26133.	Doc G (Bay Area) (mgavino)	4	101.66	106.66	1	25.00
26134.	Mohammad (mewsamurai)	4	77.98	83.70	2	50.00
26135.	Meet (mete2119)	4	54.28	59.96	0	0.00
26136.	Mimi (merrymolly23)	4	82.82	88.75	2	50.00
26137.	Meow (meowchamp)	4	69.54	73.07	1	25.00
26138.	melanie (mellaniee)	4	63.34	69.39	0	0.00
26139.	melinder (melindayao21)	4	70.62	73.83	3	75.00
26140.	Michael (mekel_elden)	4	95.40	99.59	3	75.00
26141.	Mehrab (mehrab23)	4	46.75	58.65	0	0.00
26142.	mitchelle (megets)	4	32.51	45.11	0	0.00
26143.	Meet (meet_singh88)	4	37.82	40.11	0	0.00
26144.	megan (meaogan)	4	124.02	138.11	3	75.00
26145.	Michael (mdz64)	4	71.69	78.65	1	25.00
26146.	Mathew (mdwelborn)	4	72.69	79.98	2	50.00
26147.	doshishowspeed (mcqueen_v2)	4	67.84	77.34	1	25.00
26148.	Matt (mchoe2000)	4	60.49	66.46	2	50.00
26149.	Josef (mcblyat)	4	87.60	95.10	1	25.00
26150.	Marcus (mb_2001)	4	85.92	89.33	1	25.00
26151.	Matias (mazubazu)	4	62.18	71.72	1	25.00
26152.	Mazen (mazenayman)	4	90.02	94.51	2	50.00
26153.	22ru (mayushy)	4	122.83	132.75	4	100.00
26154.	Beeymax (mayumii)	4	63.00	71.38	1	25.00
26155.	Max (maxpoppe)	4	62.18	64.70	0	0.00
26156.	Andrea (maxistarling)	4	52.49	55.65	0	0.00
26157.	m (mawcks)	4	53.90	70.77	0	0.00
26158.	Matthew (matty_g)	4	92.99	99.52	3	75.00
26159.	Matt (mattyrice)	4	62.32	74.38	0	0.00
26160.	Matthew (matty21988)	4	78.71	83.01	0	0.00
26161.	Matthew (mattify)	4	64.68	76.81	0	0.00
26162.	Matt (matfia22)	4	62.55	68.61	0	0.00
26163.	mathisvan (mashipeas123)	4	83.64	87.32	2	50.00
26164.	Marz (marzcovers)	4	94.83	105.63	1	25.00
26165.	Marvin (marxman16)	4	64.40	70.28	3	75.00
26166.	Martin (martin_lol)	4	58.28	63.22	0	0.00
26167.	Martin (martindungeon)	4	97.52	103.75	0	0.00
26168.	Mars (marsattacks97)	4	72.73	77.39	0	0.00
26169.	Markos (marky35707)	4	79.51	90.41	1	25.00
26170.	Mark (mark2912)	4	83.29	95.66	0	0.00
26171.	mar (marhaage)	4	56.16	69.37	0	0.00
26172.	Marcus (marcusvang1234)	4	83.38	93.74	1	25.00
26173.	Mana (mannaa)	4	85.30	92.15	0	0.00
26174.	Khang (manhkhangvn)	4	70.76	78.79	0	0.00
26175.	Paweł (malzeer)	4	103.45	124.24	4	100.00
26176.	JONAS (___jonas___)	4	75.68	78.71	0	0.00
26177.	Jessy (___jessy___)	4	76.80	79.14	2	50.00
26178.	yida (_yoda_)	4	35.16	41.13	1	25.00
26179.	Thelegend27 (_thelegend_27_)	4	79.18	87.92	2	50.00
26180.	Richard (_spicyramen_)	4	69.63	82.27	1	25.00
26181.	MooMoo (_moomoo_)	4	73.29	81.69	1	25.00
26182.	_Lxwrxncx_ (_lxwrxncx_)	4	59.64	63.37	2	50.00
26183.	Lily (_lily)	4	55.51	66.71	0	0.00
26184.	Jansson (_jansson_)	4	68.35	82.09	0	0.00
26185.	Damian (_damian_)	4	61.73	67.43	0	0.00
26186.	_batonnoir (_batonnoir)	4	121.85	126.06	1	25.00
26187.	. (z_edward)	4	114.79	122.05	2	50.00
26188.	Alex (zyt3ch)	4	62.42	84.54	1	25.00
26189.	S (zotus)	4	86.76	90.36	1	25.00
26190.	Eddie (zorrpan)	4	86.25	89.79	3	75.00
26191.	Aleks (zooby_san)	4	79.15	84.97	0	0.00
26192.	zitsy (zitsy)	4	59.33	66.01	1	25.00
26193.	Zion (zionmegalion)	4	98.88	107.14	1	25.00
26194.	Zhivko (zikica97)	4	83.64	94.14	2	50.00
26195.	Zilong (zhziong)	4	106.73	110.63	2	50.00
26196.	zhender (zhender)	4	64.81	88.63	3	75.00
26197.	Pengwen (zhaopengwen)	4	76.72	80.56	2	50.00
26198.	Zethrian (zethrian)	4	94.92	103.97	3	75.00
26199.	zeta (zeta235)	4	43.48	48.74	0	0.00
26200.	Diego (zem0nic)	4	110.45	114.89	1	25.00
26201.	Zeke (zekedroid)	4	106.07	114.33	1	25.00
26202.	Rui (zehs)	4	68.37	72.88	1	25.00
26203.	Timothy (zeevox)	4	93.83	100.00	2	50.00
26204.	zeek (zeek618)	4	89.07	100.50	0	0.00
26205.	Druzie (zectrople)	4	89.35	93.58	2	50.00
26206.	Aleksa (zdravce988)	4	80.30	95.78	0	0.00
26207.	Serph (zasvern)	4	50.36	55.12	0	0.00
26208.	Zarif Rafiul haque (zarifzars)	4	49.17	59.65	4	100.00
26209.	Zanzaru (zanzaru)	4	77.10	94.36	0	0.00
26210.	Zaniac (zaniac10)	4	135.31	145.45	2	50.00
26211.	............. (zalvary)	4	76.87	84.78	2	50.00
26212.	Rarw. (zambodia)	4	131.71	133.63	1	25.00
26213.	Zambo (zambo_dev)	4	64.80	66.23	2	50.00
26214.	Zaim (zaimanator)	4	102.47	118.33	4	100.00
26215.	Damien (zahx666)	4	113.83	120.65	4	100.00
26216.	Zahid (zahidconcha)	4	43.95	52.14	1	25.00
26217.	Zach (zachyp)	4	61.28	69.52	0	0.00
26218.	Zach (zachog)	4	49.00	61.98	0	0.00
26219.	zackjh (zacharykjh)	4	100.27	112.56	2	50.00
26220.	zach (zacaroniandcheese)	4	105.48	134.06	3	75.00
26221.	zaarium (zaarium)	4	55.13	59.25	0	0.00
26222.	yath (yyatt)	4	103.32	109.29	0	0.00
26223.	Yusuf (yusuft2)	4	69.78	77.53	0	0.00
26224.	Vik (yungcoolioth)	4	92.85	111.02	2	50.00
26225.	Chan (yunelle)	4	64.14	67.60	0	0.00
26226.	Yumin (yumin)	4	68.46	82.16	1	25.00
26227.	MDevil - (yt_mdevil)	4	86.02	105.73	3	75.00
26228.	Yowmang (yowmang)	4	64.54	72.26	0	0.00
26229.	Connor (yowassuphomies)	4	100.04	117.06	1	25.00
26230.	Bill (youngbilliam)	4	64.47	68.81	0	0.00
26231.	Ampheline (younes_feline)	4	109.98	116.68	3	75.00
26232.	You (you3345)	4	65.86	67.56	0	0.00
26233.	Adam (yoooooooooooooooooooo...	4	34.47	38.10	3	75.00
26234.	YoMoMGae (yomomgae)	4	68.05	77.11	1	25.00
26235.	Luan (yoitsluan)	4	101.18	111.77	3	75.00
26236.	RaspberryPi1 (yodabyteram)	4	76.58	86.04	0	0.00
26237.	RATATA (yiracan2)	4	57.57	66.20	0	0.00
26238.	Jugemu (yerden01)	4	62.27	66.69	1	25.00
26239.	Jeff (yenemy)	4	130.14	139.38	1	25.00
26240.	Randolph (yellowtofu)	4	94.32	107.98	1	25.00
26241.	Albert (yellowmoose)	4	59.36	63.24	1	25.00
26242.	Lion (yellowlion321)	4	89.14	98.94	2	50.00
26243.	Adam (ya_boi27)	4	110.34	120.48	1	25.00
26244.	271 REIS#4706 (yasseir)	4	44.57	45.81	0	0.00
26245.	☺☻☺ (yahyahoo)	4	46.98	50.82	0	0.00
26246.	XxKarmaX (xxkarmax)	4	71.24	80.97	0	0.00
26247.	youngboy (xthomasedwa)	4	92.52	99.05	2	50.00
26248.	heng (xshadowlegendx)	4	121.61	134.69	4	100.00
26249.	Skye W. (xpeq7)	4	50.57	51.44	1	25.00
26250.	xil (xilvantheous)	4	65.60	67.48	0	0.00
26251.	Lunchlady (xg33kx)	4	117.10	132.05	2	50.00
26252.	Cameron (xerxes_backwards)	4	82.67	87.05	0	0.00
26253.	Xelieu (xelieu)	4	115.16	129.37	4	100.00
26254.	Xavonium (xavonium)	4	79.78	87.59	4	100.00
26255.	Poyraz (xaryop)	4	65.50	66.77	0	0.00
26256.	X0137 (x0137)	4	47.78	53.52	0	0.00
26257.	Wyatt (wyattaker)	4	89.69	115.43	3	75.00
26258.	Weston (wwalker1)	4	86.38	99.58	1	25.00
26259.	Astricd (wunwun2468)	4	63.27	66.69	0	0.00
26260.	Wujy (wujy)	4	64.74	76.69	1	25.00
26261.	Andrew (wtypo25)	4	63.69	69.10	0	0.00
26262.	William (wsz_riptide)	4	72.42	84.34	2	50.00
26263.	Wendy (wracicot)	4	63.07	67.86	1	25.00
26264.	John (word_weaver)	4	34.44	35.55	0	0.00
26265.	Sjors (wordmasterofbooks)	4	76.32	90.58	0	0.00
26266.	Akash (wolverine07)	4	37.46	42.80	0	0.00
26267.	Wojtek (wojtekwro)	4	51.52	57.45	0	0.00
26268.	Derrick (wnorad)	4	87.63	97.49	3	75.00
26269.	Thịnh (wizardhire)	4	64.75	79.71	1	25.00
26270.	Nathan (wilson_w_wilson)	4	65.24	73.26	2	50.00
26271.	Wilson (wilsontanvis)	4	76.32	84.34	1	25.00
26272.	Will (will_stz)	4	58.52	63.20	1	25.00
26273.	Will Of The Wind (will_of_t...	4	72.75	79.98	3	75.00
26274.	Tushar (willingtushar)	4	63.65	72.17	1	25.00
26275.	Qi (williamz)	4	79.74	87.24	0	0.00
26276.	AsteroGamer (williamvalerian)	4	95.74	109.34	1	25.00
26277.	Wilhelm (wilhelm_the_typing...	4	59.89	61.63	0	0.00
26278.	Vaibhav (whybhav)	4	61.55	63.95	1	25.00
26279.	Weziq (weziq)	4	71.10	77.94	1	25.00
26280.	Michael (wevvt)	4	71.48	85.38	2	50.00
26281.	Evan (westboys)	4	93.31	97.35	2	50.00
26282.	Wengison (wengison)	4	72.08	74.08	0	0.00
26283.	nannan (weepee)	4	49.77	56.94	1	25.00
26284.	William (wbulovas)	4	76.42	88.47	3	75.00
26285.	Waske (waskepro_official)	4	59.56	65.74	1	25.00
26286.	Warren (warren98)	4	54.80	67.04	1	25.00
26287.	Dimian (want_dimsum)	4	103.08	114.59	2	50.00
26288.	Waleed (waleed_sawalhi)	4	84.60	89.59	0	0.00
26289.	Vincent (waldoo)	4	88.97	99.62	3	75.00
26290.	Big (wakibeast211)	4	39.62	42.93	0	0.00
26291.	Dennis (waar_is_de_magnetron)	4	90.35	95.17	0	0.00
26292.	vukeli (vukeli)	4	75.30	79.03	1	25.00
26293.	Iamsparta (void_snowy)	4	95.73	108.90	2	50.00
26294.	Underworld (vnderworld)	4	89.31	102.62	3	75.00
26295.	Vncnt (vncntrvldo)	4	30.15	32.78	1	25.00
26296.	Vive (vivethemodder)	4	115.02	125.61	4	100.00
26297.	lyudmila (vityaz)	4	95.71	110.88	2	50.00
26298.	Mimi (virtuamima)	4	82.21	89.30	2	50.00
26299.	Virtual (virtualtrash)	4	69.50	75.26	2	50.00
26300.	Sacha (viperfang)	4	99.41	104.96	4	100.00
26301.	Viktor (viktor3257)	4	57.94	61.92	0	0.00
26302.	annop (viiorgmj)	4	94.98	100.62	3	75.00
26303.	Viet (vietvhcr)	4	85.04	94.49	1	25.00
26304.	Venus (venus_liki)	4	53.06	59.81	1	25.00
26305.	Vengence99 (vengence99)	4	105.78	119.00	2	50.00
26306.	Veena (venawartmander)	4	75.24	80.21	1	25.00
26307.	Mariah (vellichorne)	4	61.09	72.78	0	0.00
26308.	vedanttoke20 (vedanttoke20)	4	81.72	89.58	1	25.00
26309.	Vaibhav (vaibhav12301)	4	54.99	65.86	0	0.00
26310.	Paweł (uuyy)	4	92.03	102.78	2	50.00
26311.	Your (urtrashkid906)	4	70.07	79.73	4	100.00
26312.	Unsolved (unsolvedcypher)	4	117.73	137.78	3	75.00
26313.	Liozyyy (undead_zay)	4	76.14	80.72	2	50.00
26314.	Phin (uncleshelby)	4	107.32	118.67	2	50.00
26315.	uncal (uncalgg)	4	34.99	37.84	0	0.00
26316.	Marcos (ultizin)	4	58.24	65.38	0	0.00
26317.	Ultimate (ultimate_pootato)	4	81.27	84.50	1	25.00
26318.	Ting (t_mist)	4	77.54	84.15	0	0.00
26319.	Yan (tzunyan)	4	48.16	52.51	0	0.00
26320.	Katilin (type_casting)	4	97.91	112.48	2	50.00
26321.	typeracer2487 (typeracer2487)	4	94.61	97.59	1	25.00
26322.	Tynai (tynka)	4	26.38	28.53	1	25.00
26323.	(tyleryoung210)	4	112.72	121.70	3	75.00
26324.	DownOnMe (twindracula)	4	119.18	125.46	3	75.00
26325.	:/ (tweezers)	4	94.28	104.42	1	25.00
26326.	Teun (tve9)	4	74.67	77.76	2	50.00
26327.	Tuguldur (tuug_16)	4	43.53	47.57	4	100.00
26328.	Tushar (tushar_3)	4	69.76	72.81	0	0.00
26329.	Smyan (tunafish5555)	4	84.73	96.42	1	25.00
26330.	Abby (tuffbluff)	4	63.75	74.07	2	50.00
26331.	Zhapyr (tuchka)	4	43.92	49.98	0	0.00
26332.	D (tsaf_epyt)	4	52.17	64.97	1	25.00
26333.	Flavio Dai (tryonetry)	4	55.02	61.72	1	25.00
26334.	Trxnia (trxnia)	4	68.31	71.97	3	75.00
26335.	Taylor (trob388)	4	97.46	103.11	3	75.00
26336.	Tristan (tris_tan)	4	76.59	81.35	0	0.00
26337.	Tristan (trigg770)	4	66.06	74.14	1	25.00
26338.	Trigabyte (trigabyte)	4	121.40	132.86	4	100.00
26339.	Gowtham (triforceofpi)	4	75.85	83.06	2	50.00
26340.	Anton (tricksterequiem)	4	75.46	91.43	2	50.00
26341.	Tricia (tricia20)	4	41.34	42.93	1	25.00
26342.	Tristan (tribby)	4	38.48	40.79	2	50.00
26343.	Trevor (trevorstamour)	4	113.03	155.87	3	75.00
26344.	Trevor (trevman)	4	75.88	83.88	0	0.00
26345.	trepan (trepan)	4	107.42	121.69	2	50.00
26346.	Trap (trapv)	4	84.58	91.72	1	25.00
26347.	Daniel (trader29)	4	39.11	44.00	1	25.00
26348.	Tom (tomwoolf)	4	39.34	42.49	0	0.00
26349.	Thomas (tommy_wang)	4	93.56	99.74	1	25.00
26350.	Thomas (tommyspo)	4	82.12	89.23	1	25.00
26351.	Tom (tommydws)	4	70.25	72.43	0	0.00
26352.	Starfox (tommyhlu)	4	75.37	94.09	1	25.00
26353.	cod3hulk (tomave)	4	80.11	85.32	1	25.00
26354.	Thomas (tomathon)	4	92.01	97.29	1	25.00
26355.	Todd (toddism1)	4	57.44	61.74	2	50.00
26356.	Toni (toek)	4	64.22	68.51	0	0.00
26357.	Nathan (tna_typing)	4	35.83	40.28	1	25.00
26358.	Joseph (tn6mrawesome)	4	60.13	64.29	2	50.00
26359.	Takiur (tm0n3y)	4	43.71	47.89	0	0.00
26360.	Greg (titogreg)	4	90.19	102.80	0	0.00
26361.	tehmbot (timu)	4	110.65	126.32	3	75.00
26362.	0 (timswin)	4	61.51	77.62	1	25.00
26363.	Timothy (timataio)	4	100.66	109.77	2	50.00
26364.	Michael (tichaelman)	4	90.87	99.72	1	25.00
26365.	Othmane (tibicha)	4	52.25	59.56	0	0.00
26366.	Michael (tibbitin)	4	83.71	104.47	1	25.00
26367.	Chris (thrash3r)	4	112.98	117.66	2	50.00
26368.	Thomas (thomas_t)	4	83.41	91.12	2	50.00
26369.	Thnift (thnift)	4	89.15	97.70	1	25.00
26370.	Drug (thisisscandalous)	4	112.47	120.56	3	75.00
26371.	Thirdy (thirdsus)	4	62.75	67.59	0	0.00
26372.	Om (thiscuriousbeing)	4	46.23	49.85	1	25.00
26373.	WabberDabber (thingexplainer)	4	90.32	94.22	0	0.00
26374.	Gooper (thijswillemsen)	4	102.59	110.63	3	75.00
26375.	Cris (the_thesaurusrex)	4	59.88	66.02	1	25.00
26376.	John (the_miserable_omega)	4	80.92	85.22	1	25.00
26377.	the_faceless (the_faceless)	4	70.97	82.89	1	25.00
26378.	TheVan (thevan)	4	64.06	67.29	1	25.00
26379.	Josh (theunknownhero)	4	127.33	135.33	4	100.00
26380.	Subid (theslowtyper8)	4	66.95	74.49	1	25.00
26381.	Amogh (therealmog)	4	62.05	74.36	0	0.00
26382.	Milan (themilan)	4	47.70	50.31	0	0.00
26383.	The Marvello (themarvello)	4	50.98	57.25	0	0.00
26384.	Andrew (thelittleninja7)	4	93.14	106.17	2	50.00
26385.	Kyle (thekyle0)	4	71.42	75.12	0	0.00
26386.	K (thekman)	4	90.82	104.20	0	0.00
26387.	Thege (thegenericbanana)	4	132.76	139.31	3	75.00
26388.	theFurlong (thefurlong)	4	56.67	61.31	0	0.00
26389.	Blake (theengi321)	4	107.15	123.43	2	50.00
26390.	MrConvoluted (theduckman)	4	63.13	67.11	1	25.00
26391.	Adesh (thechosenadesh)	4	52.03	59.11	1	25.00
26392.	Me (thecanuck)	4	65.11	72.30	2	50.00
26393.	Ish (theblessedgalaxy)	4	83.87	90.14	3	75.00
26394.	Matt (the25thbam)	4	52.29	57.28	0	0.00
26395.	SkyleNexo (thaonenub)	4	95.11	102.71	1	25.00
26396.	funny (tesseractbeyond)	4	99.16	113.62	1	25.00
26397.	Terminal (terminall_07)	4	38.97	42.25	0	0.00
26398.	Tenshi (tenshi3_a)	4	69.80	77.98	1	25.00
26399.	Cactus (tehcrazycactus)	4	106.88	132.05	1	25.00
26400.	Tedward (tedward765)	4	104.58	108.01	2	50.00
26401.	William (tea_chan)	4	69.95	77.70	0	0.00
26402.	Teal (teal5)	4	49.81	60.03	0	0.00
26403.	Diego (tapetepato)	4	95.13	99.65	2	50.00
26404.	RC (tandiaman)	4	114.99	125.51	4	100.00
26405.	Tams (tamstams16)	4	62.93	70.54	2	50.00
26406.	taya (tamey0urimpala)	4	59.37	62.62	2	50.00
26407.	Joseph (tamejtm)	4	74.33	79.33	0	0.00
26408.	Taka (takatyper)	4	85.35	91.14	0	0.00
26409.	Tahsin (tahsin82)	4	65.93	74.28	2	50.00
26410.	Dominic (t4dominic)	4	87.64	92.45	2	50.00
26411.	Sara (s_sh)	4	58.46	65.81	2	50.00
26412.	Islam (s_l_m)	4	41.85	46.52	0	0.00
26413.	syuuu (syuuu)	4	120.06	123.38	1	25.00
26414.	Sydney (sydmarie)	4	120.91	136.72	3	75.00
26415.	swetha (swethaesp)	4	61.28	70.38	2	50.00
26416.	Sam (sweatycactus)	4	73.37	82.34	0	0.00
26417.	Evan (swang88)	4	101.05	108.63	1	25.00
26418.	Arvin Jay (sushisancat)	4	86.59	96.94	1	25.00
26419.	sushiwasabi (sushiwasabi)	4	96.79	104.57	3	75.00
26420.	Surya (suryapun)	4	67.27	72.03	0	0.00
26421.	Suraj03 (suraj03)	4	63.29	69.41	0	0.00
26422.	Marvin (super_nam)	4	63.33	69.22	1	25.00
26423.	sunny (sunnykr17)	4	37.65	43.43	0	0.00
26424.	Sunil (sunilbv)	4	76.69	92.33	2	50.00
26425.	Sunho (sunhokwon)	4	106.34	107.90	3	75.00
26426.	han (sunhelo1)	4	69.63	73.11	0	0.00
26427.	Andre (sundown765)	4	67.14	74.65	0	0.00
26428.	Sukritha (sukritha)	4	69.26	72.30	0	0.00
26429.	David (subpar_typing)	4	65.70	70.84	2	50.00
26430.	John (subarutato)	4	64.55	67.51	1	25.00
26431.	Suraj (suarj)	4	51.44	54.75	1	25.00
26432.	Ralph (stunnar)	4	75.83	81.23	0	0.00
26433.	Luke (stuartlittle6)	4	65.36	71.70	1	25.00
26434.	Erik (strezz)	4	107.92	118.48	2	50.00
26435.	asdas (strexle)	4	74.95	78.63	3	75.00
26436.	Ruben (streakwind)	4	109.78	122.60	4	100.00
26437.	Alex (stradivarius64)	4	80.12	102.97	1	25.00
26438.	Owen (stoveovenowen)	4	85.91	94.41	2	50.00
26439.	Tim (stormblock)	4	99.74	122.69	2	50.00
26440.	Zay (stiki_boi)	4	54.92	59.06	1	25.00
26441.	Shubham (stickyfingas)	4	50.67	58.32	0	0.00
26442.	John (stevie123)	4	82.33	91.39	1	25.00
26443.	Vít (stepky)	4	48.30	49.95	0	0.00
26444.	Marwan (steelman)	4	83.66	90.98	1	25.00
26445.	SServe (sserve)	4	82.99	88.19	2	50.00
26446.	Sra1 (sra1)	4	47.77	55.40	0	0.00
26447.	Spr_ingg (spr_ingg)	4	76.97	80.93	1	25.00
26448.	Enzo (springgs)	4	64.28	66.67	2	50.00
26449.	Devin (spratty)	4	105.87	121.80	1	25.00
26450.	B (sploops)	4	47.88	58.74	0	0.00
26451.	Autism (autismorigins)	4	83.77	105.05	1	25.00
26452.	ben (spirxt223)	4	100.27	105.73	3	75.00
26453.	aleksi (speedysmurffi)	4	92.92	102.67	0	0.00
26454.	SpeedySloth (speedyslothmeh)	4	65.50	74.05	2	50.00
26455.	Mohammad (speedyboi108)	4	93.28	105.62	1	25.00
26456.	. (speed1x)	4	81.40	91.76	1	25.00
26457.	CM (specialize)	4	81.76	89.59	3	75.00
26458.	SparkleFace (sparkle_face)	4	64.75	68.03	0	0.00
26459.	kosmonautas (spacepeasant)	4	45.57	51.25	0	0.00
26460.	viridiAn (spacedooky)	4	94.38	98.16	2	50.00
26461.	Mike (so_cool31220)	4	71.53	83.81	1	25.00
26462.	Souther (souther1)	4	68.83	71.52	3	75.00
26463.	Dan (sonixspeedster)	4	37.88	40.85	0	0.00
26464.	Lo (sonia0852)	4	57.02	65.10	2	50.00
26465.	Sondi (sondi2234)	4	67.90	77.52	0	0.00
26466.	Ethroc (someweirdcuck)	4	73.09	79.44	0	0.00
26467.	Lizard (somber_lizard76)	4	107.14	120.07	3	75.00
26468.	Phillip (solonjhee)	4	81.40	90.79	1	25.00
26469.	Spencer (soliloquial)	4	105.75	113.36	1	25.00
26470.	Brad (soldtheworld)	4	36.14	41.77	0	0.00
26471.	A (soh_cah_toa)	4	113.53	129.73	1	25.00
26472.	Soggy (soggyspartan)	4	53.85	60.18	0	0.00
26473.	SOGGY (soggybigbooty)	4	121.52	142.13	1	25.00
26474.	Lawn (sofusboisen)	4	76.42	79.76	2	50.00
26475.	Isaac (softwilly)	4	50.49	56.65	0	0.00
26476.	Sameer (socoolsameer)	4	81.69	98.86	1	25.00
26477.	Phoebe (snicklepickles)	4	99.53	101.50	2	50.00
26478.	Sm (sm12333)	4	77.39	79.94	0	0.00
26479.	SlyBlue (slyblue)	4	45.09	48.42	0	0.00
26480.	Ya (slow_typist123)	4	82.02	85.95	0	0.00
26481.	varkiziotis (slow_like_ribas)	4	96.03	102.03	2	50.00
26482.	Nom (slower_than_shrimp)	4	83.21	88.69	0	0.00
26483.	Nathan (slowbo12)	4	102.08	115.86	1	25.00
26484.	training hard (slj111)	4	103.80	113.55	3	75.00
26485.	slip (sliiiip)	4	114.42	127.65	1	25.00
26486.	Slickster (slickster_)	4	40.09	46.92	0	0.00
26487.	NAILs (sleepyt0wne)	4	56.09	64.66	0	0.00
26488.	Edward (slappyedward)	4	102.42	112.12	1	25.00
26489.	Noah (slankynoah)	4	101.25	107.88	4	100.00
26490.	GS PVH (skyvn97)	4	74.87	90.95	4	100.00
26491.	Skyer (skypeasant)	4	66.35	79.14	4	100.00
26492.	Skyler (skylrrr)	4	92.41	95.52	2	50.00
26493.	sam (skhavari)	4	78.75	88.61	1	25.00
26494.	Nikos (skatzos)	4	52.98	61.65	0	0.00
26495.	keith (skagod02)	4	83.47	89.94	0	0.00
26496.	Sithindu (sithsiri)	4	79.24	81.93	1	25.00
26497.	Lebron (sirsneakycheeks)	4	54.40	62.01	0	0.00
26498.	C (sirbop)	4	109.31	116.89	3	75.00
26499.	Simon (simco)	4	30.96	34.58	0	0.00
26500.	Fabulous (sim5501)	4	79.23	83.54	3	75.00
26501.	sillysyl (sillysyl)	4	53.82	59.00	0	0.00
26502.	Silen (silentyper)	4	94.32	109.86	3	75.00
26503.	Nick (sidj0n)	4	83.13	90.30	0	0.00
26504.	༄༊࿆Lazy (siddharthmmore)	4	74.05	77.58	2	50.00
26505.	Siavash (siavash3)	4	87.85	97.29	1	25.00
26506.	Shreyas (shrysptl22)	4	67.93	73.07	1	25.00
26507.	Alessandro (shrykull_scars)	4	68.31	77.22	0	0.00
26508.	Shrav (shravstars15)	4	63.32	70.37	0	0.00
26509.	Shiyyo (shiyyo)	4	115.17	126.75	2	50.00
26510.	Shiva (shivabalutia)	4	39.60	42.82	0	0.00
26511.	ShinyPants (shinypants7112)	4	79.93	85.50	4	100.00
26512.	gaf (shinryu1324)	4	109.25	113.80	1	25.00
26513.	shine (shine_3)	4	30.95	32.77	0	0.00
26514.	Elliott (shim3107)	4	110.81	123.68	1	25.00
26515.	Olav (shikkou)	4	90.68	115.64	3	75.00
26516.	ceejay (shijei)	4	102.26	113.87	0	0.00
26517.	Alec (shifty_py)	4	68.32	76.19	1	25.00
26518.	Stanley (shidanley)	4	85.15	91.18	1	25.00
26519.	(sherixn)	4	62.82	71.34	0	0.00
26520.	sheng (shenglol)	4	64.35	65.50	1	25.00
26521.	DiscordMod (sheevpalpatine66)	4	101.81	123.75	2	50.00
26522.	Shea (shea378)	4	75.65	89.61	0	0.00
26523.	Shayaan (shaynedoan)	4	77.94	90.87	2	50.00
26524.	shaun (shaunrtyu)	4	54.69	58.01	0	0.00
26525.	Jonathan (sharkeyyy)	4	84.88	93.62	0	0.00
26526.	shafay (shafay)	4	54.94	61.37	1	25.00
26527.	Shady (shadyhippo)	4	108.25	111.93	2	50.00
26528.	Edgar (sgtplasma)	4	74.92	91.80	1	25.00
26529.	SGpro (sgpro)	4	78.87	88.37	1	25.00
26530.	sean (sgdth)	4	101.84	118.43	1	25.00
26531.	Sezim (sezim20_12)	4	22.22	23.47	2	50.00
26532.	Diwangkoro (serperone)	4	108.94	115.33	2	50.00
26533.	hola (sensei_1st)	4	55.13	60.65	0	0.00
26534.	Sloth (senseisloth)	4	91.29	114.00	1	25.00
26535.	sensei455 (sensei455)	4	97.88	107.37	2	50.00
26536.	Senn (sennvacan)	4	34.17	36.04	0	0.00
26537.	Melody (selkie)	4	72.81	77.15	1	25.00
26538.	Adam (seleulu)	4	66.69	76.55	1	25.00
26539.	Ivan (seivo)	4	77.67	94.36	1	25.00
26540.	Seeking (seekingtotype)	4	55.45	63.50	0	0.00
26541.	Cedric (sedorikku)	4	98.57	102.52	0	0.00
26542.	Ani (secretary_ani)	4	119.12	124.09	3	75.00
26543.	Haerin buff (searsokvarkhim)	4	44.93	49.47	1	25.00
26544.	Krzysztof (scythonsoul)	4	84.64	93.90	1	25.00
26545.	Jinny (sctfgreentae)	4	47.20	50.99	0	0.00
26546.	Arjun (arjunnaidu)	4	43.57	47.67	0	0.00
26547.	arjayar (arjayar)	4	72.94	76.58	1	25.00
26548.	Arif (aripin_cmk)	4	81.17	85.41	1	25.00
26549.	Arturs (archey187)	4	97.16	108.52	2	50.00
26550.	Alex (arandazzo829)	4	110.57	129.45	2	50.00
26551.	Andrea (arachnedefiant)	4	110.47	113.78	2	50.00
26552.	Ara (aracelis)	4	50.80	57.45	1	25.00
26553.	TaeHyoung (aqweds1)	4	83.38	85.32	3	75.00
26554.	superfish (aprettysuperfish)	4	65.21	79.90	1	25.00
26555.	Adam (appeac)	4	94.00	104.15	3	75.00
26556.	Aoden (aoden)	4	75.11	94.65	0	0.00
26557.	Anxiete (anxiete)	4	50.38	56.55	1	25.00
26558.	(anumon6395)	4	107.10	112.15	2	50.00
26559.	Antogs (antogs)	4	96.27	106.49	2	50.00
26560.	Rafi (antirafi)	4	42.69	48.03	0	0.00
26561.	Antete (antete)	4	59.56	66.02	0	0.00
26562.	Ansh (anshr)	4	87.12	97.59	1	25.00
26563.	fastasf (anshisfast)	4	93.67	98.78	1	25.00
26564.	Ankush (ankushmishra)	4	56.16	63.89	0	0.00
26565.	Michael (angeles_cabilao)	4	107.31	114.95	4	100.00
26566.	Angela (angelaho40)	4	62.03	65.50	0	0.00
26567.	raf (anemonespotted)	4	96.36	103.59	3	75.00
26568.	andy (andypaling)	4	79.01	81.67	2	50.00
26569.	Oleksandr (andrusenko)	4	78.56	86.81	1	25.00
26570.	Evan (androidlegend)	4	91.25	105.63	2	50.00
26571.	A (andrewg124)	4	88.13	101.47	1	25.00
26572.	Andrew (andrew4763)	4	66.70	72.57	0	0.00
26573.	Andrés (and9686)	4	48.40	51.52	2	50.00
26574.	David (anakonda06)	4	47.80	51.24	1	25.00
26575.	amos (amoooss88)	4	96.44	98.52	2	50.00
26576.	Ammar (ammarsya4)	4	41.94	43.50	0	0.00
26577.	Md Aminul (ami_pronoy)	4	61.78	63.12	2	50.00
26578.	Amigo (amigom)	4	56.06	59.93	0	0.00
26579.	martin (amezquitamartin)	4	50.87	54.98	0	0.00
26580.	Amelie (amelierosemcd)	4	74.29	83.24	0	0.00
26581.	Ambrosia (ambiic)	4	77.28	85.58	1	25.00
26582.	Nick (alphaman3801)	4	97.37	105.04	3	75.00
26583.	Allen (allenxxx)	4	84.51	94.44	0	0.00
26584.	Ali (alirn76)	4	59.66	64.01	4	100.00
26585.	AlirezA (alirezaslayer)	4	81.70	88.08	2	50.00
26586.	alios99 (alios99)	4	44.39	48.33	0	0.00
26587.	Alina (alinag)	4	92.47	97.73	2	50.00
26588.	Alex (alex_575)	4	74.37	82.59	2	50.00
26589.	ig: __Alexxzh (alextyperop)	4	89.89	109.80	1	25.00
26590.	Alex (alexsun)	4	105.20	115.38	3	75.00
26591.	Alex (alexswearingen)	4	100.79	102.01	3	75.00
26592.	Alex (alexonboba)	4	58.24	62.37	4	100.00
26593.	Alex (alexkwon)	4	93.78	102.97	1	25.00
26594.	Alex (aleex)	4	75.20	81.36	1	25.00
26595.	Alcor (alcorinf)	4	66.22	70.84	0	0.00
26596.	Taiotox (albertosama)	4	51.84	56.47	0	0.00
26597.	Albert (albert239825)	4	90.03	97.85	2	50.00
26598.	rick (alaric_saltzman)	4	46.97	50.37	0	0.00
26599.	alan (alanlaw999)	4	63.65	82.90	2	50.00
26600.	Alan (alan2021233)	4	107.74	136.92	3	75.00
26601.	Akbar (akbarginanjar)	4	32.72	35.62	2	50.00
26602.	bit lee (akazed)	4	98.17	111.76	1	25.00
26603.	akash (akash__)	4	56.51	60.74	0	0.00
26604.	Akash (akashdeep_912)	4	36.87	41.11	0	0.00
26605.	Azad ul Kabir (akash455)	4	45.27	55.70	1	25.00
26606.	- (airplane100)	4	131.89	146.83	3	75.00
26607.	Aiden (aidmfc)	4	103.14	112.05	4	100.00
26608.	Aidan (aidanpr)	4	104.48	114.11	1	25.00
26609.	Aidan (aidan0829)	4	65.94	70.76	3	75.00
26610.	Ahmed (ahmed_emad21)	4	44.25	48.21	0	0.00
26611.	ahmed (ahmedadel2020)	4	60.95	66.10	1	25.00
26612.	Agilan (agilan2001)	4	74.96	77.64	1	25.00
26613.	Steven (agentsb024)	4	89.38	95.14	4	100.00
26614.	Afshin (afshin)	4	43.53	50.63	1	25.00
26615.	Jacob (adudethattypes)	4	89.51	103.33	4	100.00
26616.	ahmed (admica)	4	75.99	81.54	0	0.00
26617.	adityasaini (adityasaini)	4	80.76	91.64	1	25.00
26618.	RoadTo100 (adininoxyz)	4	74.31	84.31	0	0.00
26619.	Adi (adi321456)	4	83.54	97.61	1	25.00
26620.	Adam (adamhitchcock)	4	76.19	96.94	1	25.00
26621.	Adalyee (adalyee)	4	81.41	90.76	0	0.00
26622.	Адиль (ad1lek)	4	40.90	50.76	2	50.00
26623.	new keeb (achyut_tripathi)	4	72.00	75.55	0	0.00
26624.	Lukas (achertin)	4	96.64	111.99	3	75.00
26625.	Aiden (acer564)	4	123.22	133.54	4	100.00
26626.	Accurate (accurate_typer)	4	94.05	103.85	4	100.00
26627.	Nerd Typist (accuracy_goddess)	4	103.21	114.99	0	0.00
26628.	AccidentalGrenade (accident...	4	94.18	102.21	2	50.00
26629.	ABudgie (abudgie)	4	90.40	110.89	4	100.00
26630.	Abhi (abhishekdas1025)	4	33.09	34.40	0	0.00
26631.	Abada (abada)	4	64.22	69.43	0	0.00
26632.	Albert (aastefanov)	4	111.10	121.07	3	75.00
26633.	☺ AASHRU... (Business Ana...	4	104.22	110.02	2	50.00
26634.	Antoni (aaahello)	4	81.45	88.25	3	75.00
26635.	aqibzuhaini (a1mplayz)	4	105.20	118.48	4	100.00
26636.	vijay (950vijay)	4	64.97	71.39	0	0.00
26637.	Joe (8bitsmash)	4	69.67	73.50	2	50.00
26638.	Travis (7yl3r)	4	71.38	77.20	0	0.00
26639.	Thew (5_years_old)	4	116.80	126.52	1	25.00
26640.	Alex (5xlegend)	4	56.75	65.44	1	25.00
26641.	Elvira (5oap)	4	65.45	71.87	1	25.00
26642.	Timmy (547k4)	4	65.52	77.25	1	25.00
26643.	Ahmed (4hmed4dnan)	4	63.72	70.29	2	50.00
26644.	hugo (21_hugo)	4	107.37	122.72	2	50.00
26645.	Literature (20120623)	4	102.27	104.88	0	0.00
26646.	Vasilis (2004vas)	4	70.84	80.51	1	25.00
26647.	Kushveer (1nst1nct)	4	69.20	77.08	4	100.00
26648.	Justin (1mmure)	4	104.05	109.64	3	75.00
26649.	Heloa (1letterfromhell)	4	66.26	72.75	0	0.00
26650.	εiз (13uttercup)	4	111.11	131.45	3	75.00
26651.	Riley (0wned21)	4	69.24	75.60	0	0.00
26652.	ratgirl (0pter)	4	88.27	95.01	3	75.00
26653.	Joshua (0forphysics)	4	87.41	88.45	1	25.00
26654.	Luan (hungnn1094)	4	79.65	83.21	0	0.00
26655.	Bruno (yodidillybaggins)	4	117.42	132.78	2	50.00
26656.	sapix (lepordiswhite)	4	55.88	59.81	0	0.00
26657.	Jehovahtrashman (jehovahtra...	4	87.87	107.41	0	0.00
26658.	Jelly (jellyroll_derp)	4	73.00	79.80	2	50.00
26659.	Austin (unf0rgivable)	4	64.78	74.92	2	50.00
26660.	paragraph (paragraph)	4	62.05	72.39	1	25.00
26661.	Akil (para_ducks)	4	70.86	79.22	1	25.00
26662.	Adam (tripzz)	4	44.41	47.93	0	0.00
26663.	Jay (jay90)	4	60.72	65.82	0	0.00
26664.	Woosh (woosh_7)	4	70.93	91.37	2	50.00
26665.	Dusan (dukezyy)	4	61.74	68.08	1	25.00
26666.	Dennis (fredaroop12)	4	88.62	104.60	2	50.00
26667.	South (southbeastgaming)	4	99.33	119.78	2	50.00
26668.	Luis Ortiz (luenorju97)	4	87.74	93.04	0	0.00
26669.	Liana (liiiiiiaaaaannnnnaa)	4	94.04	102.64	2	50.00
26670.	Dark (darkwizard1980)	4	92.54	97.49	1	25.00
26671.	xAwwMan2010 (xawwman_winning_)	4	68.73	73.17	0	0.00
26672.	Sreenath (fledgingeagle)	4	63.40	66.89	0	0.00
26673.	Brad (bradstecker)	4	46.64	51.81	1	25.00
26674.	Yasser (ybeast02)	4	64.97	70.69	1	25.00
26675.	Pranjul (prankful)	4	72.58	86.50	1	25.00
26676.	Akshat (paneerbiryani)	4	85.82	97.37	1	25.00
26677.	pnd88 (pnd88)	4	101.75	115.82	4	100.00
26678.	Pavlos10 (alithinospavlakis...	4	70.75	78.52	2	50.00
26679.	Yama (yamalolz)	4	91.28	99.53	1	25.00
26680.	K1r4 (kira_o)	4	76.45	82.21	0	0.00
26681.	Vater (cpttezuka)	4	96.72	100.30	1	25.00
26682.	Не знам (justsoni)	4	76.62	83.40	4	100.00
26683.	Vilius (vilius5000)	4	79.35	82.65	3	75.00
26684.	Amoxcillin (j5098)	4	105.95	131.58	2	50.00
26685.	Andy (notclickbait)	4	78.19	94.25	1	25.00
26686.	enoch (eenoch)	4	31.56	33.99	0	0.00
26687.	Martin (martymcb)	4	56.56	61.86	0	0.00
26688.	Chase (creidinger)	4	73.40	81.98	2	50.00
26689.	Yew Lee (yewlee)	4	86.93	96.42	2	50.00
26690.	? (m_phisto)	4	68.18	72.62	2	50.00
26691.	Adam (soulberry)	4	27.26	30.91	2	50.00
26692.	tedro (sktedro)	4	82.96	88.68	1	25.00
26693.	Kyle (pikabear)	4	91.97	99.88	3	75.00
26694.	Perla (nunezperlaa)	4	43.72	48.90	0	0.00
26695.	Justin (jyhyim)	4	64.39	75.45	1	25.00
26696.	Sarah (charaliha)	4	67.88	69.25	0	0.00
26697.	John (jm12986)	4	65.47	72.22	1	25.00
26698.	Bamboo (pyramid322)	4	25.73	37.96	0	0.00
26699.	enhbold (enhbold)	4	82.45	86.88	1	25.00
26700.	zelsius (zelsius0)	4	37.20	38.23	0	0.00
26701.	Mack (alhawks)	4	85.37	107.47	2	50.00
26702.	jimmy (pringies)	4	85.27	89.53	4	100.00
26703.	Slava (slavah8)	4	93.66	97.83	0	0.00
26704.	Isaiah (jifaker)	4	44.46	54.22	3	75.00
26705.	Cailer (cailer)	4	99.36	109.89	2	50.00
26706.	qih (qih24)	4	56.03	62.16	2	50.00
26707.	Michael (meiner_223)	4	54.65	60.41	0	0.00
26708.	Azfa (zeinnaku)	4	45.60	47.64	1	25.00
26709.	Eason (imharuna)	4	75.20	85.10	1	25.00
26710.	Trent (beastchump)	4	70.32	74.46	1	25.00
26711.	Inuk (eskimogang2)	4	59.82	65.05	0	0.00
26712.	XiaoXie (xiaoxie)	4	51.30	58.39	0	0.00
26713.	Thanadol (thanadol_a)	4	58.13	66.71	4	100.00
26714.	ACARROT (acarrot)	4	91.70	101.00	0	0.00
26715.	Ben (losot557)	4	51.34	59.19	0	0.00
26716.	john (totoytikas)	4	56.88	63.82	0	0.00
26717.	Matt (mattdust)	4	82.46	97.48	1	25.00
26718.	Sabriya (sabri259)	4	108.03	115.20	4	100.00
26719.	Damani (slowguyy)	4	52.11	56.51	4	100.00
26720.	your (tytu23)	4	77.91	85.82	4	100.00
26721.	Colin (bliksem1212)	4	43.57	49.92	0	0.00
26722.	Raymond (lemong)	4	95.07	97.76	2	50.00
26723.	Mohamed (mido_haitham)	4	53.31	61.24	0	0.00
26724.	Tuguldur (tuxindahood)	4	58.43	63.14	0	0.00
26725.	Chris (coffeebeans)	4	63.97	66.13	1	25.00
26726.	Tomoya (oktomo011)	4	48.13	55.47	0	0.00
26727.	Cell (celluloidracer2)	4	67.91	74.46	1	25.00
26728.	Reem (reemyziz)	4	60.96	66.32	0	0.00
26729.	Jan Nosek (s1ngle_)	4	42.28	44.39	1	25.00
26730.	Harsh (yodenharsh)	4	74.45	80.16	4	100.00
26731.	Krexcent (krexcent)	4	100.81	122.12	3	75.00
26732.	Ezra (efernandeza)	4	95.50	110.30	1	25.00
26733.	Jun (thriftster)	4	69.37	74.66	1	25.00
26734.	Spencer (thundersalad)	4	100.37	107.32	3	75.00
26735.	Akhsan (haurieel)	4	48.45	49.92	0	0.00
26736.	LittleFrench (littlefrench)	4	76.35	80.66	1	25.00
26737.	K (kimk12071991)	4	69.34	79.48	2	50.00
26738.	Pyreon (pyreon)	4	87.24	99.37	1	25.00
26739.	no (manathai)	4	104.96	118.08	2	50.00
26740.	ikonikon (ikonikon)	4	59.57	68.26	0	0.00
26741.	chloe (picklea)	4	85.43	95.08	1	25.00
26742.	Matthew (skywaffle)	4	92.45	102.21	3	75.00
26743.	Pete (ple103)	4	81.52	84.44	2	50.00
26744.	Liam (piistol)	4	71.76	75.45	1	25.00
26745.	Koki (kokitnl)	4	58.83	61.47	0	0.00
26746.	Charbel (k12178)	4	98.55	108.64	0	0.00
26747.	N (niclashermansson)	4	69.83	80.45	0	0.00
26748.	shibal (balbz)	4	64.14	67.89	0	0.00
26749.	Shreshth (shoutingmonkey)	4	62.60	73.95	2	50.00
26750.	Ariel (achang8)	4	70.59	78.46	1	25.00
26751.	Ona (ona_27)	4	54.23	64.71	1	25.00
26752.	Tony (hexsymple)	4	85.83	93.71	2	50.00
26753.	Blaze (blitzbot)	4	50.61	55.36	1	25.00
26754.	MrManOnMars (mrmanonmars)	4	80.03	84.56	2	50.00
26755.	Chris (szidat)	4	60.75	69.66	1	25.00
26756.	bubby (bubbylol)	4	56.99	58.74	0	0.00
26757.	Scrub (scrubfn)	4	97.28	101.65	3	75.00
26758.	Caspar (jollofboy)	4	60.13	66.59	1	25.00
26759.	Jayke (jayke_narn)	4	94.65	102.43	2	50.00
26760.	Murariu (bucovina)	4	101.24	113.33	1	25.00
26761.	Nashu (nash0u)	4	46.38	58.35	0	0.00
26762.	Technaltech (506302147)	4	23.26	24.85	0	0.00
26763.	Ez (hnnh)	4	86.01	88.74	1	25.00
26764.	Hjálmar Ingi (molinnn)	4	47.31	51.11	0	0.00
26765.	Jordan (jordanfa)	4	76.81	81.01	1	25.00
26766.	Ben (bhmorse)	4	78.56	98.74	0	0.00
26767.	Aghastlobster (aghastlobster)	4	83.84	87.17	1	25.00
26768.	Ryan (yarn_is_fried)	4	49.88	52.99	0	0.00
26769.	Will (wsuter13)	4	97.94	111.81	4	100.00
26770.	khalil (kak_)	4	68.45	80.68	2	50.00
26771.	Nickpask (nickpask)	4	48.06	53.34	0	0.00
26772.	Tomás (duk47)	4	88.06	98.37	1	25.00
26773.	jungkook (bts_jungkook)	4	79.86	86.04	1	25.00
26774.	LeNNis (lennis)	4	60.41	74.27	0	0.00
26775.	Paul (polpolpol)	4	73.79	89.51	1	25.00
26776.	Meto (meto1337)	4	88.33	92.31	2	50.00
26777.	Ons (onsali20)	4	86.84	99.70	3	75.00
26778.	Garrison (garrison111)	4	76.17	86.06	1	25.00
26779.	ema (emav69)	4	70.92	74.36	1	25.00
26780.	Finn (finn22)	4	78.99	86.88	2	50.00
26781.	Justin (rainiak)	4	81.79	84.04	1	25.00
26782.	uWu (zatmir)	4	46.36	48.45	1	25.00
26783.	emily (emi_panda)	4	56.14	57.75	0	0.00
26784.	Sly (sly_wolf62)	4	94.19	105.97	2	50.00
26785.	Hynerd (skywalker190208)	4	38.31	42.46	0	0.00
26786.	Twisted (twistedyoyo20)	4	78.50	83.39	0	0.00
26787.	Tien (hinhid89)	4	44.51	53.84	0	0.00
26788.	Matt (duckrobin)	4	86.27	94.50	2	50.00
26789.	Sudipto (sudiptoshuvo)	4	64.35	77.10	2	50.00
26790.	Friday (meli0us)	4	84.54	94.05	4	100.00
26791.	mayyy (maybb)	4	67.96	72.75	0	0.00
26792.	Danilo (ddcj)	4	82.61	92.91	0	0.00
26793.	Oppyyy (oppyyy)	4	44.30	50.12	0	0.00
26794.	Bowen (bobobang2)	4	36.89	40.94	0	0.00
26795.	Paul (okonkwo9)	4	72.28	76.42	0	0.00
26796.	V (moonhiee)	4	71.54	84.87	2	50.00
26797.	K (netsukei)	4	80.32	91.11	3	75.00
26798.	Pandaemonium (pandaemonium)	4	86.08	93.62	3	75.00
26799.	Paul C (pccomputer)	4	69.35	72.81	1	25.00
26800.	One (morfar123)	4	75.42	80.28	4	100.00
26801.	Sams (sams_)	4	45.00	49.42	1	25.00
26802.	Gary (raresiren292)	4	45.02	50.32	0	0.00
26803.	Rahmone (rahmone)	4	94.18	98.39	2	50.00
26804.	Aria (ariamm)	4	48.96	58.75	0	0.00
26805.	j (atribecalledquest)	4	101.14	110.52	2	50.00
26806.	Anthony (therealdrum)	4	47.25	50.56	2	50.00
26807.	sam (tritoke)	4	78.93	83.56	1	25.00
26808.	Dario (dariolol)	4	61.06	68.78	1	25.00
26809.	Antonio (astaroth278)	4	51.80	54.61	1	25.00
26810.	Curiosity (im_koruto)	4	33.32	36.58	0	0.00
26811.	tanly (tanlyk)	4	53.49	58.84	0	0.00
26812.	JustSeeker (seeker_playz)	4	66.38	71.47	1	25.00
26813.	Crsytal (crystalfyre)	4	31.10	35.40	0	0.00
26814.	silvia (silvichu)	4	98.63	109.72	3	75.00
26815.	Harry (taylor23harry)	4	81.81	88.55	3	75.00
26816.	Blaze (blazw_real)	4	72.24	77.49	2	50.00
26817.	Micah (injury_upstairs)	4	54.18	59.73	1	25.00
26818.	Aaron (eunskim9)	4	110.44	121.13	2	50.00
26819.	Cubiss (cubiss)	4	80.49	87.21	1	25.00
26820.	Daredevil (prathameshparit)	4	60.72	66.50	1	25.00
26821.	Anthony (tonycalrya)	4	78.39	90.45	4	100.00
26822.	Lesky (leskalon)	4	79.55	85.84	1	25.00
26823.	Alex (aambro64)	4	74.12	80.32	0	0.00
26824.	Ape (fz3725)	4	83.12	85.61	1	25.00
26825.	zainelden (zain_22)	4	40.75	46.37	0	0.00
26826.	Tai (kronnn)	4	49.19	52.60	0	0.00
26827.	Damian (drroxx)	4	52.57	59.36	1	25.00
26828.	Eric (thysolar)	4	84.17	98.80	0	0.00
26829.	EerDick (eerdick)	4	80.46	91.12	1	25.00
26830.	Daniel (zetsuno)	4	76.71	86.16	3	75.00
26831.	Josiah (jojesus)	4	102.11	109.26	4	100.00
26832.	Gabriel (smileztypes)	4	96.36	111.19	1	25.00
26833.	Gareon (axolotlz)	4	47.98	55.64	1	25.00
26834.	Asami Sato (asamisato)	4	100.65	108.41	1	25.00
26835.	Alex (aaaaaaaa8)	4	52.78	57.33	1	25.00
26836.	Sahil (epsilon573)	4	57.61	61.25	4	100.00
26837.	chris (chrishuang)	4	93.13	103.14	0	0.00
26838.	martin cabello iii (marcodr...	4	103.19	112.55	2	50.00
26839.	R (s0401067)	4	71.33	74.51	3	75.00
26840.	rishi (zodi99)	4	51.56	55.66	0	0.00
26841.	Joshua (your_boi2249)	4	63.65	68.63	0	0.00
26842.	Zack (zlaskow)	4	92.25	97.44	3	75.00
26843.	Jack (backpack_jack)	4	65.67	71.30	1	25.00
26844.	Dan (dhogan)	4	75.55	89.91	0	0.00
26845.	Cory (takfull)	4	48.42	57.08	0	0.00
26846.	Ionescu (ihrom)	4	120.87	136.21	2	50.00
26847.	Fake Guest (cochodau)	4	81.94	92.05	2	50.00
26848.	Didoe (didoe)	4	77.79	82.47	0	0.00
26849.	fire (firemyballz)	4	71.19	79.26	1	25.00
26850.	Kush (kushmaster)	4	95.90	121.46	1	25.00
26851.	Creature247 (creature247)	4	51.27	59.06	0	0.00
26852.	vic (dexireds)	4	110.99	133.39	2	50.00
26853.	Chris (baigels)	4	64.98	77.02	0	0.00
26854.	Technoyams (pimplehead)	4	57.40	63.62	1	25.00
26855.	Tanner (phorox99)	4	112.87	122.59	2	50.00
26856.	Michael (derpymurloc)	4	83.13	92.15	0	0.00
26857.	Christian (modernfallacy)	4	72.52	76.97	0	0.00
26858.	aws (awsmate)	4	59.77	72.61	3	75.00
26859.	Lester (pokeaye)	4	89.98	103.03	1	25.00
26860.	Julian (lantrajul99)	4	88.60	95.27	1	25.00
26861.	Jennifer (bigbeanondiscord)	4	68.16	75.20	2	50.00
26862.	Adam (headtaker)	4	53.44	55.92	0	0.00
26863.	Pereira (pereirakawaii)	4	74.92	77.05	1	25.00
26864.	Bryan (brakuya888)	4	89.76	103.60	1	25.00
26865.	Maarten (toolateqt)	4	52.59	57.16	1	25.00
26866.	John (wilkieman)	4	70.75	93.24	3	75.00
26867.	Jason (jasonh34)	4	80.59	100.23	2	50.00
26868.	Socks (socksjap)	4	91.95	103.95	3	75.00
26869.	Sixhexes (sixhexes)	4	73.43	81.90	3	75.00
26870.	Stillian (deadnit1_)	4	88.97	104.73	2	50.00
26871.	Caden (cadeng1)	4	94.96	109.99	1	25.00
26872.	Abby (ab1gael)	4	52.51	57.31	2	50.00
26873.	whappened (axis_tilt)	4	80.01	94.17	3	75.00
26874.	Yeemail (yeemail)	4	77.34	85.46	2	50.00
26875.	Jigglytuft (jigglytuft)	4	90.22	96.06	1	25.00
26876.	Montexic (montexic)	4	81.94	95.47	1	25.00
26877.	Force (forcebuilder)	4	92.57	105.78	1	25.00
26878.	Sloth (slothgod)	4	83.24	91.50	4	100.00
26879.	Chulaluck (chulaa14)	4	83.40	92.63	0	0.00
26880.	Dahyun (datzu)	4	97.34	121.46	1	25.00
26881.	Nancy (nancyb5)	4	47.22	49.71	1	25.00
26882.	EmerDuck (emerduck)	4	31.06	37.38	0	0.00
26883.	Soumyajoy (soumyajoydas01)	4	39.69	40.69	0	0.00
26884.	JP (girkingume)	4	57.34	61.38	1	25.00
26885.	leo (leo_zaddy)	4	32.23	36.09	0	0.00
26886.	Paddy (weepaddy)	4	93.30	103.26	2	50.00
26887.	Joel (fiyinqbread)	4	57.82	63.33	1	25.00
26888.	zidbon (zidbon)	4	41.17	46.77	0	0.00
26889.	guest (privat)	4	67.29	71.18	1	25.00
26890.	Nectar (negtar)	4	43.24	49.93	0	0.00
26891.	Hinn (hxnn)	4	93.05	98.96	3	75.00
26892.	Mairon (mairont)	4	30.85	32.33	0	0.00
26893.	itsme_Subid (itsmesubid)	4	25.83	28.83	0	0.00
26894.	Kate (kgw11)	4	65.23	68.53	0	0.00
26895.	Aleksandar (bazzbuzzbazz)	4	54.04	58.28	1	25.00
26896.	Smriti (smritimdhr)	4	65.13	72.49	3	75.00
26897.	biscuit (biscuit112)	4	89.22	98.58	1	25.00
26898.	biscuits (veronicalo)	4	80.53	85.92	0	0.00
26899.	Zeek (zeekdeek)	4	73.23	77.49	1	25.00
26900.	Wasif (wasif_abtahi)	4	78.95	85.57	3	75.00
26901.	jessamine (jessaminer)	4	86.91	90.73	2	50.00
26902.	Nicholas (nuilifieds)	4	143.17	158.31	4	100.00
26903.	Wyanne (wyannethewat)	4	54.36	60.10	0	0.00
26904.	Luke (speedy7typer)	4	51.57	56.38	0	0.00
26905.	ShinPyro (shinpyro)	4	50.29	62.59	1	25.00
26906.	modred (modredias)	4	54.82	62.73	1	25.00
26907.	Darkshadow (darkshadow2312)	4	39.14	45.67	0	0.00
26908.	Jamie (fryo)	4	134.35	151.23	2	50.00
26909.	yo (fruitjuices)	4	88.00	98.30	2	50.00
26910.	Benjamin (frostdeee)	4	82.47	90.24	0	0.00
26911.	frontier64 (frontier64)	4	105.91	117.38	3	75.00
26912.	Logan (frigidgaming)	4	107.07	119.66	0	0.00
26913.	cj (frfrstopcappin)	4	47.31	52.13	0	0.00
26914.	typetard (frenchfriessalty)	4	72.76	79.93	0	0.00
26915.	Fray (frayazu)	4	73.94	80.37	1	25.00
26916.	Francesca (francesca34369)	4	104.81	112.33	4	100.00
26917.	Fourty (fractionals)	4	67.94	78.35	2	50.00
26918.	Razvan (forreckful)	4	128.76	137.74	3	75.00
26919.	lol (formulol)	4	107.76	135.46	2	50.00
26920.	Megan (foreverpurple)	4	67.66	72.23	0	0.00
26921.	Forestii (forestii)	4	48.93	50.57	4	100.00
26922.	Trương (fly1710)	4	36.38	40.24	0	0.00
26923.	Foster (fluzii)	4	111.03	119.03	2	50.00
26924.	aspen (flooot)	4	56.03	65.15	0	0.00
26925.	Florian (flodaking)	4	79.12	85.29	3	75.00
26926.	flavouredpig (flavouredpig)	4	85.80	102.85	2	50.00
26927.	Flap (flapk)	4	80.72	84.92	1	25.00
26928.	Keane (flaminbanana)	4	101.00	115.21	1	25.00
26929.	Youssef (flameyoyo64)	4	96.18	114.85	2	50.00
26930.	Erick (fishywasabi)	4	102.74	111.74	1	25.00
26931.	Brandon (fireinthesoul)	4	55.38	60.80	0	0.00
26932.	Lance (firball62)	4	106.91	116.54	1	25.00
26933.	Fast (filpix)	4	41.73	46.54	2	50.00
26934.	FIGBERT (figbert)	4	105.27	110.69	4	100.00
26935.	Trevor (fifty_eight)	4	58.77	65.61	0	0.00
26936.	Kalman (ferrmo)	4	61.91	64.01	2	50.00
26937.	Felipe Bell (felipebell)	4	59.52	64.99	1	25.00
26938.	S (fear4321)	4	122.32	139.32	2	50.00
26939.	Faster than (fasterthanshlok)	4	112.40	126.80	2	50.00
26940.	Fares (farfosi)	4	64.48	77.53	4	100.00
26941.	Taylor (falceb)	4	62.21	89.28	1	25.00
26942.	Fake Tree (faketree)	4	65.12	71.36	1	25.00
26943.	Steven (faiching89)	4	71.78	76.74	1	25.00
26944.	fae (faeswag)	4	89.24	96.33	2	50.00
26945.	Adam (ezrice)	4	54.67	61.50	1	25.00
26946.	E (ezet208)	4	67.48	83.78	0	0.00
26947.	Hans (extrem3typist)	4	93.58	109.35	0	0.00
26948.	Silas (experiencedcrafter)	4	53.88	58.76	1	25.00
26949.	Existence (existence_vip)	4	67.78	71.66	1	25.00
26950.	Riley (examinedrumble7)	4	93.42	103.65	4	100.00
26951.	Zagar (ewentuz)	4	26.57	31.23	0	0.00
26952.	Kyle (evilone2654)	4	87.63	92.07	4	100.00
26953.	rrt (even_faster)	4	85.41	91.58	2	50.00
26954.	Evanovache (evanovache)	4	53.95	63.86	0	0.00
26955.	Devin (eulertour)	4	93.09	103.12	1	25.00
26956.	Sinan (eul3r)	4	70.62	78.74	1	25.00
26957.	e10 (ethodo)	4	72.70	82.54	0	0.00
26958.	DiveDeep (ethanelm)	4	74.76	89.77	0	0.00
26959.	ET (etdreamsofsleep)	4	128.43	141.81	2	50.00
26960.	ESJvR (esjvr)	4	53.07	58.68	1	25.00
26961.	Nicholas (erpanter)	4	50.19	56.46	0	0.00
26962.	Erik (erikberik)	4	96.36	101.54	0	0.00
26963.	Eric (eric007)	4	86.91	99.41	2	50.00
26964.	Epic (epic360_boy)	4	61.75	69.96	0	0.00
26965.	Enrico (enricosrt)	4	87.70	97.10	1	25.00
26966.	Enderus (enderus)	4	64.16	67.15	1	25.00
26967.	Emil (emild90)	4	101.79	109.10	1	25.00
26968.	Ben (emeraldshield)	4	90.37	95.19	1	25.00
26969.	Keith (emblazin)	4	119.35	135.41	3	75.00
26970.	Emma (embi_)	4	50.75	53.89	1	25.00
26971.	Ethan (emanfrazier)	4	57.20	75.71	1	25.00
26972.	Elmouradi (elmouradiamine)	4	90.63	93.24	0	0.00
26973.	hello (elllowwww)	4	37.39	55.91	1	25.00
26974.	- (elliottmozley)	4	149.46	162.62	4	100.00
26975.	beth (elizabethbrantt)	4	92.75	97.22	1	25.00
26976.	elclid (elclid)	4	83.26	97.28	2	50.00
26977.	Telekonesis (eirchue)	4	149.20	158.88	4	100.00
26978.	eight (eight293)	4	72.94	75.76	1	25.00
26979.	Eli (eiervonsatan)	4	69.93	73.71	2	50.00
26980.	egork1dd (egorkidd)	4	84.04	88.92	1	25.00
26981.	Jack (eeeeeeeeeeeeeeeeeeeeeee)	4	70.11	82.31	1	25.00
26982.	edz (edz81)	4	90.32	104.93	2	50.00
26983.	Edith (edith44)	4	46.34	57.52	0	0.00
26984.	Eden (edenthompson)	4	88.97	99.11	2	50.00
26985.	Mahmoud (ec41513)	4	18.60	21.56	1	25.00
26986.	Afonso (eatotronic)	4	99.51	106.19	0	0.00
26987.	wazzzaah (dzejkobb)	4	87.04	99.04	3	75.00
26988.	Dylan (dylanjp)	4	50.88	60.55	2	50.00
26989.	Michael (dunsterville)	4	65.97	77.67	0	0.00
26990.	binh (dunkbing)	4	53.50	59.32	0	0.00
26991.	Albin (dunderalf)	4	68.22	71.25	0	0.00
26992.	Vinzel (dukeofweselton)	4	84.16	97.14	1	25.00
26993.	Flake (dukebiscko22)	4	82.84	90.83	0	0.00
26994.	Peter (duhburry)	4	115.84	126.50	2	50.00
26995.	duck (duckupus)	4	67.68	75.86	1	25.00
26996.	Duck (duckduckwhale)	4	89.69	102.86	2	50.00
26997.	TOfu (dubunism)	4	72.70	79.79	1	25.00
26998.	Nghĩa (dtnghia031199)	4	63.20	73.67	1	25.00
26999.	David (dstran)	4	88.28	103.08	4	100.00
27000.	davorin (dsego)	4	79.90	84.09	2	50.00
27001.	Semyon (dsa_ru)	4	37.87	42.26	0	0.00
27002.	dr (drpolish)	4	79.01	82.38	2	50.00
27003.	Kato (dreamy_soul)	4	61.42	67.81	3	75.00
27004.	Andreas (dray101)	4	71.98	83.48	1	25.00
27005.	Draven (dravenator)	4	82.15	94.76	4	100.00
27006.	Drake (drake251200)	4	96.21	108.12	2	50.00
27007.	RoundCustard (dragontunglam)	4	87.53	97.12	3	75.00
27008.	Ethereal (dragonfly654)	4	53.38	62.55	0	0.00
27009.	Draggun (draggun)	4	81.15	92.38	1	25.00
27010.	Double (doublemichael)	4	102.44	107.83	2	50.00
27011.	Glitch (dos_santos)	4	52.09	59.99	4	100.00
27012.	Burnt Piece (doomlad)	4	98.15	114.26	1	25.00
27013.	DoodieMan (doodieman)	4	48.19	56.63	0	0.00
27014.	bids (donuxes)	4	100.68	117.26	2	50.00
27015.	Hannah (donethat)	4	94.93	108.90	1	25.00
27016.	dond (dond_feller4)	4	80.22	91.77	3	75.00
27017.	DomeBoy (domeboy)	4	77.23	84.83	0	0.00
27018.	T (dolphintail902)	4	87.24	95.66	1	25.00
27019.	Andi (dolphingarlic)	4	91.12	93.50	2	50.00
27020.	edy (dogusyildiz)	4	54.02	63.52	2	50.00
27021.	Matteo (dogshitteo)	4	63.11	72.00	0	0.00
27022.	Doychin (dodosaurus)	4	71.07	77.50	1	25.00
27023.	Dode (dode_pep)	4	60.08	63.21	0	0.00
27024.	Adwyn (dkmplz)	4	135.88	150.91	4	100.00
27025.	Dabror (dk9mstar)	4	66.98	71.77	3	75.00
27026.	Bane (djex808)	4	94.07	97.56	1	25.00
27027.	Dhruv (djdhruv)	4	73.84	88.09	3	75.00
27028.	Joys (dj25808)	4	28.37	30.89	2	50.00
27029.	Divya (divya_16)	4	68.24	74.44	4	100.00
27030.	Brady (dittowog)	4	57.05	60.75	2	50.00
27031.	nathaniel (disbigspider)	4	40.28	42.40	0	0.00
27032.	Died273 (died273)	4	77.20	91.32	1	25.00
27033.	Mohcine (dictatox)	4	81.63	92.83	3	75.00
27034.	diana (dianitax)	4	72.03	80.44	1	25.00
27035.	HTT (diamond99007)	4	131.66	135.41	3	75.00
27036.	the shoe eater (devourer_of...	4	61.51	68.88	0	0.00
27037.	Devin (deviniity)	4	101.69	105.73	0	0.00
27038.	Vinay (devinay)	4	44.61	48.26	2	50.00
27039.	Desodred (desodred)	4	43.08	50.09	1	25.00
27040.	Desiigner (desiignerkekw)	4	66.74	77.61	0	0.00
27041.	Derryck (derryck)	4	76.57	81.60	3	75.00
27042.	Gabriel (derpydood)	4	78.31	80.16	2	50.00
27043.	David (depc)	4	68.44	73.06	3	75.00
27044.	Veeridel (del_234)	4	77.26	85.29	0	0.00
27045.	Typical (deltakoma)	4	71.28	74.69	1	25.00
27046.	Daniel (delixx1)	4	97.93	103.38	2	50.00
27047.	David (delkos)	4	103.15	109.07	2	50.00
27048.	FlyingFlamingo (deinna222)	4	108.78	119.07	1	25.00
27049.	Marco (deggamargo)	4	87.41	93.59	2	50.00
27050.	J (definetly_not_a_guest)	4	66.32	68.44	1	25.00
27051.	Neil (defecto)	4	115.29	124.94	3	75.00
27052.	Alex (deeseebro)	4	78.46	83.92	2	50.00
27053.	Deddie (deddie_1)	4	115.11	134.41	3	75.00
27054.	D (deathnoters)	4	105.90	114.60	3	75.00
27055.	DearCows (dearcows)	4	124.93	140.42	4	100.00
27056.	David (ddellspe)	4	99.91	108.97	2	50.00
27057.	David (davidpo)	4	67.00	75.47	1	25.00
27058.	Heyhou (david73)	4	93.88	98.79	1	25.00
27059.	David (davalav)	4	59.36	65.00	2	50.00
27060.	Darnell (darnell_2502)	4	77.29	81.08	1	25.00
27061.	Drake (dark_wing)	4	65.43	77.75	2	50.00
27062.	i cant type im trash (darkn...	4	95.45	104.45	3	75.00
27063.	Vasyl (dardhard)	4	60.61	70.93	0	0.00
27064.	DapperDjent (dapper_djent)	4	48.25	52.67	0	0.00
27065.	Daniel (danny_dvlpr)	4	64.21	74.10	1	25.00
27066.	Daniel (dannyxo)	4	107.52	109.78	1	25.00
27067.	Dannei (dannidarling)	4	58.16	65.22	0	0.00
27068.	Dankest (dankesttt)	4	101.32	114.66	0	0.00
27069.	Dani (daniespi)	4	48.68	54.16	3	75.00
27070.	DanielP (daniel504)	4	116.09	121.91	1	25.00
27071.	DangLin (dang_lin_wang)	4	64.32	70.75	2	50.00
27072.	DNGZ (dangiuz)	4	128.65	151.83	3	75.00
27073.	Andres (dandidandi)	4	66.15	70.70	1	25.00
27074.	DanCanDoIt (dancandoit27)	4	65.39	72.56	4	100.00
27075.	Danan (dananbookworm)	4	148.18	150.82	4	100.00
27076.	Dala (dalarifat)	4	94.28	107.65	3	75.00
27077.	Sam (dakiller234)	4	117.65	134.18	3	75.00
27078.	Daito (daitozen)	4	63.06	65.70	1	25.00
27079.	daisy_lilly (daisy_lilly)	4	42.18	54.22	0	0.00
27080.	I'm Slow : (daiplatinue)	4	44.52	53.01	2	50.00
27081.	david (dafearn)	4	133.42	159.48	3	75.00
27082.	Jonathan (daddyiz)	4	63.86	73.27	1	25.00
27083.	João (d4rkdreamspt)	4	45.60	53.12	0	0.00
27084.	Dahlia (d4hli4)	4	72.27	75.65	1	25.00
27085.	Dom (d0m_)	4	69.48	73.45	1	25.00
27086.	yamitori (czas)	4	36.61	37.48	4	100.00
27087.	Cyxone (cyxone)	4	91.63	109.57	2	50.00
27088.	c (cvu24)	4	77.14	81.44	0	0.00
27089.	Ricky (cutlert)	4	69.48	73.23	1	25.00
27090.	Alex (cush_palace)	4	54.17	61.07	0	0.00
27091.	Colin (cuken)	4	108.12	114.72	4	100.00
27092.	Seth (cucookid)	4	101.91	102.51	3	75.00
27093.	Jon (cuber1)	4	42.27	44.55	1	25.00
27094.	Csutka (csutkabali)	4	48.87	55.84	0	0.00
27095.	S (cryten56)	4	81.68	89.59	0	0.00
27096.	Crystallyen (crystallyen)	4	59.30	67.42	1	25.00
27097.	zzRouxfop_ (cryptic_blade)	4	90.13	103.14	0	0.00
27098.	audrey (crustish)	4	110.57	116.10	4	100.00
27099.	Crown (crownmp)	4	49.16	56.57	0	0.00
27100.	Nate (critic)	4	68.57	78.37	0	0.00
27101.	Beqa (crimsy8)	4	94.75	104.04	0	0.00
27102.	Sike (creme_egg)	4	87.38	93.46	3	75.00
27103.	Crazzor (crazzor)	4	88.38	101.45	2	50.00
27104.	BeckerGames.com (crazyninja...	4	96.67	104.77	1	25.00
27105.	Ryan (cratis)	4	58.24	63.50	1	25.00
27106.	CrackedEight (crackedeight)	4	61.37	69.95	1	25.00
27107.	Prajna (cptdeka10)	4	67.58	75.66	1	25.00
27108.	Spyros (covertcommunist)	4	71.27	83.60	2	50.00
27109.	Cory (cory421)	4	89.72	99.63	3	75.00
27110.	Coraline (coralinebutton)	4	49.05	50.48	0	0.00
27111.	Kacper (coomkacz12345678)	4	40.96	48.31	0	0.00
27112.	Meghan (coolmegmc)	4	95.40	101.46	3	75.00
27113.	lol (coolkid55)	4	43.73	52.33	1	25.00
27114.	SOme (coolhacker420)	4	46.26	49.61	0	0.00
27115.	Connor (connor12568)	4	108.49	112.11	4	100.00
27116.	chloe (comradebiden)	4	87.00	97.84	2	50.00
27117.	Twix (commit147)	4	46.34	52.22	1	25.00
27118.	Amin (collypso)	4	70.38	85.36	1	25.00
27119.	Martin (codetheidiot)	4	105.51	116.06	2	50.00
27120.	codding (codding_beast)	4	52.62	54.85	0	0.00
27121.	Tamie (cocota2)	4	73.50	80.34	2	50.00
27122.	Justin (cocok97)	4	71.66	75.99	2	50.00
27123.	Caitlin (cmonjeau)	4	122.33	139.28	4	100.00
27124.	rachel (clxudyss)	4	106.12	121.78	2	50.00
27125.	Foster (clovexr)	4	51.82	54.48	0	0.00
27126.	Ryan (cloutmasterz)	4	60.48	68.84	2	50.00
27127.	Barry (cloolboy)	4	80.34	88.53	1	25.00
27128.	clock (clockq)	4	48.35	51.08	1	25.00
27129.	Ethan (clobbster)	4	66.15	71.36	1	25.00
27130.	Clawzer (clawzer)	4	103.41	107.89	1	25.00
27131.	Claire (claireeeieie)	4	89.62	97.93	0	0.00
27132.	clarz (claerchen)	4	51.22	57.56	1	25.00
27133.	charlie (ck840204)	4	59.63	64.98	1	25.00
27134.	CJ (cjcurata)	4	64.86	67.35	1	25.00
27135.	Circlestrafin (circlestrafin)	4	93.94	97.90	3	75.00
27136.	Ciontel (ciontel)	4	76.77	86.34	0	0.00
27137.	cimbraien (cimbraien)	4	102.98	109.86	3	75.00
27138.	Ciarbin (ciarbin)	4	65.49	72.05	0	0.00
27139.	Chy (chy_)	4	81.71	95.74	0	0.00
27140.	chyzellechan (chyzellechan)	4	49.31	60.54	0	0.00
27141.	(chugjugwithyou)	4	124.01	143.60	3	75.00
27142.	Martin (chubbinub)	4	72.93	79.32	1	25.00
27143.	Dilly (chronixz)	4	76.99	81.61	0	0.00
27144.	Chrome (chroman00)	4	92.58	96.84	1	25.00
27145.	Hello (chroma56)	4	58.12	62.24	1	25.00
27146.	Christian (christiangodtdm)	4	94.71	100.63	3	75.00
27147.	Chris Klenø (chrisnk)	4	194.26	199.94	3	75.00
27148.	Chris (chrisljiang)	4	99.61	117.16	1	25.00
27149.	Julie (chowoww)	4	113.91	129.52	2	50.00
27150.	ChocoDoco (chocodoco)	4	68.57	71.96	2	50.00
27151.	Chittaarth (chitt09)	4	55.40	66.21	4	100.00
27152.	Tommy (ching_wong_un)	4	56.45	63.04	0	0.00
27153.	CHICKENWINGCHILD (chickenwi...	4	50.68	53.27	0	0.00
27154.	Eirik (chickenboomer)	4	81.08	89.44	2	50.00
27155.	Chi (chichung91)	4	91.90	97.25	2	50.00
27156.	TouchTyping (cheesticks)	4	76.23	94.04	2	50.00
27157.	charegg1127 (charegg1127)	4	94.15	107.41	1	25.00
27158.	Free Palestine (chaoticorder)	4	80.82	94.36	2	50.00
27159.	Chaos (chaosfyre)	4	61.89	69.26	1	25.00
27160.	Divyanshu (chakanshu)	4	21.81	31.72	0	0.00
27161.	Cooper (cglavin)	4	99.42	107.30	4	100.00
27162.	Lukas (cerilious)	4	69.48	73.99	0	0.00
27163.	Ceptlog (ceptlog)	4	55.64	64.66	0	0.00
27164.	Chris (cdyson1313)	4	50.16	56.02	0	0.00
27165.	Mitch (cbfworkin)	4	94.13	99.40	1	25.00
27166.	bea (cbeae)	4	98.21	107.52	3	75.00
27167.	Cavouc (cavouc)	4	74.43	78.86	2	50.00
27168.	Catroomba (cat_roomba)	4	101.08	111.31	2	50.00
27169.	coal_town (cat_guy)	4	104.97	111.25	3	75.00
27170.	Denis (carvedseven)	4	88.41	91.76	1	25.00
27171.	Carter (cartersaechao92)	4	84.22	105.98	1	25.00
27172.	Speedy Cici (carmur)	4	99.60	101.96	3	75.00
27173.	CarelessInternet (carelessi...	4	89.60	95.48	1	25.00
27174.	Gggreg (cardriver)	4	53.94	56.56	1	25.00
27175.	Mason (captainmom7)	4	106.78	116.52	3	75.00
27176.	CapoAgus (capoagus)	4	97.11	107.02	1	25.00
27177.	Bumbly (canextro)	4	93.77	113.26	3	75.00
27178.	Lili (candazaac)	4	63.10	68.46	0	0.00
27179.	dakota (camissonia)	4	103.82	109.26	2	50.00
27180.	Cameron (cameron_friday)	4	78.27	87.93	1	25.00
27181.	Cam (cambrown)	4	101.23	111.90	3	75.00
27182.	kolja (callmemink)	4	72.11	78.77	1	25.00
27183.	celine (cald)	4	81.11	91.78	1	25.00
27184.	Mary (calamary)	4	100.08	111.40	1	25.00
27185.	Chelsea (cakeling)	4	100.84	108.75	3	75.00
27186.	Piplup (caitcat)	4	106.06	121.62	3	75.00
27187.	Alexander (caesarsgambit)	4	76.53	81.65	0	0.00
27188.	Cactusmon (cactusmon)	4	92.79	105.48	1	25.00
27189.	Chris (cactichris123)	4	53.89	77.97	3	75.00
27190.	ButTtTKiccKeRr (buttkickker)	4	72.41	82.00	2	50.00
27191.	BupsterWavelength (bupsterw...	4	117.34	130.49	2	50.00
27192.	Paul (bunkerking)	4	88.22	99.88	1	25.00
27193.	András (bundikah)	4	63.56	72.73	3	75.00
27194.	Bunda (bundapump)	4	100.40	109.19	4	100.00
27195.	bie (bumblebie)	4	117.00	121.32	3	75.00
27196.	zafreeti (budexxx6)	4	47.35	55.26	0	0.00
27197.	Ella (bubble0176)	4	86.44	94.21	0	0.00
27198.	getnthr (bspur11)	4	39.83	43.29	0	0.00
27199.	Inigo (brotheringo)	4	79.08	83.88	1	25.00
27200.	Ibs (brjoker)	4	73.21	79.53	3	75.00
27201.	Britney (britney1550)	4	70.85	79.79	2	50.00
27202.	(bribe)	4	140.64	150.40	4	100.00
27203.	Brian (briandawn)	4	61.89	70.07	1	25.00
27204.	brianbear (briand724080)	4	148.42	155.07	4	100.00
27205.	b (brgr2022)	4	78.55	80.27	1	25.00
27206.	Brent (brentdrns)	4	89.56	99.18	2	50.00
27207.	Vincent (breadcheese2021)	4	66.68	78.99	1	25.00
27208.	Brantly (brantlyd)	4	108.63	113.66	2	50.00
27209.	Brandon (brandonjcox)	4	72.87	82.31	0	0.00
27210.	Brandon (brandonabsent)	4	45.21	57.25	0	0.00
27211.	Abel (brainstorm122004)	4	74.19	80.47	1	25.00
27212.	Bradley (bradleyjohnson)	4	47.33	53.71	0	0.00
27213.	brad (bradacook)	4	47.91	50.59	1	25.00
27214.	peemer (bot00014)	4	64.13	68.14	0	0.00
27215.	Your (bossspy75)	4	87.41	91.19	1	25.00
27216.	Ryan (bossmanryan)	4	113.05	121.92	3	75.00
27217.	Bosko (bosko)	4	98.95	105.22	0	0.00
27218.	boppin (boples)	4	62.03	70.21	0	0.00
27219.	Sanju (boomier)	4	68.00	71.26	1	25.00
27220.	Andriy (bonbonita)	4	68.10	73.35	1	25.00
27221.	bool3max (bolemax)	4	113.80	120.87	2	50.00
27222.	Bolam Blom (bolam_blom)	4	64.28	68.04	0	0.00
27223.	Anton (boisingkit)	4	81.96	90.43	1	25.00
27224.	Bog (bogdanovix)	4	88.64	99.44	1	25.00
27225.	Bob (bobthethird)	4	76.56	81.09	2	50.00
27226.	Bobross (bobrossrtx)	4	74.38	77.62	1	25.00
27227.	Mathias (bluecolibri)	4	52.97	55.30	0	0.00
27228.	bloop 💫 (bloopedyblap)	4	108.46	130.58	1	25.00
27229.	bla3oss (bla_3oss)	4	47.73	54.30	0	0.00
27230.	Blatzien (blatzien)	4	98.59	111.24	1	25.00
27231.	Blank (blank28)	4	48.89	61.51	0	0.00
27232.	David (bisbalian)	4	58.50	61.48	1	25.00
27233.	BinsentKarlo (binsentkarlo)	4	74.73	82.60	2	50.00
27234.	B (billus)	4	110.21	123.42	0	0.00
27235.	William (billiam98)	4	45.68	55.55	0	0.00
27236.	Mini.S (billbang6)	4	95.52	101.86	3	75.00
27237.	Terry (big_tarray)	4	95.46	103.93	3	75.00
27238.	Big (bigsmokeracer)	4	91.57	101.47	1	25.00
27239.	Big (bigpoorboy)	4	91.93	100.98	3	75.00
27240.	Big Ole Deezer (bigoledeezer)	4	92.49	112.32	1	25.00
27241.	John (bigjohn7256)	4	61.80	71.71	2	50.00
27242.	Banana__Plant (bibinprakash)	4	61.16	64.99	1	25.00
27243.	Pavle (bezimeni04)	4	53.91	58.42	1	25.00
27244.	Tatum (beryl_bee)	4	67.78	77.35	0	0.00
27245.	berry (berryroseblood)	4	70.02	76.90	1	25.00
27246.	Bernie (berniesanders69)	4	51.45	54.53	2	50.00
27247.	Ben (benw12)	4	84.62	95.84	1	25.00
27248.	Benji (benjibennick)	4	95.98	105.32	0	0.00
27249.	Benjamin (benjaneb)	4	62.89	71.63	0	0.00
27250.	Benjamin (benjaminwu)	4	132.40	140.89	4	100.00
27251.	Nikhil (benesch)	4	126.58	133.65	2	50.00
27252.	Believer09 (believer09)	4	47.24	50.98	0	0.00
27253.	Bekzat (bekzat_abdikarimov)	4	42.50	56.61	0	0.00
27254.	Belarus (belarus03)	4	52.08	55.64	1	25.00
27255.	jason (bekster_)	4	70.00	75.60	1	25.00
27256.	Asylkhan (beeppuck)	4	62.68	66.27	0	0.00
27257.	Billy (beel00)	4	107.18	111.26	0	0.00
27258.	Naren (bearcum)	4	103.46	111.64	2	50.00
27259.	bbdnoir (bbd_noir)	4	60.24	68.72	0	0.00
27260.	Boris (bb667)	4	124.43	134.92	1	25.00
27261.	JOHN (bb5k)	4	106.99	114.78	2	50.00
27262.	Zak (bazingazak_v2)	4	88.35	95.71	1	25.00
27263.	pebble (baumkuchen)	4	66.60	73.49	1	25.00
27264.	Batstark (batstark)	4	61.97	64.11	0	0.00
27265.	David (barrard)	4	45.28	48.89	0	0.00
27266.	Rolling Thunder (barkingside)	4	87.45	90.23	0	0.00
27267.	Harsit (baral)	4	100.62	115.73	2	50.00
27268.	Anhar (bantharfanta)	4	77.83	86.37	3	75.00
27269.	Banana (banmanan)	4	85.68	87.57	0	0.00
27270.	bananabonger (bananabonger)	4	146.64	165.54	3	75.00
27271.	ok (banadagril)	4	65.08	73.27	0	0.00
27272.	Balazs (balazs11)	4	62.92	73.74	0	0.00
27273.	Rahul (badrii)	4	54.12	58.89	0	0.00
27274.	Billy (badbikes)	4	95.63	113.51	3	75.00
27275.	Andrew (baconpapi)	4	60.24	66.36	0	0.00
27276.	b1otch (b1otch)	4	41.21	46.53	1	25.00
27277.	Danil (a_str0)	4	80.85	83.74	0	0.00
27278.	A (a_goldfish)	4	87.32	94.91	2	50.00
27279.	Azri Akmal (azriakmalk)	4	59.68	68.95	1	25.00
27280.	Azn (aznrayxz)	4	80.68	90.43	1	25.00
27281.	Azimjon (azimjon)	4	30.40	33.18	0	0.00
27282.	Azikiro (azikiro)	4	105.91	128.52	1	25.00
27283.	Azhar (azharnawaz)	4	76.13	81.37	2	50.00
27284.	Axzyte (axzyte)	4	127.56	139.03	3	75.00
27285.	Max (axe_)	4	62.73	66.36	2	50.00
27286.	Axeor (axeor)	4	50.75	55.32	1	25.00
27287.	blop (axemalt)	4	119.85	125.23	4	100.00
27288.	Alexa (axela33)	4	113.38	125.85	0	0.00
27289.	Avi (avir)	4	60.61	69.08	0	0.00
27290.	NANI (aurimuxasltgg)	4	84.03	89.43	2	50.00
27291.	Yury (auaster)	4	60.62	66.96	0	0.00
27292.	AtomToast (atomtoast)	4	71.47	75.35	2	50.00
27293.	Rikard (atmoscube)	4	77.85	88.45	0	0.00
27294.	Athanasia (athanasialaras)	4	79.39	82.50	1	25.00
27295.	T^T (asylumchess)	4	88.54	103.55	1	25.00
27296.	Xeo (astroloser)	4	65.38	72.11	1	25.00
27297.	Kadra Don (assem07)	4	37.40	40.37	1	25.00
27298.	asottile (asottile)	4	94.66	111.19	1	25.00
27299.	marley (asianwonton)	4	96.88	102.76	2	50.00
27300.	Hannes (asiansticka)	4	64.36	71.12	1	25.00
27301.	Andrew (asianpenguin2)	4	79.86	89.53	1	25.00
27302.	Timmy (asianhacker9000)	4	64.24	78.11	0	0.00
27303.	Kerschel (asdfjklsemic0lon)	4	104.49	117.32	1	25.00
27304.	Mahesh (asc_91)	4	52.87	55.72	0	0.00
27305.	Mike (ascential)	4	100.68	111.74	3	75.00
27306.	Artemis (artemis64)	4	82.40	87.13	2	50.00
27307.	Maarten (arteeh)	4	60.48	92.50	1	25.00
27308.	Arsen (arsijo)	4	46.80	52.97	0	0.00
27309.	Arsa (arsa2312)	4	74.38	81.11	1	25.00
27310.	Arman (armashka_)	4	46.77	58.25	0	0.00
27311.	Jorge (armando_villatoro)	4	43.40	54.20	0	0.00
27312.	Logan (fudge500)	3	82.90	86.12	1	33.33
27313.	MOON (frozenmoonage)	3	98.53	111.97	0	0.00
27314.	Henry (frostyedits)	3	101.96	106.54	2	66.67
27315.	Thomas (froskeprinsen)	3	49.52	52.05	1	33.33
27316.	friwerowsky (friwerowsky)	3	93.05	96.52	2	66.67
27317.	freemind1992 (freemind1992)	3	53.95	62.76	1	33.33
27318.	Freddy (fredyael)	3	43.58	47.07	2	66.67
27319.	Meow (franklin31113)	3	86.48	90.63	1	33.33
27320.	Frank (frankiboi)	3	54.51	56.20	1	33.33
27321.	Fprase (fprase)	3	73.50	87.38	1	33.33
27322.	Tony (forthawhur)	3	117.31	127.58	2	66.67
27323.	Forb. (forbearance)	3	119.65	130.91	2	66.67
27324.	Zeb (foghorn)	3	88.30	95.14	2	66.67
27325.	Chris (fogcityroller)	3	117.99	126.86	2	66.67
27326.	Francesca (fmbuckley)	3	66.58	76.63	1	33.33
27327.	Byte_Zero (flo_one)	3	67.06	72.07	0	0.00
27328.	d (flindocks)	3	82.35	86.16	0	0.00
27329.	Flex (flex_luthor)	3	69.22	71.29	2	66.67
27330.	Rachael (fleefloop)	3	41.22	46.43	1	33.33
27331.	Kevin (flash98765)	3	85.02	90.85	3	100.00
27332.	Hannah (flambewater)	3	72.84	74.18	1	33.33
27333.	Michael (fl4mx)	3	133.32	148.59	3	100.00
27334.	Chanson (fistarmeister)	3	96.76	100.21	2	66.67
27335.	fistedpancake (fist3dpancake_)	3	92.02	96.53	2	66.67
27336.	fishmatt (fishmatt)	3	89.95	107.41	3	100.00
27337.	firedarkS (firedarks)	3	108.10	115.24	1	33.33
27338.	Nolan (finny210)	3	69.34	75.13	1	33.33
27339.	Fingers (fingersgofast)	3	127.01	131.98	2	66.67
27340.	Philis (fillegunnar)	3	41.42	45.06	0	0.00
27341.	Filip (filis93)	3	109.21	118.62	3	100.00
27342.	Filicia (filicia)	3	53.80	55.48	0	0.00
27343.	filassy (filassy)	3	95.55	109.75	1	33.33
27344.	figher2016 (fighter2016)	3	71.87	81.44	0	0.00
27345.	Andi (fianputra157)	3	60.70	67.18	0	0.00
27346.	Chris (fhondubity)	3	123.62	125.41	3	100.00
27347.	Feliks (fgpfelix)	3	54.06	54.43	0	0.00
27348.	Daniel (fflake)	3	79.10	90.59	0	0.00
27349.	Jeff (ffej5333)	3	70.81	76.81	0	0.00
27350.	Kenneth (feyro)	3	70.94	78.72	3	100.00
27351.	Ferotiq (ferotiq)	3	86.17	99.86	1	33.33
27352.	Diego (fenderthelion)	3	53.17	55.22	0	0.00
27353.	Heather (feedtheflames)	3	86.93	98.96	1	33.33
27354.	Feb (feb_ryan)	3	49.39	54.12	1	33.33
27355.	Featfox (featfox)	3	91.17	97.33	0	0.00
27356.	Travis (fcdrummer01)	3	81.18	87.93	0	0.00
27357.	Fred (fblue)	3	76.76	103.11	1	33.33
27358.	Nathan (faustytr)	3	81.16	92.52	2	66.67
27359.	Faurazeko (faurazeko)	3	60.31	66.04	1	33.33
27360.	FatCat (fatcat2)	3	99.40	102.45	2	66.67
27361.	amy (fasttrainchoochoo)	3	98.34	100.17	2	66.67
27362.	zawa9 (faston)	3	41.00	48.18	1	33.33
27363.	Haji (fart_dude)	3	62.22	65.21	0	0.00
27364.	farlig (farlig1)	3	95.69	103.78	2	66.67
27365.	Fathan (falonez)	3	51.69	58.69	0	0.00
27366.	fakakon (fakakon)	3	71.44	73.83	2	66.67
27367.	Faith (faithy3)	3	104.64	113.02	2	66.67
27368.	Faisal (faisal0)	3	67.23	74.04	1	33.33
27369.	Tyler (failuretolaunch)	3	46.29	49.73	0	0.00
27370.	(fafadoodle)	3	130.71	146.05	3	100.00
27371.	Hikaru (fadilach)	3	87.06	103.39	3	100.00
27372.	FadesHandle (fadeshandle)	3	67.26	74.24	1	33.33
27373.	Facundo (facundof13)	3	86.69	105.42	1	33.33
27374.	AmauryM (facepalmtyping)	3	75.99	78.21	2	66.67
27375.	f4ww4z (f4ww4z)	3	90.85	95.23	1	33.33
27376.	eyeliddy (eyeliddy2)	3	93.82	98.04	2	66.67
27377.	dustin (eyedi)	3	96.02	107.57	1	33.33
27378.	Exxon (exxon)	3	75.56	83.44	1	33.33
27379.	EXTREMEBEAST537 (extremebea...	3	56.36	59.90	1	33.33
27380.	Casey (ewoozy)	3	56.44	66.49	1	33.33
27381.	Edward (ewc340)	3	96.57	100.78	1	33.33
27382.	Ed (ewardabaus)	3	142.66	154.93	3	100.00
27383.	EvJ (ev_j)	3	91.08	96.61	0	0.00
27384.	Gray (evlyra)	3	107.43	112.63	3	100.00
27385.	Evan (evennumber2)	3	67.12	77.33	0	0.00
27386.	eugene (eugenethreat)	3	106.72	121.53	1	33.33
27387.	followme (ethish)	3	54.79	63.31	1	33.33
27388.	etherene (etherene)	3	59.28	70.48	0	0.00
27389.	blueturtle (esraels)	3	84.94	89.56	0	0.00
27390.	Shikigami (ersunema)	3	53.92	56.88	0	0.00
27391.	Error (errorws)	3	97.40	98.70	3	100.00
27392.	Erik (erky1952)	3	112.34	120.79	2	66.67
27393.	Jon (erikzh)	3	56.68	57.41	0	0.00
27394.	Eric (ericyau82)	3	40.13	41.77	0	0.00
27395.	Erick (erickp32)	3	75.88	85.51	0	0.00
27396.	erayser (erayser)	3	97.88	104.06	0	0.00
27397.	Ruda (epic_333)	3	71.28	72.47	0	0.00
27398.	Andrew (epiandrew)	3	93.10	100.64	1	33.33
27399.	EonDuoLatios (eonduolatios)	3	84.97	86.24	3	100.00
27400.	Enrrique (enriqu3714)	3	61.99	68.00	1	33.33
27401.	Nathaniel (engage)	3	85.71	87.06	2	66.67
27402.	EnderMite (endermite)	3	70.73	76.42	1	33.33
27403.	Empirix (empirix)	3	85.47	90.95	0	0.00
27404.	emily (emmyentropy)	3	65.93	77.08	0	0.00
27405.	EmiRoseMoore (emirosemoore)	3	105.05	128.67	2	66.67
27406.	Ethan (eminum99)	3	61.35	64.81	2	66.67
27407.	Emily (emilyvol6)	3	50.94	56.00	0	0.00
27408.	Electronic (emil2107)	3	101.09	110.25	1	33.33
27409.	Maria (emejota)	3	52.11	54.23	0	0.00
27410.	EMCL (emcl)	3	134.19	146.90	3	100.00
27411.	Raphael (elysian_fields)	3	53.02	59.97	2	66.67
27412.	El (eluif4)	3	69.41	72.75	3	100.00
27413.	One Finger (elionefinger)	3	61.49	68.82	0	0.00
27414.	Elen (eliivapuu)	3	67.45	77.55	1	33.33
27415.	Elias (eliasstr53)	3	59.54	61.28	2	66.67
27416.	Giovanni (elgiov)	3	82.01	88.77	0	0.00
27417.	Eli (elewint)	3	118.22	133.43	3	100.00
27418.	Element (elementoop)	3	80.72	91.63	1	33.33
27419.	eldrick (eldricck)	3	58.29	68.03	1	33.33
27420.	Eldar (eldartoleubay1)	3	35.30	41.60	2	66.67
27421.	Addy (egglols)	3	87.04	90.96	0	0.00
27422.	eloise (eeloise)	3	86.20	87.77	2	66.67
27423.	Eduardo (eduardocg)	3	62.12	64.83	0	0.00
27424.	Edo (edo4th)	3	70.46	77.07	0	0.00
27425.	Eden (edenboboi)	3	71.13	74.62	0	0.00
27426.	Charlie (eatsrice)	3	99.02	106.86	0	0.00
27427.	eashr37 (eashr37)	3	70.41	75.66	0	0.00
27428.	Thanh (d_t_nguyen)	3	79.86	82.63	1	33.33
27429.	🐢 (dzzz664)	3	91.89	93.04	1	33.33
27430.	mangled (dyslectic)	3	103.66	109.24	2	66.67
27431.	JEDIDIAH (dyna_myte)	3	63.17	69.45	0	0.00
27432.	Fitz (dylab)	3	124.17	128.57	3	100.00
27433.	Adam (dwindleflip)	3	82.15	86.12	1	33.33
27434.	Daniel (dwang18)	3	117.89	119.34	1	33.33
27435.	Denis (dwake)	3	59.24	70.91	1	33.33
27436.	DVORAK Dell KB522/Asus G01K...	3	122.70	136.86	2	66.67
27437.	Dunking3022 (dunking3022)	3	79.79	81.60	2	66.67
27438.	Jimmy (dumplingrecipe)	3	75.98	84.66	0	0.00
27439.	Derrick (dummy_123)	3	76.04	78.41	0	0.00
27440.	Landen (duklin)	3	106.79	110.98	1	33.33
27441.	dude (dudeorino)	3	59.86	68.86	1	33.33
27442.	breh (duclc)	3	83.04	88.01	1	33.33
27443.	duckie (ducknoodles25)	3	112.33	125.89	2	66.67
27444.	duckmoon99 (duckmoon99)	3	91.13	105.00	0	0.00
27445.	Alex (dubalpha)	3	98.48	107.33	3	100.00
27446.	Chris (dtarzan)	3	79.21	81.80	1	33.33
27447.	Dan (dstreety)	3	45.15	51.13	1	33.33
27448.	Clifford (drizzleup)	3	51.23	58.95	0	0.00
27449.	Austin (driedisland7766)	3	91.68	96.17	2	66.67
27450.	Drew (drewsworth)	3	91.09	103.34	1	33.33
27451.	Drew (drewsalem)	3	102.62	124.20	2	66.67
27452.	John (dregz)	3	71.19	73.94	1	33.33
27453.	dreezy (dreeezy)	3	71.69	73.61	1	33.33
27454.	Camilo (drcabo26)	3	69.80	78.91	0	0.00
27455.	Nguyen (dra_go)	3	78.42	91.66	2	66.67
27456.	Carl (draori)	3	114.44	120.06	1	33.33
27457.	Andy (drancio)	3	85.03	89.96	1	33.33
27458.	matt (drakkus)	3	134.21	141.25	2	66.67
27459.	Dragos (dragoselu)	3	75.69	95.00	2	66.67
27460.	Drago (dragosan)	3	63.11	68.33	2	66.67
27461.	Goon (dragonszn)	3	75.93	86.93	1	33.33
27462.	Neon (dragonkingscrown)	3	54.05	64.54	0	0.00
27463.	Doug (dougly)	3	87.05	91.55	1	33.33
27464.	Douglas (douglasmm24)	3	85.37	93.24	1	33.33
27465.	Dora (dorasmoothy)	3	97.83	101.86	2	66.67
27466.	hanni3 (dontwakeme)	3	70.86	82.41	2	66.67
27467.	Steph (donnerblumen)	3	64.35	71.04	1	33.33
27468.	David (donkykong2008)	3	87.57	94.62	2	66.67
27469.	George (dolias)	3	118.77	124.24	2	66.67
27470.	Vivian (dojacatsfeet)	3	88.92	95.40	1	33.33
27471.	DoGe (doge_)	3	92.24	101.49	3	100.00
27472.	Mun Hin (dodo_bird)	3	79.32	85.40	0	0.00
27473.	Andy (doctorhammer)	3	51.13	55.58	0	0.00
27474.	Duc Anh (doc1997)	3	94.94	97.05	1	33.33
27475.	D (dmaulish)	3	102.74	109.68	2	66.67
27476.	Lucid (dldri)	3	95.78	111.95	1	33.33
27477.	Daniel (dlarocque)	3	82.87	91.30	3	100.00
27478.	Dkaf (dkaf9497)	3	95.56	102.19	0	0.00
27479.	angula (dixiehugh)	3	46.21	49.63	0	0.00
27480.	Ditto (dittochang)	3	91.57	112.51	1	33.33
27481.	Jörg (dislookskewl)	3	51.74	57.51	1	33.33
27482.	discordia (discordia1)	3	81.44	90.56	1	33.33
27483.	Julian (disclo5ure)	3	144.65	146.39	3	100.00
27484.	Dirix (dirix1219)	3	101.29	115.95	2	66.67
27485.	direw (direw)	3	61.55	64.72	0	0.00
27486.	Dino (dinzxd)	3	51.81	55.14	1	33.33
27487.	dinesh (dinesh66)	3	50.59	52.37	1	33.33
27488.	Dimitri (dimitrins)	3	74.79	81.77	2	66.67
27489.	Dill (dillz_weed)	3	125.88	138.86	1	33.33
27490.	Diego (dieagui)	3	56.11	62.24	1	33.33
27491.	Dian (dianeka)	3	43.51	49.93	1	33.33
27492.	Emerson (diamondud3)	3	79.70	87.03	1	33.33
27493.	Diahpn (diahnurrahmah)	3	42.33	43.44	0	0.00
27494.	brian (dhafjkskjh)	3	128.62	132.61	1	33.33
27495.	De_Stroyed (de_molished)	3	94.59	104.68	2	66.67
27496.	Dex (dexister)	3	100.52	108.93	2	66.67
27497.	Alex (dexiple)	3	85.59	89.52	1	33.33
27498.	Devender (dev2002)	3	51.40	58.67	0	0.00
27499.	Francesco (deto_man)	3	72.82	83.31	1	33.33
27500.	Andrew (dethzombi)	3	89.20	99.50	1	33.33
27501.	Jacob (derr1)	3	85.66	96.45	1	33.33
27502.	Jin (derherro)	3	94.83	103.23	3	100.00
27503.	Derek (derekomgmok)	3	47.41	49.77	0	0.00
27504.	derdier (derdier)	3	105.59	117.93	2	66.67
27505.	Nicky (denmam69)	3	60.78	62.38	0	0.00
27506.	Delros (delros)	3	115.17	121.22	3	100.00
27507.	Delirious (deliriousbadger)	3	85.00	90.55	0	0.00
27508.	D (deffenel_782)	3	95.14	103.90	1	33.33
27509.	Deependra (deepak_typer)	3	59.20	64.00	1	33.33
27510.	Robert (deeckie)	3	91.77	96.22	1	33.33
27511.	deckador (deckador)	3	109.69	115.90	2	66.67
27512.	noobboy (debiggay)	3	107.59	134.56	1	33.33
27513.	Thuan (deadlydragon100)	3	112.76	130.82	1	33.33
27514.	Biscuit (ddxddx)	3	60.14	66.01	2	66.67
27515.	Derek (ddw004)	3	67.56	74.44	0	0.00
27516.	Anthony (ddragon217)	3	67.21	72.51	1	33.33
27517.	Dylan (dc4lif3)	3	70.88	77.31	1	33.33
27518.	debwl (dbwls)	3	74.92	78.21	1	33.33
27519.	Amritanshu (da_sikka_x)	3	97.73	105.64	1	33.33
27520.	daMidu (da_midu)	3	74.11	82.16	1	33.33
27521.	Alexander (dawgsrlife)	3	109.80	110.54	0	0.00
27522.	David (davidniupa)	3	68.70	72.14	2	66.67
27523.	Dave (daviddatroll)	3	56.03	57.95	1	33.33
27524.	David (david0524)	3	107.36	125.71	3	100.00
27525.	Hector (datafli)	3	72.38	80.22	0	0.00
27526.	Daniels (dasis5)	3	78.17	84.12	1	33.33
27527.	Darshan (darshanlakkundi)	3	67.30	75.68	3	100.00
27528.	Darrix (darrixl)	3	109.86	119.17	3	100.00
27529.	s (dapawner)	3	108.58	120.39	2	66.67
27530.	dansuke (dansuke)	3	69.12	82.87	0	0.00
27531.	Dannyngve (dannyngve)	3	56.71	63.62	3	100.00
27532.	Daniel (dannyfannyg)	3	74.69	78.55	0	0.00
27533.	Dan (danjohnson1209)	3	68.18	69.44	1	33.33
27534.	Daniel (daniel_ga_1309)	3	62.73	67.21	2	66.67
27535.	Daniel (danielmini0101)	3	97.32	107.15	3	100.00
27536.	Corlex (dani356d)	3	112.37	116.32	2	66.67
27537.	Danai (dan9s_)	3	68.06	74.88	0	0.00
27538.	Damon (damon1864)	3	50.50	64.68	1	33.33
27539.	Damjan (damjank)	3	68.41	75.01	1	33.33
27540.	Dakota (dakbell)	3	97.39	99.55	1	33.33
27541.	Aaron (daggertye)	3	116.35	131.93	0	0.00
27542.	David (dafweeda)	3	86.89	92.74	0	0.00
27543.	Mike (daemonevox)	3	65.41	70.21	1	33.33
27544.	d4nielle (d4ni_typer)	3	95.81	108.06	3	100.00
27545.	Adi (cylify)	3	55.66	56.08	0	0.00
27546.	Nirzhor (cyclonite)	3	64.56	72.31	0	0.00
27547.	Cyberwolf (cyberwolf555)	3	93.02	99.87	1	33.33
27548.	John (cyal8er)	3	113.35	124.58	1	33.33
27549.	CWCCX.Artist (cwccx_artist)	3	59.75	62.76	0	0.00
27550.	Owen (cvlized)	3	31.00	33.91	0	0.00
27551.	Cuthalion (cuthalion)	3	113.70	122.01	1	33.33
27552.	Pavel (curlink)	3	46.22	48.53	0	0.00
27553.	josh (cubuff8)	3	87.93	103.19	1	33.33
27554.	Kavin (cuboidmaniac)	3	72.46	73.64	1	33.33
27555.	cty28137 (cty28137)	3	90.03	99.06	2	66.67
27556.	Crystal (crystalwen)	3	90.67	95.47	3	100.00
27557.	tryone (crvckhead)	3	52.06	56.97	0	0.00
27558.	Spas (crsorsmth)	3	113.96	131.16	2	66.67
27559.	chicken (crossedhands)	3	103.74	109.45	3	100.00
27560.	Christos (cros107)	3	97.23	111.97	0	0.00
27561.	Chris (cronox)	3	127.79	133.62	2	66.67
27562.	Christopher (critterjohnson)	3	78.18	80.97	0	0.00
27563.	Cris (cris001)	3	75.07	75.92	2	66.67
27564.	Crimsoonn (crimsoonn)	3	74.52	78.14	1	33.33
27565.	Patrick (crimson_talon)	3	126.50	128.04	1	33.33
27566.	Filip (creer)	3	69.78	70.11	1	33.33
27567.	Mohammed (creative506)	3	68.02	75.58	0	0.00
27568.	Extrode (crazytrends)	3	101.92	116.72	1	33.33
27569.	Srihari (crazysriharii)	3	84.20	90.13	0	0.00
27570.	crappyper (crappyper)	3	83.96	89.96	0	0.00
27571.	DholaSain (cptmujahid)	3	60.02	68.80	0	0.00
27572.	Cheembs (cottagethepottage)	3	66.88	71.88	2	66.67
27573.	cosmix (cosmix)	3	139.32	156.32	3	100.00
27574.	Cory (corydean)	3	108.32	121.15	2	66.67
27575.	CortsTypist (cortsvan)	3	96.59	98.27	2	66.67
27576.	Cornelius (corneliusyan)	3	96.44	101.86	3	100.00
27577.	Cooper (coopy498)	3	86.00	90.82	2	66.67
27578.	Conrad (conradkay)	3	123.57	131.83	2	66.67
27579.	Conner (connerfitz)	3	104.56	110.31	2	66.67
27580.	Arno (computer_9)	3	46.94	49.08	0	0.00
27581.	Combo (combospag)	3	119.70	126.52	2	66.67
27582.	me type gud (coltvhd)	3	137.42	142.83	3	100.00
27583.	wiiiiiiiiiiiiiiiiiiiiiiiiii...	3	116.76	125.25	3	100.00
27584.	Abdulla (coldeye3)	3	46.10	53.27	1	33.33
27585.	colby (colbyfuchs)	3	61.58	74.11	1	33.33
27586.	Coffee (coffeezzz)	3	54.01	55.90	0	0.00
27587.	Tim (codingmaster)	3	84.15	89.16	1	33.33
27588.	Hi (coarse)	3	104.98	106.54	3	100.00
27589.	Ali (cloudy_coyote)	3	80.07	88.68	0	0.00
27590.	Cliptic (cliptic_)	3	78.91	86.22	2	66.67
27591.	Zeb (cleavecamael)	3	92.98	101.37	2	66.67
27592.	Joel (clashofkeys)	3	80.49	84.24	1	33.33
27593.	Joel (clarkwest1)	3	38.84	42.16	0	0.00
27594.	Cj (cjp2739)	3	62.02	68.00	2	66.67
27595.	cj (cjanti)	3	62.29	69.65	2	66.67
27596.	Gokula (citizen34)	3	53.99	57.11	0	0.00
27597.	cig (cigtype)	3	96.72	100.51	1	33.33
27598.	Ian (cigaweed)	3	93.04	101.05	1	33.33
27599.	ChyShabo (chyshabo)	3	56.93	58.65	0	0.00
27600.	chris (chwis)	3	70.98	77.75	0	0.00
27601.	Yam (chunchumh)	3	62.08	67.06	0	0.00
27602.	Connor (chuggs1798)	3	99.05	116.90	1	33.33
27603.	Matt (chuckleschopstick)	3	90.60	117.00	1	33.33
27604.	chubbylc (chubbylc)	3	83.95	90.73	0	0.00
27605.	Chronp (chronp)	3	29.59	35.87	0	0.00
27606.	CHRON (chronnie)	3	100.77	108.93	1	33.33
27607.	Zoot (chroniaro)	3	92.97	94.52	3	100.00
27608.	Christof (christofvanhove)	3	50.32	56.25	0	0.00
27609.	Christina (christina0907)	3	70.24	78.44	2	66.67
27610.	Chris (christaborg)	3	102.07	109.90	2	66.67
27611.	chris :) (chrissypop)	3	58.91	67.99	0	0.00
27612.	chrissie911 (chrissie911)	3	107.24	111.05	0	0.00
27613.	christopher (chrismoss5)	3	20.95	23.75	0	0.00
27614.	Chocolate (chocolatekid)	3	82.43	87.79	0	0.00
27615.	Chloro (chlorowins)	3	103.16	107.20	2	66.67
27616.	Chloe (chloegamedev)	3	98.97	106.19	2	66.67
27617.	Shiv (chi_ken)	3	67.15	74.38	2	66.67
27618.	Chinmay_Tiwari (chinmay_tiw...	3	66.81	69.22	0	0.00
27619.	chiirin (chiirin)	3	78.80	83.07	1	33.33
27620.	Rahat (chiefrahat)	3	64.06	68.96	0	0.00
27621.	ChickenMaster (chickenmaster1)	3	84.27	99.03	0	0.00
27622.	mergaza (chiboub)	3	108.58	118.39	2	66.67
27623.	Austin (chewzy)	3	152.43	167.58	1	33.33
27624.	Chenna (chenna06)	3	72.31	81.09	0	0.00
27625.	Cheska (cheesekuh)	3	109.47	119.21	2	66.67
27626.	Creamy (cheesebutt69)	3	137.62	145.91	3	100.00
27627.	Hinn (cheehinn)	3	63.61	86.21	3	100.00
27628.	lacktoast (cheaky46)	3	42.70	45.48	0	0.00
27629.	ChandraMouli (chandramouli)	3	41.80	43.38	0	0.00
27630.	glassbottle (chambonu)	3	95.91	100.81	1	33.33
27631.	Gevorg (cgev)	3	76.38	78.52	1	33.33
27632.	Cezou (cezou)	3	67.49	75.13	1	33.33
27633.	Alexander (ceverion)	3	111.59	117.50	2	66.67
27634.	Dena (cestdena)	3	57.44	62.35	0	0.00
27635.	Hento (ceckerli)	3	76.73	96.73	1	33.33
27636.	cecilie (ceci754f)	3	58.15	62.82	1	33.33
27637.	Caven (caven)	3	90.30	94.87	3	100.00
27638.	Christopher (catmando00)	3	41.22	46.55	0	0.00
27639.	Casual (casual_penguin)	3	115.27	123.73	2	66.67
27640.	Dolton (caramelsauces)	3	57.72	66.66	2	66.67
27641.	mike (capzor)	3	78.77	82.69	0	0.00
27642.	Sebastian (cantdefeatairman)	3	34.46	37.35	3	100.00
27643.	WHO (candleshands)	3	47.56	51.07	0	0.00
27644.	summeR (canadianruler)	3	90.37	100.78	1	33.33
27645.	Cameron (camd1zy)	3	73.12	75.85	1	33.33
27646.	Callum (cal_dis)	3	124.49	138.60	2	66.67
27647.	Slobodan (calorifically)	3	78.29	94.37	2	66.67
27648.	Audric (callmeric)	3	39.68	50.53	0	0.00
27649.	Albert (callmeal)	3	91.44	95.28	0	0.00
27650.	Tom (calder27)	3	88.24	104.73	2	66.67
27651.	Cain (cainlimbo)	3	69.57	80.10	0	0.00
27652.	cooter (c0oter)	3	59.94	64.09	1	33.33
27653.	Bri (b_marli)	3	106.05	119.61	0	0.00
27654.	Benjamin (bw1625)	3	162.26	164.03	0	0.00
27655.	ANNEw (butzy)	3	68.17	68.76	0	0.00
27656.	BUSH (bushtyperacer)	3	99.79	103.82	1	33.33
27657.	Ashley (bunnymama23)	3	90.92	97.86	1	33.33
27658.	Bunjee (bunjeeman27)	3	59.98	72.79	0	0.00
27659.	olajide olatunji (bulgelord)	3	96.80	103.32	2	66.67
27660.	Buenas Tardes (buenastardes)	3	57.66	62.80	0	0.00
27661.	bu (bubu2006)	3	61.98	63.78	0	0.00
27662.	Lan (bubbleangel33)	3	112.38	121.94	1	33.33
27663.	Almahbuby (bubanz1101)	3	77.18	78.88	1	33.33
27664.	neblig (bsy_af)	3	73.92	79.68	1	33.33
27665.	Bruh (bruhmoem)	3	81.82	89.68	1	33.33
27666.	kewuan (bruhletmein)	3	42.57	45.94	0	0.00
27667.	Vathan (bruddinha)	3	72.66	79.37	1	33.33
27668.	Aodhan (brsijraz)	3	90.23	101.35	3	100.00
27669.	Broodje (broodjebal74)	3	84.15	91.60	2	66.67
27670.	Braxton (brontar)	3	59.38	68.94	0	0.00
27671.	Brock (brockgoins01)	3	52.55	64.47	0	0.00
27672.	Bristopher (bristopherwoods)	3	64.54	73.88	1	33.33
27673.	Brian (briank91)	3	114.91	125.72	1	33.33
27674.	😀 (brettkavanaughcj)	3	96.54	102.53	1	33.33
27675.	Brenda (brendaiscool)	3	82.77	91.66	3	100.00
27676.	Bratke (bratke)	3	82.03	89.58	2	66.67
27677.	Brandon (bransap)	3	98.46	110.54	3	100.00
27678.	Brandon (brandonhariyanto)	3	98.18	100.12	2	66.67
27679.	Brandon (brandinothefilipino)	3	154.55	167.75	1	33.33
27680.	Maksym (branchofsin)	3	46.48	53.18	1	33.33
27681.	João (brancao)	3	74.79	82.38	1	33.33
27682.	Bradley (bradt30h)	3	85.29	87.45	1	33.33
27683.	Brandon (bradenpatoni)	3	103.19	106.63	1	33.33
27684.	Ethan (boxisfat)	3	37.79	43.45	0	0.00
27685.	Andre (bouncybear6969)	3	76.69	79.19	0	0.00
27686.	HauntedMop (boss_mario)	3	85.78	93.34	3	100.00
27687.	Euan (bossmankrabs)	3	59.86	64.97	1	33.33
27688.	Lilac (borntosurvive27)	3	57.81	58.63	0	0.00
27689.	borkes (borkes)	3	56.55	60.89	1	33.33
27690.	boris (borisu)	3	72.31	79.91	2	66.67
27691.	booger (boogerbuttcheeks)	3	101.49	103.03	0	0.00
27692.	qwerty_han (booboo_)	3	91.05	104.42	1	33.33
27693.	Bonnie (bonbon601)	3	58.10	60.42	1	33.33
27694.	Ignacy (bombylius)	3	86.14	90.03	0	0.00
27695.	bogo (bogo10)	3	76.53	78.98	1	33.33
27696.	Jonathan (bods_88)	3	73.67	79.64	1	33.33
27697.	Emmanuel (bodmas)	3	94.55	103.67	0	0.00
27698.	bob (bobsmith111)	3	70.83	77.33	1	33.33
27699.	Bob (bobrossisfresh792)	3	50.63	59.58	2	66.67
27700.	Alex (bobpoopsalot8)	3	92.75	97.22	3	100.00
27701.	Veritas (bobo347844)	3	82.61	86.41	1	33.33
27702.	nathan (bobhehehe69)	3	49.35	58.80	1	33.33
27703.	Bob (bobgolf)	3	77.01	79.98	0	0.00
27704.	Eli (bobfrankie)	3	109.36	124.95	3	100.00
27705.	boas (boas)	3	92.63	96.96	2	66.67
27706.	Akko (blue_akko)	3	67.67	72.70	0	0.00
27707.	bluesheep97 (bluesheep97)	3	100.28	102.64	3	100.00
27708.	Blue (bluemoonzz)	3	72.28	80.48	0	0.00
27709.	Philemon (blubblubgoldfish1...	3	59.31	60.96	2	66.67
27710.	dox (bloxyshark)	3	104.29	109.11	3	100.00
27711.	Bob (blooperboy)	3	129.20	139.42	2	66.67
27712.	Abhay (bloodyhero)	3	78.50	84.52	2	66.67
27713.	Calvin (blindpainter)	3	84.09	87.10	1	33.33
27714.	Blastoise (blastoise24)	3	103.98	112.54	1	33.33
27715.	Xavier (blademaster5)	3	68.16	69.69	0	0.00
27716.	Black (blackhacker)	3	55.00	58.67	0	0.00
27717.	Jack (blackened_angel)	3	72.85	83.13	0	0.00
27718.	Billy (billydoesgaming)	3	122.08	125.78	2	66.67
27719.	bilegt (bilegtkka)	3	46.84	48.34	0	0.00
27720.	tstats[bilayer] (bilayer)	3	113.72	139.02	1	33.33
27721.	Arif (bilai)	3	51.72	53.90	1	33.33
27722.	Vibes (big_vibe)	3	68.44	79.07	0	0.00
27723.	bigwayv (bigwayv)	3	52.48	55.33	0	0.00
27724.	Kevin (bigtimetyperacer)	3	121.01	129.43	2	66.67
27725.	Mina (bigoppai)	3	60.77	62.12	2	66.67
27726.	Big Khagan (bigkhagan)	3	44.20	46.02	3	100.00
27727.	Alan (bigd_16_in)	3	91.52	108.53	1	33.33
27728.	f (bigbarney)	3	49.93	53.19	3	100.00
27729.	Biasface (biasface)	3	120.91	125.24	2	66.67
27730.	Paweł (biah2206)	3	74.43	84.84	1	33.33
27731.	sam (beuk15)	3	70.63	74.83	3	100.00
27732.	Zhibek (besunshine)	3	35.96	49.29	1	33.33
27733.	Albert (bertikcertik)	3	77.21	85.27	0	0.00
27734.	Ben (benspeedin)	3	81.66	83.00	1	33.33
27735.	Ben (bensilasf)	3	52.64	63.70	1	33.33
27736.	beng (benguwu)	3	96.17	105.77	1	33.33
27737.	Ben (benf999)	3	111.73	113.36	1	33.33
27738.	Vincentius (benaldii)	3	67.31	69.00	1	33.33
27739.	bell (bell125)	3	77.12	82.06	2	66.67
27740.	Pumpkin (beigepumpkin)	3	80.35	88.26	2	66.67
27741.	BÉ HEO (beheo2012)	3	24.48	28.76	1	33.33
27742.	BeeTheKay (beethekay)	3	55.27	59.13	1	33.33
27743.	Jaloliddin (beebeep)	3	30.99	32.71	0	0.00
27744.	because (because_123)	3	88.90	95.72	2	66.67
27745.	bebeconsarna (bebeconsarna)	3	36.64	40.76	1	33.33
27746.	beans (beans_baked)	3	61.35	63.53	1	33.33
27747.	Bean (beanx316)	3	77.52	80.48	0	0.00
27748.	BeanLord (beanlordishere)	3	58.15	63.81	2	66.67
27749.	Shamus (bbtoskar)	3	55.18	64.71	1	33.33
27750.	Brad (bborrell)	3	76.96	82.29	1	33.33
27751.	Ambien (bbcocaine)	3	96.39	99.11	1	33.33
27752.	Billy (bathtimebilly)	3	96.30	110.26	2	66.67
27753.	Lukas (barorak)	3	46.26	49.03	0	0.00
27754.	baron (baronvie)	3	78.61	90.31	1	33.33
27755.	BaoOtakun (baootakun)	3	44.21	45.52	0	0.00
27756.	Sam (bananaman923)	3	101.90	115.90	1	33.33
27757.	Anonymous (ballistic_kraken)	3	92.97	104.66	0	0.00
27758.	Ramiro (baginius3000)	3	44.99	54.82	0	0.00
27759.	Christopher (baby_chou)	3	76.05	102.08	0	0.00
27760.	Babylons (babylons)	3	84.20	86.04	1	33.33
27761.	Matt (babyeater58)	3	69.40	73.76	0	0.00
27762.	Ben (baboo_)	3	78.08	84.23	0	0.00
27763.	Evan (bababooouy)	3	47.63	50.14	1	33.33
27764.	Hugh (a_very_hughjanus)	3	106.64	122.09	2	66.67
27765.	Azaan (azstar)	3	98.38	101.29	2	66.67
27766.	Azal (azalro)	3	60.79	67.34	0	0.00
27767.	ayytimbo (ayytimbo)	3	88.58	99.22	1	33.33
27768.	Marc (ayylmarc)	3	95.23	97.67	1	33.33
27769.	Ayush (ayushprem)	3	39.83	42.20	1	33.33
27770.	Mr.T (aysanoglu)	3	72.81	74.66	0	0.00
27771.	Ayrton (ayrton1110)	3	71.14	73.42	1	33.33
27772.	Kyle (awesomeinator42)	3	61.31	64.65	0	0.00
27773.	Sebastian (aweseb64)	3	94.46	108.70	1	33.33
27774.	Avi (avi_1301)	3	85.15	86.53	1	33.33
27775.	Aviatato (aviatato)	3	101.35	110.10	1	33.33
27776.	average (average_dude)	3	44.44	47.93	0	0.00
27777.	Averie (aveeeriiieee)	3	83.54	88.55	2	66.67
27778.	Aaron (auztistic)	3	65.38	70.31	1	33.33
27779.	Jacob (author_)	3	115.66	121.81	1	33.33
27780.	Austin (austinsnow)	3	112.00	115.09	0	0.00
27781.	Austin (austinparkk)	3	82.71	88.06	0	0.00
27782.	AURRUM (aurrum007)	3	82.87	89.32	1	33.33
27783.	inSomnia (auriskv)	3	95.48	100.89	3	100.00
27784.	Zisis (atrogzisis)	3	59.12	64.18	1	33.33
27785.	Ato (atorization123)	3	112.75	123.93	3	100.00
27786.	atomic (atom1c)	3	74.03	76.14	1	33.33
27787.	Ashley (aswenson3907)	3	83.87	94.29	1	33.33
27788.	Alex (asleslie)	3	79.52	85.62	1	33.33
27789.	Sam (asianshampoo)	3	75.22	79.91	2	66.67
27790.	anyou (asianguy2816)	3	102.00	111.30	0	0.00
27791.	Jos (asiangei)	3	110.73	121.72	3	100.00
27792.	Sirjay (asiafaceboy)	3	68.74	74.44	0	0.00
27793.	Ash (ashzs)	3	78.16	96.26	1	33.33
27794.	Ashutosh (ashutosh026)	3	64.70	75.64	0	0.00
27795.	Ashley (ashleya9790)	3	109.79	117.55	3	100.00
27796.	Asger (asgerbf)	3	43.78	49.15	2	66.67
27797.	Anthony (asenarith)	3	71.74	76.80	1	33.33
27798.	Griffin (asdwz458)	3	101.22	114.32	3	100.00
27799.	Made (aryx)	3	83.26	87.83	1	33.33
27800.	art (artushhheee)	3	81.23	83.92	0	0.00
27801.	Tony (artemisu)	3	109.28	126.88	0	0.00
27802.	Gabe (artemiaduch)	3	92.58	104.45	0	0.00
27803.	noah (armedwhale)	3	62.23	66.60	1	33.33
27804.	Guest (__guest_)	3	105.13	120.28	1	33.33
27805.	Paul (_separate)	3	74.92	83.57	0	0.00
27806.	lia (_lia1_)	3	37.91	41.88	0	0.00
27807.	kenboi (_kenboi)	3	105.52	117.50	2	66.67
27808.	Ian (_iii_an)	3	96.80	105.75	2	66.67
27809.	Frito (_frito)	3	91.63	100.92	0	0.00
27810.	bad (_dingus)	3	129.45	139.98	3	100.00
27811.	ZZ (zztypes)	3	74.64	81.90	1	33.33
27812.	Shoaib😂🔫 (zvje2da)	3	65.68	70.88	1	33.33
27813.	zuwuz (zuwuz)	3	102.78	103.64	1	33.33
27814.	Zack (zrobjohn)	3	79.67	88.04	0	0.00
27815.	QUACK (zooming235)	3	66.48	68.64	0	0.00
27816.	unknown (zoom777)	3	79.44	90.86	2	66.67
27817.	zo (zohway)	3	80.24	89.06	0	0.00
27818.	ZlotZ (zlotz)	3	101.40	109.38	0	0.00
27819.	Z (zixosa)	3	58.80	59.77	0	0.00
27820.	Noah (zipzapimoncrack)	3	62.01	62.70	1	33.33
27821.	Preston (ziphyy)	3	84.82	91.29	2	66.67
27822.	Ziad (zinafzi)	3	23.75	27.93	1	33.33
27823.	Jill (zilzili)	3	56.85	67.65	1	33.33
27824.	Zid (zid1312)	3	71.08	75.14	3	100.00
27825.	Jess (zhoujt23)	3	87.55	97.56	0	0.00
27826.	Neyman-Pearson (zhenchao)	3	63.16	63.57	0	0.00
27827.	zyn (zezyn)	3	101.88	112.66	1	33.33
27828.	Zero (zerowaffles)	3	93.51	106.98	1	33.33
27829.	Zerokles (zerokles)	3	113.67	118.75	2	66.67
27830.	Furkan (zerdlai)	3	48.40	60.24	1	33.33
27831.	Davey (zenyatta_main)	3	92.10	98.43	2	66.67
27832.	Zekrew (zekrew)	3	74.30	82.10	2	66.67
27833.	Zeb (zebstrikal)	3	93.07	95.98	3	100.00
27834.	Sabin (zealousy)	3	76.65	77.66	2	66.67
27835.	Mike (zaza_wolfv2)	3	78.32	83.62	0	0.00
27836.	Zane (zanecoldyt)	3	28.83	29.85	0	0.00
27837.	J (yzy1234)	3	93.64	100.44	1	33.33
27838.	alexander (yummyspiderman)	3	85.93	102.56	0	0.00
27839.	Kit (yukit123)	3	67.85	70.01	1	33.33
27840.	Shakres (yukikow14)	3	57.59	65.46	0	0.00
27841.	Yugant (yuga009)	3	58.32	72.88	0	0.00
27842.	Youwho1234567 (youwho1234567)	3	51.48	53.81	1	33.33
27843.	Yora (yorad)	3	47.97	52.53	1	33.33
27844.	YonYon (yonyon205)	3	64.22	67.00	2	66.67
27845.	Angel (yomommaspimp)	3	43.36	47.88	0	0.00
27846.	scut-黄光积 (yh_1314)	3	64.44	65.58	0	0.00
27847.	Gyeoulie (yennie)	3	94.33	98.26	1	33.33
27848.	Yellow (yellowbow)	3	87.36	96.64	1	33.33
27849.	keker (yash117)	3	118.58	121.96	1	33.33
27850.	EC (yapenchong1)	3	70.71	72.51	1	33.33
27851.	Yagiz (yagizbahadiroglu)	3	90.99	96.37	3	100.00
27852.	Yael (yaeltellez)	3	60.40	65.36	1	33.33
27853.	neko (yabaicat)	3	88.79	97.10	3	100.00
27854.	y (y1266)	3	79.40	88.73	0	0.00
27855.	Eggnog (y0ink)	3	146.11	161.84	1	33.33
27856.	Corbin (xx_nut_xx)	3	68.10	71.22	1	33.33
27857.	Behind (xx_blaze_xx)	3	64.56	65.62	0	0.00
27858.	Nicole (xxnicolexx)	3	125.72	135.67	3	100.00
27859.	David (xpoes)	3	100.41	105.11	2	66.67
27860.	Nikan (xnikan)	3	114.18	124.59	2	66.67
27861.	Spaketi (xngelic)	3	70.34	74.46	1	33.33
27862.	Xmen (xmen1404)	3	74.32	82.17	1	33.33
27863.	Jakubi (xmask)	3	81.00	81.14	1	33.33
27864.	Francisco (xikinho21)	3	58.23	60.35	2	66.67
27865.	xiu (xihuan)	3	69.96	93.67	0	0.00
27866.	Dennis (xdmeneer)	3	99.22	106.34	2	66.67
27867.	Max (xdevilwastaken)	3	62.28	69.20	0	0.00
27868.	ravi (xdbanterman321)	3	94.69	101.63	0	0.00
27869.	XA25 (xa25)	3	65.74	72.83	1	33.33
27870.	wyss (wyss)	3	93.59	102.26	1	33.33
27871.	Tsuki (wumi4)	3	70.85	74.88	1	33.33
27872.	work in (work_in_progress)	3	132.28	150.10	3	100.00
27873.	WongMan4U (wongmanforyou)	3	53.66	56.39	1	33.33
27874.	I.M. (wonderl4nd_puff)	3	39.60	41.41	0	0.00
27875.	Wonder Bread (wonder590)	3	78.59	80.20	0	0.00
27876.	Will (wombat50ng)	3	71.27	81.99	0	0.00
27877.	woejang (woejang)	3	65.22	67.64	1	33.33
27878.	kristjan (wlayzer)	3	68.95	76.68	0	0.00
27879.	Wizard (wizardtypist)	3	77.93	82.36	1	33.33
27880.	T (wish_i_could_type)	3	84.62	89.03	1	33.33
27881.	windywendi (windywendi)	3	73.55	79.63	1	33.33
27882.	Will (winam777)	3	89.14	93.36	0	0.00
27883.	Ngoc (windblossom0520)	3	66.66	69.95	0	0.00
27884.	Ruby (wimbleruby)	3	54.73	63.84	0	0.00
27885.	Wilbert (wil_bwrt)	3	74.99	82.16	0	0.00
27886.	Will (willtang)	3	126.05	133.57	2	66.67
27887.	Willjum (willjum)	3	66.98	83.14	0	0.00
27888.	William (williamusa)	3	104.62	114.21	1	33.33
27889.	Ree (wild_reemoo)	3	90.30	99.40	1	33.33
27890.	Wawan Cahyo (wildanie12)	3	76.50	80.85	1	33.33
27891.	Harold (who_da_penguin)	3	97.18	105.32	1	33.33
27892.	Isaac (whosisaac)	3	85.15	89.38	2	66.67
27893.	WhooAre_you (whooare_you)	3	55.66	73.50	1	33.33
27894.	Sebastian (whipees)	3	38.18	41.27	0	0.00
27895.	whattywhat (whattywhat)	3	91.16	92.98	0	0.00
27896.	Emryys (whako1337)	3	84.56	102.47	1	33.33
27897.	Werdna (werdnawerd)	3	100.77	104.22	2	66.67
27898.	Marty (wender97)	3	67.33	70.51	0	0.00
27899.	Will (wdoutreband)	3	95.97	107.95	1	33.33
27900.	wayson (wayson)	3	66.47	69.35	0	0.00
27901.	German (wat_germy)	3	83.87	112.38	1	33.33
27902.	Ethan (waterman111)	3	65.75	68.87	3	100.00
27903.	Dio (waterboyz)	3	85.27	91.01	2	66.67
27904.	Joe (watchtheskies)	3	50.17	56.05	0	0.00
27905.	Wasshi- (wasshi)	3	106.83	111.96	0	0.00
27906.	Abdulrahman (wasd1234)	3	93.85	100.70	2	66.67
27907.	alireza (warlord_08)	3	61.29	62.35	0	0.00
27908.	Warhio (warhio)	3	42.98	48.69	0	0.00
27909.	tstats[wardenod17] (wardeno...	3	116.19	124.18	1	33.33
27910.	Andrew (warden99)	3	112.59	118.18	3	100.00
27911.	C4 (wantsomedeath)	3	73.95	83.26	1	33.33
27912.	Kunpeng (wankupi)	3	53.95	57.98	2	66.67
27913.	isaiah (wamuuuu)	3	83.03	94.66	1	33.33
27914.	Phil (walter_mittys_left_kn...	3	77.11	83.26	1	33.33
27915.	Walker (walkers12)	3	97.74	103.12	1	33.33
27916.	samren (walker452)	3	122.72	131.87	3	100.00
27917.	waleed (waleedbinkhalid)	3	74.29	81.89	1	33.33
27918.	Albert (waifu420)	3	70.27	76.39	0	0.00
27919.	wae (wae_da_algae)	3	109.37	121.46	3	100.00
27920.	Adam (w0nsh)	3	107.50	117.14	3	100.00
27921.	Tu (vuanhtu52)	3	81.53	90.12	0	0.00
27922.	Vrapas (vrapas)	3	57.05	61.35	2	66.67
27923.	Steven (vosstingy)	3	90.59	93.44	1	33.33
27924.	Charleston (voltricity)	3	61.59	66.83	2	66.67
27925.	Eshcole (volcanic515)	3	54.02	58.81	0	0.00
27926.	Shukrullo (vodiylik)	3	59.83	64.07	0	0.00
27927.	Vaughn (vlonebay)	3	63.32	64.48	1	33.33
27928.	Vladimir (vladimirrl)	3	135.66	154.38	3	100.00
27929.	vitus (vituschabreholm)	3	50.49	51.61	0	0.00
27930.	vishnukumar (vishnu_kumar)	3	51.47	54.08	1	33.33
27931.	vishal (vishal2005)	3	72.53	81.26	0	0.00
27932.	V (vinn9)	3	66.64	67.67	1	33.33
27933.	Said (villager4)	3	78.76	84.36	0	0.00
27934.	vic (vikk1234)	3	72.71	78.08	0	0.00
27935.	vikash (vikash_hembram)	3	58.04	65.09	1	33.33
27936.	viixonn (viixonn)	3	33.21	37.23	1	33.33
27937.	Vihanga (vihangatheturtle)	3	40.73	47.08	0	0.00
27938.	Vihaan (vihaan89)	3	70.81	85.71	1	33.33
27939.	Vince (vietzerg)	3	82.60	85.46	0	0.00
27940.	Wouter (victorylion97)	3	104.25	105.75	0	0.00
27941.	Victor (victorsaurus)	3	98.32	105.99	1	33.33
27942.	Anip (vibeth)	3	97.72	109.54	1	33.33
27943.	Androide (vforvali)	3	91.25	96.87	2	66.67
27944.	Vivian (vesperine)	3	122.70	144.38	2	66.67
27945.	Omar (versohnne_1)	3	102.86	116.00	3	100.00
27946.	Verilly (verilly)	3	91.12	95.84	3	100.00
27947.	Ashutosh (vegeta_2001)	3	64.06	68.39	1	33.33
27948.	veeru (veeru_05)	3	33.06	34.29	0	0.00
27949.	Romeo (vatecoucher21)	3	80.54	83.68	0	0.00
27950.	Varenuk (varenuk)	3	79.24	88.13	0	0.00
27951.	Antonio (vaping_tony96)	3	35.21	35.72	0	0.00
27952.	Vanja (vanjamc)	3	66.19	70.15	1	33.33
27953.	Ivan (vanchi822)	3	44.90	51.44	0	0.00
27954.	Tayden (vanage)	3	60.11	64.06	2	66.67
27955.	Zaire (vamsire)	3	85.65	94.92	1	33.33
27956.	vamoshi (vamoshi)	3	71.54	73.12	0	0.00
27957.	Valzor (valzor)	3	94.66	97.69	2	66.67
27958.	(valikor)	3	133.05	138.87	3	100.00
27959.	vaintez (vaintez)	3	92.09	107.90	1	33.33
27960.	Goodwill (vadrone)	3	76.45	88.82	0	0.00
27961.	Banana (vadai)	3	58.50	61.02	0	0.00
27962.	Vache (vacheka)	3	89.54	96.38	0	0.00
27963.	David (u_david)	3	63.12	65.66	2	66.67
27964.	Bob (user4)	3	79.67	82.51	0	0.00
27965.	gusss (ursu718)	3	75.21	76.17	2	66.67
27966.	Uriel (urielhainzl)	3	99.50	107.63	2	66.67
27967.	Aarsh (upward_leap)	3	75.18	85.29	0	0.00
27968.	Katelyn (upperbutt)	3	133.69	143.64	1	33.33
27969.	Bartek (unua)	3	82.42	85.43	0	0.00
27970.	Guus (untitledgoos)	3	46.27	49.49	1	33.33
27971.	UnSeen212 (unseen212)	3	79.79	87.92	2	66.67
27972.	unknowndivide (unknowndivide)	3	54.01	59.70	0	0.00
27973.	Aaron (unhuggity)	3	91.01	97.19	1	33.33
27974.	Illusive (uneducated_scholar)	3	59.93	66.22	0	0.00
27975.	Johnathan (uneasybbj)	3	77.58	78.57	0	0.00
27976.	undecipherable (undeciphera...	3	34.61	35.56	0	0.00
27977.	uncle jiggy (unclejiggy)	3	73.00	80.90	1	33.33
27978.	Christian (umadandrei)	3	90.54	93.23	1	33.33
27979.	Reniar (ulaner1_)	3	85.84	91.66	2	66.67
27980.	Ulaai (ulaai)	3	61.71	65.43	1	33.33
27981.	Vincent (uincent)	3	60.38	62.18	0	0.00
27982.	brandan (uepuejq)	3	123.96	137.92	2	66.67
27983.	Thomas (uedoh)	3	111.38	113.91	1	33.33
27984.	Ken (tzekenster)	3	111.72	113.64	3	100.00
27985.	Andy (tyranttick)	3	111.91	115.40	1	33.33
27986.	Tommy (typrtommy)	3	67.98	73.51	3	100.00
27987.	typos (typos247)	3	50.21	52.70	0	0.00
27988.	NEVER RESET (typing_is_hard...	3	109.98	113.16	0	0.00
27989.	type (typesuck)	3	71.25	73.85	0	0.00
27990.	Nah (typereally)	3	82.80	89.35	3	100.00
27991.	benzhayeed (typemaster2004)	3	53.81	56.86	0	0.00
27992.	Robert (typefingerpl)	3	87.28	89.54	0	0.00
27993.	e (typecrazyyy)	3	65.63	69.33	0	0.00
27994.	Tyler (tylerota2)	3	103.07	111.88	2	66.67
27995.	Bryan (tylanstor)	3	118.87	131.00	2	66.67
27996.	Tarun (twyoooo)	3	69.03	72.11	0	0.00
27997.	Two - (twojokers)	3	82.75	89.67	2	66.67
27998.	TvHead (tvhead)	3	71.93	81.47	2	66.67
27999.	Heitor (tutesthetyper)	3	76.82	79.46	0	0.00
28000.	Johan (turbongus)	3	73.67	90.54	0	0.00
28001.	tuna (tunacore)	3	76.09	85.82	0	0.00
28002.	Trim (tuechombe)	3	87.34	90.00	2	66.67
28003.	Lucas (tublessdart)	3	74.89	76.74	1	33.33
28004.	Sinatec (ttv_sinatec)	3	88.86	102.29	2	66.67
28005.	Taylor (tttaylor)	3	93.62	107.16	3	100.00
28006.	Travis (ttomich)	3	41.23	43.38	1	33.33
28007.	t (ttha)	3	111.90	112.54	2	66.67
28008.	Terence (tt9000)	3	96.93	107.28	3	100.00
28009.	Ali (tsunali)	3	64.10	77.17	3	100.00
28010.	Tsogtbayar (tsogtbayarbox)	3	66.84	73.33	1	33.33
28011.	Raffael (tschuebi)	3	91.33	101.50	3	100.00
28012.	Parker (tsayp)	3	104.45	116.60	3	100.00
28013.	Aidan (tryingacrobat52)	3	58.11	59.50	0	0.00
28014.	Tryhardest (tryhardest)	3	93.61	100.63	3	100.00
28015.	Limbo (trulylimbogene)	3	110.28	115.28	1	33.33
28016.	Jake (truejake)	3	131.07	143.87	3	100.00
28017.	trucle (tructruc)	3	67.22	69.34	0	0.00
28018.	Michael (trotskyy)	3	48.00	50.97	0	0.00
28019.	Conner (tropicul)	3	85.90	106.08	2	66.67
28020.	trias (trobles)	3	66.38	74.50	1	33.33
28021.	Tristan (tristanhilton85)	3	89.41	92.17	0	0.00
28022.	Tristan (tristandavoulas)	3	104.48	108.52	2	66.67
28023.	Jonathan (trintrun2)	3	84.69	91.20	3	100.00
28024.	Typer_Guru (trinity_max)	3	50.43	51.94	2	66.67
28025.	Trihedral (trihedral)	3	110.72	116.22	1	33.33
28026.	Evan (trigger8)	3	69.95	77.11	0	0.00
28027.	Benji (triforce04)	3	74.12	77.31	0	0.00
28028.	Trey (trey113)	3	83.28	87.08	0	0.00
28029.	treesrnice (treesrnice)	3	76.60	84.15	1	33.33
28030.	Tommy (treemantom)	3	91.40	100.54	0	0.00
28031.	TrChik (trchik)	3	80.63	83.96	3	100.00
28032.	Trav (travm)	3	98.04	104.32	0	0.00
28033.	Travis (travisrussell)	3	64.98	74.22	1	33.33
28034.	Umbra (tratosian)	3	100.26	115.44	1	33.33
28035.	Treeler (trackertree)	3	46.43	54.96	0	0.00
28036.	Tozu (tozu2)	3	108.74	117.28	1	33.33
28037.	Tom (totallytom)	3	66.25	67.01	0	0.00
28038.	Tortol (tortol)	3	108.43	112.23	0	0.00
28039.	Vulcan_Onion (top500pro)	3	52.25	61.19	0	0.00
28040.	Andre (toothpickjanitor)	3	57.74	61.55	0	0.00
28041.	chipmunk (tonyboi)	3	90.03	93.48	2	66.67
28042.	Tonmai (tonmaiisawesome)	3	91.03	104.28	2	66.67
28043.	tomtom (tomtomm)	3	104.38	124.57	1	33.33
28044.	To (tomo01)	3	100.87	106.20	1	33.33
28045.	Viper (tomp2)	3	60.89	66.03	0	0.00
28046.	Tommy (tomdollars)	3	72.74	74.00	0	0.00
28047.	Vincent (tokiix)	3	130.22	133.44	3	100.00
28048.	Tobie (tobberd)	3	89.16	94.55	0	0.00
28049.	natetron (toasterboy5)	3	116.33	131.99	1	33.33
28050.	T_nology (tnology)	3	112.46	121.31	3	100.00
28051.	Travis (tjgrant309)	3	103.31	122.71	2	66.67
28052.	Tina (tinanuggi)	3	107.46	115.52	0	0.00
28053.	Tiffany Hwang (tiffany_hwang)	3	85.92	99.28	1	33.33
28054.	(tieninator07)	3	81.10	85.96	0	0.00
28055.	Tidez (tidez3)	3	87.42	89.43	1	33.33
28056.	Amin (thyfoeracer)	3	111.29	118.74	1	33.33
28057.	JOHN (thunderstormsamset)	3	51.86	56.02	0	0.00
28058.	thunder (thundersico)	3	64.00	67.60	0	0.00
28059.	Thunderer (thunderer)	3	57.32	66.35	1	33.33
28060.	Dorian (thrashdivision)	3	64.97	86.94	1	33.33
28061.	Thomas (thomasgp98)	3	81.03	84.22	0	0.00
28062.	drywalleater34 (thiccblah_)	3	98.17	108.61	1	33.33
28063.	Kevin (the_pacifist)	3	68.10	74.21	1	33.33
28064.	Shreyas (the_mediocre_gatsby)	3	38.56	41.62	0	0.00
28065.	Dipu Kumar (the_marvello_op)	3	56.10	62.67	1	33.33
28066.	Leo (the_e_lemonator)	3	97.38	108.53	2	66.67
28067.	They23 (they23)	3	78.09	84.23	1	33.33
28068.	TheUnMin (theunmin)	3	83.43	90.43	3	100.00
28069.	tech (thetechboy)	3	109.80	114.70	1	33.33
28070.	devinkhell (thesilverbrid)	3	95.33	101.51	1	33.33
28071.	Joshua (thesensinator)	3	130.71	134.10	2	66.67
28072.	Christian (theponce88)	3	79.15	81.97	0	0.00
28073.	TheMining72 (themining72)	3	89.03	97.77	2	66.67
28074.	Sebastian (themanblevins)	3	76.19	80.68	1	33.33
28075.	based (thelettuceman)	3	63.34	66.04	0	0.00
28076.	TheKRAM (thekram)	3	89.35	91.25	1	33.33
28077.	NahFam (thekojiman)	3	77.08	81.82	2	66.67
28078.	A (thekingwindsor)	3	65.74	71.48	0	0.00
28079.	M. (thehoaxshow)	3	73.84	78.29	0	0.00
28080.	godspeed (thegr8kabeer)	3	69.04	69.75	0	0.00
28081.	Casey (thefearedturtle)	3	96.53	100.75	3	100.00
28082.	TheEwaffle (theewaffle)	3	65.44	66.99	0	0.00
28083.	Rusterton (theeg3)	3	92.51	104.70	0	0.00
28084.	Radford (theegg)	3	78.62	82.23	1	33.33
28085.	adin (thedvoraktypist)	3	116.29	118.59	1	33.33
28086.	A (thedirtysouth)	3	78.61	88.25	0	0.00
28087.	bk (thebriankwon)	3	104.12	114.85	0	0.00
28088.	Adam (thebeast1235)	3	68.80	79.52	0	0.00
28089.	Ichiro (theanalyst9344)	3	81.78	87.81	0	0.00
28090.	TheAluMinion (thealuminion)	3	95.06	98.14	1	33.33
28091.	Tristan (thavelick)	3	60.57	64.75	0	0.00
28092.	Guy (thatguyrsa)	3	50.48	56.11	0	0.00
28093.	Bradley (tgun)	3	121.41	128.07	1	33.33
28094.	Burrito (tgmburrito)	3	92.27	100.69	0	0.00
28095.	Tezzori (tezzori_ikki)	3	75.16	83.44	1	33.33
28096.	Tey (teyy)	3	67.19	69.61	1	33.33
28097.	Tevanuk (tevanuk)	3	75.54	78.75	0	0.00
28098.	tengen (tete_12)	3	74.68	85.53	1	33.33
28099.	Jordy (testingkeyboard)	3	90.32	96.88	1	33.33
28100.	Tesseus (tesseus)	3	107.87	123.16	1	33.33
28101.	TEMUCHIN (temuchin)	3	21.20	23.14	0	0.00
28102.	pat (teloi)	3	97.01	102.61	2	66.67
28103.	Naufal (tehonionpotato)	3	80.51	93.60	1	33.33
28104.	TeeDoe (teedoe)	3	74.43	80.16	1	33.33
28105.	Austin (teddy_0351)	3	62.27	67.75	2	66.67
28106.	Taylor (tayylorngo)	3	108.36	113.84	2	66.67
28107.	TayyabPW (tayyabpw)	3	96.19	101.63	1	33.33
28108.	Taukekhan (taukekhan)	3	58.39	67.53	0	0.00
28109.	Steven (tasgu)	3	82.17	99.82	0	0.00
28110.	yst (taro311)	3	119.28	125.21	3	100.00
28111.	Alexander (taklit)	3	83.07	91.94	2	66.67
28112.	Rustylee (tairl)	3	94.40	105.59	3	100.00
28113.	Erek-Shin (t0sh1ro)	3	87.56	91.39	1	33.33
28114.	szxlfik (szxlfik)	3	75.15	78.71	2	66.67
28115.	Evan (syzer7)	3	68.36	72.60	0	0.00
28116.	Kelvin (syraxius)	3	172.04	173.66	3	100.00
28117.	sylk (sylk28)	3	92.69	104.14	2	66.67
28118.	SwordSwarm (swordswarm)	3	98.90	106.94	2	66.67
28119.	bruh (swordsbeef)	3	76.42	85.19	0	0.00
28120.	Reno (swifturtle)	3	91.09	92.75	2	66.67
28121.	Luke (swarmington5)	3	70.64	80.74	2	66.67
28122.	donald balls (swag_man_unli...	3	88.54	93.10	1	33.33
28123.	Sonia (swagaholik)	3	102.30	110.68	1	33.33
28124.	Steven (sw66666)	3	90.80	94.32	1	33.33
28125.	Suze (suze_com)	3	77.90	80.35	1	33.33
28126.	Joshua (suresoar)	3	41.34	43.06	0	0.00
28127.	Stefan (superman0904)	3	83.92	88.50	0	0.00
28128.	Andy (superchubs)	3	99.98	102.60	2	66.67
28129.	xiaobai (superbarnie)	3	117.49	120.79	1	33.33
28130.	Eden (sunkmantis)	3	87.24	92.32	1	33.33
28131.	Sun (suncrusader)	3	100.08	109.49	2	66.67
28132.	Sunaiart (sunaiart)	3	88.84	94.44	0	0.00
28133.	SuKu (suku_586)	3	80.15	88.18	1	33.33
28134.	Suka (sukab1itz)	3	82.07	89.12	1	33.33
28135.	Sujith (sujith2005)	3	75.03	85.45	0	0.00
28136.	bigfatchickan (suchaslowpoke)	3	79.64	88.27	1	33.33
28137.	suchcookies (suchcookies)	3	66.56	68.37	0	0.00
28138.	Subhankar (subhankarch)	3	54.17	60.39	0	0.00
28139.	suancreative (suancreative)	3	70.95	75.62	1	33.33
28140.	Dan (stun100)	3	58.72	68.80	0	0.00
28141.	S (stu217)	3	113.28	122.78	2	66.67
28142.	Wietse (stroopwafel123)	3	82.27	88.08	0	0.00
28143.	Striker (strikerfury)	3	78.81	85.53	2	66.67
28144.	StrawHat (strawhat_amine)	3	64.05	64.75	1	33.33
28145.	Daniel (stompy361)	3	48.50	50.10	0	0.00
28146.	Ollie (stillcanttouchtype)	3	76.41	85.45	0	0.00
28147.	Steve (stevehauser11)	3	50.12	50.89	0	0.00
28148.	Steve (steveeeeeeeeeeee2)	3	92.05	100.02	0	0.00
28149.	Jashua (stelless)	3	92.00	111.22	0	0.00
28150.	Stella (stellafav)	3	115.09	128.84	1	33.33
28151.	SteffVz (steffvz)	3	60.82	65.72	1	33.33
28152.	sander (starkseven)	3	47.32	49.10	0	0.00
28153.	poop (stanloon1231)	3	108.14	118.13	1	33.33
28154.	Danish (stampynoob)	3	54.61	56.12	0	0.00
28155.	Saurabh (ssb456)	3	20.09	21.64	0	0.00
28156.	COCO (sryulose)	3	93.85	99.64	0	0.00
28157.	Sri Akshya (sri_akshya)	3	72.22	81.98	0	0.00
28158.	zoomingfastaf (imfastafb0i)	3	85.76	91.81	0	0.00
28159.	Victor (sravn)	3	102.68	114.55	2	66.67
28160.	Paraducks (sras208)	3	28.85	31.75	0	0.00
28161.	Squidyguin (squidyguin)	3	68.33	69.86	0	0.00
28162.	Nich (squiddyjohnlong)	3	44.31	46.53	0	0.00
28163.	David (squeetus)	3	121.06	126.17	2	66.67
28164.	Squeeb (squeeb)	3	76.71	101.57	1	33.33
28165.	Miles (squarepeanut)	3	70.08	80.62	2	66.67
28166.	SPOU1 (spou1)	3	37.52	43.93	0	0.00
28167.	Spookee (spookee)	3	84.57	93.50	1	33.33
28168.	spiky (spikyy)	3	114.88	120.34	2	66.67
28169.	hehe (spicyaim)	3	87.50	90.70	1	33.33
28170.	S (spencers0730)	3	67.35	76.51	0	0.00
28171.	spelling (spellingglitch)	3	82.96	84.74	0	0.00
28172.	Speed (speed_weed1)	3	92.21	102.74	2	66.67
28173.	Speed Typing (speedytypingyt)	3	128.34	137.63	3	100.00
28174.	fastboi (speedofwhite)	3	102.69	119.60	2	66.67
28175.	w (speeder_skrr)	3	105.24	119.81	1	33.33
28176.	Mike (specialized)	3	96.18	103.05	1	33.33
28177.	Sparik (sparik)	3	88.57	89.95	1	33.33
28178.	Glenn (spanishomelette)	3	81.25	94.95	1	33.33
28179.	spacy (spacyarie)	3	60.32	71.90	1	33.33
28180.	Richie (sovitou)	3	88.54	101.88	1	33.33
28181.	souvlakeeb (souvlakeeb)	3	66.15	71.55	1	33.33
28182.	SoundtrackDan (soundtrackdan)	3	110.21	120.70	2	66.67
28183.	Jeffrey (sorisque)	3	103.93	106.67	0	0.00
28184.	Sky (soranohana)	3	67.69	73.54	0	0.00
28185.	justin (sonzoffury)	3	91.35	97.79	1	33.33
28186.	sondosensei (sondosensei)	3	88.38	100.61	0	0.00
28187.	solarwind (solarwind75)	3	59.10	75.82	1	33.33
28188.	EINSWOOD (solaire119)	3	105.57	113.22	1	33.33
28189.	Iamslow (softshui)	3	110.16	114.53	2	66.67
28190.	Snowy (snowyhessh)	3	118.62	127.46	2	66.67
28191.	Savannah (snowyaussie)	3	122.19	131.82	3	100.00
28192.	Sayan (snbk97)	3	48.11	51.26	0	0.00
28193.	Snugget (snaiel)	3	76.85	88.52	1	33.33
28194.	Xavi (smithtimmytim)	3	62.64	64.33	2	66.67
28195.	Smine (sminerino)	3	84.43	98.79	0	0.00
28196.	eldon (smile4dasight)	3	84.97	89.22	1	33.33
28197.	rt (smigglewiggle23)	3	64.74	68.75	3	100.00
28198.	kkgbyn (slyle)	3	129.04	140.10	1	33.33
28199.	John Brent (slow_turtle6278)	3	50.57	51.75	1	33.33
28200.	Aidan (slowdownplz)	3	54.23	63.16	0	0.00
28201.	tico (slowcheetah)	3	72.86	73.99	0	0.00
28202.	Jacob (slipperysloper)	3	64.01	71.99	1	33.33
28203.	Slim (slimshady2000)	3	93.25	94.37	2	66.67
28204.	Slim (slimjesus2)	3	89.10	89.63	1	33.33
28205.	zach (slickzach)	3	84.87	89.55	2	66.67
28206.	[SMURTEX] (slenex_yt)	3	79.51	82.76	2	66.67
28207.	Micah (slenderhog)	3	40.50	43.99	0	0.00
28208.	Shaun (sladerrr)	3	70.68	73.58	0	0.00
28209.	Skyler (skylerlsx)	3	83.39	89.85	0	0.00
28210.	SkyDarkBomber (skydarkbomber)	3	70.75	78.81	1	33.33
28211.	Dominic (skrrt_pull_up)	3	50.77	63.76	2	66.67
28212.	Law (skreeblenutz)	3	95.86	100.48	0	0.00
28213.	Arturo (skikdo)	3	105.40	123.83	1	33.33
28214.	Skift (skift2)	3	70.24	79.03	1	33.33
28215.	Joey (sjuney)	3	108.08	118.29	2	66.67
28216.	Travis (sixyn)	3	132.39	154.93	2	66.67
28217.	sitong (sitong)	3	72.12	72.81	0	0.00
28218.	Jacob (siskonwich)	3	116.23	124.82	1	33.33
28219.	Daniel (sirwatson)	3	77.08	79.87	0	0.00
28220.	sirpotatojoe (sirpotatojoe)	3	124.11	128.54	2	66.67
28221.	com (sin_ical)	3	88.21	90.05	2	66.67
28222.	Curie (silverfox420)	3	60.63	64.06	0	0.00
28223.	Sidiq (sidiqbheem)	3	81.79	85.58	2	66.67
28224.	Siddhant (siddhantprateek)	3	41.06	44.76	1	33.33
28225.	Sicao (sicao)	3	80.39	86.86	2	66.67
28226.	Sibert (sibert)	3	65.30	66.81	2	66.67
28227.	Sithu (siaung)	3	84.92	89.42	1	33.33
28228.	Leex (shyen1337)	3	80.73	85.41	1	33.33
28229.	Shuggi (shuggi)	3	67.03	72.62	0	0.00
28230.	shua (shuaskies)	3	107.60	109.15	2	66.67
28231.	Shocker (shockerzap)	3	57.12	57.72	2	66.67
28232.	pj (shmarcus)	3	69.62	73.49	3	100.00
28233.	Hari Krishnan (shk_1)	3	43.18	45.88	0	0.00
28234.	Shivam (shivamg)	3	59.47	63.85	0	0.00
28235.	水色#0001 (shirogane_ao)	3	122.47	128.26	1	33.33
28236.	Daniel (shifu254)	3	65.25	70.45	0	0.00
28237.	Dulat (shershen)	3	46.06	50.68	0	0.00
28238.	Sheen (sheendinner)	3	104.95	112.43	3	100.00
28239.	Shashank (shashank_typer)	3	86.36	90.73	2	66.67
28240.	Sharktooth (sharktoothx)	3	49.45	54.01	0	0.00
28241.	Hashim (sharkh)	3	91.26	93.04	1	33.33
28242.	Shanu (shanu777)	3	63.79	73.03	1	33.33
28243.	Mason (shankydanky)	3	52.42	54.75	0	0.00
28244.	naruto (shahzadak09)	3	62.52	70.25	3	100.00
28245.	Fahim (shahriar193)	3	46.55	50.20	1	33.33
28246.	Shahan (shahanneda)	3	92.21	93.86	3	100.00
28247.	Shagnik (shagnik)	3	95.77	102.33	1	33.33
28248.	Kirumi (shady_blaze0o0)	3	44.28	48.41	0	0.00
28249.	Stephan (shadwgod)	3	83.37	95.21	1	33.33
28250.	Willey (shadowheart123)	3	102.03	103.13	1	33.33
28251.	Shadd (shaddahmed)	3	43.78	46.29	0	0.00
28252.	Benito (sevilre)	3	127.75	128.83	2	66.67
28253.	Ahmed (severianx)	3	60.73	65.07	0	0.00
28254.	Leo (senpaileo)	3	47.08	50.98	0	0.00
28255.	Seneca (senecamanu)	3	105.35	112.14	3	100.00
28256.	wao (sendnudesplease)	3	82.31	96.66	1	33.33
28257.	Seman (semantan06)	3	52.06	56.24	1	33.33
28258.	Sedlynne (sedlynne)	3	37.19	37.70	0	0.00
28259.	Seal (seal5059)	3	109.45	121.64	3	100.00
28260.	Conner (seacitysound)	3	74.81	76.86	0	0.00
28261.	Asian (sdf415)	3	92.99	96.93	0	0.00
28262.	James (scrubinatub)	3	80.37	85.85	1	33.33
28263.	Scratchyjo (scratchyjo)	3	78.08	86.53	1	33.33
28264.	Jakub (scrappycz)	3	45.29	47.29	0	0.00
28265.	Alexandre (malfortune)	3	85.37	91.05	1	33.33
28266.	Melvin :) (malevolant_melvin)	3	58.10	61.98	0	0.00
28267.	Jacob Miko (makoton815)	3	87.55	91.96	2	66.67
28268.	3DMakerKid (makerkid)	3	81.68	96.77	1	33.33
28269.	Mahar (maharkamran01)	3	85.80	89.10	1	33.33
28270.	Firstene (magikarpusedfly)	3	51.49	59.35	1	33.33
28271.	ray (magicsticks)	3	86.28	96.82	1	33.33
28272.	Mae (maesmith)	3	87.54	91.16	1	33.33
28273.	Nick (maddogitb)	3	93.73	96.63	3	100.00
28274.	SnaccAllister (mactrey)	3	104.61	109.50	3	100.00
28275.	Macmed (macmed)	3	80.24	87.80	0	0.00
28276.	Macintosh (macintosh_fan)	3	99.15	103.01	3	100.00
28277.	Karlo (m4china)	3	66.98	72.95	0	0.00
28278.	James (m33pit)	3	107.68	115.46	2	66.67
28279.	m (m1604)	3	79.88	89.66	0	0.00
28280.	Lily ^& (lysbparker)	3	66.57	72.44	3	100.00
28281.	lyricata (lyricata)	3	26.43	28.31	1	33.33
28282.	Joshua (lyodd90)	3	121.81	131.45	1	33.33
28283.	lynn (lynniee)	3	70.86	75.05	0	0.00
28284.	Lydia (lydia_sol)	3	58.97	61.80	1	33.33
28285.	lxvxnderry (lxvxnderry)	3	64.58	71.33	1	33.33
28286.	Force (lv_force_vl)	3	59.56	67.03	1	33.33
28287.	namln.com (luunhatnam)	3	75.76	78.23	0	0.00
28288.	YEP (lumpytacos)	3	55.30	63.40	1	33.33
28289.	autoelk (lukefly2)	3	100.14	110.32	2	66.67
28290.	Lukas (lukbuz)	3	54.02	55.43	0	0.00
28291.	Lukas (lukasdw)	3	60.29	60.67	0	0.00
28292.	lucky3495 (lucky3495)	3	56.36	57.90	2	66.67
28293.	Luc1d (luc1d_on_typeracer)	3	50.97	57.49	1	33.33
28294.	tadiyos (lt_tad)	3	71.74	79.93	1	33.33
28295.	Loydox8930 (loydox8930)	3	55.64	63.31	0	0.00
28296.	Sam (loverofpi)	3	71.96	84.91	1	33.33
28297.	Tanishq (lovely_singh)	3	46.34	48.31	1	33.33
28298.	Darius (lovefirecrackers)	3	84.06	98.52	1	33.33
28299.	Your (lor14510)	3	72.66	77.19	2	66.67
28300.	🐱👤 (loomi)	3	127.16	140.22	2	66.67
28301.	Greg (lolzface)	3	108.53	111.85	2	66.67
28302.	lollylols1 (lollylols1)	3	63.12	67.72	1	33.33
28303.	Mflop (lolgetmoorekt)	3	86.32	94.62	1	33.33
28304.	Alpha (lolcat81)	3	71.58	76.67	0	0.00
28305.	lokill (lokillfm)	3	39.80	45.36	1	33.33
28306.	Loco (locomagoes)	3	91.88	96.83	2	66.67
28307.	Pedro (lobin)	3	42.18	43.45	0	0.00
28308.	Loay (loayahmed)	3	91.93	104.73	1	33.33
28309.	LKB (lkb1)	3	108.33	133.24	1	33.33
28310.	Liz (lizchu413)	3	110.92	141.51	1	33.33
28311.	Sam (live2cube)	3	62.27	64.33	0	0.00
28312.	Peter (litoprobka)	3	68.40	75.66	3	100.00
28313.	Kataalyst (litextreme)	3	119.73	129.25	3	100.00
28314.	Jeff (litboi101)	3	115.21	132.66	2	66.67
28315.	Lisa (lis__)	3	53.80	56.51	1	33.33
28316.	Qiwei (liqiwei)	3	74.12	80.43	1	33.33
28317.	Banana (lippicp)	3	48.05	54.78	0	0.00
28318.	George (linkopen)	3	124.65	135.96	2	66.67
28319.	Raimi (limeykun)	3	107.73	126.42	1	33.33
28320.	Emil (lime03)	3	56.73	58.34	1	33.33
28321.	lillu (lilluwu)	3	96.22	132.64	0	0.00
28322.	edith (lilloser)	3	38.09	41.41	0	0.00
28323.	Leo (lileo261)	3	76.89	80.86	1	33.33
28324.	Dorothy (lildottycat)	3	38.70	42.82	1	33.33
28325.	Justin (lightningvoltix)	3	88.40	89.56	1	33.33
28326.	Libby (libbyrozzi)	3	81.94	85.31	1	33.33
28327.	Dark (lewpur)	3	123.06	139.74	3	100.00
28328.	Suparno (letsbecool)	3	55.10	59.53	2	66.67
28329.	Matti (lerssi_)	3	53.60	59.00	0	0.00
28330.	Leon (leon882888)	3	45.60	47.40	0	0.00
28331.	LEO (leolelele)	3	72.02	90.44	2	66.67
28332.	Leoinas (leoinas7)	3	78.99	83.20	0	0.00
28333.	LenY (lenyx24)	3	65.40	83.09	0	0.00
28334.	Len (lennonisbest)	3	86.18	90.93	0	0.00
28335.	lemonwaterr (lemonwaterr)	3	87.29	91.74	1	33.33
28336.	Daan (lemonob)	3	81.71	89.03	1	33.33
28337.	Ludvig (lelzarenn)	3	84.39	91.42	0	0.00
28338.	Daniel (leinad_32)	3	82.49	96.27	1	33.33
28339.	Leifman (leifman)	3	110.54	113.45	2	66.67
28340.	Oonga (legoarmyguy223)	3	60.36	61.64	3	100.00
28341.	Lee (leeulrich)	3	78.89	83.75	1	33.33
28342.	eat4free (leewei05)	3	55.37	57.63	0	0.00
28343.	leetuser (leetuser)	3	69.36	73.89	1	33.33
28344.	Melvin (lechero)	3	50.48	58.89	0	0.00
28345.	Leax (leax)	3	52.07	54.23	0	0.00
28346.	leah (leannah)	3	139.63	161.94	2	66.67
28347.	William (lazerpie)	3	82.67	87.18	2	66.67
28348.	Valera (layge)	3	32.66	33.18	0	0.00
28349.	lawrence (lawrence_nguyen)	3	60.67	64.37	0	0.00
28350.	lawnardo (lawnardo)	3	101.29	114.98	3	100.00
28351.	Lauren (lauren_conrad)	3	114.32	126.88	0	0.00
28352.	Lauge (laugejuul14)	3	72.71	79.47	1	33.33
28353.	Last (last220)	3	60.88	64.09	1	33.33
28354.	Lapis (lapisor)	3	84.77	94.80	3	100.00
28355.	Lana (lana121)	3	69.53	74.76	0	0.00
28356.	Ben (lalbtyd25)	3	92.72	104.86	2	66.67
28357.	Wei Quan (laiweiquan)	3	57.96	60.80	1	33.33
28358.	Michael (kyrano)	3	91.38	100.69	1	33.33
28359.	Vannei (kymaz)	3	47.79	48.69	1	33.33
28360.	KYLECUMBER (kylecumber)	3	56.76	62.02	0	0.00
28361.	ky (kyajin)	3	136.12	144.74	0	0.00
28362.	James (kwequay)	3	106.69	109.93	0	0.00
28363.	Wrenpy (kuwabaro)	3	66.85	80.46	1	33.33
28364.	Kurtis (kurtino)	3	125.73	153.40	3	100.00
28365.	Kuripa (kuripa)	3	70.35	74.42	0	0.00
28366.	Ivan (kuleee)	3	75.63	79.89	1	33.33
28367.	Kris (ktale007)	3	78.14	81.29	1	33.33
28368.	Taylor (kryxilis)	3	78.32	89.32	0	0.00
28369.	SlowTyperT-T (krusty_krab10)	3	89.47	100.14	0	0.00
28370.	krt_ (krt_)	3	87.31	95.91	1	33.33
28371.	Kristóf (kristofy)	3	60.04	66.10	0	0.00
28372.	Kristen (kristenb225)	3	59.76	62.34	0	0.00
28373.	Kristina (krisl9)	3	67.82	72.35	0	0.00
28374.	Krish (krishkat)	3	94.19	107.90	1	33.33
28375.	Krafci (krafcisky)	3	71.88	75.67	1	33.33
28376.	koya (koya8)	3	79.16	84.95	0	0.00
28377.	Neyo (kouheisan)	3	78.34	86.32	2	66.67
28378.	i am slower than you (koplkop)	3	80.88	85.88	0	0.00
28379.	Ishan (kooshnoo)	3	74.09	82.68	1	33.33
28380.	Alireza (kolento79)	3	47.02	49.42	1	33.33
28381.	Koi (koisoysauce)	3	112.75	118.48	0	0.00
28382.	Kohlis (kohlis)	3	73.53	75.97	0	0.00
28383.	Knyq (knyq_626)	3	93.81	96.63	1	33.33
28384.	Jacob (klosure)	3	66.25	69.32	0	0.00
28385.	KlokkisRacer (klokkis_utfor...	3	69.88	82.37	0	0.00
28386.	Che (klimkeyboard)	3	46.28	51.60	0	0.00
28387.	shaked (kknify)	3	109.93	121.10	3	100.00
28388.	kiwomi (kiwomi)	3	38.69	45.47	0	0.00
28389.	Kishore (kishorep)	3	87.47	92.82	2	66.67
28390.	Biscuit. (kiokuru)	3	117.20	127.12	3	100.00
28391.	amk (kingyboi42)	3	74.26	82.21	1	33.33
28392.	Kincaid (kincaida)	3	88.65	92.81	0	0.00
28393.	Mik (kimses12)	3	65.87	70.41	0	0.00
28394.	Kimo (kimota)	3	96.34	107.53	1	33.33
28395.	ICEMAN (kimoas)	3	64.59	72.45	1	33.33
28396.	James (kimandoxs)	3	78.72	99.65	0	0.00
28397.	The great (killerlee3245)	3	31.49	33.73	1	33.33
28398.	Ahmed (killer549)	3	45.54	47.39	1	33.33
28399.	Andres (kikikiros)	3	68.52	76.82	0	0.00
28400.	Kieyas (kieyas)	3	51.46	55.90	0	0.00
28401.	Stephen (kibasa)	3	121.04	137.87	2	66.67
28402.	Thomas (khoaph)	3	48.16	50.94	3	100.00
28403.	Jessica (khalia12)	3	74.29	83.08	0	0.00
28404.	co-pilot (keyboardlogger)	3	62.00	67.10	0	0.00
28405.	FSH (kevm8888)	3	104.10	106.87	0	0.00
28406.	Kevin (kevinpamberg)	3	80.37	88.14	2	66.67
28407.	Kevin (kevgelblitz)	3	62.84	64.45	0	0.00
28408.	Ketki (ketki611)	3	48.43	52.20	0	0.00
28409.	Ketchup (ketchupsokies)	3	86.05	89.95	1	33.33
28410.	Karol (kerol0)	3	85.26	89.81	1	33.33
28411.	Andres (kerchingle)	3	98.26	103.36	0	0.00
28412.	Omni (kenkaster001)	3	77.75	85.19	2	66.67
28413.	Jan (kenaj)	3	80.24	86.60	0	0.00
28414.	Kelly (kellyyah)	3	111.81	113.58	1	33.33
28415.	kellyfunk (kellyfunk)	3	95.18	112.01	1	33.33
28416.	Keegan (kekky)	3	88.10	95.59	0	0.00
28417.	Keex (keex)	3	87.01	96.53	1	33.33
28418.	Keepito (keepito1337)	3	114.45	121.60	2	66.67
28419.	keaten (keaten)	3	88.70	97.29	1	33.33
28420.	Keago (keago)	3	82.81	87.19	1	33.33
28421.	Daniel (kd19lio)	3	68.92	72.78	0	0.00
28422.	Justiss is the best (kbeast)	3	130.02	143.89	3	100.00
28423.	Azamat (kayoshi)	3	90.76	93.75	3	100.00
28424.	Kaya Toast (kaya_toast)	3	74.91	101.09	3	100.00
28425.	kaya (kayawaffle)	3	58.02	60.31	0	0.00
28426.	Katrina (katkatkat)	3	77.34	80.27	1	33.33
28427.	CiscoAdmin (kaszanka12)	3	103.96	107.70	1	33.33
28428.	Kandanai (karnnypicture)	3	49.84	51.07	0	0.00
28429.	Karolis (karolingas01)	3	62.68	64.49	1	33.33
28430.	Laziness (karinoshuka)	3	105.58	108.73	2	66.67
28431.	Karsen (karguy2)	3	78.48	82.54	0	0.00
28432.	Abulqadir (kaore)	3	62.88	64.68	1	33.33
28433.	Kanvaro (kanvaro)	3	102.40	112.00	2	66.67
28434.	Kang (kangplz)	3	79.98	83.55	2	66.67
28435.	John Clarence (kamoteforce)	3	95.51	105.26	0	0.00
28436.	Kamyk (kamiszewskyy)	3	69.05	74.62	1	33.33
28437.	Murray (kamenz)	3	63.52	65.87	0	0.00
28438.	Andrey (kalida)	3	34.18	43.02	0	0.00
28439.	Ramazan (kalash)	3	45.54	49.26	0	0.00
28440.	Vu1can (kaiayush)	3	30.28	35.16	2	66.67
28441.	Kage (kagealan)	3	68.22	76.25	0	0.00
28442.	jarit (kaastype)	3	37.50	38.36	1	33.33
28443.	meowskullsfeetfreaks (k7x1e)	3	46.43	51.92	3	100.00
28444.	Kat (k4t3)	3	103.28	111.86	1	33.33
28445.	Jojo (j_oey)	3	88.78	91.48	1	33.33
28446.	João (jvvv)	3	85.65	89.34	1	33.33
28447.	J (jv8111)	3	113.28	119.55	3	100.00
28448.	juuuws (juuuws)	3	76.97	79.96	1	33.33
28449.	Xavier (justxav)	3	86.23	92.37	3	100.00
28450.	Just (justalittlewolf)	3	87.96	91.82	1	33.33
28451.	Jun Wen (junwen)	3	62.18	70.39	0	0.00
28452.	Ronit (juniorvid)	3	96.03	98.69	1	33.33
28453.	jun (junhan)	3	40.96	45.18	0	0.00
28454.	Junaed (junaed_siam)	3	75.34	81.82	1	33.33
28455.	Junion (jun1on)	3	112.68	130.60	3	100.00
28456.	Julian (julianwonghi)	3	113.83	119.05	2	66.67
28457.	Julian (julianmonk)	3	45.68	50.09	0	0.00
28458.	jugal kishor (jugal_sahu)	3	66.33	69.83	2	66.67
28459.	Jude (judeavery)	3	71.96	74.29	0	0.00
28460.	Juan (juanpunch)	3	85.92	91.64	1	33.33
28461.	Jose (jtrrazo_21)	3	49.81	53.39	2	66.67
28462.	Jackson (jtrainpdx1)	3	97.46	100.51	2	66.67
28463.	jTnqr (jtnqr)	3	66.88	77.43	2	66.67
28464.	johnnyboy (jstav)	3	94.43	100.84	2	66.67
28465.	Jack (jsdsparky)	3	82.15	92.77	1	33.33
28466.	Jakov (jpalikuca)	3	89.58	93.46	1	33.33
28467.	KingJulian (jpaglia61)	3	54.79	56.78	0	0.00
28468.	Zak (joyridinglordofdeath)	3	76.30	80.26	1	33.33
28469.	joshua (joshunatoir)	3	45.83	48.56	0	0.00
28470.	Josh (joshmv)	3	66.87	74.16	0	0.00
28471.	Josh (joshlearnsdvorak)	3	94.28	102.83	0	0.00
28472.	Josh (josh0561)	3	61.79	63.02	1	33.33
28473.	John (josborne)	3	81.04	88.37	0	0.00
28474.	Jordan (jorsian)	3	115.47	126.39	0	0.00
28475.	Jordan (jordanlangford)	3	69.35	72.77	0	0.00
28476.	jOn (jonsport)	3	111.08	123.45	3	100.00
28477.	Jon (jonrao)	3	92.38	108.22	2	66.67
28478.	ジョンジョンジョン...	3	89.25	102.70	1	33.33
28479.	jonjonbon (jonjonbon)	3	87.31	96.59	1	33.33
28480.	Jake (jokedac)	3	59.83	65.28	0	0.00
28481.	Joe (joeythedice)	3	103.19	111.96	2	66.67
28482.	Joerty (joertsy)	3	87.23	102.40	1	33.33
28483.	Joe (joenuts007)	3	75.20	78.09	0	0.00
28484.	Joe (joegoggin27)	3	46.69	48.96	0	0.00
28485.	Jacklyn (jlyn_nn)	3	57.67	63.41	1	33.33
28486.	Jeffrey (jlhart1717)	3	82.31	86.71	2	66.67
28487.	Jonah (jkeates)	3	48.07	52.62	0	0.00
28488.	j (jk993)	3	80.69	87.38	0	0.00
28489.	Liam (jjaegui)	3	81.97	84.26	0	0.00
28490.	JixS4v (jixs4v)	3	26.34	27.87	0	0.00
28491.	Jitender (jitendercool)	3	72.49	80.53	0	0.00
28492.	Jitander (jitander)	3	52.63	63.10	0	0.00
28493.	Jion (jiondarien)	3	93.19	109.39	2	66.67
28494.	Connor (jincwe)	3	80.81	94.84	0	0.00
28495.	Jiayan (jiayanluo)	3	108.21	127.49	1	33.33
28496.	Jiamin (jiamind)	3	71.64	75.81	1	33.33
28497.	Squeeby (jhettman)	3	66.71	69.88	1	33.33
28498.	JHDW (jhdw)	3	79.74	82.88	3	100.00
28499.	Jhaztyn (jhaztyn)	3	69.70	71.98	0	0.00
28500.	Joshua (jh817)	3	91.86	101.87	0	0.00
28501.	gogo (jg80990)	3	61.66	61.82	2	66.67
28502.	James (jfor8080)	3	47.78	49.97	0	0.00
28503.	Jezebelle (jezebe11e)	3	89.93	95.93	1	33.33
28504.	Jesse (jessecan)	3	74.58	83.56	3	100.00
28505.	Jerico (jericopulvera)	3	93.97	102.00	1	33.33
28506.	jeremiejig (jeremiejig)	3	54.85	55.73	0	0.00
28507.	jens (jenspie)	3	48.79	53.77	0	0.00
28508.	Tobias (jensen9430)	3	58.41	66.80	2	66.67
28509.	joshi (jehoshuah)	3	75.71	82.75	0	0.00
28510.	Jeffrey (jeffrey3712)	3	97.91	105.08	3	100.00
28511.	James (jeffinger38)	3	95.96	104.73	3	100.00
28512.	Jed (jedaiski)	3	62.71	65.41	1	33.33
28513.	Amar (jebemtimater52)	3	92.65	102.26	3	100.00
28514.	Jason (jd_istooshort)	3	81.65	88.23	0	0.00
28515.	bimmm (jdrbvgserg)	3	109.48	116.46	3	100.00
28516.	Josh (jdh4211)	3	100.67	113.92	1	33.33
28517.	JC (jczak)	3	69.57	74.30	0	0.00
28518.	JCalibs (jcalibs_13)	3	64.19	71.09	1	33.33
28519.	Justin (jbui123)	3	71.95	74.99	3	100.00
28520.	Jay (jayssa2)	3	104.49	109.15	1	33.33
28521.	Mr. (jayskeels)	3	77.77	81.75	1	33.33
28522.	Jawn (jawnblue)	3	90.01	93.49	3	100.00
28523.	Javlonbek (javlonbek)	3	24.11	27.34	2	66.67
28524.	Jason (jason3103)	3	82.86	88.40	1	33.33
28525.	jarif (jarif12)	3	60.15	67.11	1	33.33
28526.	tstats[jangstyle] (jangstyle)	3	59.82	60.88	0	0.00
28527.	Jakub (jakgin)	3	56.13	59.40	2	66.67
28528.	jahed (jahedk)	3	65.72	76.81	0	0.00
28529.	some_dude (jad_)	3	112.36	119.79	1	33.33
28530.	Jacob (jacquesz)	3	85.90	97.95	0	0.00
28531.	Jack (jackthetyper)	3	105.75	114.59	1	33.33
28532.	Jackson (jacksonsheldon)	3	79.42	84.84	1	33.33
28533.	Luke (jaberwacky)	3	70.33	76.48	1	33.33
28534.	0mg (j4s0nb0urn3)	3	61.72	65.98	0	0.00
28535.	jiggleburger (j2nkins)	3	89.75	96.14	1	33.33
28536.	Joshua (j1_kkk)	3	133.95	151.22	1	33.33
28537.	J (i_am_speeed)	3	60.47	67.12	0	0.00
28538.	Ivan (ivan_h)	3	65.26	67.93	0	0.00
28539.	to sam ja (ivanbire)	3	62.44	75.88	0	0.00
28540.	Victor (iusearchbtw)	3	119.42	124.47	0	0.00
28541.	tam (iufosonzz)	3	75.89	76.98	0	0.00
28542.	itzsamxp (itzsamxp)	3	73.70	76.81	2	66.67
28543.	Allen (itzhelix)	3	84.40	86.64	1	33.33
28544.	Sohan (itypenow)	3	52.86	55.64	0	0.00
28545.	LuJkE (itsthot)	3	74.11	82.04	1	33.33
28546.	Sollyy (itssollyy)	3	81.02	83.26	0	0.00
28547.	alien (itscloveryt)	3	70.04	81.78	1	33.33
28548.	Itay (itay_amit)	3	71.24	74.26	0	0.00
28549.	Ishan (ishanxlr8)	3	63.66	73.25	1	33.33
28550.	ishakan (ishakan)	3	79.01	86.29	0	0.00
28551.	Isaiah (isaluteya)	3	104.70	105.04	1	33.33
28552.	Aizakku (isaace)	3	81.29	88.37	1	33.33
28553.	Jaden (ironic_)	3	89.83	103.57	1	33.33
28554.	InvisWasTaken (inviswastaken)	3	62.20	68.90	1	33.33
28555.	aryan (interestedpartridge)	3	47.37	48.85	0	0.00
28556.	Druhan (insert_meme_here)	3	65.04	72.91	0	0.00
28557.	Colin (infusionpc)	3	88.47	93.38	1	33.33
28558.	Brian (infinibro)	3	68.37	70.23	0	0.00
28559.	Johnny (im_fast_af_boyyy)	3	53.08	60.21	0	0.00
28560.	Tino (imtino)	3	52.54	60.85	2	66.67
28561.	Imran (imran_maso)	3	40.84	43.67	0	0.00
28562.	Jun (impressed)	3	133.16	142.46	1	33.33
28563.	gram (imaginewastaken)	3	46.82	53.28	0	0.00
28564.	Jimmy Butler (ilyrxtro)	3	55.95	62.98	1	33.33
28565.	Mattias (illmajol)	3	67.34	78.58	0	0.00
28566.	Mark (iliekrice)	3	81.74	86.75	2	66.67
28567.	ilias (iliakesk)	3	28.98	32.81	1	33.33
28568.	bike (ikenim)	3	99.68	107.43	1	33.33
28569.	Teresa (iilxvelycrystal)	3	107.33	114.55	3	100.00
28570.	(ilii) (iili)	3	95.79	99.44	3	100.00
28571.	Nol (iileeper)	3	87.50	93.74	2	66.67
28572.	p4n (ihateant1212)	3	57.24	63.02	3	100.00
28573.	Alexandre (ignorantez)	3	58.81	68.95	1	33.33
28574.	Ignfroggy (ignfroggy)	3	68.19	79.84	0	0.00
28575.	Claude (igie007)	3	49.72	54.20	0	0.00
28576.	Ifan (ifan98)	3	58.68	62.38	0	0.00
28577.	idunno (idunno_)	3	89.65	96.66	0	0.00
28578.	black. (idkmyfriend)	3	70.62	74.60	1	33.33
28579.	Icy (icy687)	3	67.16	75.23	3	100.00
28580.	Kem (ice_kem)	3	94.97	101.29	2	66.67
28581.	Unanymous (iceman0bc)	3	73.26	78.07	2	66.67
28582.	Anonimo (ibzjem7v)	3	55.99	60.87	0	0.00
28583.	Ian (iboletchek)	3	87.56	89.74	1	33.33
28584.	Ibnu (ibenusina)	3	96.76	109.78	2	66.67
28585.	iam (iamtypinglin)	3	52.67	53.70	0	0.00
28586.	Slow_and_steady_ (iamskk)	3	81.22	82.48	1	33.33
28587.	LordTouchMe (iamjustarealga...	3	79.80	87.38	1	33.33
28588.	Kerry (i8pp)	3	99.61	133.88	2	66.67
28589.	Eris (hyururi)	3	78.52	82.15	2	66.67
28590.	HYP34 (hyper_typer200)	3	74.94	78.12	1	33.33
28591.	Wesley (hyperwes)	3	138.63	154.78	2	66.67
28592.	Hussain (hussain_22)	3	91.34	103.50	0	0.00
28593.	Aswin (humble_boy)	3	54.96	59.43	1	33.33
28594.	Wahaha (huhduh600)	3	69.00	75.95	0	0.00
28595.	Hucare (hucare_)	3	81.12	89.44	1	33.33
28596.	Allan (huangkong)	3	97.63	111.11	0	0.00
28597.	NekokeN (hr47)	3	86.35	93.90	2	66.67
28598.	Erik (hotman_04)	3	41.66	49.81	0	0.00
28599.	Hossam (hossamhero7)	3	31.68	32.36	0	0.00
28600.	benjamin (hombreba)	3	60.39	66.20	0	0.00
28601.	ayusha (hm_yes)	3	59.61	66.00	0	0.00
28602.	Hunter (hlikesramen)	3	72.66	74.44	1	33.33
28603.	Shinon (hitoshi_shinon)	3	50.33	56.38	0	0.00
28604.	Jigar (hiraj)	3	58.40	63.44	0	0.00
28605.	Hullu (hilivilperi)	3	74.34	79.25	0	0.00
28606.	A-A-RON (hihyooka)	3	81.54	88.58	0	0.00
28607.	Andres (highmes)	3	61.78	68.06	0	0.00
28608.	High889 (high889)	3	78.02	82.56	1	33.33
28609.	Ph (hidenki)	3	64.25	67.92	0	0.00
28610.	Hibiscus (hibiscuswaimeae)	3	51.07	56.92	0	0.00
28611.	Heysi ❤ (heysi)	3	95.77	103.92	2	66.67
28612.	hello lads (heymanurgood)	3	57.11	57.61	0	0.00
28613.	Herman (hermanleong)	3	79.11	89.14	2	66.67
28614.	亨利 (henry034)	3	56.80	59.15	1	33.33
28615.	henrik74 (henrik74)	3	37.63	43.96	1	33.33
28616.	Lukiji (hempasaur)	3	109.35	125.37	2	66.67
28617.	Free Palestine (hemo313)	3	60.16	65.49	2	66.67
28618.	Alexander (helmers)	3	64.77	71.52	1	33.33
28619.	Vin (hellotherevin)	3	60.72	65.12	0	0.00
28620.	HelixFossil1 (helixfossil1)	3	64.56	69.53	1	33.33
28621.	Helios (heliosishot)	3	88.74	89.57	2	66.67
28622.	Hehe (hehenaicha)	3	82.02	88.73	2	66.67
28623.	Bread (heftybread)	3	80.12	83.37	1	33.33
28624.	Hugo (hchang800)	3	103.65	115.45	3	100.00
28625.	Haxwhy (haxwhy)	3	47.66	50.77	0	0.00
28626.	Havel (havel29)	3	86.61	90.25	0	0.00
28627.	hasan (hassan_yousefi)	3	47.08	48.68	0	0.00
28628.	Muhammad Hassaan Wajid (has...	3	65.95	68.13	0	0.00
28629.	HasiTheAvenger (hasitheaven...	3	44.03	46.54	1	33.33
28630.	harsh (harshlunagaria)	3	59.28	63.44	2	66.67
28631.	Harry (harrythegreat9)	3	47.72	52.21	2	66.67
28632.	Hzifah (hariaz27)	3	37.26	42.08	2	66.67
28633.	Matthew (happychau0v0)	3	81.68	84.68	3	100.00
28634.	TM22 (hanschen96)	3	86.77	97.26	1	33.33
28635.	therealed777 (handwritingch...	3	107.10	115.73	3	100.00
28636.	imnotanygood (handicaped)	3	82.32	86.17	2	66.67
28637.	Hanami (hanamiaiko)	3	58.79	60.94	1	33.33
28638.	Hector (hampsterking9000)	3	68.11	74.51	1	33.33
28639.	Ferbo (g_ferbo)	3	90.06	102.40	1	33.33
28640.	Gur (gur111)	3	76.57	81.55	3	100.00
28641.	Lance (gulickle)	3	88.14	90.82	1	33.33
28642.	Guilherme (gui_szk)	3	67.87	73.06	0	0.00
28643.	GTank (gtank)	3	103.65	120.59	2	66.67
28644.	Grten (grten)	3	70.12	72.23	1	33.33
28645.	Eric (grqy)	3	98.94	107.46	3	100.00
28646.	Ismail (group4k)	3	74.23	79.11	2	66.67
28647.	Grizzle (grizzlemonk)	3	111.35	119.01	2	66.67
28648.	Gremble (gremble)	3	87.22	91.20	1	33.33
28649.	Kevin (greetedsine6)	3	77.47	80.61	0	0.00
28650.	Gravity (gravity_eyes)	3	82.55	86.37	3	100.00
28651.	tstats[gravityhurts] (gravi...	3	98.81	105.76	1	33.33
28652.	Gratias (gratias1)	3	55.56	61.06	0	0.00
28653.	Marco (gras8)	3	43.77	45.36	0	0.00
28654.	Ivan (grapfik)	3	43.76	45.31	1	33.33
28655.	GG (goldy_boi)	3	79.18	90.60	0	0.00
28656.	GoldenPotato (goldenpotato)	3	90.89	105.38	0	0.00
28657.	going4speed (going4speed)	3	75.46	78.53	1	33.33
28658.	Tushar (god_fingers)	3	78.26	80.89	1	33.33
28659.	Gnr. Garst (gnr_garst)	3	68.07	76.33	2	66.67
28660.	Ryan (glasses928)	3	72.98	84.22	1	33.33
28661.	Greg (gkup8)	3	106.88	111.49	0	0.00
28662.	A3gon (giralt)	3	70.78	85.27	0	0.00
28663.	Jittimon (gibjittimon)	3	33.46	38.75	0	0.00
28664.	Parker (ghxstie)	3	88.10	92.92	0	0.00
28665.	Jack (ghoultree)	3	99.01	117.65	2	66.67
28666.	Ghosy (ghosy)	3	82.51	89.37	0	0.00
28667.	Kosuke (ghostkk)	3	89.39	106.75	3	100.00
28668.	ghina (ghinaz)	3	49.78	60.34	2	66.67
28669.	celia (ghettogarbagemonster)	3	45.46	54.83	1	33.33
28670.	Adam (gh00st)	3	58.04	66.21	1	33.33
28671.	Gabriel (gfz1k)	3	46.70	49.01	0	0.00
28672.	Geukers (geukers)	3	89.75	100.88	1	33.33
28673.	Oseph (getoutofmyhouse)	3	112.47	117.37	3	100.00
28674.	Mark (geronimus)	3	72.20	83.40	1	33.33
28675.	George (georgesung25)	3	90.06	94.09	1	33.33
28676.	Hubert (georgeger)	3	36.24	37.54	0	0.00
28677.	gelis (gelis07)	3	68.04	75.28	0	0.00
28678.	Gegug (gegug)	3	96.17	107.55	1	33.33
28679.	Tom (gearsofvore)	3	88.44	94.73	1	33.33
28680.	gaule (gaule)	3	75.63	84.73	1	33.33
28681.	Gabriel (gatauahmalesbiasalah)	3	68.55	71.58	0	0.00
28682.	Danyon (gasperdb)	3	100.62	116.41	1	33.33
28683.	Garvit (garvitar)	3	62.87	69.16	1	33.33
28684.	Ryan Kim (gardenhoe)	3	139.83	151.42	0	0.00
28685.	Setu (ganjuitta)	3	95.82	102.87	2	66.67
28686.	Gamesepic123 (gamesepic123)	3	53.22	60.29	1	33.33
28687.	skream² (galil_gaben)	3	87.53	93.02	1	33.33
28688.	Austin (galactiac)	3	80.26	90.83	0	0.00
28689.	Gabriel (gabrielke)	3	62.86	65.02	1	33.33
28690.	fyre_chicken (fyre_chicken)	3	57.49	60.86	0	0.00
28691.	Dawson (funkemunky)	3	88.84	89.44	1	33.33
28692.	- (fullswingtango)	3	103.03	112.42	1	33.33
28693.	Schalbuch (schalbuch)	3	93.17	97.73	1	33.33
28694.	Scarlancy (scarlancy)	3	54.64	59.01	1	33.33
28695.	I am speeed (scarea)	3	64.24	65.57	1	33.33
28696.	Scalbi (scalbi47yrsold)	3	86.71	94.32	1	33.33
28697.	Savatar (sava7ar)	3	48.29	70.06	0	0.00
28698.	Sarah (saucypeanut)	3	52.07	54.26	0	0.00
28699.	sash (sashtypes)	3	96.39	119.17	1	33.33
28700.	Derek (sashimi_exe)	3	64.22	73.37	1	33.33
28701.	Sashati (sashati)	3	37.61	40.92	0	0.00
28702.	omer (sashasin)	3	99.32	107.31	1	33.33
28703.	Saschamz (saschamz)	3	119.84	121.55	2	66.67
28704.	OJ (saroisu)	3	92.78	94.52	1	33.33
28705.	Sara (sara_9876554432112345...	3	56.76	61.56	3	100.00
28706.	Mighty (saranb)	3	109.36	116.43	3	100.00
28707.	John Andrew (santiagoja_rog)	3	115.74	118.80	2	66.67
28708.	Santiago (santac)	3	90.10	97.93	2	66.67
28709.	Sanj (sanjbanz)	3	52.73	59.36	2	66.67
28710.	Hoang (sanh01)	3	66.01	70.94	1	33.33
28711.	Sangryool (sangryool)	3	42.55	57.35	1	33.33
28712.	sandhikagalih (sandhikagalih)	3	57.11	61.17	0	0.00
28713.	Sander (sanderv3)	3	94.38	104.94	2	66.67
28714.	sam (sam_star99)	3	61.50	74.13	0	0.00
28715.	sammy (sam_i_am01)	3	72.68	79.60	1	33.33
28716.	Samarth (sam_100)	3	37.93	41.26	0	0.00
28717.	Sam687 (samuel687)	3	75.01	78.20	3	100.00
28718.	Books (samngoertzen)	3	80.01	83.16	1	33.33
28719.	Samuel (sammiedodgers)	3	77.47	81.72	0	0.00
28720.	bob (sami1010)	3	99.51	105.72	0	0.00
28721.	Sam (samgang)	3	99.84	108.76	1	33.33
28722.	sam (samchez)	3	107.06	114.80	2	66.67
28723.	Sam (samblez)	3	95.68	103.03	1	33.33
28724.	deez (salt_tea)	3	96.38	101.77	3	100.00
28725.	Ali (salloum)	3	65.20	68.93	1	33.33
28726.	Saky (saky74)	3	78.32	82.22	2	66.67
28727.	Sakil_BD (sakil_bdd)	3	55.72	58.93	1	33.33
28728.	Anthony (saga_)	3	63.95	79.22	1	33.33
28729.	Jean-Michel (safturento)	3	114.44	122.35	3	100.00
28730.	Sad1y (sad1y)	3	44.83	49.26	1	33.33
28731.	AJ (sacrificials)	3	139.86	173.58	2	66.67
28732.	Surkhab (s606)	3	103.12	116.34	2	66.67
28733.	Grace (s0porific)	3	80.62	83.17	1	33.33
28734.	Slender (r_slender)	3	86.33	93.00	2	66.67
28735.	Rzechu12 (rzechu12)	3	35.76	49.91	1	33.33
28736.	Anuar (ryuojin)	3	79.35	85.10	2	66.67
28737.	Ryokuuy (ryokuuy)	3	59.27	66.23	0	0.00
28738.	Randy (ryanrules428)	3	106.78	110.03	1	33.33
28739.	Ryan (ryanknav)	3	67.64	76.60	0	0.00
28740.	Ryan (ryan767898)	3	85.45	89.13	0	0.00
28741.	Ryan (ryachu)	3	70.43	77.09	0	0.00
28742.	Henry (rustylimbs)	3	96.76	101.65	0	0.00
28743.	Lily (russiantorts)	3	122.12	136.54	3	100.00
28744.	Bruno (runichan)	3	46.44	48.58	0	0.00
28745.	ruby (ruby_lu)	3	120.98	129.95	3	100.00
28746.	Gabe (rubikcrube)	3	92.73	99.48	0	0.00
28747.	Nerx (rshield)	3	112.38	115.77	2	66.67
28748.	Xoi (roynadhiier)	3	62.61	65.84	1	33.33
28749.	Royal (royalman)	3	85.51	96.23	0	0.00
28750.	Royce (royck)	3	104.19	108.59	1	33.33
28751.	RouxSauced (rouxsauced)	3	54.47	55.87	0	0.00
28752.	raegan (rotoole15)	3	46.44	49.74	0	0.00
28753.	Rotaberq (rotaberq)	3	54.10	57.81	0	0.00
28754.	Rose (roselenataylor)	3	51.65	52.33	1	33.33
28755.	CHAU (rookylk)	3	71.04	78.68	2	66.67
28756.	Andrei (rooky127)	3	74.83	82.64	2	66.67
28757.	tarun (ronythakur)	3	65.29	73.55	1	33.33
28758.	𝙣_𝙞_𝙩_𝙧_𝙤 (r...	3	83.92	86.41	1	33.33
28759.	Hålløw (rohanrules21)	3	94.90	97.49	1	33.33
28760.	Ritvik (rockey000)	3	94.52	96.65	2	66.67
28761.	RobotGG (robotez)	3	66.63	71.27	0	0.00
28762.	Elham (rivalry_)	3	99.33	109.28	1	33.33
28763.	ritesh (ritesh_k)	3	55.61	59.32	0	0.00
28764.	Rishi (rishiosaur)	3	110.19	117.44	2	66.67
28765.	Rishabh (rishabhkr)	3	61.65	65.99	0	0.00
28766.	rila (rilakuma)	3	95.18	104.32	2	66.67
28767.	Rift (rifterk)	3	40.83	45.71	0	0.00
28768.	Hussein (rifath33)	3	93.62	104.66	1	33.33
28769.	Ricky (ricky54326)	3	140.59	146.98	3	100.00
28770.	r (richiedeo)	3	87.10	95.29	0	0.00
28771.	Rituparna (ri2parna)	3	59.11	62.92	0	0.00
28772.	rhys (rhys22199)	3	75.95	90.88	1	33.33
28773.	Ro (rgpdancer)	3	69.66	78.86	0	0.00
28774.	Adrian (revi_10)	3	82.79	93.27	1	33.33
28775.	Resync (resync)	3	131.24	141.57	1	33.33
28776.	Reshoup (reshoup)	3	87.22	93.12	1	33.33
28777.	rome (renzo2kpro)	3	78.82	84.35	1	33.33
28778.	Renstyfus (renstyfus)	3	58.82	69.49	0	0.00
28779.	Dimitar (renoxtv)	3	100.06	111.22	1	33.33
28780.	Ozan (remnant)	3	127.66	132.74	1	33.33
28781.	lewis (remmurd)	3	76.47	78.36	0	0.00
28782.	Kitnipan (remaintion)	3	54.00	57.24	0	0.00
28783.	Rein (reindlsu)	3	110.57	121.43	3	100.00
28784.	REs (reessss)	3	62.91	66.60	0	0.00
28785.	User (redytedy)	3	105.07	109.56	2	66.67
28786.	scapegoat (realscapegoat)	3	131.45	144.43	3	100.00
28787.	ObamaGaming (realobamagaming)	3	93.10	96.20	3	100.00
28788.	David (realdavidcruz)	3	57.90	63.58	1	33.33
28789.	Bartek (reaction73)	3	76.89	82.04	1	33.33
28790.	Rayni (raynikay)	3	73.48	73.61	0	0.00
28791.	Raymoz (raymoz)	3	70.94	84.19	0	0.00
28792.	Exooo (ranold)	3	63.94	66.48	0	0.00
28793.	Randy (randylee)	3	108.00	116.60	0	0.00
28794.	Stefan (random_user231)	3	61.59	65.25	0	0.00
28795.	RandomBoy (randomracer5)	3	31.99	36.39	0	0.00
28796.	Raiyc (raiyc)	3	68.15	74.70	2	66.67
28797.	Raisul (raisulmushfeq)	3	61.75	63.18	0	0.00
28798.	rahul (rahularctic)	3	57.20	67.00	0	0.00
28799.	Rahul (rahul0379)	3	79.70	86.63	0	0.00
28800.	rahmu (rahmu)	3	102.81	103.62	0	0.00
28801.	rasmus (ragusa12)	3	79.46	87.72	0	0.00
28802.	Affan (raging_fire37)	3	68.00	69.87	0	0.00
28803.	Potato (ragingpotato711)	3	100.06	102.34	1	33.33
28804.	Ragged (raggedstar)	3	113.68	116.47	3	100.00
28805.	Justin (ragegaze)	3	70.80	80.53	1	33.33
28806.	Rafsun (rafsun_100)	3	57.63	61.14	0	0.00
28807.	race_me_now (I miss Czy) (r...	3	132.23	150.32	3	100.00
28808.	Dodger (racedodger)	3	103.56	112.90	3	100.00
28809.	Jacob (raazl)	3	52.85	54.59	0	0.00
28810.	Keyzard (qwertyzard)	3	88.18	96.58	2	66.67
28811.	GOAT (qwerty1111)	3	59.84	64.44	0	0.00
28812.	speed demon (quickity)	3	108.96	115.64	3	100.00
28813.	Justin (quick2diddle)	3	124.04	130.73	2	66.67
28814.	Marcin (quenthel)	3	69.15	73.33	0	0.00
28815.	quebequoi (quebequoi)	3	55.39	67.73	0	0.00
28816.	Quan (quan_1)	3	55.11	56.52	0	0.00
28817.	Quang Minh (quangng711)	3	36.62	37.89	0	0.00
28818.	K (quakk)	3	107.38	111.13	2	66.67
28819.	Krishna (qrishna59)	3	57.21	68.83	0	0.00
28820.	sm (qdbs)	3	81.67	98.34	3	100.00
28821.	Mads (pythonmilk)	3	98.37	110.19	1	33.33
28822.	Pyare (pyarexpress)	3	42.41	44.21	0	0.00
28823.	vachana (pvloveks)	3	55.42	58.99	0	0.00
28824.	Alex (putzig)	3	71.96	73.93	0	0.00
28825.	NB (purple_turkey)	3	119.35	126.08	1	33.33
28826.	Kevin (purplekev)	3	89.03	105.52	0	0.00
28827.	purple (purplecity)	3	52.89	54.78	0	0.00
28828.	Alex (purpleauro)	3	114.36	120.11	3	100.00
28829.	Ivan (pugaelmen)	3	59.71	65.95	2	66.67
28830.	David (puchando)	3	100.56	110.50	1	33.33
28831.	psyklo10 (psyklo10)	3	75.53	80.24	2	66.67
28832.	Ryan (prophetofregret)	3	95.78	98.14	1	33.33
28833.	Ventilyator (propeller187)	3	36.36	39.85	2	66.67
28834.	Pro (proishere)	3	44.32	45.05	2	66.67
28835.	Harry (procuties)	3	70.20	89.80	0	0.00
28836.	Robert (privateer)	3	92.75	98.53	1	33.33
28837.	Prison (prisonmike69)	3	48.70	50.27	0	0.00
28838.	prisky (prisky)	3	84.64	86.98	1	33.33
28839.	Princeton (princetonjeffries)	3	98.51	116.59	1	33.33
28840.	PRINCE (princeamir)	3	47.43	49.13	1	33.33
28841.	PremuimRice (premuimrice)	3	74.16	78.04	0	0.00
28842.	Codastix (pranavthetypist)	3	64.46	68.03	1	33.33
28843.	ppgg (pp__gg)	3	83.10	86.16	2	66.67
28844.	Porpoise (porpoisefantasy)	3	118.94	120.87	3	100.00
28845.	ti (popy_15)	3	48.54	51.06	0	0.00
28846.	a (poopeater10231)	3	87.74	96.50	3	100.00
28847.	Kieran (polaris03)	3	43.56	48.02	0	0.00
28848.	Christoffer (poetastrophe)	3	91.65	97.82	1	33.33
28849.	Sara (pluto13x)	3	83.64	87.55	0	0.00
28850.	Pluto (pluto094)	3	79.55	90.00	0	0.00
28851.	Atticus (plutakis)	3	84.97	93.77	0	0.00
28852.	ZeppelinRG (plasmapig)	3	82.51	91.34	1	33.33
28853.	Abe (plantboy808)	3	78.59	97.23	1	33.33
28854.	Oscar (pla3ma)	3	82.36	93.29	2	66.67
28855.	Jacob (pjacobh)	3	73.60	79.91	0	0.00
28856.	seqqie (pitufita)	3	90.96	115.71	1	33.33
28857.	pistonsnick (pistonsnick)	3	85.57	93.62	0	0.00
28858.	Pipe (pipeuwu)	3	56.27	60.66	0	0.00
28859.	muffin (pintu_otaku)	3	51.68	55.89	0	0.00
28860.	Pijke (pijkeee)	3	95.39	100.01	0	0.00
28861.	pigoopi (pigoopi)	3	92.17	104.92	0	0.00
28862.	Josh (piggygaming1004)	3	89.77	98.02	1	33.33
28863.	Peter (picklepete)	3	68.21	70.29	0	0.00
28864.	Phycxz (phycxz)	3	74.18	81.06	2	66.67
28865.	PJ (phuang)	3	98.97	104.54	1	33.33
28866.	Phong (phonglt)	3	58.68	60.78	1	33.33
28867.	Pedro (phld)	3	51.22	56.06	0	0.00
28868.	Phantom (phantomx0990)	3	77.66	84.17	0	0.00
28869.	phantas (phantaslock)	3	70.88	75.86	1	33.33
28870.	Phalgooni (phalguni)	3	75.90	78.51	3	100.00
28871.	crow (ph4tomz)	3	102.52	115.78	1	33.33
28872.	Charles (ph4ntom)	3	66.75	74.31	1	33.33
28873.	Liam (ph3zz)	3	82.69	93.77	0	0.00
28874.	blahblah (pfftpftpfft)	3	46.68	48.41	0	0.00
28875.	Nje (pettsonator)	3	46.68	48.01	0	0.00
28876.	Pervasive (pervasive)	3	75.04	82.02	2	66.67
28877.	Hian Zing (peperon321)	3	108.96	110.68	1	33.33
28878.	Pehz (pehz)	3	103.12	115.42	0	0.00
28879.	Justin (peguegue)	3	50.50	55.46	1	33.33
28880.	Melvin (peekachoo)	3	111.16	122.56	0	0.00
28881.	Pedro (pedrobaptista29)	3	39.44	40.45	0	0.00
28882.	Oscar (peccary)	3	100.77	114.85	1	33.33
28883.	Jose (peanuts11963)	3	67.66	70.05	1	33.33
28884.	aj (peanut2004)	3	94.62	101.71	2	66.67
28885.	pd9999 (pd9999)	3	54.06	59.95	0	0.00
28886.	Darma (pcfounder)	3	55.95	56.96	0	0.00
28887.	psb (pbeeky)	3	46.25	56.92	1	33.33
28888.	Kevin (pb9000)	3	68.52	73.45	0	0.00
28889.	James (paynedeath)	3	89.46	101.98	2	66.67
28890.	pawncheaux (pawncheaux)	3	127.34	152.47	0	0.00
28891.	paulo (pauliii)	3	86.63	89.15	0	0.00
28892.	Lukas (paulanergarten)	3	51.81	55.43	0	0.00
28893.	Paul (paul27)	3	61.79	64.21	1	33.33
28894.	Patryk (patryqu08)	3	31.15	35.15	0	0.00
28895.	China nº1 (patato123)	3	95.28	109.00	1	33.33
28896.	Tata (patata_tata)	3	44.46	47.49	0	0.00
28897.	Pasha (pashacccp)	3	70.22	83.93	1	33.33
28898.	parto (partoptr)	3	65.91	67.55	1	33.33
28899.	TiTi (partiti)	3	86.03	88.14	0	0.00
28900.	Парса (parsrch)	3	73.76	75.63	3	100.00
28901.	Param (parmy)	3	68.09	69.89	1	33.33
28902.	Parking (parkingmeter)	3	71.80	81.32	1	33.33
28903.	Andy (parachuteguy500)	3	118.40	128.55	3	100.00
28904.	Ezra (papu7505)	3	84.04	97.17	1	33.33
28905.	Chris (papadroop)	3	117.36	128.29	2	66.67
28906.	papachuro (papachuro)	3	72.13	77.85	2	66.67
28907.	Kristán (panika_system)	3	64.97	66.92	1	33.33
28908.	Kanye (pangoliar)	3	105.06	109.53	0	0.00
28909.	PandaDriver (pandadriver)	3	70.04	73.86	0	0.00
28910.	Ahmed (panda679)	3	54.50	62.24	0	0.00
28911.	palaceisbad (palaceisbad)	3	64.63	71.34	1	33.33
28912.	Timmy (pakuyg)	3	114.57	116.95	3	100.00
28913.	Paganini (paganinibr)	3	65.01	68.67	0	0.00
28914.	pacmansghost (pacmansghost)	3	86.90	94.09	3	100.00
28915.	Pablo_35 (pablo35)	3	62.48	69.72	1	33.33
28916.	Даниил (p1zda)	3	23.87	25.96	0	0.00
28917.	P0neh (p0neh)	3	99.09	106.12	2	66.67
28918.	Owen (owenhayes)	3	82.40	98.41	1	33.33
28919.	Joe (oveslikeagger)	3	27.53	30.51	1	33.33
28920.	Yea (oulliac)	3	95.31	99.10	0	0.00
28921.	Owen (oskin_)	3	66.61	69.97	2	66.67
28922.	jojodoru (oshihiteo)	3	62.95	65.21	2	66.67
28923.	Oscar (oscardangal)	3	46.40	49.84	0	0.00
28924.	Afker (oryginalnyitsme)	3	106.09	114.87	2	66.67
28925.	Bella (organicsooshi)	3	84.15	87.56	0	0.00
28926.	Kamil (oreg0s)	3	77.36	83.12	1	33.33
28927.	ozamandias (orbman_)	3	84.61	92.09	1	33.33
28928.	Orange (orange_oranges)	3	109.42	120.14	2	66.67
28929.	Sinavestos (optictears)	3	117.87	131.17	1	33.33
28930.	Trent (opman335)	3	85.31	91.14	1	33.33
28931.	opintial (opintial)	3	63.06	63.93	0	0.00
28932.	LE (opcleaver0)	3	71.75	74.34	0	0.00
28933.	onionshavewings (onionshave...	3	34.06	35.33	0	0.00
28934.	haziq aiman (onichan69)	3	51.51	57.08	0	0.00
28935.	emo (omylime)	3	75.35	81.27	1	33.33
28936.	Tyriq (omgitstyriq)	3	51.50	61.49	0	0.00
28937.	tstats[omarthefast] (omarth...	3	105.33	114.81	0	0.00
28938.	Omar (omar4321)	3	67.91	76.28	1	33.33
28939.	Ollie (ollie438)	3	55.33	62.14	0	0.00
28940.	oliver (oliver_tacmon)	3	73.14	75.14	2	66.67
28941.	oivee (oivee)	3	105.68	121.41	3	100.00
28942.	Anica (oica)	3	91.00	97.32	2	66.67
28943.	A (ohyoturtles)	3	90.37	97.26	1	33.33
28944.	Keigo (ogiekako)	3	86.58	88.60	1	33.33
28945.	Lea (offset36)	3	47.28	55.61	0	0.00
28946.	e (officialinsert)	3	84.06	93.62	1	33.33
28947.	alex (officewarehouse)	3	80.27	86.74	3	100.00
28948.	Stan (odeathdragon)	3	117.85	124.09	2	66.67
28949.	OddlySerious (oddlyserious)	3	86.79	102.43	1	33.33
28950.	Emily (octopanda4)	3	105.51	110.44	2	66.67
28951.	Fox (obviouslyweeb)	3	65.30	69.14	0	0.00
28952.	Same (obsoletepotato)	3	82.98	91.78	1	33.33
28953.	юрій підор (obskur...	3	128.71	144.26	2	66.67
28954.	Ashish (obnox33)	3	82.18	88.44	1	33.33
28955.	Curtis (obeseocean)	3	131.88	136.05	2	66.67
28956.	Jack (oakinsyphon)	3	103.29	109.04	1	33.33
28957.	Nathan (nzmaster0516)	3	84.63	101.25	1	33.33
28958.	Nymex (nymex67)	3	95.19	98.91	0	0.00
28959.	Chris (nukesterz)	3	117.28	137.67	1	33.33
28960.	nigus (nuge_2425)	3	46.71	49.33	0	0.00
28961.	Nube (nubenoober)	3	68.94	72.79	0	0.00
28962.	nuate (nuate)	3	126.20	138.49	3	100.00
28963.	Nspace (nspace)	3	89.73	93.58	2	66.67
28964.	NotNamedMark (notnamedmark)	3	43.45	52.50	0	0.00
28965.	Michael (notillusion)	3	60.08	64.34	0	0.00
28966.	@ii (notchaman)	3	71.53	78.97	2	66.67
28967.	Norton (nortonmon)	3	113.35	116.37	2	66.67
28968.	Norris (norris_is_fat)	3	85.28	90.76	2	66.67
28969.	anon (nootathotep)	3	93.71	98.49	0	0.00
28970.	Noor (noorrahman)	3	31.09	31.54	0	0.00
28971.	noooit (noooit)	3	74.65	80.85	0	0.00
28972.	cogz (nooodlefish)	3	76.95	82.33	1	33.33
28973.	Joe (nookgun)	3	49.07	54.08	0	0.00
28974.	koleraba (noob4love)	3	54.73	61.31	0	0.00
28975.	Noir (noirrime)	3	114.36	125.21	2	66.67
28976.	Jorge (nogoodlul)	3	77.77	79.43	1	33.33
28977.	Mirochi (nobitad)	3	81.68	86.97	0	0.00
28978.	Tarso (noaxispe)	3	76.98	80.60	2	66.67
28979.	Noah (noahlee)	3	106.14	111.98	1	33.33
28980.	Noah (noahcheeseman)	3	65.57	70.62	1	33.33
28981.	Noah (noaahhh)	3	116.70	118.70	1	33.33
28982.	nmyo (nmyo)	3	136.60	143.73	3	100.00
28983.	minh (nminhanh420)	3	49.56	49.84	0	0.00
28984.	Speeeeed (nkpaintsil)	3	64.50	66.24	0	0.00
28985.	nitai (nitai777)	3	60.41	64.61	1	33.33
28986.	Nishan (nishanepic)	3	100.43	101.91	1	33.33
28987.	Adam (ninjapadam)	3	86.59	99.29	3	100.00
28988.	Ethan (ninjabot5)	3	92.07	101.81	1	33.33
28989.	Dominic (ninjabean)	3	89.54	101.60	1	33.33
28990.	Oleg (ninele7)	3	56.08	60.92	0	0.00
28991.	nim (nimen)	3	85.35	90.21	0	0.00
28992.	nik (nikoloose)	3	85.32	94.23	1	33.33
28993.	Nikolas (nikolaslim)	3	149.60	167.18	3	100.00
28994.	i am (nikhilt)	3	37.84	38.27	0	0.00
28995.	naclytyper (nikhila)	3	107.92	110.35	1	33.33
28996.	NikeTheProSk8r (nikethepros...	3	66.76	69.32	0	0.00
28997.	Joe (niconiconicasio)	3	65.34	71.84	0	0.00
28998.	Nicole (nicoleoioioi)	3	57.98	60.35	1	33.33
28999.	michael (ngmich)	3	139.84	151.51	3	100.00
29000.	Christian (neva_type)	3	54.26	61.22	0	0.00
29001.	Nethum (nethum)	3	77.07	81.50	0	0.00
29002.	Cuong (nespro)	3	75.38	80.51	0	0.00
29003.	Nep (nep_nepped_yuumi)	3	97.82	111.69	3	100.00
29004.	Neo (neo7)	3	98.95	103.33	1	33.33
29005.	neo (neo007)	3	45.78	48.02	0	0.00
29006.	Nenfal (nenfal)	3	92.01	94.71	0	0.00
29007.	Nemanja2304 (nemanja2304)	3	72.82	76.52	3	100.00
29008.	nelmalu (nelimalu)	3	89.89	94.23	3	100.00
29009.	Ning (nekophobia)	3	77.00	80.70	2	66.67
29010.	Yui (nekootoko)	3	84.39	90.98	1	33.33
29011.	Hugh (negoose)	3	92.82	94.31	1	33.33
29012.	Neekon (neekon)	3	110.29	121.64	2	66.67
29013.	_(:3) ∠) (neco36)	3	99.05	105.50	0	0.00
29014.	ndk100 (ndk100)	3	73.75	79.18	1	33.33
29015.	NayoTomato (nayotomato)	3	43.57	45.84	0	0.00
29016.	natsuki (natsuki_x)	3	60.21	62.78	0	0.00
29017.	Nathan (nathan_benedict)	3	47.31	57.59	1	33.33
29018.	Natalie (nataliejw4)	3	64.28	71.50	1	33.33
29019.	narikami (narikami)	3	80.64	92.09	2	66.67
29020.	Bambi (nanoperceptoin)	3	81.97	90.01	0	0.00
29021.	NamhomEG (namhomeg)	3	78.72	84.13	1	33.33
29022.	Nameless (nameless_pixel)	3	82.47	84.66	2	66.67
29023.	NalynnZ (nalynnz)	3	73.45	80.03	2	66.67
29024.	Renato (nadev)	3	68.74	74.85	0	0.00
29025.	Naafiyan (naafiyan)	3	92.91	101.13	1	33.33
29026.	Toko (n17n)	3	71.07	87.86	1	33.33
29027.	Ninja (n0inja_randy)	3	55.94	60.16	0	0.00
29028.	Mohamed (m_gemy)	3	54.82	56.16	1	33.33
29029.	Tsen (myungjunjun)	3	67.10	76.03	0	0.00
29030.	Chris (mythicalocelot)	3	53.98	58.59	1	33.33
29031.	Tony (mysticalchime)	3	150.00	156.65	3	100.00
29032.	ToastyCPU (mynewuser)	3	93.51	96.14	1	33.33
29033.	Kyle (mydoricon)	3	106.12	115.60	2	66.67
29034.	Maki (mxki)	3	84.91	99.06	0	0.00
29035.	Johnny (muzuki)	3	74.45	80.05	1	33.33
29036.	Tony (muuyfeo)	3	75.71	79.61	0	0.00
29037.	Soph (murmeline)	3	76.83	80.67	3	100.00
29038.	MUKUND (mukundk)	3	80.29	83.64	3	100.00
29039.	Mukkuru (mukkuru)	3	73.39	85.55	1	33.33
29040.	Tian (mtianms)	3	59.88	64.59	1	33.33
29041.	Bakerman (mthnglac)	3	75.32	79.85	2	66.67
29042.	Mssd (mssd200927)	3	44.27	52.52	0	0.00
29043.	Tomek (mr__t)	3	51.98	58.06	0	0.00
29044.	Jarel (mr_dogwater)	3	32.52	38.64	0	0.00
29045.	alec (mrwisntworking)	3	71.07	84.49	1	33.33
29046.	Joshua (mrjoshy)	3	104.50	114.66	1	33.33
29047.	MrFade14 (mrfade14)	3	64.95	70.76	0	0.00
29048.	Rip reckful (moudizg)	3	130.73	138.30	3	100.00
29049.	Mouad (mouadox)	3	51.11	51.42	0	0.00
29050.	Darwisy (motoofast)	3	85.50	90.40	2	66.67
29051.	Mostafa (mostfkhttb11)	3	55.17	63.94	0	0.00
29052.	Nicolas (morgoth890steno)	3	89.68	100.17	1	33.33
29053.	krane (moozies)	3	111.77	126.55	2	66.67
29054.	maggie (mooski)	3	56.95	64.39	0	0.00
29055.	Ram (moonify)	3	136.91	142.44	2	66.67
29056.	Monsquinch (monsquinch)	3	57.36	61.00	2	66.67
29057.	Monkeyjwzd (monkeyjwzd)	3	110.47	121.02	1	33.33
29058.	J'Lenn (monkeydjiggy)	3	49.67	60.84	0	0.00
29059.	Aebel (monkeeeee)	3	55.56	59.20	1	33.33
29060.	Andrew (momoterraw)	3	110.09	125.72	1	33.33
29061.	Sam (momomcds)	3	112.14	116.92	0	0.00
29062.	Aisyah (momogi13)	3	71.88	75.88	1	33.33
29063.	momodao (momodao)	3	94.57	104.41	1	33.33
29064.	Moises (moi_ses123)	3	51.08	57.50	1	33.33
29065.	mohannad (mohanadtab)	3	38.31	43.46	0	0.00
29066.	Mohanad (mohanadahmd)	3	91.21	100.18	2	66.67
29067.	Mochaeri (mochaeri)	3	85.66	95.40	1	33.33
29068.	Mike (mmanzinger)	3	110.53	117.32	2	66.67
29069.	Tommy (mizo_ramen)	3	48.29	51.13	0	0.00
29070.	mithilesh (mithilesh_just_t...	3	36.92	38.38	0	0.00
29071.	Mitchell (mitchow)	3	95.38	98.66	2	66.67
29072.	will (mistywaves)	3	88.53	93.43	2	66.67
29073.	Nate (mistrpopo)	3	78.99	86.68	0	0.00
29074.	Tasnim (misteryoda)	3	53.24	61.13	1	33.33
29075.	idontflinch (mistergold)	3	58.72	61.76	0	0.00
29076.	mis7ake (mis7ake)	3	48.55	54.08	0	0.00
29077.	m (miomo)	3	82.08	90.66	1	33.33
29078.	Elliot (mini_toh)	3	94.57	97.28	2	66.67
29079.	Min (minimizer123)	3	97.65	111.05	3	100.00
29080.	Garret (minecraftkid2007)	3	114.62	131.30	2	66.67
29081.	Mindmaster (mindmaster03)	3	54.98	58.89	1	33.33
29082.	Milos (milosj)	3	102.52	112.65	1	33.33
29083.	Mihir (mihirthecoolboi)	3	101.05	106.73	3	100.00
29084.	Madiyar (mightymadik)	3	44.98	45.89	0	0.00
29085.	Emil (mielies1)	3	62.95	65.16	0	0.00
29086.	Michael (mickyyyr)	3	105.28	114.14	0	0.00
29087.	Mishi (mickimouse)	3	117.48	125.96	2	66.67
29088.	Mickey (mickeymini)	3	53.67	67.51	0	0.00
29089.	MTH (michaeltrayvonheckman)	3	245.46	258.67	3	100.00
29090.	Michael (michaelmalgapo10)	3	85.84	97.33	2	66.67
29091.	Michael (michaelhau)	3	96.23	113.16	2	66.67
29092.	michael (michael1117)	3	14.24	16.77	0	0.00
29093.	Mia (miatkd)	3	58.08	63.07	0	0.00
29094.	mieke (miakra)	3	48.43	50.36	0	0.00
29095.	MGKPs (mgkps)	3	42.52	46.24	0	0.00
29096.	Mike (mferger92)	3	88.05	98.62	1	33.33
29097.	hi im merm!! (mermed)	3	145.28	150.69	3	100.00
29098.	dave (mercurz)	3	101.48	119.64	1	33.33
29099.	merc824 (merc824)	3	44.51	48.94	0	0.00
29100.	Arifa (meowx2)	3	51.62	55.23	2	66.67
29101.	Matthew (memermatt)	3	64.70	67.31	3	100.00
29102.	Alex (memento108)	3	79.73	83.19	1	33.33
29103.	melon (melon_aid)	3	97.94	108.81	1	33.33
29104.	Austin (melonyt10)	3	88.50	92.09	0	0.00
29105.	Mello (melancholic_god)	3	83.86	96.32	2	66.67
29106.	Gavin (meizlizard)	3	79.44	81.27	1	33.33
29107.	Meirkhan (meirkhans)	3	43.71	45.98	1	33.33
29108.	Meghan (meghanbmcl)	3	61.97	68.88	0	0.00
29109.	mecharekk (mecharekk)	3	54.95	56.98	0	0.00
29110.	Mohamed (mdmod)	3	70.98	77.76	1	33.33
29111.	McScoops (mcscoops)	3	65.53	69.32	3	100.00
29112.	🔰Cosmeen (mcpotato)	3	82.05	87.96	0	0.00
29113.	Mayoukh (mayoukh)	3	69.49	70.52	0	0.00
29114.	Maya (maya_prowers)	3	121.71	129.03	3	100.00
29115.	Max (maxzims)	3	80.28	95.85	0	0.00
29116.	maxwell (maxwellcude)	3	54.07	55.96	1	33.33
29117.	Mauricio (maurizzzio)	3	100.11	112.26	0	0.00
29118.	James (mauricetheferret)	3	99.88	110.43	1	33.33
29119.	Mats (mats1104)	3	61.27	66.07	2	66.67
29120.	Mathias (math225r)	3	86.95	88.80	2	66.67
29121.	christian (matebookd)	3	58.22	64.67	1	33.33
29122.	Akshat Aggarwal (master_mlnd)	3	63.65	69.80	1	33.33
29123.	Msdon (masonarg)	3	46.40	46.76	0	0.00
29124.	Matt (masecla22)	3	79.08	81.88	0	0.00
29125.	Mase (maseabd)	3	86.35	95.90	1	33.33
29126.	:D (marz__s)	3	113.07	126.59	1	33.33
29127.	Mark (mark_my_name)	3	35.25	36.69	0	0.00
29128.	Markus (markusj99)	3	53.46	56.76	3	100.00
29129.	Markus (markusizergin)	3	60.17	68.58	1	33.33
29130.	Juan (marksman10)	3	77.78	83.85	2	66.67
29131.	Mark (markf0cu5)	3	118.22	128.40	1	33.33
29132.	Marijuana (marijuanah)	3	65.66	71.44	0	0.00
29133.	jinkook (marikabing)	3	52.60	53.29	0	0.00
29134.	Maria (mariatran9)	3	84.58	90.51	0	0.00
29135.	Marcos (marcosv)	3	32.08	35.69	3	100.00
29136.	Márton (marconka)	3	63.14	73.58	1	33.33
29137.	tstats[marcko042] (marcko042)	3	83.41	93.04	2	66.67
29138.	Mv (marcellv)	3	64.26	66.91	2	66.67
29139.	Marco (marc7202)	3	101.56	106.06	2	66.67
29140.	pp (marais)	3	79.29	81.92	2	66.67
29141.	Dylan (manyanomalies)	3	75.24	87.04	0	0.00
29142.	Martin (manthee1)	3	44.07	47.07	1	33.33
29143.	Manley (manley716)	3	86.57	93.87	3	100.00
29144.	Jason (manjova)	3	102.41	106.92	1	33.33
29145.	Manav (manavkush)	3	66.19	70.27	1	33.33
29146.	Victor (malvikus)	3	60.50	63.11	0	0.00
29147.	Kevin (malthross)	3	57.32	62.44	1	33.33
29148.	Argo (arks200)	3	86.27	96.42	2	66.67
29149.	Arjav Jain (arjav_jain)	3	45.11	45.93	0	0.00
29150.	Petapa Sakti (arief2014)	3	47.70	48.29	0	0.00
29151.	argo (argoneus)	3	122.89	125.79	3	100.00
29152.	John (arcticanthony)	3	69.96	72.07	0	0.00
29153.	ArchiveAnon (archiveanon)	3	104.99	113.84	2	66.67
29154.	Adnrew (arapoib)	3	81.20	102.02	0	0.00
29155.	aranav (aranavkacker)	3	79.13	83.44	2	66.67
29156.	Moon (aquacharles)	3	83.30	88.36	2	66.67
29157.	AYUSH (apx_morris)	3	57.25	62.87	0	0.00
29158.	Alex (apw024)	3	76.66	78.95	0	0.00
29159.	Ugur (apparro)	3	56.04	64.98	1	33.33
29160.	Appalling Camel (appalling_...	3	65.31	68.24	0	0.00
29161.	Jonas (aplit)	3	81.14	85.47	1	33.33
29162.	Adam (aplesin)	3	85.61	89.44	3	100.00
29163.	Anirudh (apie)	3	122.29	122.65	2	66.67
29164.	🖤 R.I.P. reckful ❤️ ...	3	111.03	114.65	1	33.33
29165.	an (an_vu41)	3	37.41	46.10	0	0.00
29166.	Sunny (anzphoenix)	3	68.54	76.83	0	0.00
29167.	Antzlee (antzlee)	3	97.73	103.25	1	33.33
29168.	Antonio (antoniopelayo)	3	75.96	79.51	0	0.00
29169.	Mr (antoniskan)	3	71.66	74.90	3	100.00
29170.	Anti (anti8157)	3	93.80	98.42	1	33.33
29171.	Jackson (anonym00se)	3	70.40	79.84	0	0.00
29172.	Anon (anonjr)	3	69.68	77.58	1	33.33
29173.	Seb (aniuortes)	3	63.73	66.15	0	0.00
29174.	Nyrico (angelocuartel)	3	75.73	87.50	1	33.33
29175.	Andrei (andythemenace)	3	58.42	64.45	0	0.00
29176.	Andrei (andymfd)	3	30.00	33.17	0	0.00
29177.	Andy (andyc716)	3	75.23	80.89	0	0.00
29178.	Andrew (andrewforce)	3	56.42	57.08	2	66.67
29179.	amaan (andrewescott)	3	60.26	64.51	0	0.00
29180.	Andrew (andrewdanoob)	3	46.28	51.53	0	0.00
29181.	Andrew (andrew530)	3	60.71	71.41	0	0.00
29182.	Andra (andrasense)	3	64.49	68.41	0	0.00
29183.	Andre (andre2016)	3	26.87	27.78	0	0.00
29184.	Anders (andersranum)	3	87.81	89.26	3	100.00
29185.	Nick (anc708)	3	131.78	141.41	3	100.00
29186.	matthew (ananiku)	3	53.59	55.60	0	0.00
29187.	Anand (anand7711)	3	36.42	39.56	0	0.00
29188.	Elijah (amusingquill3)	3	92.61	100.50	1	33.33
29189.	Marcelo (amsua99)	3	81.92	85.70	0	0.00
29190.	Laurence (amphora)	3	101.81	106.59	0	0.00
29191.	among us (among_us)	3	78.62	83.14	2	66.67
29192.	Ammar Ahmed (ammarahmed001)	3	37.11	41.45	0	0.00
29193.	Bryn (ami_kawashima)	3	59.08	62.04	0	0.00
29194.	Amit (amit_panwar)	3	57.33	67.76	0	0.00
29195.	Amith (amith_c_04)	3	64.15	67.67	0	0.00
29196.	tobin (amilliwpm)	3	90.43	97.36	2	66.67
29197.	aman (amanostrich)	3	108.67	115.41	1	33.33
29198.	Amura (amaar)	3	78.94	86.10	1	33.33
29199.	Amaanudeen (amaanudeen)	3	67.29	70.80	2	66.67
29200.	alulss (alulss)	3	54.76	73.93	0	0.00
29201.	Noah (alpha_tortle)	3	88.12	98.10	0	0.00
29202.	Alpha (alpha_sp4rky)	3	69.37	73.90	0	0.00
29203.	Alpha (alphatyper123)	3	119.01	125.35	2	66.67
29204.	Alphan (alphan)	3	48.14	59.96	1	33.33
29205.	Alpha (alpha5466)	3	133.58	146.31	3	100.00
29206.	Mahfuz (almahfuz)	3	46.15	49.71	1	33.33
29207.	ally (ally004)	3	73.77	82.80	1	33.33
29208.	Ronnie (allyosaugh)	3	148.64	152.81	3	100.00
29209.	Alloysius (alloysius)	3	103.28	106.66	2	66.67
29210.	nate (allin110)	3	61.62	62.69	0	0.00
29211.	AlittleJuku (alittlegook)	3	87.83	91.24	2	66.67
29212.	ali (alithegrandpa)	3	44.39	46.38	0	0.00
29213.	Alissa (alissatabb)	3	111.96	113.34	3	100.00
29214.	Alikhan (alikhanzhamankhan_...	3	73.57	77.15	0	0.00
29215.	Ali Haider (alihaider12qw)	3	56.55	58.76	1	33.33
29216.	bee (aliceisjesus)	3	78.42	98.09	1	33.33
29217.	Alex (alexsanderror)	3	53.32	59.25	0	0.00
29218.	Alexander (alexloading)	3	54.63	60.59	0	0.00
29219.	Alex (alexberroverbite)	3	69.61	80.38	3	100.00
29220.	Alex (alex005)	3	81.86	82.82	1	33.33
29221.	Martín (albugineo)	3	65.70	77.88	1	33.33
29222.	Lex (akitgwapa)	3	63.91	69.38	1	33.33
29223.	Blob (akagitsune)	3	60.77	64.53	0	0.00
29224.	Aiden (ajargo2)	3	91.06	94.72	0	0.00
29225.	Matt (airkeeper)	3	93.15	101.30	1	33.33
29226.	Jason (airify)	3	62.72	68.36	3	100.00
29227.	Amy (aimeesongg)	3	98.20	109.01	2	66.67
29228.	Aaryn (ahong0319)	3	63.18	69.12	1	33.33
29229.	ahmir (ahmir123)	3	116.47	120.98	2	66.67
29230.	Agung (agungae)	3	70.16	73.19	1	33.33
29231.	Siddharth (agrawal97siddharth)	3	71.83	75.48	1	33.33
29232.	Allen (agginham)	3	92.93	99.67	2	66.67
29233.	LIGHTNING MEKQUEEN (aftrmg)	3	87.04	94.16	3	100.00
29234.	Apostolos (afmnt)	3	89.70	97.04	3	100.00
29235.	Aether (aetherkiller)	3	62.64	69.02	1	33.33
29236.	nisa (aesthetekim)	3	61.45	66.95	3	100.00
29237.	Hypatia (aelhypatia)	3	84.80	94.23	1	33.33
29238.	Niclas (aegzor)	3	86.36	96.88	0	0.00
29239.	adam (adumyumyum)	3	101.44	120.63	2	66.67
29240.	Nan (adu04)	3	97.11	105.52	1	33.33
29241.	Adrian (adrian_kokot)	3	99.59	115.00	1	33.33
29242.	Ryan (adorben)	3	41.19	42.27	1	33.33
29243.	Adnan (adnanzami)	3	85.09	89.50	1	33.33
29244.	aidan:3 (adizzle)	3	75.44	87.05	2	66.67
29245.	Speed_Aditya (aditya_raj)	3	48.28	60.74	0	0.00
29246.	Mohammad Adeel (adikhanzai)	3	32.97	35.81	0	0.00
29247.	Adhidevan (adhidevansreejith)	3	39.26	41.89	2	66.67
29248.	Adam (adakam12)	3	74.48	95.30	2	66.67
29249.	Ad4mxp (ad4mxp)	3	84.03	86.54	0	0.00
29250.	A (ad1217)	3	85.34	89.45	1	33.33
29251.	Alexey (actually_available_...	3	82.05	88.62	2	66.67
29252.	aCreativeUsername (acreativ...	3	82.90	84.83	2	66.67
29253.	Acid (acidderp)	3	49.50	53.62	0	0.00
29254.	Ben (achillesari)	3	75.46	79.07	0	0.00
29255.	acey (aceycanttype)	3	111.15	113.63	3	100.00
29256.	Diego (aceplex)	3	99.85	104.81	1	33.33
29257.	Wambo(dong) (aceizzhi)	3	49.36	60.20	1	33.33
29258.	Armo (acduston13)	3	76.26	84.67	3	100.00
29259.	Abok (aboookt)	3	46.71	54.58	0	0.00
29260.	Abi (abiunsy)	3	53.40	61.49	0	0.00
29261.	Abiel (abiel_abrham)	3	36.77	39.03	0	0.00
29262.	Abid (abid_zzz)	3	54.21	57.51	0	0.00
29263.	Abid Hasan (abid_hasan_abir)	3	71.01	77.83	1	33.33
29264.	Abhi (abhishekmalle)	3	90.77	97.58	1	33.33
29265.	Abhijeet (abhinitinkale)	3	82.49	85.64	2	66.67
29266.	Abhigyan (abhigyan11)	3	89.57	93.27	2	66.67
29267.	Abdullah (abdullahsoulat)	3	40.78	41.58	0	0.00
29268.	Abdullah (abdullahahmed)	3	40.92	43.47	1	33.33
29269.	@abdmhamzah (abdmhamzah)	3	45.01	65.30	0	0.00
29270.	Pink Tissue (abdalmoez)	3	108.45	117.39	3	100.00
29271.	Aaryan (aaryansarnaik)	3	63.25	69.98	1	33.33
29272.	alex (aalextr)	3	100.78	110.42	2	66.67
29273.	Maxwell (999maxwell)	3	116.16	129.37	2	66.67
29274.	Yosuke (7wolves)	3	71.84	87.81	3	100.00
29275.	Jeoff (7dollarburrito)	3	94.91	102.48	3	100.00
29276.	Vasil (777vasil)	3	95.68	98.07	0	0.00
29277.	700 (700shots)	3	51.11	54.05	1	33.33
29278.	leah (69leah)	3	81.89	87.70	0	0.00
29279.	666Rising (666rising)	3	59.55	62.07	1	33.33
29280.	Ruslan (4flamee)	3	52.23	55.09	0	0.00
29281.	desyncgod (43243264)	3	83.97	88.23	0	0.00
29282.	メラキくん (4146d0n)	3	88.94	94.60	1	33.33
29283.	3li (3licraft)	3	48.87	51.23	2	66.67
29284.	STAN JISOO (3kawaii5u)	3	128.05	139.96	1	33.33
29285.	moose (3biggiantmoose)	3	86.67	93.79	0	0.00
29286.	333pwn (333pwn)	3	60.31	71.98	1	33.33
29287.	Gerglee (333666666333)	3	91.43	96.59	1	33.33
29288.	Mac (327type)	3	85.36	96.98	0	0.00
29289.	Brad (2slo2calm)	3	76.69	77.18	0	0.00
29290.	Small (2pacaklypse)	3	122.26	143.93	3	100.00
29291.	2muchdmg (2muchdmg)	3	87.07	89.98	1	33.33
29292.	king (23bish)	3	73.98	81.95	0	0.00
29293.	Zod (1zod)	3	96.59	101.59	1	33.33
29294.	John (1underman123)	3	58.80	67.80	1	33.33
29295.	Earl (1t_r3a11y_h4rtz)	3	91.94	100.23	3	100.00
29296.	basil (1trying_to_be_fast1)	3	47.51	51.04	0	0.00
29297.	Rika (16yoshino16)	3	91.23	98.41	0	0.00
29298.	Joris (129828)	3	81.94	84.51	0	0.00
29299.	ryan (10thdentist)	3	84.43	86.70	0	0.00
29300.	Kuhaku (0kuhaku1)	3	84.94	94.64	2	66.67
29301.	Sheesh (0hpl3as3)	3	78.32	84.32	1	33.33
29302.	Piyush (piyushbhati)	3	36.28	36.88	1	33.33
29303.	Izzat (frost07)	3	66.00	70.45	2	66.67
29304.	Matt (thechyepiez)	3	99.19	107.41	1	33.33
29305.	rat (ratdog24)	3	29.02	29.77	0	0.00
29306.	Ben (geometrymazter)	3	56.68	76.20	2	66.67
29307.	Ayden (aclay47)	3	110.28	118.69	2	66.67
29308.	Andrew (andrewalvarez1)	3	79.27	93.15	1	33.33
29309.	Jordan (jg75060)	3	101.99	111.16	3	100.00
29310.	Lavie (lavish_sharma)	3	53.47	58.31	0	0.00
29311.	qTiP (qtipster)	3	95.56	100.82	1	33.33
29312.	Till (artlessventure)	3	79.99	84.20	1	33.33
29313.	Tristelo (tristelo)	3	82.26	97.61	2	66.67
29314.	Rigo (rigoftw)	3	89.37	90.63	2	66.67
29315.	Khaqan (khaqan12)	3	43.37	48.76	0	0.00
29316.	Axel (axelerrixx)	3	100.08	104.00	3	100.00
29317.	Gamaliel (ashura_1126)	3	47.57	55.24	0	0.00
29318.	pancho (panchoh)	3	68.91	70.94	0	0.00
29319.	Drewster23 (drewster23)	3	82.54	95.16	0	0.00
29320.	Enigma (darrenrs)	3	135.83	141.38	3	100.00
29321.	Kyle (lazybasilisk)	3	72.97	73.90	1	33.33
29322.	Vivi (vivibrian)	3	93.20	98.80	3	100.00
29323.	Josseph (joeymtn)	3	96.17	107.71	1	33.33
29324.	omkar (crusaderrr)	3	70.95	79.80	0	0.00
29325.	Sean (mr_responsible)	3	93.53	98.34	0	0.00
29326.	ambak (ambak)	3	62.85	69.40	1	33.33
29327.	André (anri17)	3	69.58	79.12	1	33.33
29328.	JunWOo (junwoo123)	3	45.16	50.28	0	0.00
29329.	paige (pagefromabook)	3	60.28	63.17	0	0.00
29330.	Chiril (zalmoxis)	3	61.08	63.05	1	33.33
29331.	nudel (valord1)	3	48.99	58.02	0	0.00
29332.	Izhan (izhan99)	3	68.73	79.35	0	0.00
29333.	Sofia (siouxsiexioux)	3	68.95	71.08	0	0.00
29334.	mackinzie (mackinzie)	3	49.23	53.13	0	0.00
29335.	YokingChain (yokingchain)	3	50.17	55.04	1	33.33
29336.	Neo (typo_hypo)	3	84.48	93.76	2	66.67
29337.	Khalid (khalid_syfullah)	3	85.99	93.80	3	100.00
29338.	Ervin (scripticle)	3	72.17	79.56	1	33.33
29339.	Jonathan (jonyface)	3	88.91	93.35	1	33.33
29340.	kez (kurax4)	3	72.97	81.34	2	66.67
29341.	channie (channiexuhi)	3	60.45	87.43	0	0.00
29342.	kidney (k1dn3y)	3	90.54	92.96	1	33.33
29343.	Sheesh (vxnerate)	3	90.84	106.23	1	33.33
29344.	Abdullah (zhafaat)	3	30.45	35.21	1	33.33
29345.	Guskes (guskes)	3	75.10	82.19	2	66.67
29346.	j (blowhouse)	3	38.54	42.36	1	33.33
29347.	abhay (fladistic)	3	55.16	59.38	0	0.00
29348.	Mridul (mridulhaque)	3	50.39	56.35	1	33.33
29349.	Mel (melissaseamons)	3	45.96	47.10	0	0.00
29350.	Ashlee (ash123450g)	3	41.37	43.81	1	33.33
29351.	Dreaming (dreaming_vision01)	3	79.55	80.19	2	66.67
29352.	Plickk (jazzferbanasihan86)	3	53.23	55.33	0	0.00
29353.	Erin (bubblegumerin16)	3	43.62	46.04	0	0.00
29354.	Joe (j_suzz_)	3	97.63	107.25	1	33.33
29355.	Joaquin (joaquingallo)	3	76.32	78.92	2	66.67
29356.	Hirraree (hirraree)	3	54.21	56.10	0	0.00
29357.	k8lyn (k8lyn_kat)	3	76.02	84.49	1	33.33
29358.	Oscar (enroze)	3	103.41	106.94	1	33.33
29359.	Eric (redcheetofingers)	3	46.81	49.23	0	0.00
29360.	Wingo (wingo9967)	3	122.66	132.12	3	100.00
29361.	Cindy (chi3tcin)	3	113.87	128.52	2	66.67
29362.	THUG (thugrex)	3	96.65	99.18	1	33.33
29363.	EteRoWL (eterowl)	3	61.96	72.80	1	33.33
29364.	Aaron (kieron2246)	3	43.34	49.37	1	33.33
29365.	Airrcrew (arrrow)	3	46.26	48.00	0	0.00
29366.	Shaun (afqro)	3	55.92	63.73	3	100.00
29367.	Josh (krodnc38)	3	43.01	49.88	2	66.67
29368.	Nathan (90snath)	3	59.00	66.14	0	0.00
29369.	karl (yelloxmo)	3	69.56	80.01	1	33.33
29370.	Budley (pootisspy1)	3	85.57	91.88	0	0.00
29371.	Xai (darkxai)	3	88.07	93.24	2	66.67
29372.	Marta (martarel)	3	74.50	77.63	1	33.33
29373.	toxic (toxicexe)	3	60.17	73.42	1	33.33
29374.	Dominik (toxodomo)	3	46.72	47.09	1	33.33
29375.	Travis (thetrav)	3	97.86	113.57	0	0.00
29376.	Badjo (badjo_1998)	3	53.87	57.60	1	33.33
29377.	Typhoic (typhoic)	3	60.26	64.63	0	0.00
29378.	Antony (cony77777)	3	79.70	95.95	1	33.33
29379.	dement (dement29)	3	96.41	102.75	1	33.33
29380.	Petre (epic7865)	3	64.44	70.21	1	33.33
29381.	Ava (syryquil)	3	107.01	116.25	2	66.67
29382.	Zobeid (zobeid)	3	97.12	105.63	2	66.67
29383.	Sondre (sondreeee)	3	63.92	66.88	1	33.33
29384.	Saumitra (shukla_23)	3	51.74	55.21	0	0.00
29385.	Sebastian (novatypes)	3	101.45	109.11	3	100.00
29386.	Marcin (zawadsoon)	3	68.28	69.26	2	66.67
29387.	Veronika (verunkajeracer)	3	45.19	51.23	0	0.00
29388.	Juan Luis (juan_88818)	3	55.99	62.03	1	33.33
29389.	NoaP (noap)	3	56.86	58.41	3	100.00
29390.	Maor (hello_its_maor)	3	78.55	86.93	1	33.33
29391.	Space (space8)	3	44.26	48.51	1	33.33
29392.	David (brodogo)	3	70.58	87.03	1	33.33
29393.	OdaPoda (odapoda)	3	37.61	43.17	0	0.00
29394.	MoneyStack (moneystackjack)	3	57.87	60.47	0	0.00
29395.	sloth (slothonhoth)	3	56.29	57.72	0	0.00
29396.	Jadon (jlt831)	3	58.85	64.57	1	33.33
29397.	David (redango)	3	46.25	54.16	0	0.00
29398.	sanzelda (sanzelda)	3	87.54	96.75	1	33.33
29399.	Moshi (moshitang2014)	3	90.31	99.81	2	66.67
29400.	abdul (aeza)	3	90.16	96.19	3	100.00
29401.	Rito (khabib)	3	85.78	93.58	0	0.00
29402.	Luna (heyimluna)	3	59.43	66.59	0	0.00
29403.	Luke (woozyfo)	3	84.10	93.46	1	33.33
29404.	Riana (mananasy)	3	37.85	39.49	0	0.00
29405.	Dante (doogen)	3	60.41	60.56	0	0.00
29406.	Martin (kadinov)	3	83.48	92.47	1	33.33
29407.	Ian (jay27_22)	3	71.60	76.28	0	0.00
29408.	Max (elytrous)	3	50.07	55.50	0	0.00
29409.	I SUCK (lthemanl)	3	82.43	84.13	0	0.00
29410.	Blur (blur612)	3	94.51	99.65	0	0.00
29411.	Andrew (okcandy)	3	73.38	74.29	0	0.00
29412.	aly (alyjarjar2)	3	105.23	117.73	3	100.00
29413.	Sem (semstreams)	3	81.59	84.65	1	33.33
29414.	Tuguy (twoguyswithoutans)	3	42.99	44.27	0	0.00
29415.	Poon (shadyxd88)	3	81.81	96.70	0	0.00
29416.	Daniel (dinonuggets730)	3	105.75	116.16	1	33.33
29417.	DownShiftBG (downshiftbg)	3	68.52	73.15	1	33.33
29418.	James (butterypopcorn)	3	67.20	71.41	0	0.00
29419.	moftw (moftw)	3	62.22	71.23	2	66.67
29420.	Lucas (etcetcetcmkii)	3	85.25	90.36	2	66.67
29421.	Aurum (aurumvenatus3)	3	61.80	69.21	1	33.33
29422.	Danielle (dhazan29)	3	90.51	98.70	3	100.00
29423.	Noah (glancingchair55)	3	59.28	59.61	0	0.00
29424.	ljubica (ljubical)	3	67.65	71.37	3	100.00
29425.	Palash (palashchanda)	3	47.35	49.06	0	0.00
29426.	Bruno (bfig)	3	97.20	103.22	2	66.67
29427.	john (john_twisted)	3	41.82	47.68	0	0.00
29428.	Tree (thefloatingtree)	3	100.27	112.29	2	66.67
29429.	liulian (18838007960)	3	72.56	77.95	1	33.33
29430.	Ja'Liah (liahlool)	3	25.82	30.22	0	0.00
29431.	Lepiku (dimasokto)	3	79.34	84.46	1	33.33
29432.	Phy (phyverr)	3	91.57	93.45	3	100.00
29433.	Yakup (frkngbd)	3	38.96	40.92	0	0.00
29434.	Amr (amr_bendary)	3	41.44	47.49	0	0.00
29435.	Neetij (ltcmdrdata10)	3	113.77	120.32	3	100.00
29436.	Jackson (sleepy365)	3	88.07	92.81	1	33.33
29437.	Brianne (briannejudson)	3	56.36	57.34	1	33.33
29438.	Mateo Montero (zinotu)	3	34.97	36.76	0	0.00
29439.	LK (knightcrypto)	3	55.64	58.61	1	33.33
29440.	mason (cat_curry)	3	72.22	75.89	1	33.33
29441.	EvilPatata (whoop_whoop)	3	58.42	64.29	0	0.00
29442.	Alexander (relentlessgamer1)	3	82.15	84.38	1	33.33
29443.	Jason (jasonw8)	3	34.85	40.58	0	0.00
29444.	Aggy (govno_un420)	3	82.26	89.54	0	0.00
29445.	FattyBadger (fattybadger)	3	75.07	82.89	1	33.33
29446.	GruLox (grulox)	3	73.08	78.53	2	66.67
29447.	Ronnie (roney027)	3	64.44	69.84	3	100.00
29448.	Royou (royou)	3	101.04	107.44	1	33.33
29449.	Naren (narenm)	3	50.64	58.30	1	33.33
29450.	Xiphos (xipho5)	3	72.51	84.05	1	33.33
29451.	YogurtMan (yogurtman42)	3	59.01	63.49	1	33.33
29452.	Shahriar (shahriar_dhruvo)	3	45.69	48.38	0	0.00
29453.	VentusDrake (ventusdrake)	3	74.74	78.82	2	66.67
29454.	h0ly (h0ly)	3	75.18	80.31	0	0.00
29455.	MrCrazys (mrcrazys02)	3	81.34	83.50	2	66.67
29456.	OverLoard (overtherussian)	3	92.34	96.96	2	66.67
29457.	#1 (nitin77)	3	40.73	44.96	1	33.33
29458.	John (johnathanwu)	3	124.99	133.59	3	100.00
29459.	Adrian (adrianchri)	3	45.94	50.09	0	0.00
29460.	ch2r (ch2r)	3	50.93	58.25	1	33.33
29461.	AmogusSussy1 (rowlet211)	3	104.94	130.94	1	33.33
29462.	Tristan (bigwillyhaver96)	3	76.83	83.62	2	66.67
29463.	Koustuv (kous2v)	3	81.12	83.12	2	66.67
29464.	Phin (phineas05)	3	95.76	113.07	1	33.33
29465.	ASmoothCriminal (asmoothcri...	3	92.78	101.03	3	100.00
29466.	gang gang (ianthekorean)	3	76.03	78.62	1	33.33
29467.	Derek (guest0123)	3	65.44	68.54	0	0.00
29468.	Gui (gui1802)	3	71.67	76.40	1	33.33
29469.	River (rv1024)	3	65.78	68.04	1	33.33
29470.	Justin (sparkster49)	3	101.98	112.64	3	100.00
29471.	Kriestofur (kriestofur)	3	89.49	97.48	2	66.67
29472.	Jon (jonnyguitar00)	3	103.60	114.23	3	100.00
29473.	Markian115 (markian76)	3	80.26	92.88	0	0.00
29474.	Manfred (fredje33)	3	61.98	68.15	0	0.00
29475.	Noah (noahj008)	3	61.90	66.62	0	0.00
29476.	Begonia (begonia)	3	88.30	92.34	1	33.33
29477.	wen (cuteweiwen)	3	104.45	113.18	2	66.67
29478.	who's your daddy (pglworld)	3	69.93	74.16	2	66.67
29479.	Orion (obum)	3	71.31	80.39	1	33.33
29480.	Kevin (kevinpro97)	3	85.46	94.98	1	33.33
29481.	Manas (firebolt19)	3	58.39	62.42	1	33.33
29482.	Bradley (bradley36)	3	120.37	124.70	1	33.33
29483.	jinky45 (jinky45)	3	53.22	62.72	0	0.00
29484.	Drew (big_shibe)	3	49.10	54.65	1	33.33
29485.	Francis (completelyclueless)	3	67.44	70.86	0	0.00
29486.	Slowest №1 (b210970041)	3	26.41	28.04	0	0.00
29487.	Ali (aliomar)	3	72.05	74.35	0	0.00
29488.	hyper (xx_hyper_xx)	3	59.53	63.55	0	0.00
29489.	Philip (philipafsen)	3	52.48	54.79	2	66.67
29490.	Cal Naughton, Jr. (rocket86...	3	79.13	82.13	3	100.00
29491.	Katie (katie_kim)	3	50.99	89.49	2	66.67
29492.	Nini (ninija)	3	52.96	59.66	0	0.00
29493.	Py (pyrovks)	3	61.74	69.37	2	66.67
29494.	Azraf (retiredgamer)	3	34.17	44.03	0	0.00
29495.	Bloodelfish (bloodelfish)	3	87.96	94.90	1	33.33
29496.	MK (mk005)	3	45.80	52.60	0	0.00
29497.	Kam (kam_z)	3	95.47	106.85	2	66.67
29498.	Guilherme (guissalustiano)	3	57.07	57.95	0	0.00
29499.	Winnie (nv3d)	3	68.92	73.97	1	33.33
29500.	Andrea (floatterino)	3	53.53	56.77	0	0.00
29501.	cameriin (kevisgaming)	3	79.92	86.54	0	0.00
29502.	FrostWar (frostwar77)	3	45.51	46.32	0	0.00
29503.	burnt_fingers (burnt_fingers)	3	92.09	106.90	3	100.00
29504.	Scott (scottyquist)	3	54.50	64.59	0	0.00
29505.	2IIZ (2iiz)	3	54.63	65.36	1	33.33
29506.	Trixelit (trixelit)	3	84.31	87.12	2	66.67
29507.	Michiel (michilius)	3	64.69	66.59	0	0.00
29508.	@zougari47 (zougari)	3	46.61	52.28	0	0.00
29509.	Taffy (wreckit)	3	88.25	97.53	2	66.67
29510.	mundz (mundz)	3	44.46	46.53	0	0.00
29511.	Vlad (wladfox)	3	54.81	59.32	0	0.00
29512.	Mr. Bean (leylandmini)	3	56.54	60.73	0	0.00
29513.	Nyfo02 (nyfo02)	3	44.26	47.11	0	0.00
29514.	Benjamin (schmidtrekt)	3	67.91	80.28	0	0.00
29515.	slappy (sslappy)	3	103.91	104.91	1	33.33
29516.	Andrew (papercoin)	3	92.37	96.65	2	66.67
29517.	Biggiechoco (biggie_choco)	3	39.02	43.94	0	0.00
29518.	DarkKillerXL (darkkillerxl)	3	47.79	53.20	2	66.67
29519.	Louis (keyboredwarrior)	3	77.52	80.70	1	33.33
29520.	michelle (michellebroers)	3	41.88	52.41	2	66.67
29521.	Bread (cheeseitlarge)	3	73.25	81.43	1	33.33
29522.	iiDxputy (iidxputy)	3	61.73	66.78	1	33.33
29523.	Kuip (kuiprux)	3	64.00	73.77	1	33.33
29524.	Luigi (stevewang220)	3	95.06	97.74	2	66.67
29525.	hungry (swoll)	3	45.71	58.18	2	66.67
29526.	rakel (raivsx)	3	98.21	104.98	2	66.67
29527.	Jayden (moptus)	3	53.77	57.56	1	33.33
29528.	Anton (karton)	3	100.98	109.82	3	100.00
29529.	HR (hr_farmer)	3	108.84	122.44	2	66.67
29530.	Jordan (starballer)	3	121.43	136.97	0	0.00
29531.	Ron (ronn1)	3	45.63	50.46	0	0.00
29532.	W.E. (mehrin_)	3	31.53	34.79	1	33.33
29533.	Jacob (c0mpl)	3	66.74	70.47	1	33.33
29534.	Marc (maarc)	3	58.93	63.97	0	0.00
29535.	James (j_srv)	3	79.25	86.21	1	33.33
29536.	ben (aviben)	3	52.97	55.65	0	0.00
29537.	Luke (sltm)	3	65.81	71.92	0	0.00
29538.	Josh (zeubermensch1337)	3	96.99	109.75	0	0.00
29539.	Meike (zekernietmeike)	3	68.44	73.17	1	33.33
29540.	Cole (lewkaks)	3	95.18	99.32	3	100.00
29541.	Darsh (ddashrf)	3	48.64	55.41	1	33.33
29542.	Gary (garymt)	3	54.79	69.96	1	33.33
29543.	Mateo (matep10)	3	53.95	57.37	0	0.00
29544.	jojo nub (jojo_nub)	3	74.95	79.38	1	33.33
29545.	GN Vageesh (gnvageesh)	3	44.19	50.60	0	0.00
29546.	Jake (evilwhite)	3	92.69	96.74	1	33.33
29547.	AAMpro_IV (aampro_iv)	3	68.01	68.76	0	0.00
29548.	Nathan (dollophead)	3	122.04	130.29	3	100.00
29549.	Tyler (ichihime123)	3	70.93	76.96	0	0.00
29550.	V (flashumoneo)	3	64.10	65.54	3	100.00
29551.	Man (beastnation1234)	3	86.05	96.73	0	0.00
29552.	James (frostycheesecake50)	3	66.63	77.01	0	0.00
29553.	T (super_swag)	3	80.16	87.08	1	33.33
29554.	Cody (cody0812)	3	77.92	87.45	2	66.67
29555.	Jerri (jerrii)	3	108.88	111.67	2	66.67
29556.	rpz (_rpz_)	3	72.24	85.51	2	66.67
29557.	Stephen (axama)	3	68.22	71.23	1	33.33
29558.	Patrick (tehpatrick)	3	87.22	95.70	1	33.33
29559.	Michael (mikeyj007)	3	88.45	93.36	2	66.67
29560.	Qaris (qklewl)	3	91.63	97.60	2	66.67
29561.	peter (peter_heffley)	3	83.08	93.31	0	0.00
29562.	GreenScheme (greenscheme)	3	64.18	65.11	0	0.00
29563.	Donnie (cod_almighty)	3	56.46	56.97	1	33.33
29564.	John (awesomejohn3)	3	81.49	84.37	2	66.67
29565.	Marc (cocoloco82)	3	64.76	70.72	2	66.67
29566.	Tracy (distracy)	3	75.95	79.90	1	33.33
29567.	Serena (serenafu10)	3	61.18	62.98	1	33.33
29568.	floof (derpehdoge)	3	98.29	105.19	3	100.00
29569.	Soy (soysooye)	3	93.05	98.24	1	33.33
29570.	Han Verh (batman69)	3	61.70	75.53	1	33.33
29571.	Jiro (jiro__)	3	51.55	62.58	1	33.33
29572.	Henry (hraspberries)	3	61.67	69.20	1	33.33
29573.	Matthew (barrraoutta)	3	63.21	68.01	0	0.00
29574.	AnhellOn (anhellon7)	3	66.52	77.10	1	33.33
29575.	Angel (zackcloud)	3	49.72	51.42	0	0.00
29576.	Hanseee (hanseee)	3	57.05	59.79	0	0.00
29577.	eve (eve2en)	3	41.02	48.00	0	0.00
29578.	geret13 (geret13)	3	79.75	87.55	3	100.00
29579.	Emily (egrote99)	3	61.09	61.80	0	0.00
29580.	Barney (barneyf)	3	77.03	78.69	1	33.33
29581.	Chris (xajel)	3	91.08	95.35	0	0.00
29582.	Liam (mccrouchyp)	3	72.32	74.14	0	0.00
29583.	Anmol (anmolsinghal3035)	3	55.59	60.00	0	0.00
29584.	Nolan (ttv_anegg847)	3	109.78	116.85	3	100.00
29585.	John Eybs (acidx1221x)	3	63.12	68.78	1	33.33
29586.	Shivang (shivang_2602)	3	53.86	62.87	0	0.00
29587.	Philip (phoenqx)	3	51.03	54.82	0	0.00
29588.	Rishi (srishipandey)	3	51.24	65.35	0	0.00
29589.	om1k (om1k)	3	50.46	52.29	1	33.33
29590.	john (fromthesource)	3	89.48	98.81	1	33.33
29591.	Malkeet (msdfanatic)	3	29.45	33.29	1	33.33
29592.	NOT ronin (roc0ast3r)	3	110.90	115.19	2	66.67
29593.	Jason (resunz)	3	94.24	110.56	1	33.33
29594.	Siddharth (siddharth777)	3	61.52	66.94	1	33.33
29595.	Pamonha (pamonhazinha)	3	55.35	56.53	2	66.67
29596.	Ferney (ferneyr)	3	102.34	109.48	2	66.67
29597.	Mich (michmich112)	3	55.72	59.01	0	0.00
29598.	Artur (arciix)	3	93.46	99.97	2	66.67
29599.	Antoni (antolaf)	3	46.63	48.91	0	0.00
29600.	Ricardo (heretohear)	3	75.17	81.96	3	100.00
29601.	Simon (_wed)	3	54.21	59.96	0	0.00
29602.	Abdelrahman (_isatan_)	3	51.59	56.16	0	0.00
29603.	Yeh (thanano)	3	45.33	48.25	0	0.00
29604.	nami (namivague)	3	91.38	95.75	2	66.67
29605.	Nicholas (nitrooooo)	3	96.54	103.51	1	33.33
29606.	derick (derick1975)	3	92.29	96.34	1	33.33
29607.	Gabriel (gabriel425)	3	45.87	47.92	0	0.00
29608.	Tino (tino_zz)	3	47.91	53.67	0	0.00
29609.	Koala (koalabear2003)	3	89.22	92.12	0	0.00
29610.	Halter (halter_101)	3	79.38	81.58	1	33.33
29611.	vodahmin (vodahmin)	3	97.74	112.09	2	66.67
29612.	dishybloom (dishybloom)	3	50.70	53.79	0	0.00
29613.	Chimmy (chimmyjin)	3	79.87	82.79	1	33.33
29614.	Vic (vicjang)	3	90.08	95.63	3	100.00
29615.	Azad (nano_modzz)	3	35.20	38.05	0	0.00
29616.	fleffixza (fleffixza)	3	73.52	77.24	1	33.33
29617.	Mihai (cutudestroyer)	3	44.52	47.37	0	0.00
29618.	Hasanat (hasanatrn)	3	25.29	27.39	0	0.00
29619.	NeonFlamez (neonflamez1000)	3	61.39	64.81	0	0.00
29620.	JJP (jjpswfc)	3	86.00	96.69	1	33.33
29621.	Trey (treyjohnson_84)	3	84.81	91.28	1	33.33
29622.	hello (pandatyper12)	3	61.35	64.41	1	33.33
29623.	Keyen (lonedrifter7)	3	101.00	121.83	1	33.33
29624.	Rudolf (ovchi1)	3	51.45	54.94	0	0.00
29625.	Antony (iamkoch)	3	85.66	95.38	2	66.67
29626.	Seig (seighart)	3	40.18	42.76	0	0.00
29627.	TwelveFingers (twelvefingers)	3	89.45	91.48	3	100.00
29628.	Viru (viru2656)	3	88.55	96.36	1	33.33
29629.	Human (human_pi)	3	27.20	29.15	0	0.00
29630.	Gordon (gordonxu)	3	79.07	86.19	2	66.67
29631.	constanza (slowbch)	3	39.10	42.22	0	0.00
29632.	Hans (hansworsttyperacer)	3	58.95	64.71	0	0.00
29633.	hani (arkado_h)	2	42.89	43.86	0	0.00
29634.	Arkajyoti (arkajyotijha)	2	63.29	67.79	1	50.00
29635.	Arik (arikuu)	2	86.70	88.56	2	100.00
29636.	Aries (ariesqi)	2	70.28	72.98	0	0.00
29637.	Zaynah (arianagrandeyuh27)	2	55.75	59.27	0	0.00
29638.	Arnold (argoat)	2	85.14	88.86	1	50.00
29639.	Aryaan (argentumv)	2	70.87	85.40	1	50.00
29640.	Arek (arekzaleski)	2	46.70	47.13	0	0.00
29641.	Ben (archerypineapple)	2	69.40	73.55	0	0.00
29642.	Arafat (arafat_hasan)	2	55.12	56.10	0	0.00
29643.	Arabi's (arabisgamingyt)	2	44.45	45.93	0	0.00
29644.	aqua (aqua_plays_bball)	2	94.39	98.82	1	50.00
29645.	austin (apschween)	2	67.83	75.04	0	0.00
29646.	a (apno)	2	92.99	94.14	0	0.00
29647.	Aplukat (aplukat_69)	2	91.48	95.84	1	50.00
29648.	anvildorms (anvildorms)	2	108.76	117.06	1	50.00
29649.	BeaT (anutorn)	2	107.11	108.39	2	100.00
29650.	feet (ant_1105)	2	63.37	67.60	0	0.00
29651.	Antony819 (antony819)	2	62.51	69.28	1	50.00
29652.	Antoine (antiwaniwan)	2	112.97	116.57	2	100.00
29653.	Ziggy (antioch)	2	91.96	102.00	1	50.00
29654.	Logan (anonymous_934)	2	71.27	72.59	2	100.00
29655.	jesper (anneflank)	2	87.08	89.12	1	50.00
29656.	Ankur (ankurgoel)	2	104.14	114.51	2	100.00
29657.	Aniket (aniket2988)	2	74.40	85.03	0	0.00
29658.	Aidan (anguyenkn)	2	92.09	98.07	0	0.00
29659.	AnExoticIdiot (anexoticidiot)	2	39.45	42.73	0	0.00
29660.	Ben (androminous)	2	104.51	104.96	0	0.00
29661.	Andrew (andrewpalet)	2	55.59	59.56	0	0.00
29662.	Andrew (andrewawsome122)	2	90.97	95.88	2	100.00
29663.	Andrew (andrew69314)	2	99.23	100.39	0	0.00
29664.	Andrea (andrealol)	2	97.30	113.13	0	0.00
29665.	andrei (andrake)	2	56.87	59.01	0	0.00
29666.	Andriy (andoroid)	2	68.80	70.07	0	0.00
29667.	Rapha (anakin1178)	2	126.97	128.02	2	100.00
29668.	Alix (anahlia)	2	99.48	102.77	1	50.00
29669.	Andrew (an0nym0us_27)	2	67.05	69.37	1	50.00
29670.	Amy (amyt11)	2	62.55	72.18	0	0.00
29671.	Amy (amydakao)	2	123.96	130.34	2	100.00
29672.	Amy (amyjean)	2	39.12	46.52	0	0.00
29673.	amtrax (amtrax)	2	61.24	61.26	1	50.00
29674.	Landon (amtreeboi)	2	65.05	66.30	0	0.00
29675.	Anton (amsavchenko)	2	45.38	45.69	0	0.00
29676.	Amarpreet (ampit)	2	94.79	103.03	1	50.00
29677.	Dont (amosdaragon69)	2	67.40	68.58	1	50.00
29678.	Amit (amitdahan)	2	99.25	119.19	2	100.00
29679.	Abhishek (amishra7292)	2	63.85	67.25	1	50.00
29680.	AmiLemon (amilemon)	2	59.89	61.55	0	0.00
29681.	amelia (ameliality)	2	64.49	65.44	1	50.00
29682.	Ádám (amegmi)	2	53.99	54.30	0	0.00
29683.	Andrew (amao01)	2	86.52	91.82	0	0.00
29684.	Keia (alu15)	2	50.69	52.08	0	0.00
29685.	GGEZ (altris)	2	102.30	102.42	2	100.00
29686.	Altynbek (altoon)	2	43.59	45.30	0	0.00
29687.	Altan (altan_twitchz)	2	88.90	95.54	0	0.00
29688.	Sara (alphathealpha)	2	131.86	140.13	2	100.00
29689.	Alpha (alphaomegaepsilon)	2	107.06	122.68	0	0.00
29690.	Allen (alphadvorak)	2	64.16	65.58	0	0.00
29691.	Gheorghe (alpha0)	2	50.62	52.14	0	0.00
29692.	alp atakan (alpatakan)	2	60.26	60.60	2	100.00
29693.	alpaca (alpacaaviator)	2	112.45	113.49	1	50.00
29694.	xǝl∀ (alnotreally)	2	53.96	54.93	2	100.00
29695.	Alnas (alnasnasu)	2	60.43	65.96	0	0.00
29696.	Almight (almight)	2	53.34	55.65	1	50.00
29697.	june (alltoowell)	2	75.87	79.46	0	0.00
29698.	J (allobubu)	2	112.69	117.41	1	50.00
29699.	alldeux (alldeux)	2	95.25	97.57	2	100.00
29700.	G (alldetected)	2	74.49	74.62	0	0.00
29701.	Allan (allanersaj)	2	61.75	61.87	1	50.00
29702.	Jonnathan (aljeak_)	2	76.98	77.30	1	50.00
29703.	Alejandro (aljandro2o)	2	49.20	56.73	1	50.00
29704.	ALixe (alix3)	2	88.37	89.45	1	50.00
29705.	alien_super (alien_super)	2	94.03	99.15	1	50.00
29706.	AlhassanTaher (alhassantaher)	2	60.12	64.07	0	0.00
29707.	Alex (alexxxkachow)	2	71.82	73.90	0	0.00
29708.	a (alextheman49)	2	82.86	86.45	0	0.00
29709.	ayky (alexisyeo)	2	68.01	70.65	1	50.00
29710.	Xander (alex0824)	2	92.45	99.67	2	100.00
29711.	Ale (aleplayz)	2	51.19	52.40	0	0.00
29712.	Alec (alecwest)	2	89.37	93.81	1	50.00
29713.	ale (ale10212)	2	35.97	39.44	1	50.00
29714.	Aldas (aldas25)	2	67.86	68.33	0	0.00
29715.	Dirivial (alcade)	2	74.42	86.55	0	0.00
29716.	Albert (albertthedy)	2	108.35	119.16	1	50.00
29717.	Alberti (albertibass)	2	107.48	107.62	1	50.00
29718.	Rodrigo (alang217)	2	87.04	95.03	1	50.00
29719.	Alan (alanfortlink)	2	115.84	123.29	2	100.00
29720.	Miesepeter (akizow)	2	72.62	73.40	2	100.00
29721.	kaneki (akiyama_shinchi)	2	64.53	69.18	0	0.00
29722.	Akhil (akhilrawat001)	2	51.90	54.58	0	0.00
29723.	akelok (akelok)	2	137.07	138.76	2	100.00
29724.	Akash (akashshrm02)	2	79.60	88.49	0	0.00
29725.	AJ (ajk810)	2	72.41	83.15	0	0.00
29726.	Jason (ajelliedonut)	2	69.29	77.27	0	0.00
29727.	Ajay (ajay_sharma)	2	46.18	47.94	0	0.00
29728.	alex (aj25)	2	105.38	105.87	0	0.00
29729.	PrinceRemielAleks (aisakata...	2	107.47	117.03	1	50.00
29730.	sudo (airpline1)	2	92.93	95.02	0	0.00
29731.	ain (ainzel)	2	58.29	64.95	0	0.00
29732.	aidan (aidooo)	2	55.48	57.95	0	0.00
29733.	wowza (aidan3540)	2	77.65	78.49	1	50.00
29734.	a (aidan2021)	2	107.33	119.89	0	0.00
29735.	Ahududu (ahududuyt)	2	22.88	27.29	0	0.00
29736.	MR. Nobody (ahsanakbar)	2	73.72	75.11	1	50.00
29737.	Doggy (ahousecat6969)	2	68.54	69.69	0	0.00
29738.	deez (ahntahrees)	2	83.60	85.95	1	50.00
29739.	Ahmed (ahmedkn)	2	47.60	47.82	0	0.00
29740.	Ahan (ahanmal)	2	69.40	79.30	0	0.00
29741.	Joe (afromonkey)	2	89.57	93.08	0	0.00
29742.	fishOil (afishoil)	2	89.50	95.20	1	50.00
29743.	APA COBA!!! (afider)	2	35.87	37.71	0	0.00
29744.	Alireza (afateh)	2	66.88	75.88	0	0.00
29745.	Alori (aeshaefi)	2	50.70	51.19	0	0.00
29746.	Kelvin (aerochow)	2	118.27	125.43	2	100.00
29747.	Andrea (aerdna12)	2	71.34	72.92	0	0.00
29748.	SpicyBoi (aedsman)	2	113.35	116.29	0	0.00
29749.	advu_ (advu_)	2	84.85	85.50	0	0.00
29750.	adol (adoll)	2	127.93	133.25	2	100.00
29751.	Aditya (aditya_trans63)	2	45.99	46.31	0	0.00
29752.	adiguna (adiguna7)	2	54.94	60.41	0	0.00
29753.	Adelrik (adelrik)	2	53.98	56.80	1	50.00
29754.	Adelio (adeliogaudi)	2	94.80	97.10	1	50.00
29755.	.georgy (add_me_on_discord)	2	148.31	151.40	1	50.00
29756.	Addison (addisondj)	2	95.28	97.28	1	50.00
29757.	Adam (adamt_543)	2	68.28	68.31	2	100.00
29758.	Adam (adamnordin)	2	57.95	58.19	0	0.00
29759.	adam (adamcute122)	2	66.79	72.67	2	100.00
29760.	Actinom (actinom)	2	101.34	107.26	1	50.00
29761.	Andrew (acr21)	2	46.85	49.58	0	0.00
29762.	achewytoffee (achewytoffee)	2	89.48	94.04	1	50.00
29763.	John (acg55678)	2	98.93	102.50	1	50.00
29764.	pomgie (achan66)	2	97.92	106.66	2	100.00
29765.	zildanzabani (aceraven7)	2	51.48	58.15	1	50.00
29766.	David (abush635)	2	83.22	97.66	0	0.00
29767.	abukoj (abukoj)	2	87.56	87.92	0	0.00
29768.	Hadiff (abubu)	2	63.59	68.06	1	50.00
29769.	Abrar (abrar_al_samit)	2	89.10	90.43	0	0.00
29770.	Ibrahim (aboyasser)	2	67.55	76.66	1	50.00
29771.	big (aboxofkleenex)	2	103.38	104.85	1	50.00
29772.	abdalkarim (aboodz)	2	55.32	59.54	0	0.00
29773.	Abhishek (abhis004)	2	39.78	51.05	1	50.00
29774.	Cesar I. (aberuwu)	2	74.80	78.48	1	50.00
29775.	Abdullah (abdullahahmad)	2	51.27	52.98	0	0.00
29776.	Appa (abdallah99)	2	61.20	67.21	0	0.00
29777.	Abda (abdaishere)	2	46.92	51.69	2	100.00
29778.	Abby (abbykiehlbauch)	2	91.89	98.88	2	100.00
29779.	aardvark (aardvark_warrior)	2	72.39	81.97	1	50.00
29780.	AAMMEERRIICCAA (aammeerriic...	2	73.03	74.96	1	50.00
29781.	Tan (aalliance11)	2	55.43	57.80	1	50.00
29782.	aagils (aagils)	2	55.25	59.57	2	100.00
29783.	A (aa1729)	2	104.84	108.88	0	0.00
29784.	BP (a227673)	2	90.78	95.48	1	50.00
29785.	Esk (99tester)	2	84.26	93.02	1	50.00
29786.	🏎️Zermist (90wpmomg)	2	166.07	173.27	1	50.00
29787.	Henry (7enry)	2	87.44	97.72	1	50.00
29788.	79eL (79el)	2	111.10	116.88	0	0.00
29789.	??? (5apphire)	2	100.72	100.93	0	0.00
29790.	Ron (4ronse)	2	65.17	68.19	1	50.00
29791.	. (4n0nym0us_h4ck3r)	2	71.22	75.17	1	50.00
29792.	ada (4ex7)	2	60.59	65.02	0	0.00
29793.	Rei (45kin)	2	63.37	73.00	0	0.00
29794.	TN (47percent)	2	92.76	96.32	1	50.00
29795.	Zakhar (3eldu)	2	98.87	103.50	1	50.00
29796.	darryl (3dsss)	2	72.90	74.48	0	0.00
29797.	Lando Commando (360curve)	2	138.88	144.25	1	50.00
29798.	M Ali +923104362942 (35wppm)	2	85.40	87.20	0	0.00
29799.	Rajan (340900190)	2	109.97	118.42	1	50.00
29800.	Andrew (2pack)	2	56.21	57.70	0	0.00
29801.	Kill (2fast4yall)	2	101.48	105.38	1	50.00
29802.	2Change (2change)	2	69.88	71.92	1	50.00
29803.	Rosvaldas (27god)	2	100.82	110.06	1	50.00
29804.	~~~ (2019ygao)	2	69.24	70.62	1	50.00
29805.	1t2ht (1t2ht)	2	61.14	61.56	0	0.00
29806.	Peter (187streetlegends)	2	54.14	61.24	0	0.00
29807.	No (11ucky)	2	67.84	69.21	0	0.00
29808.	Dan (114_ddo)	2	87.47	95.63	0	0.00
29809.	Phoenyx (1013482)	2	83.07	86.36	0	0.00
29810.	ALL (0gets)	2	77.95	85.18	1	50.00
29811.	North (0azimuth)	2	134.12	153.02	2	100.00
29812.	L33T (01l33t)	2	79.79	84.52	1	50.00
29813.	Liew (00hong)	2	80.25	80.58	1	50.00
29814.	dhiv25 (edtyper)	2	56.26	58.23	1	50.00
29815.	owokamii (owokamii)	2	54.02	58.09	2	100.00
29816.	Skull Crusher (_vikhyat)	2	54.17	60.53	0	0.00
29817.	monkecmonkedo (statisity)	2	96.99	107.94	1	50.00
29818.	Ghita (ghostwriter007)	2	40.06	40.22	0	0.00
29819.	Sebastian Fischer (basti747)	2	33.36	44.74	0	0.00
29820.	z (zeessh)	2	70.99	76.02	2	100.00
29821.	Ameen (takvacs)	2	62.76	64.95	2	100.00
29822.	Leo (lion2005chen)	2	70.40	71.33	0	0.00
29823.	Zahoark (zahoark)	2	74.06	76.77	0	0.00
29824.	Skimmex (skimmex)	2	85.77	93.04	0	0.00
29825.	Slyvix (slyvix)	2	68.96	74.42	0	0.00
29826.	Matt (mschmize)	2	92.31	92.66	1	50.00
29827.	pi_calculus (pi_calculus)	2	65.80	69.25	0	0.00
29828.	UV (__uv__)	2	75.44	77.92	1	50.00
29829.	Mohamed (mohamedgbreel)	2	51.89	54.46	1	50.00
29830.	Kevin (kevinriccy)	2	75.78	76.09	0	0.00
29831.	Aryaman (hackman23ary)	2	72.72	73.94	2	100.00
29832.	Wayne (zhuw)	2	85.14	87.25	0	0.00
29833.	Joshua (adu_4063)	2	117.47	123.20	2	100.00
29834.	Otto (slowclapper)	2	56.06	59.62	1	50.00
29835.	Isaac (soggy_duck1)	2	60.57	64.42	0	0.00
29836.	VU (vvv12345)	2	38.09	41.45	0	0.00
29837.	Archit (apotharazu)	2	108.13	112.15	1	50.00
29838.	Meneer (meneer)	2	104.70	105.90	1	50.00
29839.	Goran (ahh1)	2	39.38	39.43	1	50.00
29840.	This is (literallyjerk)	2	107.40	125.11	0	0.00
29841.	m (mtrizz)	2	86.37	86.86	1	50.00
29842.	PSGN (nick_fury02)	2	62.70	65.38	0	0.00
29843.	rex (rexorangecounty)	2	62.14	63.53	0	0.00
29844.	Jaden (itzjayyx3)	2	106.84	125.59	1	50.00
29845.	Evan (wddfrt)	2	79.88	80.44	1	50.00
29846.	Sebastian (sleopold)	2	85.43	87.46	0	0.00
29847.	med (fools_world)	2	65.34	67.90	1	50.00
29848.	MOHINI (mohini_tripathi)	2	49.36	50.34	0	0.00
29849.	tin (tintinbananas)	2	74.99	77.82	1	50.00
29850.	Coder (m8nlight_blue)	2	32.52	32.54	0	0.00
29851.	Fatih (filthyadcmain)	2	75.33	78.71	1	50.00
29852.	Basti (bastizocker84)	2	28.97	29.81	1	50.00
29853.	Jay (enchant)	2	81.41	82.47	1	50.00
29854.	Kenyan (kenyan)	2	55.37	63.67	1	50.00
29855.	Josh (frqit)	2	82.21	90.51	0	0.00
29856.	extratiger (extratiger)	2	66.14	70.51	1	50.00
29857.	CHiperdoodles (chiperdoodles)	2	45.81	51.33	0	0.00
29858.	Yousef (yousefmagdy11)	2	49.64	51.82	0	0.00
29859.	Darrin (mrnuma)	2	40.86	45.43	0	0.00
29860.	bronzki (bronzki)	2	65.96	70.74	0	0.00
29861.	Colin (zolohd)	2	57.15	65.77	1	50.00
29862.	Azamat (cl3vn)	2	49.86	52.13	0	0.00
29863.	zenitsufromph (zenitsufromph)	2	118.50	121.01	2	100.00
29864.	Emad (alkamali)	2	76.17	81.73	1	50.00
29865.	Cocktavian (cocktavian)	2	93.21	94.28	2	100.00
29866.	batkhishig dulamsurankhor (...	2	62.53	64.54	0	0.00
29867.	regnir (satyo)	2	94.91	104.58	0	0.00
29868.	zshyne (zshyne)	2	93.11	98.35	2	100.00
29869.	philip (philipalm)	2	51.72	54.88	0	0.00
29870.	***** (veimik)	2	107.14	114.43	1	50.00
29871.	Aryan (_noob_racer_)	2	62.30	62.81	1	50.00
29872.	Jade (jeido)	2	72.02	84.21	2	100.00
29873.	Aviya (aviyash)	2	87.74	94.77	0	0.00
29874.	Justin (pingpongpoo)	2	108.48	109.38	2	100.00
29875.	soulesskunoi (soulesskunoii_)	2	70.00	73.26	1	50.00
29876.	Callum (callum_wiebe14)	2	72.28	75.08	1	50.00
29877.	Jannik (jbirk)	2	76.71	77.86	0	0.00
29878.	Safal (safal23)	2	50.53	62.31	1	50.00
29879.	James (jamshm)	2	77.46	81.17	0	0.00
29880.	Evan (aeviswhy)	2	62.69	64.83	0	0.00
29881.	Steven (spfabian)	2	53.63	57.51	1	50.00
29882.	Panda (panda2627)	2	31.90	36.48	0	0.00
29883.	Thomas (bijlenman)	2	74.99	80.02	1	50.00
29884.	Amruth (thedarknight40)	2	61.40	64.48	2	100.00
29885.	Devin (djspi)	2	75.64	76.58	0	0.00
29886.	Raymond (bowlcutninja)	2	62.81	78.40	1	50.00
29887.	Faralha (faralha)	2	64.30	67.85	2	100.00
29888.	James (jamesbt365)	2	77.34	82.43	0	0.00
29889.	Yassin (yy86)	2	92.22	93.75	1	50.00
29890.	Xziden (xziden)	2	71.23	72.61	1	50.00
29891.	Alyx (ekatya)	2	121.20	127.70	1	50.00
29892.	Raymond (kp1419)	2	84.32	88.95	0	0.00
29893.	Jani (jankko77)	2	73.35	79.08	0	0.00
29894.	Veljko (vucko777)	2	61.92	62.65	1	50.00
29895.	" " (jawnny)	2	96.53	99.14	0	0.00
29896.	Gabriel (cntbstr)	2	99.71	106.76	1	50.00
29897.	Alim (amanzholov8)	2	64.20	65.05	0	0.00
29898.	Ammar (ammarali047)	2	52.77	55.88	1	50.00
29899.	pizzlyhusk (husker144)	2	81.50	84.38	1	50.00
29900.	Aither (aither)	2	82.87	91.39	2	100.00
29901.	jean (jeanoodles)	2	98.32	101.14	2	100.00
29902.	starwars2151 (starwars2151)	2	112.04	112.06	2	100.00
29903.	AP (ittoki_gaku)	2	46.23	46.93	0	0.00
29904.	Halle (halleberry77)	2	59.41	60.47	0	0.00
29905.	Orange (the_opulent_orange)	2	62.24	63.79	1	50.00
29906.	Wud (wud_)	2	53.20	58.44	0	0.00
29907.	Shay (guest102)	2	71.34	75.34	0	0.00
29908.	Muhammad (mjuwaeni25)	2	36.82	39.05	0	0.00
29909.	Adam (adam_phelan)	2	53.31	62.03	1	50.00
29910.	Hotaru (tanglewreck)	2	73.24	74.88	0	0.00
29911.	Jeb (jcay628)	2	61.33	72.04	0	0.00
29912.	Tomáš (kokias)	2	65.19	67.95	2	100.00
29913.	Tim (tlin7)	2	82.08	82.33	1	50.00
29914.	maia (maiaau)	2	62.93	68.98	0	0.00
29915.	NotGood (nogoodtyper)	2	59.06	61.12	1	50.00
29916.	Jo (dsrezza123)	2	57.90	57.92	2	100.00
29917.	Lin (blusewill)	2	51.20	57.06	0	0.00
29918.	Michael (warpedwords)	2	95.19	97.01	0	0.00
29919.	Ethan (etuann)	2	94.89	101.13	1	50.00
29920.	Gergely (goldgamer2)	2	53.77	53.85	0	0.00
29921.	fatih (fatiher)	2	59.40	61.96	0	0.00
29922.	felix (lusciousbun)	2	67.99	74.41	0	0.00
29923.	Aaron (01100001)	2	112.93	115.53	0	0.00
29924.	Jackson (judyisbaby)	2	77.92	87.55	0	0.00
29925.	TheLavaMouse (first_try)	2	67.52	70.92	0	0.00
29926.	Nixon (nixonyung)	2	67.44	73.59	0	0.00
29927.	Nick (nickxd1)	2	71.04	72.11	0	0.00
29928.	hielo (hiel0)	2	57.31	57.70	1	50.00
29929.	massive (ninjamaster0324)	2	67.47	78.84	0	0.00
29930.	testicles (aigis99)	2	103.22	109.92	1	50.00
29931.	hubs (hub600)	2	78.22	86.66	0	0.00
29932.	Max (maximedupre)	2	67.22	68.53	0	0.00
29933.	will (willychang21)	2	51.64	56.97	0	0.00
29934.	Nick (mizuvapor)	2	76.03	77.02	2	100.00
29935.	Infern (infernql)	2	72.22	72.96	0	0.00
29936.	Dallas (darknightdal)	2	86.20	95.18	1	50.00
29937.	zero (0crows)	2	44.15	47.08	0	0.00
29938.	luizhp (luizhp)	2	60.57	67.19	2	100.00
29939.	Paul (paulsmith4561)	2	65.98	73.12	2	100.00
29940.	juniel (juniel999)	2	63.69	65.35	0	0.00
29941.	TypingShark (virtualclark)	2	89.81	90.86	0	0.00
29942.	poopmunkey (poopmunkey)	2	75.92	83.71	1	50.00
29943.	4.41 $ (zed_zed)	2	76.71	81.32	1	50.00
29944.	Γεωργια (geosaurus_rex)	2	60.88	66.45	0	0.00
29945.	Weldon (coconutsip)	2	85.08	86.70	1	50.00
29946.	EmbersTheLimit (fm_producti...	2	66.46	67.02	2	100.00
29947.	kunal (kunal012)	2	24.59	28.49	0	0.00
29948.	Jan (fruitlessjester)	2	83.99	84.98	1	50.00
29949.	HitchH1k3r (hitchh1k3r)	2	47.34	50.96	0	0.00
29950.	Sandra (sxndraxmo)	2	63.29	70.29	0	0.00
29951.	Vosshindran (astroscape)	2	66.01	72.23	1	50.00
29952.	Ryan (mkace482)	2	47.23	48.21	0	0.00
29953.	anuj (yadavanuj)	2	71.11	77.66	1	50.00
29954.	Amy Nguyen (anguye58)	2	54.73	54.79	0	0.00
29955.	Aaron (smallerpog)	2	80.87	82.07	0	0.00
29956.	Sai Arpan (notbattlestar)	2	54.65	59.87	0	0.00
29957.	Hugo Roberts (hugo_speed)	2	69.55	78.33	1	50.00
29958.	Michael (odorf91)	2	53.42	53.81	0	0.00
29959.	ewald (ewald2137)	2	90.21	96.19	1	50.00
29960.	Abhay (twoseven)	2	50.09	52.72	1	50.00
29961.	calo_0 (calo_0)	2	45.44	46.73	0	0.00
29962.	valerie (vaalerie)	2	99.58	100.95	2	100.00
29963.	Juan (halodude11728)	2	88.64	97.75	0	0.00
29964.	Zip53a (zip53a)	2	37.29	37.50	0	0.00
29965.	Elliot (elliotff)	2	60.73	66.15	0	0.00
29966.	k (kbostan)	2	70.70	71.07	2	100.00
29967.	Caleb (chickenmac)	2	55.10	61.47	0	0.00
29968.	Kvn (kvn482)	2	40.34	41.66	0	0.00
29969.	ShadowTrail123 (abdu327)	2	90.35	93.14	1	50.00
29970.	Yes (qwertydubs)	2	64.91	70.26	1	50.00
29971.	Azerux (cleoalcanzo)	2	59.95	69.50	0	0.00
29972.	Rod (grimmr)	2	74.04	74.08	1	50.00
29973.	Yashwanth (yashspeedy)	2	79.84	79.95	0	0.00
29974.	Ramon (dreadparadox)	2	40.44	41.29	0	0.00
29975.	Filip (psycholog420)	2	68.74	71.49	0	0.00
29976.	Jeff (blaurg)	2	124.11	125.75	1	50.00
29977.	Johannes (jpq8)	2	39.13	40.74	2	100.00
29978.	Ren (joebewildman)	2	91.08	94.52	2	100.00
29979.	gary (furryman84)	2	100.49	103.78	1	50.00
29980.	nate (natewon)	2	63.68	76.10	1	50.00
29981.	Theo (billybigboy3)	2	87.56	97.66	1	50.00
29982.	Accu (accu_)	2	63.25	65.87	2	100.00
29983.	AhmedAsd (keys_slayer)	2	45.28	46.06	0	0.00
29984.	Robin (rlkee888)	2	44.47	47.52	0	0.00
29985.	A (ahzahraee)	2	61.59	66.24	0	0.00
29986.	Dyfan (mesosphere)	2	77.96	81.28	2	100.00
29987.	Martins (sneez1e)	2	66.14	67.48	1	50.00
29988.	peanut (spuhgetee)	2	76.98	82.60	1	50.00
29989.	Heisenberg (heisenberg11119)	2	76.27	76.70	0	0.00
29990.	BiggieCheese (breadstick_ba...	2	57.15	58.29	1	50.00
29991.	CP Addict (cpaddict02)	2	61.06	62.00	1	50.00
29992.	Poke (thechosenpoke)	2	74.71	77.84	0	0.00
29993.	Karl (kagia)	2	71.62	78.89	2	100.00
29994.	Demons (demonsawaked)	2	63.50	68.33	0	0.00
29995.	Barry Allen (tjbarter)	2	76.43	92.02	1	50.00
29996.	JustaSkin (justaskin)	2	76.34	81.12	0	0.00
29997.	RegalGiant (alyssa_lee)	2	51.46	56.54	0	0.00
29998.	UPENDRA SINGH (upsc1002)	2	42.34	44.28	0	0.00
29999.	Ryan (ryan86me)	2	129.02	129.02	2	100.00
30000.	Petar (p3taar)	2	51.05	52.41	1	50.00
30001.	pikabread (pikabread)	2	35.21	36.14	1	50.00
30002.	Jimmy (abcsquirrel)	2	73.74	77.96	0	0.00
30003.	Guardian (darkforce097)	2	91.73	92.94	2	100.00
30004.	Deandre Javier (razer_corte...	2	72.67	84.80	2	100.00
30005.	hooh (cdmkk)	2	43.09	47.02	1	50.00
30006.	Kimmalyn (kimmalyn)	2	68.65	71.00	0	0.00
30007.	Emma (etyper987)	2	90.19	96.08	1	50.00
30008.	S (omniron)	2	85.02	88.68	1	50.00
30009.	AJVJ (ajvj69)	2	56.02	62.25	0	0.00
30010.	Thomas (201lucario)	2	84.90	89.62	0	0.00
30011.	poomonky (poomonky)	2	93.42	99.94	2	100.00
30012.	Bombic (pugata)	2	52.31	54.37	0	0.00
30013.	BDOG (bmagill)	2	90.92	95.53	0	0.00
30014.	Najmi (tokimpoi)	2	59.24	61.46	0	0.00
30015.	THICCNESS (thiccnesss)	2	60.68	65.13	0	0.00
30016.	Ln (ln45)	2	92.31	95.02	2	100.00
30017.	Juan (milosabogal)	2	81.71	84.10	1	50.00
30018.	Kinglord (kinglord1090)	2	53.57	56.50	1	50.00
30019.	Ian (nai0515)	2	68.73	70.32	1	50.00
30020.	Alex (apbriggs)	2	52.93	56.94	0	0.00
30021.	Blake (animeweeb1)	2	38.01	41.52	0	0.00
30022.	Kim (karenkim99)	2	78.36	91.52	1	50.00
30023.	Guillaine (admires)	2	105.11	105.44	2	100.00
30024.	Spicy! (spicynoodlez)	2	65.30	67.85	1	50.00
30025.	Kate (kdebloois)	2	96.60	102.10	1	50.00
30026.	SpeedyVelcro (speedyvelcro)	2	77.23	83.17	1	50.00
30027.	Amr (batatah)	2	67.68	70.93	0	0.00
30028.	kyro (kyroven)	2	110.98	113.61	1	50.00
30029.	biffulator (biffulator)	2	79.26	89.27	0	0.00
30030.	Lublu (lublu)	2	63.36	66.77	0	0.00
30031.	BWBH (bwbh)	2	78.05	78.90	1	50.00
30032.	skiist (cyube)	2	82.95	84.19	0	0.00
30033.	Shahjoo (shahjoo)	2	119.40	124.41	1	50.00
30034.	BobiWan (bobiwan)	2	50.24	50.31	0	0.00
30035.	Nicole (nicolyolyo)	2	94.76	97.97	1	50.00
30036.	Chris (chrisyx511)	2	84.19	86.31	2	100.00
30037.	Minh (daominh89)	2	58.81	59.94	2	100.00
30038.	Mrs. (tomiswanson)	2	52.47	58.07	0	0.00
30039.	MTABreath (mtabreath)	2	64.22	67.19	1	50.00
30040.	Jorge (jemg)	2	52.11	61.67	2	100.00
30041.	Marvin (kaiclc)	2	97.38	98.05	1	50.00
30042.	Willie (kakkarrot)	2	75.09	89.32	0	0.00
30043.	Zamiel (ikaeren)	2	107.51	119.98	0	0.00
30044.	SayaBetaAku (sayabetaaku)	2	73.52	88.41	1	50.00
30045.	oropon (oropon)	2	67.81	78.13	1	50.00
30046.	Ry (elyr)	2	43.19	45.73	0	0.00
30047.	Nyx (lunitari)	2	95.65	98.26	2	100.00
30048.	Robert (caerus3)	2	59.20	61.83	1	50.00
30049.	Apoorv (apoorv09)	2	63.37	66.62	0	0.00
30050.	Conner (connersig)	2	73.11	82.40	1	50.00
30051.	Tsifyarc (crayfist)	2	78.12	81.18	1	50.00
30052.	Rajarshi (raj_arshi)	2	44.36	46.11	0	0.00
30053.	EH86055 (eh86055)	2	52.58	54.47	0	0.00
30054.	Sam (samb2o)	2	46.92	47.59	0	0.00
30055.	Poly (polytechnix)	2	72.79	78.46	0	0.00
30056.	Bertram (bertram_fink)	2	44.17	44.94	0	0.00
30057.	Karan (chotuganpat)	2	76.00	88.05	0	0.00
30058.	Lost (lostmail)	2	89.19	93.16	2	100.00
30059.	Jonas (oat_punk)	2	75.45	75.86	0	0.00
30060.	Rafael (yugnar)	2	90.05	96.07	1	50.00
30061.	kitzure (kitzure)	2	68.43	80.72	1	50.00
30062.	Ollieology11 (55ollie)	2	61.06	65.29	0	0.00
30063.	Sebastian (typerracer2007)	2	74.52	78.83	1	50.00
30064.	Yuglooc (yuglooc)	2	100.86	101.24	1	50.00
30065.	Smexy Bby ♥️ (bright_lord)	2	59.71	70.38	1	50.00
30066.	Djaïra (dsm_)	2	66.30	74.61	0	0.00
30067.	Sigre (sigre)	2	58.57	61.34	0	0.00
30068.	Noah (gleems)	2	70.13	74.28	1	50.00
30069.	Chili (real_chili)	2	79.68	83.39	1	50.00
30070.	Rioichi (rioichicooper)	2	71.70	74.55	0	0.00
30071.	Vigilem (vigilem)	2	92.97	94.59	0	0.00
30072.	MuckPie (muckpie)	2	100.93	117.36	1	50.00
30073.	Ngan (nganthoiba)	2	31.18	33.54	1	50.00
30074.	Abhishek (abhishek55)	2	73.03	74.20	0	0.00
30075.	Justin (flowbeat)	2	62.04	67.61	1	50.00
30076.	Adibov (adibov)	2	65.54	67.17	0	0.00
30077.	Max (stealthytyper)	2	86.41	90.93	0	0.00
30078.	James (verysoftpillows)	2	93.71	106.03	0	0.00
30079.	sam (jekkooooo)	2	51.56	59.24	0	0.00
30080.	AH (aasiyah_)	2	43.59	44.64	1	50.00
30081.	supercoolman1000 (epicgamer...	2	83.05	83.37	2	100.00
30082.	David (dfisch17)	2	109.96	118.56	1	50.00
30083.	Nikola (clear_blue_night)	2	65.45	68.94	1	50.00
30084.	villed3 (villed3)	2	70.87	75.80	1	50.00
30085.	Bilhalva (there_is_time)	2	61.08	61.61	0	0.00
30086.	matt (mattplot)	2	75.07	77.32	0	0.00
30087.	jean phillipe (jean_phillipe)	2	72.69	76.13	0	0.00
30088.	Rosa (rosaachen)	2	90.49	96.64	1	50.00
30089.	alex (amonell)	2	49.21	54.80	0	0.00
30090.	Ice (wonderpanties)	2	95.61	104.15	1	50.00
30091.	nick (nick1229)	2	90.34	95.48	2	100.00
30092.	Amanda (amanda1817)	2	75.34	83.62	1	50.00
30093.	Josh (jmith18)	2	68.77	73.12	1	50.00
30094.	HEY! slow down (maddy_1)	2	81.22	87.15	2	100.00
30095.	Max (hardyb1)	2	93.36	96.42	1	50.00
30096.	Adam (adammi)	2	30.11	30.51	0	0.00
30097.	Johnalyn Mae (sparkle_galaxy)	2	31.19	36.08	0	0.00
30098.	Kevin (kebino_)	2	106.08	117.54	0	0.00
30099.	MrTree (mrtee579)	2	59.65	65.70	1	50.00
30100.	Luka (lukajk)	2	91.92	95.90	0	0.00
30101.	Hugo (ligu)	2	50.31	52.47	0	0.00
30102.	Gummin (gummin)	2	91.21	100.66	0	0.00
30103.	Dominik (wakuly)	2	50.92	57.23	0	0.00
30104.	Teron (xribenx)	2	69.70	82.03	0	0.00
30105.	Ecksdee (deadhim)	2	82.27	87.67	0	0.00
30106.	Rushik (rushikk)	2	65.87	67.99	1	50.00
30107.	ニール (adieeeee)	2	74.32	77.57	0	0.00
30108.	Ati (atsngh11)	2	44.82	45.18	0	0.00
30109.	DmPower (dmpower)	2	59.44	73.65	1	50.00
30110.	Gl1tched (gl1tched)	2	47.05	48.91	0	0.00
30111.	Kenny (kennylou)	2	34.59	38.84	1	50.00
30112.	BigPhattBee (aldztypes)	2	73.64	79.29	2	100.00
30113.	Alexander (edehag_wpm)	2	72.36	85.01	1	50.00
30114.	BajanTravis (bajantravis)	2	40.94	47.07	0	0.00
30115.	leftieloosy (leftieloosy)	2	62.32	64.56	0	0.00
30116.	f (fsdafasdfasdfsa)	2	38.45	42.10	0	0.00
30117.	Dylan (shark2g)	2	67.18	69.56	1	50.00
30118.	Truong (tpltruong)	2	67.29	68.88	2	100.00
30119.	Najmul Huda Chowdhury (krid...	2	14.26	14.76	1	50.00
30120.	Charlie (charlie_teaa)	2	79.88	90.01	1	50.00
30121.	Muthulakshmanan (sparks0x3)	2	27.12	29.84	0	0.00
30122.	Elias Claesson (moreniceice)	2	67.03	67.05	0	0.00
30123.	Naidel (naidel)	2	62.59	65.23	0	0.00
30124.	lol (lollols)	2	69.77	71.11	1	50.00
30125.	electro (cavegame)	2	48.97	54.37	2	100.00
30126.	bucket (bucketpotato)	2	105.43	110.48	2	100.00
30127.	DEVA (nandhuismyname)	2	32.35	32.46	0	0.00
30128.	Victoria (toriastar)	2	84.22	85.73	1	50.00
30129.	joher (joher)	2	39.64	40.17	0	0.00
30130.	Andrew (drew_24)	2	56.87	61.20	0	0.00
30131.	Springhunk (springhunk)	2	104.04	112.93	1	50.00
30132.	caro (cvroline)	2	66.66	67.19	1	50.00
30133.	Zack (zgoose013)	2	69.62	77.71	2	100.00
30134.	Chuu (leichenny)	2	64.06	73.66	1	50.00
30135.	roverns (roverns)	2	72.33	88.00	1	50.00
30136.	Jed (hyperie)	2	79.50	80.19	1	50.00
30137.	Default (defaultracer)	2	63.45	70.01	0	0.00
30138.	Hero3life (herolife)	2	98.02	98.90	2	100.00
30139.	FirstName (i5kxepeu)	2	76.10	81.26	0	0.00
30140.	Stephen (bananapants8192)	2	90.22	91.94	0	0.00
30141.	liv (livtr)	2	66.20	72.80	0	0.00
30142.	Hobbestes (hobbesters)	2	50.52	52.02	0	0.00
30143.	Jacob (slickserpent99)	2	84.37	90.63	0	0.00
30144.	dom (domanater)	2	94.17	104.47	1	50.00
30145.	Arthur (arthursgo)	2	41.04	41.96	0	0.00
30146.	N (nathankai)	2	67.65	70.44	1	50.00
30147.	AnimeUncovers (animeuncovers)	2	38.32	41.77	0	0.00
30148.	Alex (poopyjeans)	2	93.28	96.12	1	50.00
30149.	Bots (itsbots)	2	94.85	99.95	0	0.00
30150.	James (sidewindersamurai)	2	75.78	79.58	0	0.00
30151.	Kiril (kiril9016)	2	44.65	49.86	0	0.00
30152.	Pog (djjjoris)	2	72.59	72.61	0	0.00
30153.	Roshan (roshan2999)	2	103.19	104.97	2	100.00
30154.	Kushagra (leafygarlic)	2	72.57	75.92	1	50.00
30155.	adam (ad4m_p3arc3)	2	65.39	69.41	1	50.00
30156.	Aditya (aditya_mohapatra)	2	49.32	49.81	0	0.00
30157.	Levi Ackerman (atharva2007)	2	44.38	48.55	0	0.00
30158.	flowstate (___flowstate)	2	121.22	135.28	1	50.00
30159.	Michael (big_mike)	2	90.57	93.04	0	0.00
30160.	Digby (d16by)	2	63.96	64.63	0	0.00
30161.	Gbutterboy (gbutterboy)	2	42.51	45.54	0	0.00
30162.	Simon (sheepkillzyu)	2	96.29	101.47	1	50.00
30163.	Immanuel (nooblegends17)	2	37.29	37.54	0	0.00
30164.	Nicole (lanzaneddeus)	2	66.80	67.00	0	0.00
30165.	Winter (wintersylvia)	2	53.24	53.51	0	0.00
30166.	Merey (typeracernomer1)	2	52.41	55.56	0	0.00
30167.	Richard (dortikcz)	2	58.18	63.78	1	50.00
30168.	Whitney (drxpdeadgxrgexs)	2	87.42	89.50	0	0.00
30169.	Lucas (lucfig20)	2	45.24	49.04	0	0.00
30170.	Robert (itsmecliffy)	2	55.09	61.47	0	0.00
30171.	Cooper (chanson02)	2	70.03	92.99	1	50.00
30172.	Jano (animilia)	2	39.96	41.35	1	50.00
30173.	Eric (acedude)	2	85.36	89.20	2	100.00
30174.	Boki (deadliestpixel)	2	96.44	108.18	1	50.00
30175.	Jake (jakerevenge)	2	88.73	92.91	2	100.00
30176.	cameron (camfron)	2	45.53	46.60	0	0.00
30177.	Nathan (n8playsbass)	2	57.72	65.48	0	0.00
30178.	Deval (nakuora)	2	46.23	47.57	0	0.00
30179.	Joaquin (unorginalkiddd)	2	28.60	32.78	0	0.00
30180.	Edison (azulistair)	2	53.18	57.42	0	0.00
30181.	Syahrul (syharulhamdani)	2	75.21	81.45	1	50.00
30182.	JJ (oldmanspeed)	2	95.80	96.73	2	100.00
30183.	Guardprimo (guardprimo)	2	55.07	56.71	0	0.00
30184.	Alan (lewuske)	2	65.03	69.47	1	50.00
30185.	Supkym (supkym)	2	54.96	59.01	0	0.00
30186.	Jose (jaag65)	2	40.15	41.12	0	0.00
30187.	ethan (minimomo)	2	86.35	89.49	2	100.00
30188.	Moin (momo666)	2	38.14	39.38	0	0.00
30189.	Merlin (mer_lin)	2	95.48	101.66	1	50.00
30190.	Destroyer152 (destroyer152)	2	53.60	59.43	0	0.00
30191.	Sindre Mandelid (ewers01)	2	72.65	79.31	0	0.00
30192.	Yash Raj (outl13r)	2	51.63	53.07	0	0.00
30193.	Jamie (niflunar)	2	69.93	81.25	1	50.00
30194.	Va (vanianita21)	2	36.00	41.64	0	0.00
30195.	Liam (potneckstump)	2	76.18	78.27	0	0.00
30196.	Daniel (sandmanno)	2	61.05	65.24	1	50.00
30197.	Turkey2 (turkey_2)	2	44.84	49.30	1	50.00
30198.	afsheen (afsheenshafayet)	2	33.34	34.73	1	50.00
30199.	Boon (hunboon)	2	89.65	96.78	1	50.00
30200.	Sammy (kawaiicece)	2	70.96	71.66	2	100.00
30201.	Kalyan (kalyan_k)	2	50.51	52.33	0	0.00
30202.	RezTrencher (rezalfn)	2	17.88	23.13	1	50.00
30203.	Jimmy (deutschsc)	2	28.26	29.67	0	0.00
30204.	Jochen (jochenmehlich)	2	96.47	101.89	2	100.00
30205.	jjbuddyhi (jjboddyhi)	2	96.74	99.87	0	0.00
30206.	Louis (louisgoldtrophy)	2	70.52	77.88	0	0.00
30207.	Sneaky (sneakyturtle69420)	2	53.40	58.20	0	0.00
30208.	Zhazira (29jazi)	2	41.52	41.87	0	0.00
30209.	Pig (goldenpig55)	2	81.36	88.95	0	0.00
30210.	Kloris (moondanc_r)	2	79.81	87.46	2	100.00
30211.	Sophie (ariesmoon)	2	80.96	81.26	0	0.00
30212.	blaszko14 (bulszatan14)	2	69.68	72.44	2	100.00
30213.	Matan (teroxil)	2	92.97	98.41	0	0.00
30214.	Justine (iamsrl1020)	2	55.17	63.62	1	50.00
30215.	Diego (saucegod_rc)	2	50.26	51.33	1	50.00
30216.	Maks (maks244)	2	79.02	87.38	1	50.00
30217.	Makküsu (makkusu)	2	40.23	42.61	1	50.00
30218.	Michal (majklovich)	2	70.36	80.54	1	50.00
30219.	Michael Antariksa (maikeru10)	2	49.62	53.84	0	0.00
30220.	Mahmoud (mahmoud_elsaeed)	2	52.84	56.91	1	50.00
30221.	Type (magicgos)	2	60.94	67.83	0	0.00
30222.	Daniel (mage3214)	2	80.94	81.88	0	0.00
30223.	∞ (maely)	2	70.37	78.39	1	50.00
30224.	Samuel (maduhbee)	2	95.10	110.47	1	50.00
30225.	Mads (mads721i)	2	65.55	70.47	0	0.00
30226.	Madi (madix00)	2	47.14	50.14	0	0.00
30227.	Ronald (macaroonie)	2	109.64	110.05	1	50.00
30228.	Jamie (mac785)	2	101.30	104.22	2	100.00
30229.	Matthew (m9thew)	2	102.69	105.15	1	50.00
30230.	Fentenal (m3ntality)	2	72.89	75.00	0	0.00
30231.	Alex (m3hran80)	2	114.76	123.53	1	50.00
30232.	Michael (m1cky82)	2	55.54	61.23	1	50.00
30233.	Lydia (lydiag)	2	60.89	67.69	1	50.00
30234.	Stammgast (lv_vl)	2	68.53	74.17	0	0.00
30235.	lunarcoffee (lunarcoffee)	2	109.42	117.13	1	50.00
30236.	Luna (lunamai)	2	147.77	174.55	2	100.00
30237.	Dany (lunakar)	2	53.67	53.80	0	0.00
30238.	Allyson (lumpylumplump)	2	89.17	91.82	1	50.00
30239.	Louisa (lulu28)	2	67.65	71.13	1	50.00
30240.	Lucas (luke210o)	2	38.85	40.61	0	0.00
30241.	Lukáš (lukashanak)	2	80.35	83.21	2	100.00
30242.	Luka (luka778)	2	26.37	26.58	0	0.00
30243.	JJ (luddeus)	2	103.82	104.52	1	50.00
30244.	Quacky Mac (lucky_ducky)	2	57.98	67.82	2	100.00
30245.	l (luckymagex)	2	61.74	67.13	0	0.00
30246.	Lucifer (lucifer97)	2	82.05	83.97	0	0.00
30247.	I am dumb (lucas_number_1)	2	95.77	98.97	1	50.00
30248.	River (lttriver)	2	57.37	58.71	0	0.00
30249.	Lsteryoshi (lsteryoshi)	2	54.79	58.61	1	50.00
30250.	Liam (lpare45)	2	29.85	33.18	1	50.00
30251.	rani (lowersky)	2	91.03	92.78	1	50.00
30252.	martin (lovestotype)	2	108.09	118.00	2	100.00
30253.	eehoS (lovespacedreams)	2	84.30	86.11	0	0.00
30254.	Louie (louise_shang)	2	64.44	65.30	0	0.00
30255.	Charlie (losttaco)	2	83.05	87.81	0	0.00
30256.	Brendan (lorsque)	2	88.96	90.56	1	50.00
30257.	palash (loserindcoffice)	2	36.53	39.12	0	0.00
30258.	lordsnivy209 (lordsnivy209)	2	50.38	53.93	0	0.00
30259.	Kevin (lordofwreck)	2	69.24	71.75	0	0.00
30260.	Johnny (lordquan)	2	94.29	100.37	0	0.00
30261.	Andre (lordesupremo)	2	85.17	90.52	1	50.00
30262.	ayyyyyy (loom2801)	2	53.81	57.77	0	0.00
30263.	Miguel (long_legs_ahh)	2	42.66	43.51	0	0.00
30264.	Lon (lonekawu)	2	44.14	45.26	2	100.00
30265.	NaTsu879 (lonely_painter)	2	76.30	78.30	0	0.00
30266.	Anna (lol_get_rekt_scrub)	2	70.51	72.78	1	50.00
30267.	LolzLiamz (lolzliamz)	2	90.46	92.49	2	100.00
30268.	Lolpikachu (lolpikachu45)	2	99.40	115.27	1	50.00
30269.	LostIn (lol1sotkillboss)	2	40.30	41.37	0	0.00
30270.	Curran (logbasepotato)	2	91.98	97.00	1	50.00
30271.	Locky (lockygamer)	2	102.90	103.91	2	100.00
30272.	Ayyyyyy (lmaoooooo)	2	101.73	109.44	0	0.00
30273.	Quan (li_quan)	2	81.11	86.13	0	0.00
30274.	Huân (lixboi)	2	63.76	64.89	0	0.00
30275.	Amelia (littlebighaha)	2	134.43	136.80	2	100.00
30276.	You (littlebabybear)	2	102.27	108.36	1	50.00
30277.	Ryan (lionryan)	2	98.93	110.61	0	0.00
30278.	lime (limelatte)	2	90.91	91.61	1	50.00
30279.	Lili (lili640)	2	60.88	61.68	0	0.00
30280.	Bao Han (lilhaan48)	2	45.82	46.71	2	100.00
30281.	Elin (lileazi)	2	104.50	106.58	2	100.00
30282.	lilbabygay_ (lilbabygay_)	2	42.65	43.32	0	0.00
30283.	Enlightened (liku45)	2	73.29	78.61	0	0.00
30284.	Nathan (light_mqueen)	2	74.83	89.68	1	50.00
30285.	Carmelo (lightning_mctype)	2	73.61	80.40	1	50.00
30286.	lightning (lightning_knight)	2	67.12	75.87	0	0.00
30287.	Gavin (ligerblubber)	2	101.79	103.45	1	50.00
30288.	Lidlidlid (lidlidlid)	2	92.71	93.37	0	0.00
30289.	Kevin (lgloo)	2	83.35	87.56	1	50.00
30290.	levi ackerman (leviackerman)	2	66.95	72.66	2	100.00
30291.	tay (levelzero)	2	94.15	95.86	1	50.00
30292.	LetsdothisEpic (letsdothise...	2	113.54	124.00	1	50.00
30293.	Sophie (lesophie)	2	75.50	78.46	1	50.00
30294.	Leonshekre (leonshekre)	2	106.26	110.19	1	50.00
30295.	leo (leloukoz)	2	67.80	71.30	0	0.00
30296.	Zohaib (leggoboyo)	2	96.54	108.14	2	100.00
30297.	Nate (legendward)	2	75.07	79.96	1	50.00
30298.	Andreas (legendmeadow)	2	118.87	119.85	1	50.00
30299.	LeftHandedKatana (lefthande...	2	71.78	74.69	2	100.00
30300.	Abby (leener999)	2	90.42	90.87	0	0.00
30301.	Leeh (leeh2002)	2	111.94	116.12	1	50.00
30302.	Akshiet (learningworm)	2	63.60	66.88	0	0.00
30303.	Slice (learningcolmak2021)	2	68.02	69.11	0	0.00
30304.	Leah (leah_bro)	2	72.83	76.34	0	0.00
30305.	Leah (leahcarj)	2	53.35	59.67	0	0.00
30306.	Jeff (lcrox)	2	72.01	73.29	1	50.00
30307.	Logan (lcawesomepotato)	2	36.13	39.04	0	0.00
30308.	Uku (lazzeri)	2	89.78	93.24	0	0.00
30309.	GqvTypeRacer (lazer_25)	2	91.36	92.16	0	0.00
30310.	Sofia (lazebrakmata)	2	62.15	64.70	0	0.00
30311.	Jake (lawyer18)	2	79.57	91.44	0	0.00
30312.	lav (lav01)	2	83.01	85.77	0	0.00
30313.	laurens (laurensjvdb)	2	81.18	83.27	2	100.00
30314.	Las (laspil)	2	47.62	48.18	2	100.00
30315.	Joop (lapingvino)	2	73.09	82.98	0	0.00
30316.	Nathan (lanza21)	2	108.32	121.37	0	0.00
30317.	Steven (lander5)	2	117.51	129.95	1	50.00
30318.	lame (lamellae)	2	87.84	93.96	0	0.00
30319.	lakshmi (lakshmi__)	2	93.06	97.67	0	0.00
30320.	lakshme 5ce (lakshme)	2	70.01	71.05	1	50.00
30321.	Rauan (l1tos)	2	32.40	34.92	0	0.00
30322.	Liz (l1gh73r)	2	88.00	92.22	2	100.00
30323.	Kai (kzhou6)	2	98.87	112.53	2	100.00
30324.	Yacine (kzeran)	2	69.32	72.76	1	50.00
30325.	kyo (kyosenpie321)	2	72.95	77.25	1	50.00
30326.	kylotastic (kylotastic)	2	102.84	104.09	0	0.00
30327.	Kyle (kyle_racer)	2	90.37	97.25	1	50.00
30328.	Kristin (kweeston)	2	84.26	93.51	2	100.00
30329.	kman (kwangyel)	2	63.89	68.19	0	0.00
30330.	Kuzel (kuzel)	2	122.68	124.30	2	100.00
30331.	Kusainov (kusainov2005)	2	57.08	57.95	0	0.00
30332.	Kuruto (kurut0)	2	64.45	69.79	2	100.00
30333.	Kurtel (kurtel)	2	88.96	91.31	1	50.00
30334.	Ken (kupperu)	2	94.67	96.99	0	0.00
30335.	D.k. (kumardeep22)	2	76.76	80.27	0	0.00
30336.	Fitz (kulaizki)	2	82.59	93.58	2	100.00
30337.	Addiv (kuge)	2	66.10	67.25	1	50.00
30338.	Emil (kuddsson69)	2	37.26	37.36	0	0.00
30339.	Simon Kubica (kubica)	2	121.78	127.33	1	50.00
30340.	Mark (kubfu891)	2	92.03	99.22	0	0.00
30341.	Kyle (kthom925)	2	105.79	114.11	1	50.00
30342.	Kyle (kstrozin)	2	90.91	104.07	1	50.00
30343.	Colby (kronkler)	2	100.03	101.00	0	0.00
30344.	Kelsey (krognicle)	2	77.03	84.23	0	0.00
30345.	Uncle Jim (krispysox)	2	85.00	93.03	0	0.00
30346.	krispycreme2012 (krispykrem...	2	47.89	50.15	0	0.00
30347.	txxs (kriiue)	2	89.53	93.76	2	100.00
30348.	Brian (krayons)	2	101.03	104.08	1	50.00
30349.	Kraust (kraust)	2	92.32	94.23	1	50.00
30350.	Karisma (kputera)	2	79.06	86.03	1	50.00
30351.	jenny (kosyourmother)	2	61.86	72.99	1	50.00
30352.	Thomas (koreo)	2	95.91	101.40	2	100.00
30353.	Koren794 (koren794)	2	31.14	32.98	0	0.00
30354.	Michael (koreanpower912)	2	95.95	96.87	1	50.00
30355.	Kopatz (kopatz)	2	69.11	69.75	0	0.00
30356.	Kasim (kontromusic)	2	91.37	94.12	2	100.00
30357.	Kommy (kommy_boo)	2	81.49	83.08	1	50.00
30358.	Kolsty (kolsty)	2	94.37	98.84	1	50.00
30359.	KoD (kodz)	2	80.30	85.93	0	0.00
30360.	Kobe (kobefireball)	2	80.04	80.43	0	0.00
30361.	Casper (knugus)	2	71.60	72.62	1	50.00
30362.	k̷̓͋̈́̒͗͋̅͌̄̈́͆̉...	2	77.88	79.48	0	0.00
30363.	knives (knives1117)	2	63.39	67.08	0	0.00
30364.	Megu (knightninja436)	2	98.32	99.21	1	50.00
30365.	kmurbi23 (kmurbi23)	2	94.58	100.12	0	0.00
30366.	Karina (kmontellano)	2	63.09	70.70	0	0.00
30367.	keyjulll (klutuk)	2	43.86	49.37	0	0.00
30368.	Klice (klice)	2	65.93	77.07	0	0.00
30369.	dany (klaviier)	2	52.45	52.97	0	0.00
30370.	kkwong (kkwong2003)	2	81.55	90.82	0	0.00
30371.	taffy (kkristof97)	2	73.73	75.13	1	50.00
30372.	Kimber (kjmlink)	2	87.16	94.09	0	0.00
30373.	Kirua (kirua99)	2	97.10	103.85	1	50.00
30374.	kinwaki (kinwaki)	2	112.70	116.21	1	50.00
30375.	Kevin (kinqkevinn)	2	99.85	100.01	1	50.00
30376.	Vincentius (kinikiz)	2	89.53	96.01	2	100.00
30377.	King (king_gamesbr)	2	100.56	106.45	2	100.00
30378.	King (king_amongthepigs)	2	90.58	92.82	1	50.00
30379.	S (kingofthenerdz3)	2	61.46	68.33	1	50.00
30380.	teeradon (kimcahill)	2	46.82	50.34	0	0.00
30381.	Philip (killfilipok)	2	53.27	53.83	0	0.00
30382.	Birdo (killersiete)	2	99.71	100.30	2	100.00
30383.	Brandon (killercucumber)	2	135.24	139.17	1	50.00
30384.	Kiet (kiethuynh)	2	85.50	85.76	1	50.00
30385.	Kieron (kierdee)	2	56.90	60.60	0	0.00
30386.	Jacob (kick0003)	2	49.07	49.93	0	0.00
30387.	Kia (kiabin)	2	81.77	86.09	2	100.00
30388.	Weenis (khojayongdoja)	2	68.87	73.69	0	0.00
30389.	Khin (khin101)	2	103.31	106.43	2	100.00
30390.	khaled (khaledmuhammad)	2	47.54	49.90	1	50.00
30391.	Kevin (kgonzales2319)	2	77.77	79.26	1	50.00
30392.	Keyborn (keyborn)	2	92.40	93.24	0	0.00
30393.	Justin (keyboard_experience)	2	65.06	69.69	0	0.00
30394.	Kev (kevwins)	2	71.40	72.73	1	50.00
30395.	Kevin (kevng2)	2	90.40	90.50	1	50.00
30396.	sub2 (kevlu8)	2	104.41	108.70	1	50.00
30397.	Kevin (kevin_moses)	2	65.41	67.27	1	50.00
30398.	TakeASui (kevinsui)	2	105.65	115.16	2	100.00
30399.	Ketan (ketan_p01)	2	63.70	65.77	0	0.00
30400.	Keshav (keshavisdabeast)	2	84.43	89.51	0	0.00
30401.	Nathan (kenshido)	2	88.84	93.68	1	50.00
30402.	kennzo (kennzo_homme)	2	79.12	86.92	1	50.00
30403.	Chrys (kenielf)	2	106.12	112.58	1	50.00
30404.	Kenan (kenan_)	2	83.81	84.73	0	0.00
30405.	kelvin (kelvin1712)	2	69.16	76.72	0	0.00
30406.	keira g (keiragg)	2	59.25	64.37	1	50.00
30407.	Keenan (keenanhardy)	2	73.92	77.33	0	0.00
30408.	Mohamad (kda_yamo)	2	54.05	56.77	0	0.00
30409.	tehfatpanduh (kb47)	2	111.47	121.35	1	50.00
30410.	Kazef (kazsuz)	2	80.56	91.73	0	0.00
30411.	Kaushik (kaushikdontula)	2	56.12	61.28	2	100.00
30412.	Katrina (katrina07)	2	39.13	41.20	0	0.00
30413.	Kartoonpanda (kartoonpanda)	2	93.94	95.95	2	100.00
30414.	Juoshi (karen_ju)	2	36.21	39.67	0	0.00
30415.	kasper (kapser1)	2	106.47	113.38	0	0.00
30416.	Kandinsky (kandinskie)	2	56.03	66.19	0	0.00
30417.	Kanawat (kanawatt)	2	57.85	64.22	0	0.00
30418.	Jason (kamesstory)	2	93.43	95.54	1	50.00
30419.	kalxed_mac (kalxed_mac)	2	83.04	85.62	0	0.00
30420.	Cayla (kalepark)	2	92.97	93.71	1	50.00
30421.	Kaibar (kaibar)	2	76.21	104.41	1	50.00
30422.	Kaholaz (kaholaz)	2	53.61	55.26	0	0.00
30423.	Leon (kahelleon)	2	90.14	100.84	1	50.00
30424.	Kaebin (kaebin)	2	84.19	133.79	1	50.00
30425.	Kadz (kadzz)	2	73.36	77.89	0	0.00
30426.	Ruben (k3y5)	2	47.55	51.63	0	0.00
30427.	Julian (k1ngjulien)	2	69.32	69.57	0	0.00
30428.	Bobert (k14robrad)	2	94.27	97.41	0	0.00
30429.	.-. (jyuawago)	2	56.96	58.24	0	0.00
30430.	Josh (jwill323)	2	66.98	68.05	0	0.00
30431.	jurek (jvrvk)	2	49.73	53.77	0	0.00
30432.	jeff (jvaliente)	2	50.51	57.27	1	50.00
30433.	Julius (juuls_dvorak)	2	31.30	33.30	0	0.00
30434.	Sidharth (just_like_you)	2	43.53	44.71	0	0.00
30435.	Justin (justinsavino)	2	70.65	74.35	2	100.00
30436.	Iveee (junmoon_)	2	41.71	46.45	0	0.00
30437.	Julo (julo56)	2	42.29	44.81	1	50.00
30438.	Jake (jujypop)	2	88.89	89.69	0	0.00
30439.	Izzy B) (juicyfruit101)	2	36.21	36.87	0	0.00
30440.	Alice (juicy0250)	2	52.99	53.01	1	50.00
30441.	. (judger_)	2	128.85	135.34	2	100.00
30442.	Jude (judead05)	2	85.15	93.78	1	50.00
30443.	[jtucci] (jtucci)	2	94.62	103.53	1	50.00
30444.	Jack (jtchen0528)	2	58.74	63.99	1	50.00
30445.	jar jar binks (jrong97)	2	102.43	111.70	0	0.00
30446.	Patrick (jpporter)	2	73.48	75.45	0	0.00
30447.	Patrick (jppat)	2	79.00	86.75	0	0.00
30448.	JP (jpdb)	2	51.29	55.35	0	0.00
30449.	Jozef (jozef.gloncak@gmail....	2	68.83	72.15	0	0.00
30450.	Josh (joshsd)	2	111.24	115.00	2	100.00
30451.	Joshua (josheevee)	2	79.08	82.24	0	0.00
30452.	Josh (joshbochuan2020)	2	81.55	82.32	2	100.00
30453.	Joseph (josephmestas)	2	48.67	57.71	1	50.00
30454.	Jorja (jorja_o)	2	29.24	31.48	0	0.00
30455.	Jorge (jorge_owo)	2	64.51	69.14	1	50.00
30456.	Jordan (jordank17)	2	54.54	57.66	0	0.00
30457.	Jordan (jordanguyen1)	2	82.50	82.69	2	100.00
30458.	jordan (jordanaavery)	2	79.02	80.25	1	50.00
30459.	Djalla (jonkoos)	2	56.53	61.74	0	0.00
30460.	Jon (jonjcp)	2	87.04	99.48	1	50.00
30461.	Jonathan (joniln)	2	46.38	48.76	1	50.00
30462.	Joni (jonijohn)	2	108.62	114.40	2	100.00
30463.	Joko (jokondo)	2	35.34	37.07	0	0.00
30464.	Jonas (jokoko)	2	75.36	85.89	0	0.00
30465.	Jakob (joker_ha)	2	39.34	40.70	0	0.00
30466.	joker (joker72426)	2	39.43	41.38	0	0.00
30467.	John (johnratchet3)	2	121.49	127.23	0	0.00
30468.	sheeshsheesh (johnnyboi321)	2	113.72	116.40	1	50.00
30469.	johnn2 (johnn2)	2	113.58	114.57	2	100.00
30470.	John (johnmonday)	2	124.38	126.48	1	50.00
30471.	Joe (joe_kazama)	2	59.69	62.18	1	50.00
30472.	Joe (joeyang1962)	2	107.05	110.96	0	0.00
30473.	Type (joex1011)	2	127.69	134.24	1	50.00
30474.	lucas (joemama3)	2	88.65	96.96	0	0.00
30475.	tstats[joelscao] (joelscao)	2	64.29	69.67	0	0.00
30476.	Joel (joelhanson)	2	43.72	44.59	1	50.00
30477.	Joel (joel5534)	2	95.97	101.70	1	50.00
30478.	joe (joebuscus)	2	51.49	52.83	0	0.00
30479.	Joao (joaofonst)	2	71.76	74.72	2	100.00
30480.	Jojopup123 (joanne225)	2	81.36	90.36	0	0.00
30481.	Rappe (jnr352)	2	40.75	42.22	0	0.00
30482.	Jack (jman777)	2	115.22	119.12	1	50.00
30483.	jluebay (jluebay)	2	58.03	59.36	0	0.00
30484.	Jacob (jlucibello)	2	59.82	63.58	1	50.00
30485.	JLocked (jlocked333)	2	96.75	99.71	1	50.00
30486.	Chico (jlkuio)	2	64.86	66.96	1	50.00
30487.	Jackson (jks0810)	2	115.14	135.70	1	50.00
30488.	J (jklp69)	2	42.67	45.93	0	0.00
30489.	Jonas (jjonnaas)	2	79.31	80.44	1	50.00
30490.	search jiyun-pro.github.io/...	2	52.05	52.14	1	50.00
30491.	Jitesh (jitesh117)	2	70.97	71.70	0	0.00
30492.	jinye (jinye)	2	45.73	47.15	0	0.00
30493.	Jinho (jinh0)	2	136.53	143.23	1	50.00
30494.	Ben (jingler)	2	76.59	79.40	1	50.00
30495.	Jimmy Nguyen (jimmytypes)	2	80.57	84.46	0	0.00
30496.	Jared (jigglyj)	2	76.62	83.60	0	0.00
30497.	Lil🔥💯 (jifhacks)	2	86.94	87.88	2	100.00
30498.	Jiaying (jiaying)	2	93.29	93.31	0	0.00
30499.	Stefan (jhus)	2	72.99	74.04	2	100.00
30500.	Jeremiah (jhmyint)	2	91.73	92.05	1	50.00
30501.	Aidan (jfsport)	2	80.84	84.00	0	0.00
30502.	Bob (jeusushimself)	2	131.34	141.96	0	0.00
30503.	JetroCuber (jetrocuber)	2	85.14	88.15	2	100.00
30504.	Denton (jetray122)	2	81.08	82.82	1	50.00
30505.	Jessveness (jessiveness)	2	147.27	154.89	2	100.00
30506.	mcqueen (jeremyyeh)	2	95.53	105.92	0	0.00
30507.	James (jepk67)	2	98.99	106.75	1	50.00
30508.	jelly (jelsyfish)	2	53.90	55.83	0	0.00
30509.	Josh (jellyjosh)	2	104.32	112.36	2	100.00
30510.	George (jejopa)	2	41.34	43.49	0	0.00
30511.	Jeff (jeff_howson)	2	116.22	126.03	1	50.00
30512.	Jeffrey (jeffro1230)	2	117.02	124.82	2	100.00
30513.	AM (je11ow)	2	71.89	86.72	0	0.00
30514.	J (jcob123)	2	124.96	126.68	1	50.00
30515.	Jason (jbourget87)	2	114.00	117.53	0	0.00
30516.	Jaysson (jayyssaahn)	2	52.17	57.81	1	50.00
30517.	jay (jayyelle)	2	62.88	70.29	0	0.00
30518.	Jack (jayjaywatson)	2	94.06	98.61	1	50.00
30519.	Jay (jayhuang123)	2	112.74	124.82	1	50.00
30520.	Jaydotsun (jaydotsun)	2	83.42	84.27	0	0.00
30521.	Jake (jaydez)	2	103.03	104.05	1	50.00
30522.	Charles (jawlz)	2	129.27	133.73	1	50.00
30523.	javiaa._ (javier_typeracer)	2	72.09	83.20	1	50.00
30524.	Javago (javago)	2	67.90	71.34	1	50.00
30525.	Mark (javacodeguy)	2	90.96	110.50	1	50.00
30526.	Jasper (jasper_bee)	2	100.20	107.57	0	0.00
30527.	Jason (jasoone)	2	113.67	119.77	1	50.00
30528.	Jason (jason314)	2	90.48	93.83	1	50.00
30529.	Jarco (jarcokers2)	2	106.16	108.11	0	0.00
30530.	Jan (jantajov)	2	63.76	67.83	1	50.00
30531.	Jenna (janengai123)	2	107.01	117.91	2	100.00
30532.	James (jamesyeer)	2	83.91	87.31	0	0.00
30533.	Ruben (jamessmplayer)	2	73.95	74.60	0	0.00
30534.	Jameson (jamesonnizo)	2	70.73	74.08	0	0.00
30535.	Alex (jalexwhitman)	2	98.33	104.41	1	50.00
30536.	izzat (jakkjubiss)	2	76.87	82.11	0	0.00
30537.	Jake (jake2005)	2	49.92	56.53	0	0.00
30538.	kintsukuroi (jae_san)	2	133.66	138.96	1	50.00
30539.	Jacob (jacobtpl)	2	95.91	98.16	0	0.00
30540.	Jackson (jacksonks)	2	75.54	95.74	2	100.00
30541.	Jackojacblacco (jackojablacco)	2	68.85	76.66	1	50.00
30542.	kcaj (jackaylward)	2	41.72	43.05	0	0.00
30543.	Jack (jack2711)	2	43.15	43.83	0	0.00
30544.	Jack (jaciepierdole)	2	84.28	86.79	0	0.00
30545.	Ivan (i_bantam)	2	37.95	38.34	0	0.00
30546.	Isaac (iy4717)	2	109.40	109.79	0	0.00
30547.	Iwo (iwoo)	2	73.07	77.17	0	0.00
30548.	Dennis (iwantahug)	2	47.94	48.32	0	0.00
30549.	Ivan (ivan_liang51)	2	108.50	116.38	1	50.00
30550.	Iván (ivansitopart)	2	69.82	75.34	0	0.00
30551.	Tyler (itztylrrtv)	2	93.16	95.71	2	100.00
30552.	ItsMega (itzmega)	2	85.01	90.21	2	100.00
30553.	Rick (itzgamedude)	2	98.61	98.70	1	50.00
30554.	Crumb (itzcrisp_xd_yt)	2	34.28	39.04	2	100.00
30555.	Pratyush (its_praty)	2	36.83	39.72	0	0.00
30556.	Bahaa (its_bahaa_aea)	2	88.59	89.96	0	0.00
30557.	Quinn (itsquinnmydudes)	2	99.76	107.42	2	100.00
30558.	wi (itsjeho65)	2	60.76	62.81	0	0.00
30559.	Ash (itsash)	2	58.73	65.96	0	0.00
30560.	flo (itbeflo)	2	69.89	72.78	1	50.00
30561.	ISuck (isuckettyping)	2	54.35	54.44	1	50.00
30562.	Ricky (istartyper)	2	97.55	98.79	1	50.00
30563.	iSchrye (ischrye)	2	74.23	80.93	1	50.00
30564.	Isaah (isaahtan_21)	2	86.93	91.72	2	100.00
30565.	isaacyoshimario (isaacyoshi...	2	119.86	125.58	2	100.00
30566.	Isabela (isa05910)	2	69.50	76.47	0	0.00
30567.	Andrew (irvie)	2	110.82	121.20	0	0.00
30568.	David (irrelevantging)	2	104.62	110.58	2	100.00
30569.	ㅤ (irlgoob)	2	146.79	155.93	2	100.00
30570.	Irene (ireneprk)	2	91.88	92.46	2	100.00
30571.	Musavi (iqbalmusavi)	2	34.48	38.47	0	0.00
30572.	ipawan (ipawan)	2	67.22	69.89	1	50.00
30573.	VijayaKumar (intvijay)	2	62.20	63.39	1	50.00
30574.	Inter (intercash)	2	31.34	31.69	0	0.00
30575.	Doge (inteldoge)	2	128.61	135.36	2	100.00
30576.	Asdfg (inosol)	2	65.93	68.07	0	0.00
30577.	Infinity (infinity15)	2	61.58	68.23	0	0.00
30578.	Person (ineedagoodname)	2	74.21	76.33	0	0.00
30579.	InDosaN (indosan)	2	67.54	69.37	0	0.00
30580.	indomitable1 (indomitable1)	2	69.22	74.05	0	0.00
30581.	framespersecond (indires)	2	99.33	110.21	1	50.00
30582.	X (inclassstudent)	2	74.68	79.46	0	0.00
30583.	Eggman (im_eggman)	2	68.15	73.17	0	0.00
30584.	ISuckAtTyperacer (im_bad_at...	2	127.75	130.76	1	50.00
30585.	ImSmarterOnWo_rdBomb (imsma...	2	70.33	78.54	1	50.00
30586.	Logan (imoshie)	2	60.42	60.64	0	0.00
30587.	TypeMaster! (imma_typing_ma...	2	36.89	40.14	0	0.00
30588.	Lukas (imfluf)	2	76.68	84.46	1	50.00
30589.	timoteo (imfastafboi9)	2	52.90	54.87	1	50.00
30590.	Joji (imaprettyboy)	2	72.20	73.93	1	50.00
30591.	Imaan (imaan_m)	2	59.98	70.86	0	0.00
30592.	ILoveFelix (ilovefelix)	2	71.71	74.89	0	0.00
30593.	damon (illbenascar)	2	74.20	76.31	0	0.00
30594.	Ilikeracing (ilikeracing)	2	76.86	99.43	0	0.00
30595.	Igor (ikrz)	2	47.11	48.01	1	50.00
30596.	ikjoshh (ikjoshh)	2	161.31	173.89	2	100.00
30597.	bourque (iketype)	2	119.56	126.61	1	50.00
30598.	Ike (ike2001)	2	51.49	52.17	1	50.00
30599.	ig : ikalzabrah (ikaoktav1697)	2	40.09	40.12	0	0.00
30600.	IgrYphon (igryphon)	2	91.84	95.69	1	50.00
30601.	iGodShark (igodshark)	2	101.39	102.23	2	100.00
30602.	iget30wpm (iget30wpm)	2	98.64	110.23	1	50.00
30603.	Genie (igenie)	2	54.66	55.02	0	0.00
30604.	Igel (igelwithdeagle)	2	81.50	81.74	1	50.00
30605.	a (ierfth)	2	95.72	98.39	1	50.00
30606.	serdna (idfwpercs)	2	87.98	90.26	2	100.00
30607.	iCursedReaper (icursedreaper)	2	87.51	105.27	1	50.00
30608.	Joe (icorion)	2	70.77	76.56	0	0.00
30609.	Ice794 (ice_794)	2	49.18	54.40	0	0.00
30610.	Scott (icerune)	2	103.13	111.07	1	50.00
30611.	Naravich (icekang)	2	60.78	62.72	0	0.00
30612.	dakota (iceey)	2	82.78	83.27	1	50.00
30613.	Dakota (iccerus)	2	81.95	84.46	0	0.00
30614.	ib (ibvenus)	2	53.77	58.39	0	0.00
30615.	Kumar (iarrive)	2	60.41	62.45	0	0.00
30616.	iarezen (iarezen)	2	91.21	93.06	0	0.00
30617.	Irfan (iamtester4)	2	74.53	77.08	1	50.00
30618.	Tim (iamsmooth)	2	94.36	106.79	0	0.00
30619.	Moin (iamrjrobin)	2	47.02	48.88	0	0.00
30620.	Chiemeka (iamlordaubrey)	2	79.47	83.37	0	0.00
30621.	Hytres (hytres)	2	75.95	79.94	1	50.00
30622.	Nurislam (hypuclam)	2	79.69	83.88	1	50.00
30623.	ryo (hyperu)	2	49.12	50.16	0	0.00
30624.	Kyle (hyperionkyle89)	2	68.74	69.95	1	50.00
30625.	big (hyperdoggo)	2	110.44	117.77	0	0.00
30626.	Ham (hwu164)	2	75.14	75.69	0	0.00
30627.	Huts (huts1)	2	97.92	101.82	2	100.00
30628.	Jacob (hushdog)	2	68.54	69.49	0	0.00
30629.	Husam (husam_)	2	79.55	82.58	1	50.00
30630.	Key (hus9)	2	103.32	110.45	0	0.00
30631.	Samuel Hong (hunterx30s)	2	77.32	78.18	0	0.00
30632.	Shanna (hungrypotato)	2	65.82	69.85	0	0.00
30633.	Hungb (hungb)	2	71.56	72.90	0	0.00
30634.	Humphrey (humfurie)	2	82.11	83.46	1	50.00
30635.	hsa (hsa_)	2	83.57	95.81	1	50.00
30636.	Leonardo (hreppy)	2	146.46	160.04	2	100.00
30637.	Hans-Peter (hpgurke69)	2	98.12	101.78	2	100.00
30638.	Howard (howien)	2	86.29	91.03	0	0.00
30639.	Sophia (hotococoa)	2	114.96	129.51	0	0.00
30640.	ep1c (hololiveweeb24)	2	83.17	86.04	2	100.00
30641.	Ethan (hoid)	2	91.56	92.54	1	50.00
30642.	Haoming (hm_002)	2	92.77	97.03	1	50.00
30643.	lerning (hmtusher)	2	68.89	69.00	1	50.00
30644.	Murilo (hitmonrillo)	2	81.08	85.32	0	0.00
30645.	Hitarth (hitarthk)	2	43.85	48.89	0	0.00
30646.	Samui (hisself)	2	60.62	98.48	1	50.00
30647.	Xavier (hillary4jail16)	2	50.54	52.09	0	0.00
30648.	Hik (hikjik)	2	100.51	105.94	1	50.00
30649.	kitty (hiimakitty)	2	142.51	145.56	2	100.00
30650.	Highwire (highwire)	2	85.92	91.94	0	0.00
30651.	Jacob (highlift)	2	89.66	95.83	1	50.00
30652.	Hidispenser (hidispenser)	2	65.91	78.06	0	0.00
30653.	Ben (heyyoubenji)	2	73.03	73.09	0	0.00
30654.	Heyuan (heyuan)	2	76.16	78.41	1	50.00
30655.	Gergo (hexa_ik)	2	49.25	52.30	0	0.00
30656.	a (herecomedatb0i)	2	110.05	116.60	1	50.00
30657.	henry11hei (henry11hei)	2	77.80	83.12	1	50.00
30658.	Henok (henokb)	2	61.52	68.89	0	0.00
30659.	HellDen (hell_den17)	2	73.59	76.97	1	50.00
30660.	Hello2u (hellotwou)	2	40.66	41.51	1	50.00
30661.	Daniel (hellgrown)	2	73.50	80.08	1	50.00
30662.	Helder (helder_98)	2	41.71	42.24	1	50.00
30663.	taco (hehehetacos)	2	87.53	87.54	1	50.00
30664.	Hegsy24 (hegsy24)	2	41.85	42.77	0	0.00
30665.	Joshua (hegemony_cricket)	2	53.73	56.46	0	0.00
30666.	HecTiic (hectiicow)	2	110.68	116.45	1	50.00
30667.	yak (hecticyak)	2	80.67	90.34	1	50.00
30668.	Hector (hectic131)	2	71.55	73.35	1	50.00
30669.	Andrei (headpats)	2	97.02	98.21	0	0.00
30670.	HDoll (hdoll)	2	85.77	97.36	2	100.00
30671.	Weber (hcehce419)	2	103.23	103.94	2	100.00
30672.	Haikal (haykalsaliba)	2	76.48	78.66	1	50.00
30673.	RA (hayhayhay111)	2	82.13	86.93	0	0.00
30674.	Sahol (hawk_eyee)	2	58.49	61.80	0	0.00
30675.	Chauncey (hauncey)	2	101.25	102.02	2	100.00
30676.	haugust (haugust)	2	44.93	47.50	0	0.00
30677.	hat (hatensemble)	2	103.01	109.57	1	50.00
30678.	Rei (hashi_datura)	2	50.56	50.96	0	0.00
30679.	Harry (harry_b0ss)	2	115.76	118.64	1	50.00
30680.	Harry (harrygoatleaf)	2	72.74	79.58	1	50.00
30681.	Harry (harnea)	2	75.98	81.29	1	50.00
30682.	Harm (harmdebeuker)	2	94.50	97.63	1	50.00
30683.	The (harit111200)	2	91.27	98.34	1	50.00
30684.	HardeQ (hardeq)	2	93.74	100.70	2	100.00
30685.	... (hardadriano1)	2	74.70	75.52	0	0.00
30686.	HanPlox (hanplox)	2	79.42	85.55	1	50.00
30687.	Vincent (hanley51)	2	68.57	74.15	1	50.00
30688.	YJ (hanguoren)	2	115.05	123.37	2	100.00
30689.	handroid (handroid)	2	41.08	41.20	1	50.00
30690.	HallMaster007 (hallmaster007)	2	76.74	79.67	1	50.00
30691.	halfwet (halfwet)	2	100.91	102.52	2	100.00
30692.	Luke (hakked)	2	97.06	109.53	1	50.00
30693.	Hailey (haileyuwu)	2	52.53	57.63	0	0.00
30694.	Haikuno (haikuno)	2	109.21	110.82	1	50.00
30695.	Pein (haha8065)	2	118.02	120.31	1	50.00
30696.	Zack (hackyzack17)	2	72.51	92.71	0	0.00
30697.	Kuba (hackplack)	2	92.13	92.45	0	0.00
30698.	Z (hackerpro)	2	67.71	72.08	0	0.00
30699.	habhibhi (habhibhi)	2	119.99	131.08	2	100.00
30700.	Harold (haac96)	2	66.60	67.44	1	50.00
30701.	Kawaguchi (h7karu)	2	96.33	97.07	0	0.00
30702.	gwubb (gwubb)	2	58.60	66.14	0	0.00
30703.	GuzaSama (guzasama)	2	75.12	89.24	1	50.00
30704.	Gustavo (gustavoythp)	2	39.24	40.76	0	0.00
30705.	sn (gunshp)	2	83.29	84.79	0	0.00
30706.	Trenten (guitars12)	2	109.14	115.43	2	100.00
30707.	Guestwith9 (guestwith9)	2	62.03	65.71	0	0.00
30708.	gubbagooba (gubbagooba)	2	91.92	93.55	0	0.00
30709.	Alvex (gr_alvex)	2	93.46	104.31	1	50.00
30710.	Matthew (gruzzlybear)	2	113.25	120.90	2	100.00
30711.	Gri0s (grios)	2	57.20	60.61	2	100.00
30712.	samuel (grimtale)	2	56.75	59.74	0	0.00
30713.	Grigor (grigor)	2	93.23	95.85	2	100.00
30714.	Griff (griffhero8)	2	65.45	68.99	0	0.00
30715.	Grenien (grenien)	2	55.29	55.51	0	0.00
30716.	gremory29 (gremory29)	2	57.33	64.71	2	100.00
30717.	Andrew (greenhoodiee)	2	58.79	63.21	0	0.00
30718.	Gregory (great_yarn)	2	70.56	73.24	2	100.00
30719.	dane (gratedane)	2	104.58	105.52	2	100.00
30720.	Graf (graf)	2	142.04	145.79	0	0.00
30721.	Just (gr33nk3ys)	2	94.21	100.50	2	100.00
30722.	Gozie (gozie_)	2	65.19	72.44	1	50.00
30723.	bob (gongster)	2	101.01	114.57	2	100.00
30724.	Jon (goneoffbread)	2	50.15	55.01	0	0.00
30725.	Peter (gompose)	2	71.72	79.20	0	0.00
30726.	Gomelx (gomelx)	2	46.18	47.93	0	0.00
30727.	robin (golden_eggs)	2	58.77	61.08	0	0.00
30728.	Dominik (goldenboi)	2	67.67	68.12	0	0.00
30729.	Yoshi (gogurtpie)	2	109.83	114.02	1	50.00
30730.	Chris (godocho)	2	78.69	80.11	0	0.00
30731.	Chad (godchad)	2	92.08	98.88	0	0.00
30732.	Goat (goatjohnson)	2	120.22	121.60	1	50.00
30733.	Pepijn (goatism)	2	116.46	118.84	0	0.00
30734.	Gnetyx (gnetyx)	2	96.86	100.96	1	50.00
30735.	Zy (gmzydra)	2	108.54	111.55	1	50.00
30736.	gavin (gmann655)	2	76.02	79.60	0	0.00
30737.	Griffin (glkannberg)	2	84.02	86.60	2	100.00
30738.	tstats[glebby] (glebby)	2	112.09	124.61	1	50.00
30739.	glaucomer (glaucomer)	2	100.94	104.64	1	50.00
30740.	Endi (glados909)	2	79.84	85.89	2	100.00
30741.	David (gitgudfast)	2	93.23	95.15	0	0.00
30742.	Mads (gismodyret)	2	108.34	112.60	0	0.00
30743.	Xin (giorgi1123)	2	102.35	106.88	0	0.00
30744.	My fingers are so damn fat ...	2	46.09	46.32	0	0.00
30745.	Whitley (gingersnack)	2	134.83	148.82	2	100.00
30746.	ginger (gingercat)	2	65.32	73.40	0	0.00
30747.	Gilwen (gilwenmountain)	2	80.99	94.11	2	100.00
30748.	ZT (gilborne)	2	69.00	70.11	1	50.00
30749.	Ghxsty (ghxsty)	2	53.47	59.13	0	0.00
30750.	Gh0sterino (gh0sterino)	2	126.85	135.75	2	100.00
30751.	Izy (ggizy)	2	93.27	94.35	0	0.00
30752.	Marcis (ggirt)	2	48.85	49.74	0	0.00
30753.	Griff (gfargo)	2	76.49	79.36	1	50.00
30754.	Gett (gettnumbers)	2	100.04	101.60	1	50.00
30755.	R (get0ut0fmywaay)	2	83.78	90.02	0	0.00
30756.	George (georgeracer1)	2	119.23	120.89	1	50.00
30757.	George (geoioanid)	2	93.18	99.94	1	50.00
30758.	geo (geogeo120)	2	59.68	61.19	0	0.00
30759.	Nathan (gengeza)	2	59.54	60.34	1	50.00
30760.	gauraav (genesisck9)	2	63.06	63.45	1	50.00
30761.	Rj (generalrj)	2	65.29	65.67	0	0.00
30762.	Charlie (generalfich)	2	115.09	118.02	2	100.00
30763.	GedSVK (gedsvk)	2	78.87	87.63	2	100.00
30764.	gchenstephen (gchenstephen)	2	92.40	109.64	1	50.00
30765.	Miles (gazza111)	2	48.85	53.26	1	50.00
30766.	Gary (garybryan)	2	106.38	107.30	1	50.00
30767.	Tony (garutoh)	2	62.95	72.46	1	50.00
30768.	Garet (garet)	2	67.72	72.13	0	0.00
30769.	garagdon (garagdon)	2	94.00	98.18	1	50.00
30770.	Manuel (ganilson)	2	48.48	49.74	0	0.00
30771.	gaming4fun67 (gaming4fun67)	2	50.50	52.55	0	0.00
30772.	Pratik (gamerpratik)	2	32.37	33.19	0	0.00
30773.	Tom (gameling)	2	51.62	52.65	1	50.00
30774.	Gal (galtzi1910)	2	75.97	76.03	1	50.00
30775.	Bob (galacticwolf7)	2	99.82	106.90	1	50.00
30776.	Gagandeep (gaggising)	2	38.62	42.07	0	0.00
30777.	MellowSky (gadeleon)	2	72.34	78.86	1	50.00
30778.	Gabriely (gabrielyzz)	2	86.28	99.21	1	50.00
30779.	Gabe (gabrielvelarde)	2	76.27	79.21	0	0.00
30780.	Gabriel (gabrielsqw)	2	96.23	97.52	2	100.00
30781.	Gabriel (gabrielfear)	2	99.51	103.84	1	50.00
30782.	Matt Gabriel (gaboooooo)	2	43.81	47.12	0	0.00
30783.	Gabish (gabish01)	2	49.19	51.14	1	50.00
30784.	Yujiro (f_zzy)	2	67.21	70.25	0	0.00
30785.	Maksym (f_w_c)	2	53.35	54.30	1	50.00
30786.	Rance (fxnc)	2	96.38	105.00	1	50.00
30787.	Fudge (furdge)	2	110.25	112.42	2	100.00
30788.	Leo (funnicat)	2	62.07	70.16	2	100.00
30789.	No (funky_wins)	2	97.51	98.27	1	50.00
30790.	Retro (fullretro)	2	115.64	123.26	2	100.00
30791.	tstats[fty1777] (fty1777)	2	73.61	77.90	0	0.00
30792.	Danny (ftm3)	2	90.55	93.56	2	100.00
30793.	frank (ftguo)	2	126.20	128.31	2	100.00
30794.	Hampton (frozeninthesnow)	2	82.86	84.24	0	0.00
30795.	Ari Rez (frizzledizzle)	2	42.52	42.53	0	0.00
30796.	Fritty (fritty)	2	69.57	69.64	0	0.00
30797.	David (frilless)	2	79.55	86.94	0	0.00
30798.	Reigen (freebies25)	2	98.40	102.37	2	100.00
30799.	Fredrik (fredrikvorpenes)	2	71.64	80.13	0	0.00
30800.	FredPerr (fredperr)	2	95.70	98.66	2	100.00
30801.	Hebes (freaken_chicken)	2	68.31	71.46	0	0.00
30802.	moshi (frcmjr)	2	34.30	39.57	0	0.00
30803.	franiel (franiel97)	2	99.97	108.97	0	0.00
30804.	Francesco (francesco_vergol...	2	74.85	75.62	0	0.00
30805.	fishy (foshe)	2	127.84	130.55	1	50.00
30806.	Zack (ford_festiva)	2	85.59	92.00	0	0.00
30807.	Daniel (fodderotter)	2	89.06	94.63	0	0.00
30808.	fmailscammer (fmailscammer)	2	112.43	123.31	1	50.00
30809.	Frazier (fmacdonald)	2	58.40	60.24	0	0.00
30810.	Jacob (flyingducky101)	2	97.06	100.62	0	0.00
30811.	Daquavian (flygoat)	2	135.33	148.03	2	100.00
30812.	Florin (florsis)	2	87.67	89.89	2	100.00
30813.	Nik (florid)	2	53.94	54.64	0	0.00
30814.	Safe (floorrip)	2	80.03	85.88	0	0.00
30815.	Eren (flochforster)	2	64.26	64.93	0	0.00
30816.	a_hsla.1 (floating_aqua_212)	2	41.06	41.32	0	0.00
30817.	Ole Martin (flidrip)	2	111.07	113.34	1	50.00
30818.	Eru (flatoon)	2	88.85	98.99	1	50.00
30819.	Flash (flashing_)	2	70.26	71.91	2	100.00
30820.	Flare (flareix)	2	83.99	96.18	2	100.00
30821.	erc (flamingllamas)	2	129.63	137.82	0	0.00
30822.	Adam (flamindemon)	2	78.12	87.28	0	0.00
30823.	bog (flamesthecat)	2	109.44	144.65	1	50.00
30824.	Shocks (fishyshocks)	2	87.54	93.21	0	0.00
30825.	fish (fishoverlord)	2	107.31	111.57	1	50.00
30826.	Landon (fireman_227)	2	50.36	57.61	0	0.00
30827.	Firebolt (firebolt__)	2	92.01	92.11	0	0.00
30828.	Finiten (finiten)	2	114.45	130.65	1	50.00
30829.	Fast (fingery)	2	39.10	53.00	0	0.00
30830.	Mo (filnaei)	2	83.49	84.00	1	50.00
30831.	Airee (fillyharmonica)	2	130.91	133.91	2	100.00
30832.	Fillmoore (fillmoore)	2	141.53	145.64	2	100.00
30833.	Fiko (fikotobel)	2	53.39	56.80	0	0.00
30834.	atthespeedofcheeba (figilon)	2	92.07	102.92	1	50.00
30835.	Aman (fifafanz)	2	119.66	123.31	2	100.00
30836.	Farzad (ferion)	2	64.58	67.60	0	0.00
30837.	Ferga12345 (ferga12345)	2	102.57	104.62	1	50.00
30838.	Dio Brando (fengy1747)	2	108.93	111.94	0	0.00
30839.	Felix (felix0003)	2	43.85	64.46	1	50.00
30840.	Felix (felfel92)	2	110.90	112.93	2	100.00
30841.	brum (feetlover)	2	47.01	51.17	0	0.00
30842.	magsterz (feelokay)	2	73.00	74.60	2	100.00
30843.	fdd (fdd1)	2	98.12	100.18	2	100.00
30844.	Francis (fccipriano)	2	63.94	70.10	0	0.00
30845.	santiago ^_^ (fawmen)	2	78.95	85.35	0	0.00
30846.	Ashley (fattass)	2	123.90	132.33	1	50.00
30847.	Brenndyn (fatpig69)	2	61.54	63.57	0	0.00
30848.	Harrison (fathole)	2	59.76	64.90	0	0.00
30849.	procrastinator (fatcatheart...	2	78.70	95.05	1	50.00
30850.	Ryan (fast_typer69_420)	2	38.18	38.58	0	0.00
30851.	Your Mother (fasttyper69420)	2	70.09	73.77	0	0.00
30852.	The Guy (farthammer2k)	2	94.72	104.84	2	100.00
30853.	Jakub (fannoth)	2	69.09	70.27	0	0.00
30854.	Falisha (falisha)	2	51.72	52.04	0	0.00
30855.	Falco (falconil)	2	107.02	113.01	2	100.00
30856.	ig@ (fainterkitten)	2	81.54	83.49	0	0.00
30857.	Jake (failura)	2	83.57	85.29	1	50.00
30858.	Kevin (faelinvxd)	2	88.36	114.83	1	50.00
30859.	Petar (ezscany)	2	92.26	94.88	2	100.00
30860.	Rameen (expoil)	2	95.50	101.51	0	0.00
30861.	Exoticz (exoticzonyt)	2	45.32	46.75	1	50.00
30862.	Exeadra (exeadra)	2	100.43	106.60	2	100.00
30863.	exdarku (exdarku)	2	77.66	86.20	1	50.00
30864.	Evan (evon_schmidt)	2	95.21	105.56	2	100.00
30865.	ataraxia (evie_0123)	2	86.80	91.07	2	100.00
30866.	Evan (evan1167)	2	84.83	87.57	0	0.00
30867.	eumis (eumis)	2	60.20	68.76	1	50.00
30868.	euan (euanvzn)	2	66.58	68.33	0	0.00
30869.	Etian (etian_)	2	95.58	96.66	1	50.00
30870.	Eshen (eshenx)	2	89.76	92.79	1	50.00
30871.	Yi (escapetiger)	2	60.59	61.80	0	0.00
30872.	Eric (errriclee)	2	103.42	116.28	0	0.00
30873.	Saruulbuyan (erozionzeal)	2	63.50	65.03	0	0.00
30874.	Eric (eric_loves_adrian)	2	86.27	89.52	2	100.00
30875.	Ábel (ephraimgodw)	2	72.75	75.79	0	0.00
30876.	Enzie (enzapenguin)	2	42.76	48.75	0	0.00
30877.	Dominik (envirel)	2	65.64	67.78	1	50.00
30878.	Frank (enomooshiki)	2	99.25	114.65	1	50.00
30879.	Kelvin (enexpand_23)	2	43.74	46.98	0	0.00
30880.	EndlessNebulous (endlessneb...	2	123.67	130.33	1	50.00
30881.	Michwael Redpants (endlessm...	2	102.47	108.42	0	0.00
30882.	Mei (enchy)	2	79.50	82.29	2	100.00
30883.	Emzze (emzze)	2	36.15	37.38	0	0.00
30884.	Emmanouil (emzoumpo)	2	83.26	88.20	1	50.00
30885.	KiddieX (emyrr)	2	69.09	71.82	0	0.00
30886.	Palmer (emrysite)	2	122.63	127.27	2	100.00
30887.	Moonlight (emn12)	2	47.80	51.70	0	0.00
30888.	bl4ck (emil_black)	2	55.34	56.20	0	0.00
30889.	La (elpapa_lapapa)	2	74.24	76.86	1	50.00
30890.	ElkTF2 (elktf2)	2	101.92	107.08	2	100.00
30891.	Elijah (elijahbau)	2	88.57	93.44	1	50.00
30892.	Ahmed (elghrbawy)	2	62.80	64.70	1	50.00
30893.	Stanciu (electronized)	2	79.08	80.42	1	50.00
30894.	ivan (electro27)	2	87.72	91.53	1	50.00
30895.	Jack (elbowlick)	2	101.95	102.69	0	0.00
30896.	EJDush (ejdush)	2	57.89	59.67	0	0.00
30897.	Stefan (eisenzelle)	2	82.62	91.92	0	0.00
30898.	eggs979 (eggs979)	2	110.21	114.55	2	100.00
30899.	Evan (egggyman)	2	71.86	80.75	0	0.00
30900.	Poch (eezoink)	2	104.12	119.76	2	100.00
30901.	Edgars (edzo34)	2	48.42	55.70	1	50.00
30902.	Edward (edward54321)	2	74.51	81.75	0	0.00
30903.	Edreith (edreith)	2	99.61	102.90	2	100.00
30904.	Ed (eddyoungster)	2	80.91	89.64	1	50.00
30905.	Elysium (eclipser)	2	102.87	104.70	0	0.00
30906.	Ruben (ecerulm_kinesis)	2	70.05	71.42	1	50.00
30907.	Emma (ebunny136)	2	49.86	50.15	1	50.00
30908.	eBright (ebright)	2	119.05	127.29	1	50.00
30909.	sanzh (easy140bpm)	2	52.19	55.70	0	0.00
30910.	Eric (ealouie)	2	81.98	85.36	0	0.00
30911.	Aisultan (d_jr)	2	36.30	38.98	0	0.00
30912.	Dipto (d_d_d)	2	72.78	76.29	1	50.00
30913.	Davit (dyeghiaz)	2	78.37	83.54	0	0.00
30914.	tec (dxnny)	2	61.36	62.41	2	100.00
30915.	Bo (dut227)	2	55.52	56.15	0	0.00
30916.	Will (duowill)	2	111.88	113.28	0	0.00
30917.	mj (dunnobru)	2	65.90	72.98	0	0.00
30918.	Travis (dune_dark)	2	44.19	54.22	0	0.00
30919.	DuduSensei (dudusensei)	2	39.12	54.70	1	50.00
30920.	Dolan (dudey7ftw)	2	110.11	118.54	2	100.00
30921.	Ryan (dudemcbroguy)	2	58.77	60.67	0	0.00
30922.	🟣⚪🟣 (duckz__)	2	84.02	84.37	1	50.00
30923.	Bo (duckydigs)	2	89.13	89.32	0	0.00
30924.	Duck (duckmasteral)	2	103.18	106.68	1	50.00
30925.	Weston (dubax)	2	102.31	105.92	1	50.00
30926.	Dustin (dtrain586)	2	89.16	98.13	1	50.00
30927.	dimash (dsquared_210t93)	2	100.59	103.17	1	50.00
30928.	G (dseus4)	2	99.61	103.10	1	50.00
30929.	I'm slow (dryerase)	2	65.73	66.45	1	50.00
30930.	Henry (drwolf)	2	116.85	123.52	1	50.00
30931.	Jacob (drummerjacob)	2	124.52	139.30	2	100.00
30932.	pauper (drsnuffulupacis)	2	105.59	108.73	2	100.00
30933.	Ric (drrz)	2	107.79	110.37	1	50.00
30934.	Ahmed (dropheart)	2	119.74	124.72	2	100.00
30935.	Invictus (drokovian)	2	104.08	110.32	1	50.00
30936.	Drawsten (drawsten)	2	89.99	99.20	1	50.00
30937.	Kyle (dragonvids)	2	87.22	91.53	1	50.00
30938.	Dragon (dragonking0712)	2	123.55	123.82	2	100.00
30939.	jse (dragoncityjose)	2	129.73	153.52	1	50.00
30940.	Katherine (doylesgirl73)	2	72.09	77.54	0	0.00
30941.	Elizabeth (downbeat)	2	88.15	97.92	1	50.00
30942.	person guy (dotta_dotta)	2	83.29	85.93	2	100.00
30943.	Dolphin (dophin)	2	55.88	56.46	2	100.00
30944.	Hankey (doodthenoodle)	2	47.22	50.96	1	50.00
30945.	Isaac (doodle_eldood)	2	88.89	91.06	0	0.00
30946.	Phillip (donutdeflector)	2	95.53	96.11	1	50.00
30947.	go (donkeyblaster69)	2	113.91	118.87	2	100.00
30948.	dom (domo56)	2	81.12	83.36	0	0.00
30949.	Dominic (domg913)	2	56.93	62.02	2	100.00
30950.	Dominique (domdknguyen26)	2	73.34	76.51	0	0.00
30951.	Dog (dogtyper500)	2	99.43	110.00	1	50.00
30952.	dogstreet1 (dogstreet1)	2	91.44	93.45	1	50.00
30953.	max (dogman50012)	2	49.47	51.73	0	0.00
30954.	PKRZ Bright Red Hats (doesi...	2	121.43	122.39	2	100.00
30955.	Duong (doduong)	2	64.73	67.22	1	50.00
30956.	Dorian (dodo2208)	2	76.48	79.03	0	0.00
30957.	Alexu (doctoralexu)	2	98.13	103.94	2	100.00
30958.	Dev (doberay)	2	83.74	85.84	1	50.00
30959.	Christian (dmrunner)	2	99.04	99.78	2	100.00
30960.	Kenneth (dlguswp101)	2	54.67	57.44	0	0.00
30961.	Kaden (dlabguy12345)	2	95.64	96.14	1	50.00
30962.	Djordje (djordjeostoic)	2	56.07	56.97	0	0.00
30963.	Ro (dixirion)	2	54.06	54.78	1	50.00
30964.	David (divdav)	2	122.17	130.74	0	0.00
30965.	ur done, ur done (diszanne)	2	86.17	96.04	2	100.00
30966.	DistractedScam (distracteds...	2	94.99	96.25	2	100.00
30967.	Joe (disconnnect)	2	55.24	58.08	0	0.00
30968.	alex (disappointd)	2	134.44	138.83	1	50.00
30969.	Diriector (diriector_doc)	2	60.68	65.33	2	100.00
30970.	Diogo Mateus (diogomateus)	2	69.25	71.28	0	0.00
30971.	dio (diocccc)	2	88.37	90.49	1	50.00
30972.	Dillon (dillon_p)	2	85.72	87.88	0	0.00
30973.	Digs (digsdigging)	2	68.52	70.79	0	0.00
30974.	Digi (digisoul4)	2	67.31	67.64	1	50.00
30975.	Degoldie (digim)	2	119.05	130.84	2	100.00
30976.	Take (diesieben07)	2	90.15	91.49	1	50.00
30977.	Diana (dianajk)	2	52.69	52.99	0	0.00
30978.	mine (diamondminer939)	2	117.91	127.89	1	50.00
30979.	Maxim (diablero)	2	66.71	70.70	0	0.00
30980.	Dorji (dexdom2th)	2	61.65	62.99	0	0.00
30981.	dexdexdex (dexdexdex)	2	132.21	139.81	1	50.00
30982.	devin (devinekadeni)	2	85.89	86.52	2	100.00
30983.	Deus (deusseb)	2	94.62	102.68	2	100.00
30984.	Destroyer of fruits (destro...	2	78.11	78.30	2	100.00
30985.	desk (desk_wall)	2	60.38	64.40	0	0.00
30986.	Desideratus (desideratus)	2	81.49	82.12	1	50.00
30987.	Derek (derekcfop)	2	88.92	92.72	1	50.00
30988.	Dequantrius (dequantrius)	2	107.44	116.45	0	0.00
30989.	Dennis (denniskoskei)	2	47.90	48.82	1	50.00
30990.	Hiro (denis_bugle)	2	95.16	103.30	1	50.00
30991.	Arpit (demonnboy)	2	44.71	45.10	0	0.00
30992.	deletboi.exe (deletboi_exe)	2	40.21	41.82	0	0.00
30993.	DELA CRUZ (delacruzz)	2	118.28	124.10	2	100.00
30994.	Riley (defectivepixel)	2	70.12	76.99	0	0.00
30995.	Deep (deepp)	2	84.43	87.84	1	50.00
30996.	deembun (deembun)	2	52.70	57.85	0	0.00
30997.	Hehe (decahexatrix)	2	118.97	125.36	0	0.00
30998.	DDarWiz (ddarwiz)	2	89.25	89.48	1	50.00
30999.	Daniel (dchomtl)	2	109.38	111.60	2	100.00
31000.	Anton (dchk)	2	20.87	21.50	0	0.00
31001.	Dan (dcardoso12)	2	90.27	94.99	1	50.00
31002.	Buba Dorj (dbuba99)	2	66.37	68.08	0	0.00
31003.	Daynn_ (daynn_)	2	54.40	57.53	1	50.00
31004.	Dawka (dawka0499)	2	65.90	74.40	0	0.00
31005.	dawgy1 (dawgy1)	2	93.05	101.99	1	50.00
31006.	David (davidrecinos41)	2	79.23	79.72	0	0.00
31007.	David (daviddd1)	2	62.47	72.96	2	100.00
31008.	lithiumranger (datoucai)	2	107.33	117.01	0	0.00
31009.	Ryan (dathadka)	2	62.21	64.69	0	0.00
31010.	Rafea (datguyrafea)	2	57.57	61.77	1	50.00
31011.	Darvydas (darwyb)	2	101.99	110.50	2	100.00
31012.	Darth (darth480)	2	59.48	74.31	0	0.00
31013.	Darrel (darrelyap)	2	101.20	104.28	1	50.00
31014.	Ahmad (darklungs)	2	56.95	59.11	1	50.00
31015.	darkll (darkll)	2	93.63	101.71	1	50.00
31016.	Charlie (darklemon33)	2	86.70	97.90	2	100.00
31017.	Simon (darkfiremoon)	2	73.37	74.83	0	0.00
31018.	Darkblask23 (darkblask23)	2	58.27	65.59	0	0.00
31019.	DaRealSiri (darealsiri)	2	84.37	86.37	1	50.00
31020.	Neptium (dan_neptium)	2	87.63	90.95	1	50.00
31021.	Danail (dansarch)	2	82.00	85.41	1	50.00
31022.	Daniel (dannye014)	2	98.11	102.35	1	50.00
31023.	Dan (danmusa562)	2	89.95	93.57	2	100.00
31024.	Dani (danivenk)	2	59.85	61.46	0	0.00
31025.	Anish (danishanish)	2	120.43	130.74	2	100.00
31026.	Danii (danii_not8)	2	43.16	47.35	0	0.00
31027.	Daniel (danielwaker)	2	95.98	103.45	1	50.00
31028.	duniel (danieljonghyun)	2	45.47	46.72	0	0.00
31029.	Daniel (danielf55)	2	86.00	90.87	0	0.00
31030.	Daniel (danex2210)	2	74.07	81.97	1	50.00
31031.	da (damingwang0007)	2	52.01	53.16	0	0.00
31032.	Damian (damianp123)	2	58.97	62.41	2	100.00
31033.	Daman (damanwrld)	2	51.89	56.92	0	0.00
31034.	Andrei (dalacul)	2	82.90	87.17	1	50.00
31035.	Darko (dakiking)	2	72.44	75.56	2	100.00
31036.	Mason Wasicek (daddymace)	2	53.99	55.87	2	100.00
31037.	foM (da1scrub)	2	125.86	130.89	2	100.00
31038.	Mvck (d3mon666)	2	122.11	139.17	1	50.00
31039.	ay (d3b1)	2	127.31	143.45	1	50.00
31040.	Luke (d357r0y3r)	2	130.03	138.67	1	50.00
31041.	Tyme (cytokine117)	2	86.77	91.54	1	50.00
31042.	Torey (cyclops13)	2	92.77	97.95	0	0.00
31043.	Siddharth (cyberraptor)	2	56.91	57.27	1	50.00
31044.	Kollol (cyanomax)	2	75.31	85.60	2	100.00
31045.	Chase (cvcalderon)	2	65.04	68.85	0	0.00
31046.	CurB (cur_b)	2	61.15	63.66	0	0.00
31047.	Curse (curse10)	2	73.93	75.57	0	0.00
31048.	jurre (currythedestroyer)	2	76.25	79.70	2	100.00
31049.	Chris (cuntychris)	2	74.94	77.32	2	100.00
31050.	Jean (cummywummy)	2	104.65	108.30	1	50.00
31051.	rawr (cuddls)	2	90.03	100.27	1	50.00
31052.	Sander (cubit33)	2	105.45	107.20	2	100.00
31053.	Brandon (cube00)	2	104.55	118.00	1	50.00
31054.	Tommy (cstommy)	2	88.53	91.22	0	0.00
31055.	Type (csong03)	2	87.25	94.66	0	0.00
31056.	而自遇見你 惡夢就�...	2	79.69	81.25	1	50.00
31057.	Crystal (crystallyn84)	2	65.26	70.34	0	0.00
31058.	megacyst (cryna)	2	112.93	116.89	2	100.00
31059.	Marat (crunkz)	2	74.65	80.42	1	50.00
31060.	Sam (creature_feature)	2	72.58	75.11	1	50.00
31061.	Creamy Koala (creamy_koala)	2	49.93	51.96	0	0.00
31062.	Piper (crazy_panda)	2	76.98	83.76	2	100.00
31063.	C (crazynuf)	2	54.38	60.43	0	0.00
31064.	better than you (craznevil)	2	123.84	135.85	2	100.00
31065.	John Paul (crazeswag)	2	38.71	42.72	0	0.00
31066.	Linda (craygirl)	2	118.71	119.62	1	50.00
31067.	nothx (crassmonkey)	2	116.02	116.19	2	100.00
31068.	cr0wfgt (cr0wfgt)	2	87.03	94.90	1	50.00
31069.	echo (cptfryingpan)	2	74.37	77.61	0	0.00
31070.	Colin (cpryan)	2	70.27	71.73	0	0.00
31071.	zander (cowymcmooy)	2	34.65	36.19	1	50.00
31072.	leo (cowboy_john)	2	22.78	24.24	1	50.00
31073.	couchbanana (couchbanana)	2	38.34	39.02	0	0.00
31074.	Corey (corkster)	2	105.82	109.56	2	100.00
31075.	David (corerev)	2	51.80	53.12	0	0.00
31076.	Greg (corei8)	2	55.74	58.48	1	50.00
31077.	Md (copticmatic)	2	73.86	75.09	1	50.00
31078.	Brae (cooride)	2	86.62	92.47	0	0.00
31079.	Andrew (cookwies)	2	54.22	55.74	0	0.00
31080.	Super (cookiecrusader)	2	81.70	83.54	0	0.00
31081.	Abhiram (contigo)	2	55.14	57.32	0	0.00
31082.	Jai (constipater)	2	26.90	28.17	0	0.00
31083.	Conk (conkermilk)	2	75.59	92.15	1	50.00
31084.	Connor (con1847)	2	61.05	64.42	2	100.00
31085.	Commander823 (commander823)	2	90.41	108.39	1	50.00
31086.	Colton (coltonj)	2	66.83	67.30	0	0.00
31087.	cole (colezyyy)	2	28.63	29.45	0	0.00
31088.	Cole (colemathew)	2	86.97	89.19	0	0.00
31089.	tomoi (colemak_muzukashii)	2	123.46	130.40	1	50.00
31090.	colemaker (colemaker)	2	60.56	63.17	0	0.00
31091.	Cole (coleleighs)	2	71.43	72.38	1	50.00
31092.	Cole (coleland)	2	68.88	74.14	1	50.00
31093.	Matheus (coelhow)	2	62.74	65.07	0	0.00
31094.	Coding (coding_riovo)	2	35.03	37.26	0	0.00
31095.	Coda (coda06)	2	84.85	86.63	1	50.00
31096.	Egg (cocodong)	2	93.36	97.36	2	100.00
31097.	Cochu (cochuu_)	2	96.59	98.05	2	100.00
31098.	PHP JMC (cmjhunneil)	2	77.30	86.33	1	50.00
31099.	Colton (cmerri)	2	85.69	93.83	1	50.00
31100.	Duc (cmd1293)	2	70.99	75.77	2	100.00
31101.	Clown (clownius_v)	2	75.96	77.46	1	50.00
31102.	Charles (cloudhaze)	2	76.47	76.67	1	50.00
31103.	Luke_mcc (clonemyster)	2	55.60	57.15	1	50.00
31104.	Heksinator (cleverpleb)	2	64.65	65.63	1	50.00
31105.	Claudia (claudsipoo)	2	83.16	83.77	0	0.00
31106.	Charles (cksabe)	2	92.00	108.50	0	0.00
31107.	ckl (ckl33)	2	120.35	122.15	0	0.00
31108.	Kwan (ckksimon)	2	82.44	86.35	1	50.00
31109.	Lamp (cjquillen)	2	90.41	94.59	1	50.00
31110.	Christian (cjlax18)	2	95.58	99.60	1	50.00
31111.	ciwlx (ciwlx)	2	106.38	107.38	1	50.00
31112.	cippuda (cippuda)	2	57.43	65.90	1	50.00
31113.	Andrew (cinderwisp)	2	101.25	118.63	1	50.00
31114.	CillerCiller (cillerciller_yt)	2	42.21	43.18	0	0.00
31115.	Rango (chucknorrisauresrex)	2	127.32	128.26	1	50.00
31116.	Goh (chuanhao)	2	89.57	97.99	0	0.00
31117.	Mike (chuangman)	2	92.68	94.16	0	0.00
31118.	Christina (chrxstina)	2	100.96	103.37	2	100.00
31119.	Christine (christinezaki)	2	51.98	58.22	0	0.00
31120.	chris (chrispfries)	2	102.11	103.35	0	0.00
31121.	Chris (chrisdapula)	2	108.59	131.79	1	50.00
31122.	Choban (chombainer)	2	98.68	102.90	0	0.00
31123.	Alexander (chokoboy3)	2	109.71	115.59	2	100.00
31124.	choi (choi0228)	2	34.53	35.80	0	0.00
31125.	Choco (choco314)	2	116.69	127.10	2	100.00
31126.	Chirpzz (chirpzzlol)	2	95.82	101.66	2	100.00
31127.	Chris (chillstice)	2	90.52	95.87	0	0.00
31128.	Daniel (chiknugg)	2	77.79	78.10	0	0.00
31129.	Salma (chick_nugget)	2	46.69	47.05	1	50.00
31130.	Essam (chickennugget665)	2	68.26	69.58	0	0.00
31131.	Chichukin (chichukin)	2	102.39	121.21	1	50.00
31132.	Sporak (cheeseballoon)	2	54.60	56.10	0	0.00
31133.	poop (cheepb)	2	80.78	86.46	1	50.00
31134.	Gabriel (cheekychicken10)	2	51.73	53.04	0	0.00
31135.	Charles (chazzzle)	2	114.46	127.92	1	50.00
31136.	Zerlinda (chazer)	2	110.23	116.58	2	100.00
31137.	Chazador (chazador)	2	82.69	88.12	1	50.00
31138.	Charleston (charlestongrays)	2	112.83	114.64	1	50.00
31139.	Owen (chaostypefast)	2	82.54	90.79	0	0.00
31140.	The Doofus (chalkshortage)	2	104.31	112.98	2	100.00
31141.	pho (chagio)	2	87.22	97.96	1	50.00
31142.	Camilo (cgiraldo_)	2	114.98	118.45	0	0.00
31143.	Kai (ceteris_paribus)	2	50.04	51.84	0	0.00
31144.	Certex (certex)	2	92.00	94.08	2	100.00
31145.	Cele (cele0530)	2	85.71	89.62	2	100.00
31146.	Cedra (cedra)	2	129.18	142.97	1	50.00
31147.	Ceci (ceci_tyson)	2	54.81	57.50	0	0.00
31148.	Cecilio (cecilio16)	2	106.04	117.55	0	0.00
31149.	Carlo (ccatiello)	2	97.66	111.33	1	50.00
31150.	catpuplover (catpuplover)	2	87.78	97.73	0	0.00
31151.	Ray (castello666)	2	75.88	75.98	0	0.00
31152.	Cassie (cassienae)	2	78.42	79.16	0	0.00
31153.	caseyclosed (caseyclosedxd)	2	116.08	125.14	1	50.00
31154.	Carlota (carlota02)	2	44.61	45.87	0	0.00
31155.	Carl Emil (carlokj)	2	90.68	105.44	2	100.00
31156.	Thomas (cardano007)	2	33.52	35.16	1	50.00
31157.	Carbarrawr (carbarrawr)	2	104.66	106.27	1	50.00
31158.	Carlos (carandrod)	2	97.40	102.30	1	50.00
31159.	Captain (captainrick)	2	75.36	86.07	1	50.00
31160.	CaptainPotatoes (captainpot...	2	66.64	76.63	1	50.00
31161.	AJ (captainlide)	2	97.78	100.48	1	50.00
31162.	Stijn (capslockstuck)	2	87.80	88.41	0	0.00
31163.	Capablanca (capablanca373)	2	71.45	75.46	0	0.00
31164.	Stephen (canasferatu)	2	108.52	114.22	1	50.00
31165.	vincent (canadian_boi)	2	66.68	68.81	1	50.00
31166.	Gabriel (camposao)	2	72.96	74.43	0	0.00
31167.	Calle (calle01)	2	92.42	98.50	2	100.00
31168.	CalciumCarbonate (calcium_)	2	67.97	70.61	0	0.00
31169.	Enixam (caban)	2	77.47	80.09	0	0.00
31170.	isaac (caasiooj)	2	82.32	82.53	1	50.00
31171.	cabell ֎ (cabell)	2	46.52	50.10	0	0.00
31172.	Hai Dang (c0smological)	2	104.48	105.61	2	100.00
31173.	Poopy (c0hink)	2	94.48	96.34	1	50.00
31174.	BytePride (bytepride)	2	101.22	108.53	1	50.00
31175.	Brian (bv_225)	2	115.00	123.82	1	50.00
31176.	Thomas (buttnuggetchiu)	2	85.95	87.87	1	50.00
31177.	Bruce (buholaha)	2	59.85	60.57	1	50.00
31178.	Mario (buggy_)	2	88.93	99.59	1	50.00
31179.	buff (buffyc)	2	79.88	83.86	0	0.00
31180.	r (buckage)	2	76.87	76.99	2	100.00
31181.	Bryce (bs2190)	2	69.17	71.88	1	50.00
31182.	B3rt4 (brz_j)	2	49.34	49.73	0	0.00
31183.	Bruna (brunais)	2	37.10	38.73	0	0.00
31184.	White (bruh_neighbor_moment)	2	74.47	77.94	0	0.00
31185.	:) (brueashear)	2	83.40	84.46	0	0.00
31186.	Brotolios (brotolios)	2	88.22	89.32	0	0.00
31187.	Superior (brother_v)	2	87.86	103.90	1	50.00
31188.	Brian (brian81877)	2	48.99	51.55	0	0.00
31189.	Bread (breadofpower)	2	78.98	79.99	2	100.00
31190.	brazil (brazilman2309)	2	88.41	88.71	2	100.00
31191.	Ryan (bravefrontier)	2	103.05	106.29	1	50.00
31192.	Brandon (branick)	2	123.79	130.56	2	100.00
31193.	Brandon (brandonkheang)	2	98.87	103.56	2	100.00
31194.	Bradley (bradleydavis)	2	98.31	109.39	1	50.00
31195.	Hugo (bothugo)	2	58.00	59.08	2	100.00
31196.	Max (bortie)	2	110.15	127.51	2	100.00
31197.	Booty (bootykhan)	2	84.27	96.99	1	50.00
31198.	Z (bootlicker1776)	2	89.49	90.63	0	0.00
31199.	Anya (bonniebonbon)	2	89.25	94.73	0	0.00
31200.	BonkyKayn (bonky_kayn)	2	62.88	66.50	1	50.00
31201.	Sam (bonksy)	2	69.88	71.27	1	50.00
31202.	Lukas (bondevik)	2	64.03	70.26	1	50.00
31203.	tstats[bomb_guard] (bomb_gu...	2	79.42	79.70	0	0.00
31204.	Pepsi (bombchicken)	2	88.61	92.89	1	50.00
31205.	katsuna (bolt0009)	2	130.14	137.78	2	100.00
31206.	Will (boi1561)	2	95.88	103.53	0	0.00
31207.	Bog (bogjip)	2	104.13	110.13	0	0.00
31208.	Jack (boehler66)	2	43.96	47.22	0	0.00
31209.	mahmoud (boda05)	2	53.09	55.09	0	0.00
31210.	BOBMAN4900tstats[bobman4900...	2	97.53	103.70	0	0.00
31211.	SaclSojo (bobharley)	2	112.97	121.42	1	50.00
31212.	Em (blugrassgreensky)	2	78.02	83.99	1	50.00
31213.	Isaac (bluexpro)	2	41.08	41.20	0	0.00
31214.	SharkThatBlue (blueshark000)	2	83.44	105.30	2	100.00
31215.	BlueNerds (bluenerds)	2	75.92	84.44	1	50.00
31216.	Tristan (bluekidcrazy)	2	84.00	93.98	1	50.00
31217.	blu (bluberryy)	2	86.50	88.47	1	50.00
31218.	Stephen (bloodwineskg)	2	84.86	91.12	0	0.00
31219.	Michael (blindingfast)	2	48.02	52.76	0	0.00
31220.	Nazeem (bleaful)	2	69.55	75.21	0	0.00
31221.	Lan (bldymsscr)	2	57.27	60.80	0	0.00
31222.	B (blazingthunder30)	2	99.30	99.79	1	50.00
31223.	notsofast (blankawaii_16)	2	35.14	44.54	0	0.00
31224.	Justin (blamuro)	2	112.68	121.73	2	100.00
31225.	dzizuz (blakayn)	2	109.76	110.40	1	50.00
31226.	stefan (bitmap48)	2	44.32	44.34	0	0.00
31227.	Lara (bisharch)	2	90.32	96.91	1	50.00
31228.	Birdacious (birdacious)	2	100.49	101.41	1	50.00
31229.	Bird (birdiesaurus)	2	92.27	93.81	2	100.00
31230.	rykuzo (binhsorrow)	2	80.36	83.92	2	100.00
31231.	Area0 (bing_b0ng)	2	86.62	87.54	0	0.00
31232.	Francesco (billyboe)	2	84.48	86.61	0	0.00
31233.	Bika (bikaandrow)	2	62.79	67.96	0	0.00
31234.	pog (big_dick_ron27)	2	46.18	50.26	0	0.00
31235.	soved (biglego)	2	91.23	104.49	0	0.00
31236.	Avery (bigger_chungus)	2	59.24	67.02	1	50.00
31237.	Victor (bigetou)	2	87.10	89.84	0	0.00
31238.	steven (bigdong696969)	2	81.20	82.48	0	0.00
31239.	Matthew (bigbananakiwi)	2	80.76	86.65	1	50.00
31240.	Bigakaboom (bigakaboom)	2	79.56	83.54	2	100.00
31241.	Bibek (bibek_gautam)	2	46.85	48.61	2	100.00
31242.	Bibba (bibba27)	2	86.40	91.28	1	50.00
31243.	BibaSenpai (bibasenpai)	2	37.90	43.20	1	50.00
31244.	GwenXYZ (bhuyquang1)	2	57.26	58.14	0	0.00
31245.	Brofist (bhyper)	2	128.82	139.29	2	100.00
31246.	Noah (bhyldir)	2	96.27	97.25	1	50.00
31247.	Brandon (bhender)	2	69.08	69.22	1	50.00
31248.	Chris (bgy11)	2	63.20	72.57	0	0.00
31249.	Benjamin (be_jamin)	2	66.05	69.07	1	50.00
31250.	Bettydaweirdo (bettydaweirdo)	2	65.29	72.56	0	0.00
31251.	Best (bestgemon)	2	70.48	74.09	1	50.00
31252.	besher (besher)	2	66.17	68.21	0	0.00
31253.	Bertus (bertus009)	2	74.29	75.27	1	50.00
31254.	Ben (bentontypesfast)	2	74.54	82.86	0	0.00
31255.	Bento (bentobox9)	2	78.54	81.81	1	50.00
31256.	Ben (bensolo1_chess)	2	43.49	52.17	0	0.00
31257.	Ben (benlestage3)	2	56.63	58.78	0	0.00
31258.	Benjamin (benjocar)	2	68.54	70.60	0	0.00
31259.	Ben (benjermanloo)	2	87.24	96.33	1	50.00
31260.	Belgutei (belgutei_0323)	2	71.49	75.96	0	0.00
31261.	Zhantore (belayed)	2	70.38	70.54	1	50.00
31262.	Ong (bebooo)	2	52.83	55.28	0	0.00
31263.	ET (bearington_45)	2	86.25	90.15	1	50.00
31264.	Nick (beansymcgee)	2	125.47	143.70	1	50.00
31265.	beachill (beachill)	2	135.45	147.80	2	100.00
31266.	Bdott (bdott_)	2	54.51	60.42	0	0.00
31267.	bbro (bbro)	2	69.18	73.84	1	50.00
31268.	Nick (bballnick2k2)	2	102.93	108.51	1	50.00
31269.	Bazoo (bazoo)	2	64.87	65.84	0	0.00
31270.	Furkan (baytak)	2	42.13	42.36	0	0.00
31271.	Okan (baykalokandemir)	2	90.40	95.69	1	50.00
31272.	Baush (baush)	2	104.83	109.21	1	50.00
31273.	Batyrkhan (batyyr)	2	102.62	112.42	0	0.00
31274.	Baslay (baslay)	2	100.83	103.56	2	100.00
31275.	BareDK (baredk)	2	44.52	44.90	2	100.00
31276.	Sally (barbiequeen5)	2	80.93	82.39	1	50.00
31277.	yusuf (barackobunga)	2	62.98	66.58	0	0.00
31278.	Deadeye (banterbry)	2	96.43	99.73	0	0.00
31279.	Rodrigo (banr_)	2	86.86	89.98	0	0.00
31280.	Long (bakabu12345)	2	51.96	55.68	2	100.00
31281.	Baka (bakabawi)	2	50.84	58.31	1	50.00
31282.	Wolferwow (baime)	2	88.95	94.72	0	0.00
31283.	Jaroslav (baegus)	2	65.49	65.93	0	0.00
31284.	Badger (badgerr)	2	74.00	83.05	2	100.00
31285.	baboom (baboom3)	2	74.33	74.71	1	50.00
31286.	Calvin (b1ack)	2	93.35	105.48	1	50.00
31287.	Aryan (a_r_y_a_n)	2	79.69	82.19	0	0.00
31288.	Anthony (a_rebello_type_hello)	2	112.59	116.97	0	0.00
31289.	Alireza (a_ashkanipour)	2	47.96	52.29	1	50.00
31290.	azuraath (azuraath)	2	91.46	96.16	1	50.00
31291.	Roro (azuirith100wpm)	2	111.80	112.37	2	100.00
31292.	Winnie (aznfreakwinnie)	2	69.16	83.58	0	0.00
31293.	Anthony (azndeadman2001)	2	78.72	80.42	0	0.00
31294.	azenia (azenia)	2	85.21	87.45	2	100.00
31295.	Jumri (azarashii)	2	79.42	83.31	0	0.00
31296.	Abdullah (azaidrahman13)	2	101.11	105.53	1	50.00
31297.	az4521 (az4521)	2	97.37	100.95	0	0.00
31298.	Anna (ayyross)	2	99.39	102.14	0	0.00
31299.	danielllll! (ayyitsdan)	2	101.50	101.90	2	100.00
31300.	Ayush (ayushtank)	2	50.20	51.98	0	0.00
31301.	Alec (ayic)	2	80.33	82.32	0	0.00
31302.	Zane (axkz)	2	54.82	55.69	0	0.00
31303.	Axel (axel_ram)	2	54.70	54.82	0	0.00
31304.	Axaul (axaul)	2	73.56	74.93	0	0.00
31305.	Technoblade (awppenheimer)	2	112.96	122.26	0	0.00
31306.	Gregory (awesome1000988)	2	111.41	119.46	2	100.00
31307.	Raymond (awedragon)	2	70.34	78.64	1	50.00
31308.	Eric (avocadopineapple)	2	119.02	126.74	1	50.00
31309.	Avishek (avishek_)	2	30.53	33.92	1	50.00
31310.	Avikam (avikam)	2	89.58	92.08	2	100.00
31311.	Bulky Hulk (avg_typist)	2	88.22	94.29	1	50.00
31312.	Avery (avery11821)	2	119.51	139.04	0	0.00
31313.	Kei (auvere)	2	117.95	120.13	1	50.00
31314.	Auto (autocats)	2	113.99	131.27	2	100.00
31315.	You don't (austin101123)	2	90.72	93.70	0	0.00
31316.	Auralis (auralis)	2	134.30	155.08	2	100.00
31317.	Augustine (augustinec)	2	90.72	95.98	1	50.00
31318.	Peter (aufbau)	2	77.59	78.87	0	0.00
31319.	Nicholas (atticcraft)	2	82.50	83.91	0	0.00
31320.	attemptless (attemptless)	2	94.83	97.40	2	100.00
31321.	MANGESH (atom2)	2	55.92	62.17	1	50.00
31322.	Egg boy (atobias28)	2	93.80	98.71	0	0.00
31323.	Alex (athensguy)	2	105.12	110.55	1	50.00
31324.	Marcelo Gomes (asyeok)	2	132.79	136.46	0	0.00
31325.	Wazukyan (aswertgvc)	2	48.09	55.46	0	0.00
31326.	Astex (astex_97)	2	59.67	62.88	0	0.00
31327.	John Wick (asr123)	2	113.82	120.89	2	100.00
31328.	Atul (asquare893)	2	51.28	54.99	0	0.00
31329.	DELTA P (aspiron)	2	61.22	75.58	1	50.00
31330.	Justin (asparaguswater)	2	82.41	84.67	1	50.00
31331.	Arthur (asmv)	2	90.52	101.83	2	100.00
31332.	Justin (asianplayz)	2	62.40	64.55	0	0.00
31333.	ashmit (ashmit1769)	2	36.81	37.79	0	0.00
31334.	Ashen (ashen12)	2	44.99	51.97	0	0.00
31335.	ASG (asg1997)	2	108.22	119.51	1	50.00
31336.	Aseemru (aseemru)	2	108.44	110.16	2	100.00
31337.	Aseel (aseel_draz)	2	53.27	56.48	0	0.00
31338.	Asado (asado)	2	87.40	88.37	1	50.00
31339.	Arxidon (arxidon)	2	109.18	114.68	1	50.00
31340.	Arvid (arvid220u)	2	87.69	98.41	0	0.00
31341.	Andrei (artoorie312)	2	87.01	88.79	1	50.00
31342.	Dr Pepper (artistp)	2	86.00	92.00	2	100.00
31343.	Artin (artinmk)	2	72.45	76.41	0	0.00
31344.	Case (arsonistlol)	2	102.08	104.86	0	0.00
31345.	Sarthak (arseeus_not_arkius)	2	116.06	119.91	1	50.00
31346.	Ar (arpratama)	2	88.56	90.87	0	0.00
31347.	Arnold (arnolddddd)	2	59.04	59.11	0	0.00
31348.	arnavf1 (arnavf1)	2	94.65	104.07	1	50.00
31349.	slow typer (_________o_____...	2	107.92	108.11	0	0.00
31350.	reeeeeee (________e________)	2	104.77	106.90	2	100.00
31351.	Syo (_syo_)	2	84.96	88.28	0	0.00
31352.	Petar (_petar_)	2	49.96	51.80	0	0.00
31353.	Ty (_pj1)	2	105.47	109.27	0	0.00
31354.	Cole (_noskilljusthax)	2	78.03	85.94	0	0.00
31355.	a (_mau)	2	54.32	58.31	1	50.00
31356.	_louob_ (_louob_)	2	78.91	81.91	0	0.00
31357.	Kroma (_kromaa_)	2	61.21	62.84	0	0.00
31358.	Ken (_k3n)	2	60.45	65.73	2	100.00
31359.	lol (_harmandeep16)	2	87.93	90.10	1	50.00
31360.	Hamid ツ (_hamid_)	2	70.68	85.77	0	0.00
31361.	Darkreaper (_darkreaper_)	2	35.20	38.92	0	0.00
31362.	Ch1LLz (_chillz)	2	55.94	59.89	1	50.00
31363.	Armaan (_armaan_singh24)	2	31.76	33.02	0	0.00
31364.	Ariyan (_ariyankhan_)	2	64.94	69.31	0	0.00
31365.	mikey (_12mr_)	2	52.55	53.49	0	0.00
31366.	Ben (_0icydrizzlez0_)	2	57.77	60.62	0	0.00
31367.	RIP RECKFUL (zyphal)	2	87.80	91.72	1	50.00
31368.	zyf (zyf_)	2	63.42	64.98	0	0.00
31369.	Z (zxxzus)	2	106.54	107.71	2	100.00
31370.	Zurchonic (zurchonic)	2	65.26	67.40	0	0.00
31371.	Stratos (ztratos)	2	106.15	111.27	1	50.00
31372.	Zander (zshark216)	2	55.98	56.79	0	0.00
31373.	Byran (zset)	2	39.86	51.38	0	0.00
31374.	ZPGStudios (zpgstudios)	2	72.06	81.58	1	50.00
31375.	Caleb (zonicon)	2	96.31	105.26	2	100.00
31376.	Mainek (zoochan)	2	76.42	78.47	1	50.00
31377.	Song (zombieswap3)	2	129.68	139.74	1	50.00
31378.	zolorf (zolorf)	2	86.90	102.51	1	50.00
31379.	jimmy (zojim)	2	59.42	63.51	0	0.00
31380.	Zach (zman30533)	2	100.76	112.94	1	50.00
31381.	Zleper8Q (zleper)	2	82.77	83.78	0	0.00
31382.	ziyummmm (ziyummmm)	2	55.91	62.87	0	0.00
31383.	zircks (zircks)	2	53.88	58.38	0	0.00
31384.	Zing (zingclassy)	2	77.36	78.64	0	0.00
31385.	zindabaad (zindabaad111)	2	64.82	70.44	0	0.00
31386.	zilzil (zilzilp)	2	79.13	89.01	2	100.00
31387.	Ike (zike_ang)	2	90.33	96.20	0	0.00
31388.	Federico (zigish)	2	78.59	79.43	1	50.00
31389.	JY (zhangjinyuan)	2	41.75	45.99	1	50.00
31390.	zfrxst (zfrxst0wpm)	2	46.97	57.07	0	0.00
31391.	Ze (zewrath)	2	44.10	49.19	0	0.00
31392.	Zephy (zephy_yx)	2	91.96	102.82	1	50.00
31393.	Wan (zenag)	2	110.29	118.13	2	100.00
31394.	zeldaplayergl (zeldaplayergl)	2	81.64	90.23	0	0.00
31395.	Moag (zefoos)	2	81.90	87.62	1	50.00
31396.	Zeph (zeezallo)	2	102.07	105.31	1	50.00
31397.	Axel (zedronar)	2	79.99	81.08	2	100.00
31398.	Lukas (zeduke14)	2	82.21	85.93	1	50.00
31399.	Zet (zeathus)	2	96.86	102.15	1	50.00
31400.	Tan (zdfhzx)	2	73.23	73.67	0	0.00
31401.	birdy (zazu7765)	2	101.92	112.64	1	50.00
31402.	Nikola (zatharel)	2	116.83	122.06	2	100.00
31403.	kimberley (zarkoraven)	2	33.28	37.33	1	50.00
31404.	Zaptronic (zaptronic)	2	70.35	72.86	1	50.00
31405.	Zach (zank0)	2	94.69	103.91	1	50.00
31406.	kenneth (zanekao)	2	77.78	80.56	1	50.00
31407.	Alex (zander77777)	2	68.02	71.76	0	0.00
31408.	Adam (zamn)	2	116.27	120.68	0	0.00
31409.	Zakaria (zakosan)	2	60.38	66.90	0	0.00
31410.	Zakir (zakitwelvee)	2	70.65	80.78	0	0.00
31411.	Sherwin (zafiros)	2	85.12	91.06	1	50.00
31412.	Mason (zadeos)	2	109.32	116.29	0	0.00
31413.	Zackyization (zackyization)	2	93.55	94.55	0	0.00
31414.	Zachary (zackfromstatefarm)	2	97.88	100.72	0	0.00
31415.	Zach (zachary2001)	2	52.24	57.58	0	0.00
31416.	yuzuru (yuzuruace)	2	83.42	89.97	1	50.00
31417.	lesseH (yung_lesseh1337)	2	90.01	92.87	0	0.00
31418.	Kevin (yungwang)	2	103.27	110.04	0	0.00
31419.	Y (yungkitchensink)	2	73.08	91.25	0	0.00
31420.	Cameron (yungjoon)	2	68.33	78.02	1	50.00
31421.	PB (yukiiiipboy)	2	58.31	60.11	1	50.00
31422.	yuccai (yucca)	2	73.20	74.67	0	0.00
31423.	Achinta (ysachinta)	2	74.79	79.02	1	50.00
31424.	Yentl (yp30)	2	56.32	58.80	1	50.00
31425.	Hyper (yo_hyper)	2	78.89	80.81	1	50.00
31426.	yousuf (yousufmanikfan)	2	84.05	86.76	1	50.00
31427.	justin (yourmuther)	2	88.18	122.12	1	50.00
31428.	Annie (yourirregulartomboy)	2	55.75	62.19	1	50.00
31429.	long (yourdad_69420)	2	57.70	60.16	0	0.00
31430.	M (yougottachill)	2	84.91	85.70	1	50.00
31431.	yopman (yopman)	2	63.90	68.17	0	0.00
31432.	Pachara (yopachara)	2	43.15	46.42	0	0.00
31433.	... (yomer)	2	78.71	80.63	2	100.00
31434.	Dylan (yokamaa)	2	90.18	90.62	0	0.00
31435.	dove (yohello11)	2	104.55	110.50	1	50.00
31436.	Ant (ynosky)	2	86.56	87.71	1	50.00
31437.	Michael (yinyanyo3)	2	74.27	76.52	0	0.00
31438.	Nii (yhuandebeste)	2	73.63	79.12	2	100.00
31439.	Geoffrey (yerffoeg)	2	101.98	107.55	0	0.00
31440.	yentup (yentup)	2	103.53	104.21	2	100.00
31441.	yehojo (yehojo)	2	60.67	64.02	1	50.00
31442.	beew (yeetit)	2	126.03	133.49	1	50.00
31443.	Hee (yeecinn13)	2	56.94	58.80	0	0.00
31444.	Jawn (yavvaios)	2	110.23	118.18	1	50.00
31445.	Yash (yashedp)	2	109.89	113.17	1	50.00
31446.	Yap (yap_lee)	2	97.56	98.45	1	50.00
31447.	Mia (yalllikefeet)	2	86.47	96.65	0	0.00
31448.	Frank (y0l0sweq)	2	113.56	114.61	2	100.00
31449.	Bilguun (xyniness)	2	99.23	113.81	1	50.00
31450.	Rica (xx_peitapave_xx)	2	103.49	115.43	2	100.00
31451.	Blaster (xx_assblaster_xx)	2	89.93	99.77	1	50.00
31452.	ty (xtremety)	2	72.41	78.31	2	100.00
31453.	xrTForces (xrtforces)	2	86.16	90.29	0	0.00
31454.	G̸̡̢̠̼̻̟̠̠̎͊͜ͅ...	2	58.01	62.05	0	0.00
31455.	Soleh (xolehahhh)	2	73.22	82.68	1	50.00
31456.	rona is on a bike (xnevermi...	2	60.22	60.61	0	0.00
31457.	Calvin (xmonkeymonk)	2	85.27	86.42	1	50.00
31458.	jerry (xmars)	2	95.57	105.61	1	50.00
31459.	xKubsoN (xkubson)	2	61.33	70.89	1	50.00
31460.	Darrick (xkj888418)	2	67.91	74.57	0	0.00
31461.	Cyrus (xk0ul)	2	83.19	98.66	0	0.00
31462.	Insta:remy_xin (xin_shadow)	2	75.91	81.96	0	0.00
31463.	xiphias (xiphias_)	2	74.30	75.52	0	0.00
31464.	Jean (xjean)	2	141.56	146.50	1	50.00
31465.	Nick (xinini)	2	80.21	83.88	1	50.00
31466.	Ximzor (ximzor)	2	68.64	76.32	1	50.00
31467.	Chris (xilteen)	2	93.89	108.47	0	0.00
31468.	green (xgreenbanana)	2	79.20	80.63	0	0.00
31469.	ghostly (xghostly)	2	55.39	61.04	1	50.00
31470.	Feniks (xfeniks)	2	47.62	49.24	0	0.00
31471.	Matt (xerth)	2	95.01	99.91	1	50.00
31472.	Xelicus (xelicus_gamingyt)	2	103.39	112.79	2	100.00
31473.	Xavier (xcperez)	2	94.56	94.75	1	50.00
31474.	Norris (xcnorris)	2	101.15	111.36	0	0.00
31475.	xchli (xchli)	2	44.78	50.05	0	0.00
31476.	Jordan (xbeastyx)	2	96.93	99.74	2	100.00
31477.	James (xaxlox)	2	89.41	92.14	1	50.00
31478.	CP Addict (xariniov9)	2	43.52	45.40	0	0.00
31479.	Amine (xabri)	2	78.90	87.48	1	50.00
31480.	Wes (wyvr)	2	90.51	103.65	1	50.00
31481.	Lewis (wyattl1)	2	25.77	26.98	0	0.00
31482.	Jit (wtf989)	2	34.46	36.91	0	0.00
31483.	Wr (wrish)	2	106.41	112.99	1	50.00
31484.	wpnwbn (wpnwbn)	2	59.03	59.21	1	50.00
31485.	Artem (wopsmops)	2	98.96	104.22	1	50.00
31486.	Raph (wolfzlol)	2	67.82	73.04	1	50.00
31487.	Wolfinaa (wolfinaa)	2	74.60	85.32	2	100.00
31488.	Czar (wolfga)	2	99.33	109.89	1	50.00
31489.	Poogen (wolfer50000)	2	118.68	127.06	2	100.00
31490.	Jackson (wok_)	2	61.98	63.01	1	50.00
31491.	hi (wmc2000)	2	62.97	63.19	1	50.00
31492.	Maverick (wizgamer)	2	55.06	56.69	0	0.00
31493.	Drew (withersoldier)	2	81.31	87.31	0	0.00
31494.	Jessy (wisticram)	2	53.74	61.00	0	0.00
31495.	zWinGaH (winzahg)	2	53.70	58.21	1	50.00
31496.	winter (winterruwu)	2	80.66	80.78	0	0.00
31497.	Winson (winlee620)	2	70.60	71.00	0	0.00
31498.	Wind (windywind)	2	76.84	84.60	2	100.00
31499.	Alberth (windwings)	2	46.99	56.80	2	100.00
31500.	wilson (wilsoncho360)	2	30.38	36.03	0	0.00
31501.	wilson (wilso499)	2	54.19	54.35	1	50.00
31502.	Will (willydale)	2	122.16	134.17	2	100.00
31503.	William (willeum)	2	87.53	91.76	0	0.00
31504.	Will (willdawarrior77)	2	64.50	67.41	0	0.00
31505.	Wilfred (wilfredfraser)	2	109.02	115.31	0	0.00
31506.	patel to the metal (wildsv2)	2	97.30	102.17	1	50.00
31507.	Finn (wildducktca)	2	105.18	109.69	2	100.00
31508.	Farzin (wickedjargon)	2	50.94	56.41	2	100.00
31509.	Whinnie (whinnie)	2	116.94	120.17	2	100.00
31510.	glenu (whetherman)	2	75.97	78.86	0	0.00
31511.	phong (whatthephong)	2	97.14	99.86	0	0.00
31512.	Seán (whaamp)	2	111.44	117.29	2	100.00
31513.	Wetetet (wetetet)	2	97.20	99.60	1	50.00
31514.	Yurekemi (wertzwertz12)	2	61.69	67.46	0	0.00
31515.	Jason (weekly5112)	2	140.18	144.46	1	50.00
31516.	SM (webadnan)	2	72.49	74.30	2	100.00
31517.	Michael (wayongg)	2	54.03	56.04	1	50.00
31518.	waxman (waxman69)	2	131.70	135.34	1	50.00
31519.	. (watertastegoood)	2	129.74	132.71	0	0.00
31520.	poophead (watermelon69)	2	97.23	100.37	1	50.00
31521.	wasituf (wasit12348)	2	88.18	100.50	0	0.00
31522.	Paul (warrenpya)	2	78.01	78.91	0	0.00
31523.	Leo (waoping)	2	100.62	105.03	2	100.00
31524.	William (walbertus)	2	70.06	70.54	0	0.00
31525.	Wailea (waileadude)	2	35.48	38.12	0	0.00
31526.	v (v____)	2	88.54	88.73	0	0.00
31527.	V_aura_V (v_aura_v)	2	43.36	44.57	0	0.00
31528.	pew (vynxr)	2	102.62	110.54	1	50.00
31529.	Vincent (vwong21)	2	68.09	69.45	1	50.00
31530.	vradhi (vradhi_108)	2	53.85	57.75	0	0.00
31531.	Vosse (vosse)	2	82.47	86.45	1	50.00
31532.	Alejandro (vortitex)	2	70.36	75.73	0	0.00
31533.	Leo (vonald)	2	60.33	64.37	1	50.00
31534.	Mikael (vompo)	2	57.45	58.08	1	50.00
31535.	Ｖｏｌｈｏｓｉｓ (v...	2	167.94	169.73	0	0.00
31536.	Dmitry (voidpointer64)	2	116.51	121.80	1	50.00
31537.	vladim (vladim)	2	58.48	69.85	2	100.00
31538.	Vlad (vlad7777)	2	78.91	95.02	1	50.00
31539.	Vivioxide (vivioxide)	2	102.71	104.25	2	100.00
31540.	Vitap (vitapramdevputra)	2	74.46	74.50	0	0.00
31541.	Vishal (vishalparkour)	2	58.66	68.28	2	100.00
31542.	tracy (viscassia)	2	101.25	110.12	1	50.00
31543.	virtualflames#1011 (virtual...	2	114.61	132.14	2	100.00
31544.	Vicky (viqnt)	2	59.49	63.83	0	0.00
31545.	Vinstalia (vinstalia)	2	99.14	104.53	2	100.00
31546.	das (vinil10)	2	38.82	41.51	0	0.00
31547.	A (viking_)	2	50.59	54.98	0	0.00
31548.	Olaf (vikingishly)	2	100.21	110.92	1	50.00
31549.	Theis (viggotheis)	2	100.27	112.54	1	50.00
31550.	Mclovin (victor_123321)	2	77.53	85.15	1	50.00
31551.	mark (victicious)	2	72.86	76.83	0	0.00
31552.	vittoria (vibesmvx)	2	70.13	70.74	1	50.00
31553.	Hayward (vhenom)	2	84.23	84.53	1	50.00
31554.	David (vgodtyper)	2	62.59	62.82	0	0.00
31555.	Venky (venkypk)	2	59.34	62.37	0	0.00
31556.	F (veneda24)	2	133.31	140.40	1	50.00
31557.	Varsovie (vendrige)	2	54.04	58.22	1	50.00
31558.	Tahmeed Ibne (vedistaan)	2	77.91	88.65	1	50.00
31559.	Vedran (veco98)	2	85.36	87.24	1	50.00
31560.	Sabix (veam)	2	60.30	60.56	1	50.00
31561.	Vaynez (vaynez)	2	69.49	74.99	1	50.00
31562.	Varit (varitfinn)	2	39.14	40.38	1	50.00
31563.	🔥Varcious🔥 (varcious)	2	116.52	118.97	1	50.00
31564.	Lakos (vanlakos)	2	62.30	64.73	1	50.00
31565.	little uzi (valstroyer)	2	89.70	94.04	1	50.00
31566.	Valerious (valeriousking)	2	61.98	75.36	1	50.00
31567.	Seth (vadneylol)	2	72.87	82.16	1	50.00
31568.	Gus (v1per41)	2	88.58	104.70	0	0.00
31569.	uxiator (uxiator)	2	75.06	78.11	1	50.00
31570.	Jimmy (user39_on_anagram)	2	68.64	69.91	0	0.00
31571.	Ajay (ur_fav_man_ajoy)	2	59.72	60.95	1	50.00
31572.	Joel (unwono)	2	45.59	45.63	1	50.00
31573.	alf (unocha)	2	85.17	93.20	2	100.00
31574.	unleashed (unleashedcode)	2	55.15	60.61	0	0.00
31575.	Fry (uncle_youtube)	2	112.01	115.49	2	100.00
31576.	Yosua (unclepo)	2	83.44	84.28	0	0.00
31577.	Shain (uncledrew09)	2	65.50	73.96	1	50.00
31578.	Thomas (unc4me4568)	2	85.11	93.10	1	50.00
31579.	duh fast af (umrca)	2	71.04	74.24	1	50.00
31580.	Gui (ult_guiks)	2	60.37	61.87	2	100.00
31581.	Saad (ultraman287)	2	69.24	77.30	0	0.00
31582.	Ulday (ulday)	2	59.02	61.00	0	0.00
31583.	Ujjwal (ujjwalavishek)	2	67.70	70.50	0	0.00
31584.	U (ugotme)	2	73.36	78.08	0	0.00
31585.	Daniel (uheardmetrick)	2	103.65	110.59	1	50.00
31586.	ugly (uglygaming)	2	47.72	50.87	0	0.00
31587.	uberstrike (uberstrikeghost...	2	62.02	65.74	1	50.00
31588.	Tal (t_b_m)	2	52.12	53.67	0	0.00
31589.	jasepa (tyreesepapi)	2	100.99	102.15	2	100.00
31590.	mikeeeee (typintypist)	2	79.57	84.48	1	50.00
31591.	George (typing_bot)	2	96.26	97.61	1	50.00
31592.	typingprogram (typingprogram)	2	95.19	97.24	2	100.00
31593.	Knut (typeracer5000)	2	62.01	70.61	1	50.00
31594.	Nikolas (typer99951)	2	97.69	102.61	1	50.00
31595.	Luc (typemasterluc)	2	72.18	72.21	1	50.00
31596.	Colin (typemaster612)	2	88.22	99.23	1	50.00
31597.	LikeASir (typelikeasir)	2	80.08	84.50	2	100.00
31598.	Tim (tymolc)	2	89.86	95.44	1	50.00
31599.	Tiffany (tylietz)	2	119.65	122.42	2	100.00
31600.	Tyler (tyli)	2	97.76	98.11	0	0.00
31601.	Tyler (ty11_24)	2	65.80	66.47	1	50.00
31602.	jaye (twojaye)	2	60.87	61.50	2	100.00
31603.	Twillerdog (twillerdog)	2	97.11	97.83	0	0.00
31604.	Tweece (tweece)	2	98.34	100.47	1	50.00
31605.	Is me Tonyyyyy (tw4040nonquit)	2	125.24	125.60	2	100.00
31606.	PogChamperino (tutsandallthat)	2	86.85	95.87	0	0.00
31607.	fast (turteled)	2	66.55	71.29	0	0.00
31608.	Vaito (tunerfrick)	2	64.10	65.68	2	100.00
31609.	Thomas (tumpz)	2	62.66	64.56	2	100.00
31610.	Ryan (tuffpuppy)	2	69.18	72.44	0	0.00
31611.	Tudi (tudipym)	2	84.12	86.46	0	0.00
31612.	Todd (ttran65)	2	123.10	123.94	1	50.00
31613.	Su (tsunamitdw)	2	49.17	49.83	1	50.00
31614.	Travis (tsmith112000)	2	97.32	100.48	1	50.00
31615.	Emrick (tsicko)	2	64.02	73.41	0	0.00
31616.	Kristoffer (tryyyy)	2	53.70	57.18	0	0.00
31617.	Michael (truongm21)	2	70.89	71.70	0	0.00
31618.	Lam (trungld)	2	56.71	59.38	0	0.00
31619.	FL (trumpetrockslol)	2	119.48	126.78	2	100.00
31620.	True (truefalse)	2	84.08	87.75	2	100.00
31621.	troy (troysimpson)	2	88.52	91.71	1	50.00
31622.	trollingck (trollingck)	2	70.87	72.86	0	0.00
31623.	Trixie1018 (trixie1018)	2	86.01	87.70	0	0.00
31624.	zesty (tristanducharme07)	2	45.25	51.16	0	0.00
31625.	Taylor (trifortay)	2	73.98	79.02	0	0.00
31626.	Tricky (trickydot)	2	85.04	87.94	0	0.00
31627.	Trav (treiner)	2	92.66	94.48	1	50.00
31628.	trac (tractray)	2	37.70	42.86	0	0.00
31629.	Perfect (tpspark42)	2	68.52	72.81	1	50.00
31630.	Jarod (toxedo999)	2	61.53	61.71	0	0.00
31631.	Ely (touch_typer)	2	58.62	59.62	0	0.00
31632.	jill (toshiba_jill)	2	101.46	107.95	1	50.00
31633.	Brzina (torpedo99)	2	81.19	86.66	0	0.00
31634.	Top1nambur (top1nambur)	2	52.25	58.66	0	0.00
31635.	tont (tont)	2	97.54	100.37	2	100.00
31636.	KundiV1 (tommy3605)	2	61.21	62.34	1	50.00
31637.	tstats[tomek1337] (tomek1337)	2	77.54	80.40	0	0.00
31638.	Thomas (tomithink)	2	52.02	54.39	0	0.00
31639.	Tomás (tomasero)	2	89.30	92.95	0	0.00
31640.	KaKundam (toilagun2004)	2	39.68	40.17	0	0.00
31641.	Olav (tocke)	2	101.68	116.26	1	50.00
31642.	Tobs (tobzs)	2	109.56	119.75	1	50.00
31643.	mansur (tmansur)	2	44.17	48.38	0	0.00
31644.	Dylan (tlwnl)	2	75.16	79.29	0	0.00
31645.	Kelsier (tkelsier)	2	128.51	132.04	1	50.00
31646.	TJ (tjheinzo)	2	77.03	79.26	1	50.00
31647.	Tjerk (tjerkderacer)	2	68.63	70.41	1	50.00
31648.	Z (tiredtyper)	2	105.25	113.80	2	100.00
31649.	Tipsy (tipsy_unicorn)	2	70.19	75.04	0	0.00
31650.	patzer (tip3)	2	88.62	89.03	0	0.00
31651.	Tinkle (tinklesticks)	2	80.75	81.54	1	50.00
31652.	Sir (tinapay)	2	97.03	101.97	1	50.00
31653.	timothy (timmysuh904)	2	111.93	119.67	1	50.00
31654.	Gavin (tictac67)	2	92.20	101.22	1	50.00
31655.	Thuxerinho (thuxerinho)	2	55.93	61.69	1	50.00
31656.	Thug_TwisterzZ (thug_twiste...	2	83.84	87.60	1	50.00
31657.	Jeremy (thugapy)	2	88.77	96.55	1	50.00
31658.	Pablo (thotwalker2020)	2	52.29	60.44	0	0.00
31659.	Thor (thor3101)	2	96.01	98.22	0	0.00
31660.	Thomas (thomas_wong)	2	49.19	49.96	0	0.00
31661.	Thomas (thomasbd)	2	74.86	84.41	2	100.00
31662.	Claire (thisisforfun)	2	123.27	130.25	2	100.00
31663.	Thi (thiorcoffee)	2	77.22	90.12	2	100.00
31664.	gabelolll (the_typing_noob1...	2	37.50	41.58	0	0.00
31665.	Spookster (the_spookster)	2	92.02	103.12	2	100.00
31666.	Thewsomeguy (thewsomeguy)	2	112.05	113.06	0	0.00
31667.	Philip (theworstracer)	2	101.00	101.73	1	50.00
31668.	thewayistay (thewayistay)	2	42.88	45.66	0	0.00
31669.	Vuong (thevuong)	2	53.71	59.31	1	50.00
31670.	Vi (thevi25)	2	64.75	66.62	0	0.00
31671.	TheUltimateMeme (theultimat...	2	87.90	90.16	0	0.00
31672.	SHURA (theshura)	2	43.42	50.60	0	0.00
31673.	Chris (thesazh)	2	65.39	72.35	1	50.00
31674.	S (therealslim69)	2	89.81	105.46	1	50.00
31675.	Martin (therealmartin)	2	100.63	101.43	2	100.00
31676.	Will (theracer69)	2	101.12	107.30	0	0.00
31677.	plasma (theplasma)	2	95.81	110.50	1	50.00
31678.	ThePiProgrammer (thepiprogr...	2	91.37	103.11	1	50.00
31679.	winnifred (thepeppery_one)	2	101.84	104.44	1	50.00
31680.	Matthew (theoriginalbrick)	2	76.85	81.58	1	50.00
31681.	Daniel (theoretic)	2	127.18	129.76	1	50.00
31682.	Theodoros (theodoros_1234)	2	75.79	81.15	1	50.00
31683.	Nero (theneronex)	2	92.07	96.89	0	0.00
31684.	Brendan (themuppet)	2	80.97	82.69	0	0.00
31685.	Swiggity (themoleinator)	2	72.47	75.54	0	0.00
31686.	Garubles (themoistseacow)	2	89.48	91.58	2	100.00
31687.	TheMayoTyrant (themayotyran...	2	100.74	131.53	1	50.00
31688.	NaN (thelebdev)	2	118.06	122.67	2	100.00
31689.	Scott (theking55555)	2	109.46	113.09	1	50.00
31690.	Sagar (theidiotkingboi)	2	70.47	71.77	0	0.00
31691.	Rose (thehashparticle)	2	62.19	63.47	0	0.00
31692.	Kevin (theguyk)	2	80.77	84.17	0	0.00
31693.	the goat (thegoat420)	2	52.13	56.33	0	0.00
31694.	Sea (theglowingman)	2	95.91	109.25	0	0.00
31695.	Alex (thegamingalex)	2	72.93	73.21	1	50.00
31696.	thefalconeye (thefalconeye)	2	64.63	65.43	1	50.00
31697.	Duck (theduckracer)	2	69.44	74.95	1	50.00
31698.	Nick (thedragon252)	2	93.51	100.11	1	50.00
31699.	Thed (thedmango)	2	55.71	57.43	0	0.00
31700.	Dhanraj (thedan123)	2	55.99	61.93	0	0.00
31701.	Liam (thecodingboy)	2	94.41	98.72	0	0.00
31702.	fartmaster69 (theblacksword...	2	52.29	56.17	1	50.00
31703.	thebennies (thebennieswho)	2	59.24	60.27	0	0.00
31704.	DIlectrix (thebeast_typer)	2	77.63	77.85	2	100.00
31705.	Abhi (theabhster)	2	101.09	108.62	1	50.00
31706.	Erm (the7erm)	2	49.57	57.01	1	50.00
31707.	berbseedle (thatonebedsheet...	2	78.96	84.74	0	0.00
31708.	Thatisdifficult (thatisdiff...	2	91.03	95.26	1	50.00
31709.	Isaac (th54)	2	114.93	126.03	1	50.00
31710.	Cody (tfwarcry)	2	120.24	122.14	2	100.00
31711.	Tezz (tezzguru)	2	62.01	66.66	1	50.00
31712.	Terrance (terrance1120)	2	101.42	111.35	2	100.00
31713.	Termite (termite04)	2	84.94	103.60	1	50.00
31714.	Nik (teriki)	2	59.07	61.05	0	0.00
31715.	Tiago (teratogo)	2	41.87	43.61	0	0.00
31716.	Tenny (tennykim)	2	84.19	90.46	0	0.00
31717.	Dean (tennis2002)	2	85.28	96.35	1	50.00
31718.	Temir (temir248)	2	51.11	54.83	0	0.00
31719.	TelFiRE (telfire)	2	95.30	98.31	0	0.00
31720.	max (tekoh)	2	96.82	106.16	2	100.00
31721.	Justin (teeheeheeheehee)	2	108.83	110.04	2	100.00
31722.	Teddy (teddyb24)	2	58.47	59.84	2	100.00
31723.	Nick (technologicnick)	2	78.69	79.80	0	0.00
31724.	goofy (technicuwu)	2	76.09	80.55	0	0.00
31725.	Lee (tec001)	2	105.81	124.51	1	50.00
31726.	Taylor (tdogyhyh)	2	79.65	84.00	0	0.00
31727.	tch (tchstf)	2	119.15	122.81	2	100.00
31728.	Taylor Ray (taylorrayhoward)	2	85.05	88.76	0	0.00
31729.	TataraZ (tataraz)	2	72.98	80.52	1	50.00
31730.	Stephen (tape319)	2	98.48	100.17	1	50.00
31731.	Ryan (tamekaiyote)	2	66.66	74.95	0	0.00
31732.	shivam (tambourinetower)	2	73.53	80.00	1	50.00
31733.	Thanathas (tamasama077)	2	80.28	86.93	0	0.00
31734.	. (tamagobaka)	2	66.39	73.76	1	50.00
31735.	twickortweat (talkingbebuu)	2	70.65	75.44	0	0.00
31736.	ICE (talje)	2	69.64	71.82	0	0.00
31737.	talayracing (talayracing)	2	64.42	67.07	0	0.00
31738.	hanage (takeruokuyama)	2	56.28	56.67	0	0.00
31739.	Takio (takioarima)	2	91.23	99.94	0	0.00
31740.	humming (tajjyboyrutus)	2	90.72	95.35	0	0.00
31741.	Taiyo (taiyo1)	2	61.00	63.26	0	0.00
31742.	Tareque Hasan (tahsin24)	2	75.12	79.61	1	50.00
31743.	Taher (taher_c)	2	69.93	73.53	2	100.00
31744.	Taco (taco_salsa)	2	95.76	106.03	2	100.00
31745.	Tacos (tacosforthem)	2	104.91	106.34	2	100.00
31746.	Taryn (tabeldt)	2	73.14	80.45	0	0.00
31747.	slow account (tabbed)	2	90.80	93.12	0	0.00
31748.	Tim (t84nightfall)	2	63.89	71.43	0	0.00
31749.	Ted (t3ddybgam3)	2	68.42	70.87	0	0.00
31750.	t0xy47 (t0xy47)	2	100.15	102.04	1	50.00
31751.	Skywalker (szqskywalker)	2	76.34	85.91	0	0.00
31752.	szk3y (szk3y)	2	76.60	77.69	0	0.00
31753.	Zul (szeph)	2	60.29	62.61	2	100.00
31754.	Syazani (syazaniii)	2	51.40	54.45	0	0.00
31755.	Muh (syafwan000)	2	42.25	49.15	0	0.00
31756.	Andrew (swissarmyman)	2	96.83	104.85	1	50.00
31757.	Swerpy (swerpy)	2	56.36	60.22	1	50.00
31758.	d-Raww (swagtyper123)	2	140.93	147.11	1	50.00
31759.	Phi (surphi10)	2	76.23	80.42	0	0.00
31760.	surferdude (surferdudepr86)	2	82.52	85.40	0	0.00
31761.	SuperHyperbole (superhyperb...	2	81.70	86.14	2	100.00
31762.	sabir (supercypok)	2	49.04	52.70	0	0.00
31763.	Nicolas (supercarlover888)	2	76.50	85.73	1	50.00
31764.	#One More Year (supeer_heroo)	2	49.75	52.59	0	0.00
31765.	Spencer (sunflxwer9)	2	89.03	91.94	0	0.00
31766.	Garima (summerqueen15)	2	47.45	51.96	0	0.00
31767.	Brad (sulfernic)	2	90.29	90.96	0	0.00
31768.	Subodh (subodhk)	2	74.77	76.09	1	50.00
31769.	CircuitMoon (subhampal)	2	72.96	76.16	2	100.00
31770.	Gavyn (styxzee)	2	73.95	76.49	1	50.00
31771.	StsThorn (ststhorn)	2	122.87	124.81	2	100.00
31772.	[[ Stropion (stropion)	2	93.24	94.92	2	100.00
31773.	Aditya (strong91105)	2	56.57	63.10	2	100.00
31774.	Lev (straward)	2	54.52	58.30	0	0.00
31775.	Steven (stoveoveoven)	2	104.45	112.81	1	50.00
31776.	storpa (storpa26)	2	100.29	103.22	1	50.00
31777.	Darius (stormmate)	2	99.61	114.31	1	50.00
31778.	Ben (stormfalcon32)	2	115.40	121.86	1	50.00
31779.	Se (stopclimatechange)	2	124.38	125.81	2	100.00
31780.	Aleksa (stojke)	2	68.33	69.27	1	50.00
31781.	Steyl (steyl)	2	83.70	84.80	2	100.00
31782.	Stepman5 (stepman5)	2	85.48	85.81	0	0.00
31783.	manorosandy (ster_sandys)	2	44.68	47.09	1	50.00
31784.	Stephen (stephen_g19)	2	88.28	94.15	2	100.00
31785.	stefanijaya (stefanijayaa)	2	69.98	76.63	2	100.00
31786.	Skye (starrysky101)	2	54.81	55.56	0	0.00
31787.	Star (starplatypus)	2	57.91	58.23	1	50.00
31788.	Meowsiez (stanleyz4)	2	60.02	60.87	0	0.00
31789.	🤔 (stabilized)	2	80.80	91.34	0	0.00
31790.	Mirto (st4rb0y)	2	89.67	94.26	1	50.00
31791.	SSStealthy (ssstealthy)	2	41.55	43.79	1	50.00
31792.	spam (sspammy)	2	69.07	69.67	0	0.00
31793.	keystroker03 (sserium)	2	112.14	116.70	0	0.00
31794.	Sebastian (ssanso)	2	93.93	97.55	1	50.00
31795.	Srijonchi (srijonchi)	2	46.64	50.40	2	100.00
31796.	Eduardo (sr142898)	2	55.08	57.12	0	0.00
31797.	Squill (squill098)	2	106.22	108.85	2	100.00
31798.	Brandon (spudslayer1990)	2	68.47	75.67	2	100.00
31799.	Wilson (springmaple)	2	71.89	78.73	2	100.00
31800.	Grace (sprang1)	2	117.95	118.60	1	50.00
31801.	Rocky (spookiestmeme)	2	103.47	105.81	1	50.00
31802.	Nick (spirk)	2	89.09	98.01	1	50.00
31803.	hanuyoo (spicymiso)	2	80.09	91.98	1	50.00
31804.	PB (spic3)	2	89.61	100.97	2	100.00
31805.	Callmequick (spellings)	2	86.23	90.79	1	50.00
31806.	Daniel (speks97)	2	62.81	65.15	0	0.00
31807.	speedy (speedydemonguy)	2	100.03	108.57	2	100.00
31808.	edot (speedymandan)	2	105.62	106.46	2	100.00
31809.	Rohith (specialabyss6_)	2	63.64	65.74	0	0.00
31810.	Chaitanya (spcspeedracer)	2	81.69	84.26	0	0.00
31811.	Scott (spditsme)	2	73.90	79.06	0	0.00
31812.	Sparkils (sparkils)	2	78.04	79.00	0	0.00
31813.	Naloxone (spark89)	2	93.94	101.27	2	100.00
31814.	Soz (soz3177)	2	61.72	73.03	0	0.00
31815.	Sowri Raja Majeti (sowri)	2	70.12	75.23	0	0.00
31816.	Aditya (soulofshades)	2	79.77	79.89	0	0.00
31817.	Soulhae (soulhae)	2	104.96	122.30	0	0.00
31818.	Sorton101 (sorton101)	2	103.91	112.03	0	0.00
31819.	Soren (sorennoob)	2	112.35	118.24	1	50.00
31820.	Anthony (sora2848)	2	89.43	90.96	2	100.00
31821.	m!nji_ (sophai)	2	76.72	92.75	0	0.00
31822.	sonny (sonnyb_)	2	116.12	124.99	1	50.00
31823.	sonic (sonic_the_hedgehog_lol)	2	112.39	123.27	1	50.00
31824.	Brian (sonicf312)	2	76.73	80.38	1	50.00
31825.	Song (songjoon)	2	74.76	80.24	1	50.00
31826.	somrand (somrand)	2	65.40	69.97	1	50.00
31827.	Pikachu (someone_cool)	2	59.75	69.63	0	0.00
31828.	Matthew (solosice)	2	74.93	76.45	1	50.00
31829.	sojo (sojoyes)	2	120.43	123.41	2	100.00
31830.	Eman (sodium0112)	2	65.26	66.92	1	50.00
31831.	Socrates (socratesbatis)	2	86.08	89.03	0	0.00
31832.	Seraph (snowpenguin2)	2	118.01	119.13	1	50.00
31833.	Stephen (snivithefox)	2	101.00	101.12	1	50.00
31834.	Julia (sneakyjelly)	2	43.34	46.85	0	0.00
31835.	Snayne (snayne)	2	89.88	92.29	1	50.00
31836.	Snapdragon (snapdragonsounds)	2	110.08	110.90	1	50.00
31837.	Vigor (snakehater)	2	67.42	69.74	1	50.00
31838.	Joshua (snabic)	2	83.28	94.19	0	0.00
31839.	jer (slugbug2)	2	61.02	63.16	0	0.00
31840.	Fox (slowlightning)	2	103.44	111.18	1	50.00
31841.	chelz (slowcolt)	2	107.71	109.62	1	50.00
31842.	elp (slothisasin)	2	66.11	67.52	0	0.00
31843.	talia (sllvio)	2	83.94	88.99	2	100.00
31844.	Jake (slimypeanut)	2	86.80	89.20	2	100.00
31845.	slick (slickgogo)	2	70.32	73.67	2	100.00
31846.	David (slezterp)	2	105.30	139.13	1	50.00
31847.	Shane (slee23)	2	128.78	131.31	1	50.00
31848.	Jessica (slacker1998)	2	79.85	83.68	1	50.00
31849.	Gavin (sl0wnsteady)	2	55.49	55.53	0	0.00
31850.	Sky (skytheguyhigh)	2	76.09	78.02	2	100.00
31851.	Skourou (skourou)	2	35.53	40.94	0	0.00
31852.	Snowern (skiriius)	2	98.06	104.75	2	100.00
31853.	Sean (skimchi)	2	85.15	87.71	1	50.00
31854.	Nick (skillofnoob)	2	83.21	87.52	0	0.00
31855.	Lynn (skebi)	2	105.52	111.99	2	100.00
31856.	skaoakeboarder (skaoakeboar...	2	90.74	93.64	1	50.00
31857.	Febri (skafkas)	2	68.50	75.11	1	50.00
31858.	Sk (sk07)	2	77.62	78.07	1	50.00
31859.	julian Schwarz (sjd2042)	2	31.22	31.79	0	0.00
31860.	galt (siuto)	2	51.52	57.09	1	50.00
31861.	Yellow (siunam963)	2	104.61	104.90	2	100.00
31862.	s (siscari)	2	100.52	110.65	2	100.00
31863.	Green (sir_onion)	2	87.01	87.10	0	0.00
31864.	Sir (sirknight)	2	51.35	56.24	0	0.00
31865.	Ahmed (sirniceman)	2	38.28	40.97	2	100.00
31866.	David (sirlaser)	2	70.71	78.70	2	100.00
31867.	Angel (sireisenburgh)	2	74.38	74.82	1	50.00
31868.	Cahid Enes (sirceness)	2	82.55	85.35	0	0.00
31869.	Andrew (sirbobcat2836)	2	126.06	126.12	0	0.00
31870.	Blixenn17 (sinonion17)	2	60.05	61.01	0	0.00
31871.	Sinai (sinaifonseca)	2	45.01	46.20	0	0.00
31872.	simon (simon_racer)	2	84.43	84.71	0	0.00
31873.	Simon (simonk33)	2	59.08	61.67	0	0.00
31874.	Yasin (silznce)	2	69.01	70.94	0	0.00
31875.	Kyle (qwewqa)	2	100.35	103.30	2	100.00
31876.	vroom (silimisim)	2	92.63	105.13	1	50.00
31877.	Silvan (sili2000)	2	73.85	81.92	0	0.00
31878.	Ares (silentglare)	2	106.65	109.72	2	100.00
31879.	Damn (sigge200)	2	69.15	72.47	1	50.00
31880.	Siddhant (sids2k)	2	70.38	73.37	1	50.00
31881.	Siddiqjon (siddiqjonuz)	2	68.77	68.82	1	50.00
31882.	Siah (siahbautista)	2	72.15	77.93	1	50.00
31883.	Leonard (shutupleonard)	2	119.90	123.59	2	100.00
31884.	shufi (shufi2)	2	87.03	88.18	0	0.00
31885.	Shubham (shubham1428)	2	74.83	87.91	1	50.00
31886.	Shromeone (shromeone)	2	112.58	117.84	2	100.00
31887.	Japonizm (showhey0705)	2	82.18	92.30	0	0.00
31888.	shortrug (shortrug)	2	123.67	134.50	2	100.00
31889.	Krzyscs (shockacs)	2	75.17	79.11	0	0.00
31890.	Aiden (shmaiden)	2	49.55	50.34	0	0.00
31891.	Shlock07 (shlocktheshlock)	2	81.05	89.42	0	0.00
31892.	tstats[shishoro] (shishoro)	2	136.48	149.17	1	50.00
31893.	Kupo (shinymoogle)	2	114.56	114.85	1	50.00
31894.	Shinoto (shinoto)	2	50.46	54.16	0	0.00
31895.	Nick (shiningspark)	2	62.56	71.12	0	0.00
31896.	hyunho (shinesky0420)	2	73.74	78.46	1	50.00
31897.	shinchan (shinchan6nohara9)	2	66.76	68.97	1	50.00
31898.	shimona (shimonas)	2	99.80	106.94	1	50.00
31899.	Shibasis (shibasisp)	2	60.03	63.06	0	0.00
31900.	Sheena (shehoy19)	2	34.75	43.00	0	0.00
31901.	Shebes (shebes)	2	77.49	82.81	2	100.00
31902.	Maksim (shchmax)	2	42.41	47.22	2	100.00
31903.	Peemie (shdwrv)	2	103.69	108.61	0	0.00
31904.	Lamb (sharkk)	2	104.67	107.21	1	50.00
31905.	fcwaffles (shanice0427)	2	89.41	93.46	1	50.00
31906.	Shane (shanelyons1020)	2	70.37	73.89	1	50.00
31907.	idk (shaham1)	2	89.93	92.35	2	100.00
31908.	Shad (shad_psycho)	2	58.56	63.61	2	100.00
31909.	@imshdx_ (shadox999)	2	58.88	65.44	0	0.00
31910.	Daniel (shadebyte)	2	92.29	95.97	0	0.00
31911.	Seth (sethrhcp)	2	97.05	104.39	1	50.00
31912.	Sesame (sesamebagel)	2	86.24	91.10	2	100.00
31913.	Senyuu (senyuu)	2	113.43	118.31	1	50.00
31914.	Jack (senteran)	2	87.71	89.84	2	100.00
31915.	Jabez (senpaijabz)	2	79.36	79.56	1	50.00
31916.	Sen (senjaeger)	2	82.52	87.68	0	0.00
31917.	Chris (segunobunaga)	2	78.77	81.07	0	0.00
31918.	Seth (sefer)	2	57.94	60.07	1	50.00
31919.	seelan (seelan)	2	90.30	91.36	0	0.00
31920.	Sedao (sedaolicious)	2	90.60	92.37	1	50.00
31921.	Sebastian (sebiai)	2	49.74	54.67	0	0.00
31922.	ᕕ( ᐛ )ᕗ (sebastiuon)	2	113.80	117.77	0	0.00
31923.	seba (sebastianbie)	2	31.26	33.31	0	0.00
31924.	seabass (sebasawesome)	2	46.81	48.83	0	0.00
31925.	Seanpanpan (seanpanpan)	2	76.19	77.28	0	0.00
31926.	Seann (seanntastic)	2	87.27	93.61	2	100.00
31927.	seal (sealtypes)	2	90.02	94.48	2	100.00
31928.	A (sd_era)	2	69.09	71.86	0	0.00
31929.	Chan (sc_chan)	2	62.18	66.22	1	50.00
31930.	Rudra (sdes)	2	37.26	40.68	1	50.00
31931.	scxrpion (scxrpion)	2	74.87	86.74	1	50.00
31932.	Scuba (scubatank)	2	97.95	103.41	2	100.00
31933.	Majd (scrollchamp)	2	100.80	105.39	1	50.00
31934.	slam man (scriptyvevo)	2	66.06	70.19	0	0.00
31935.	Trihard (screwsps)	2	96.95	97.22	2	100.00
31936.	Gavyn (scoutpack151)	2	74.71	81.36	1	50.00
31937.	Scotty (scottypills)	2	123.31	126.96	2	100.00
31938.	Scoob (scooterscoob)	2	67.44	70.82	0	0.00
31939.	Save Gaza! (scisaif)	2	77.30	79.17	0	0.00
31940.	Michael (schuh98)	2	79.95	83.85	2	100.00
31941.	Dalton (schnoook)	2	91.23	92.63	0	0.00
31942.	Sebastian (schmiffy)	2	85.84	88.70	0	0.00
31943.	scalt (scalt)	2	89.53	103.07	0	0.00
31944.	sbie (sbie)	2	72.02	75.40	1	50.00
31945.	only quit (sberens)	2	96.70	107.69	1	50.00
31946.	Sazeraq (sazeraq)	2	93.83	97.50	0	0.00
31947.	Savitar (savitarramen)	2	105.21	107.26	0	0.00
31948.	Austin (sausie)	2	60.38	61.78	0	0.00
31949.	𝖘𝖆𝖙𝖗𝖙𝖒�...	2	87.63	94.32	1	50.00
31950.	Sarthak (sarthaksidhant)	2	48.10	49.41	2	100.00
31951.	Haris (sarakas)	2	49.51	49.53	0	0.00
31952.	Santiago (santicer06)	2	68.41	75.78	0	0.00
31953.	San (sanletem)	2	57.45	57.52	1	50.00
31954.	Sander (sandyon)	2	80.57	87.74	1	50.00
31955.	David (sandshrew4)	2	95.91	99.58	1	50.00
31956.	SandoBanjo (sandobanjo)	2	91.71	97.75	1	50.00
31957.	KFXSANDDLE (sandle)	2	159.72	168.17	2	100.00
31958.	Hasandi (sandipatriawan)	2	92.08	93.15	1	50.00
31959.	Sander (sandiboii)	2	48.30	48.40	0	0.00
31960.	Sander (sanderbot66)	2	108.31	113.44	0	0.00
31961.	Sandeep (sandeep_balachandran)	2	60.34	60.60	1	50.00
31962.	Sam (sam_staz)	2	67.09	70.32	0	0.00
31963.	Guest404 (sam_sapeol)	2	51.66	53.18	0	0.00
31964.	Sam (samstarfish2013)	2	80.66	83.88	2	100.00
31965.	joe (samoyeet)	2	96.35	99.82	0	0.00
31966.	Sam (samoc9549)	2	92.49	93.18	2	100.00
31967.	Jotaro (sammy82)	2	71.89	74.38	2	100.00
31968.	Samuel (sam9182)	2	53.81	54.23	1	50.00
31969.	SALTY (saltytap3)	2	69.96	71.39	0	0.00
31970.	Salted (salted_mangoes)	2	116.18	120.42	2	100.00
31971.	tstats[salahf5] (salahf5)	2	80.86	81.07	0	0.00
31972.	Marcin (sakyuz)	2	71.44	73.21	1	50.00
31973.	Broken (sakambagal_aba)	2	95.86	102.27	0	0.00
31974.	sajinator (sajinator)	2	65.48	69.42	1	50.00
31975.	sAjAn (sajansingh)	2	90.78	93.27	2	100.00
31976.	saizenG (saizen)	2	118.29	126.92	1	50.00
31977.	Venkatasai (saivenkata521)	2	59.12	61.67	0	0.00
31978.	Carlos (saint1124)	2	56.64	62.01	1	50.00
31979.	Saira (sairacraft)	2	93.76	94.07	0	0.00
31980.	Sam (saimbintalib)	2	49.17	58.94	0	0.00
31981.	HARDCORE (sailingboat)	2	107.01	112.58	1	50.00
31982.	sahil (sahilratra)	2	39.86	41.09	0	0.00
31983.	Marcus (safetymarcus)	2	97.03	103.61	1	50.00
31984.	jared (sadtom)	2	91.57	99.78	0	0.00
31985.	sadbanana (sadbanana0)	2	73.92	76.74	0	0.00
31986.	Zach (saccery)	2	63.16	63.94	2	100.00
31987.	saarim (saarim)	2	83.64	84.36	0	0.00
31988.	tstats[s2dent] (s2dent)	2	115.96	119.06	1	50.00
31989.	S (s2929)	2	91.81	98.05	2	100.00
31990.	Ethan (s1ip2r)	2	43.64	45.22	2	100.00
31991.	Rizky (rzkyog)	2	58.75	69.23	1	50.00
31992.	Ryu (ryu_00)	2	58.66	60.97	0	0.00
31993.	Rytis (rytux369)	2	46.98	49.31	1	50.00
31994.	Ryoma (ryomak)	2	105.74	112.90	1	50.00
31995.	Rygah (rygah)	2	124.25	145.27	1	50.00
31996.	Ryan (ryan_ng1234)	2	87.65	103.72	2	100.00
31997.	Ryan (ryan_dicenzo)	2	98.75	108.26	0	0.00
31998.	Ryan (ryannnnnnnnn)	2	81.01	81.22	1	50.00
31999.	Aquaris (ryankim834)	2	99.93	104.43	2	100.00
32000.	Alex (rxndom)	2	66.50	67.32	0	0.00
32001.	Juri (rvotaenota13)	2	28.30	30.13	1	50.00
32002.	Ryan (rvisich5)	2	96.33	98.89	1	50.00
32003.	Rutvij (rutvij2811)	2	59.73	60.64	0	0.00
32004.	Kayden (russiangangsta)	2	115.45	122.06	1	50.00
32005.	arTCap (rusaterbang01)	2	41.74	42.32	1	50.00
32006.	ruohola (ruohola)	2	70.58	75.19	1	50.00
32007.	Runa Peru (runaperu)	2	107.45	108.66	1	50.00
32008.	Harry (ruggers)	2	53.52	58.36	1	50.00
32009.	ruditheracer (ruditheracer)	2	48.78	52.76	0	0.00
32010.	William (rubrubmytubtub)	2	97.92	99.74	0	0.00
32011.	WowRobertisWinning (rtruong)	2	78.67	80.91	2	100.00
32012.	Gunnar (rs_gunny)	2	74.06	77.78	0	0.00
32013.	Rakha (rrsplay)	2	50.38	50.59	0	0.00
32014.	Rosa (rrosie1213)	2	101.64	107.21	2	100.00
32015.	Notsuo (rrhousti93)	2	50.39	53.85	2	100.00
32016.	rraei (rraei)	2	91.64	93.23	1	50.00
32017.	abi (rqizel)	2	54.15	55.35	0	0.00
32018.	rpbanker (rpbanker)	2	71.42	76.54	0	0.00
32019.	Joey (rosuoammdo)	2	104.66	107.66	0	0.00
32020.	rose (roseishot)	2	70.44	75.01	0	0.00
32021.	(rontran)	2	117.03	125.84	1	50.00
32022.	Roni (rondeexe)	2	52.65	56.63	0	0.00
32023.	Roizor (roizor)	2	102.09	110.58	2	100.00
32024.	Rohan (rohanrao)	2	94.64	98.98	1	50.00
32025.	Rohan (rohanr)	2	127.12	128.56	1	50.00
32026.	Dan (rock_god_dan)	2	77.32	80.25	1	50.00
32027.	Rockey (rockey_3)	2	83.68	88.82	1	50.00
32028.	rocket (rocketz)	2	52.22	53.62	0	0.00
32029.	cobrobdob (rocketjuice)	2	75.07	77.04	1	50.00
32030.	Kisara (rock125zz)	2	93.94	95.02	2	100.00
32031.	Kool (robozarp)	2	88.74	95.74	1	50.00
32032.	Jacob (robleroj76)	2	52.97	55.01	0	0.00
32033.	Robi (robi_trabl)	2	76.78	78.05	1	50.00
32034.	Robert - NFS (robert2345)	2	80.67	91.15	2	100.00
32035.	Ryan (roadrash09)	2	65.40	107.69	1	50.00
32036.	RoachLok (roachlok)	2	93.55	97.97	1	50.00
32037.	Ryji (rmccs)	2	53.43	59.28	0	0.00
32038.	Harsh Kumar Choudhary (rkcr...	2	49.91	55.88	0	0.00
32039.	rjlee (rjlee)	2	94.91	96.58	2	100.00
32040.	rizzRacer (rizz94)	2	66.63	68.99	0	0.00
32041.	Riverspirit (riverspirit)	2	124.81	138.61	1	50.00
32042.	rivo (rivayet)	2	61.81	63.56	0	0.00
32043.	Dan (rivalesque)	2	94.37	98.63	1	50.00
32044.	ritvik (ritvikrustagi)	2	122.54	127.69	2	100.00
32045.	Rito (rito_nsj)	2	98.17	98.68	1	50.00
32046.	Ring (ringtackyeet)	2	113.44	118.94	2	100.00
32047.	kabootar (rijaezahra)	2	80.12	80.67	2	100.00
32048.	Rıfat (rifguli)	2	61.94	67.41	2	100.00
32049.	Rieko (rieko)	2	91.69	99.53	2	100.00
32050.	RidThe (ridthetwoladders)	2	67.31	78.97	0	0.00
32051.	ricky (rickysingh)	2	38.80	40.20	0	0.00
32052.	snova (rickdiculous)	2	93.22	94.87	1	50.00
32053.	Eric (rickby)	2	97.75	100.48	1	50.00
32054.	richa (richa69)	2	92.95	96.49	1	50.00
32055.	Richard (ricehard)	2	73.87	75.66	0	0.00
32056.	rialagma (rialagma)	2	67.35	69.79	1	50.00
32057.	Joseph (rhubarbasia)	2	136.51	144.32	1	50.00
32058.	Teuku (rhazzdawg)	2	96.83	100.14	2	100.00
32059.	rez1 (rezoan90)	2	72.18	73.79	1	50.00
32060.	Ollie (revvylo)	2	108.30	116.79	0	0.00
32061.	Jonathan (reverbcs)	2	92.11	92.68	0	0.00
32062.	Rev (revcows)	2	81.61	91.98	0	0.00
32063.	kream (remmie2k)	2	135.57	135.65	1	50.00
32064.	Relay (relay5131)	2	74.71	75.98	0	0.00
32065.	Goose (reichmatthew)	2	71.09	71.33	1	50.00
32066.	Caleb (reflux2k)	2	71.05	75.35	1	50.00
32067.	Rushaan (redrush12)	2	54.05	59.19	0	0.00
32068.	Rederdex (rederdex)	2	61.91	64.66	0	0.00
32069.	Rory (redder_colemak)	2	112.18	119.13	2	100.00
32070.	Robyn (realtcc)	2	82.90	94.94	0	0.00
32071.	Realslow24 (realslow24)	2	41.47	42.72	0	0.00
32072.	Ryan (rcanete26)	2	73.74	78.23	0	0.00
32073.	andre (razukandre)	2	43.18	47.83	0	0.00
32074.	Ray (ray_maddox)	2	85.78	90.29	0	0.00
32075.	Raymond (raymo_nd)	2	96.79	99.35	0	0.00
32076.	Raymond (raymondrudman)	2	58.88	62.01	0	0.00
32077.	Rayf (rayfisfast)	2	122.13	139.51	1	50.00
32078.	RayDaren (raydaren)	2	65.73	75.19	0	0.00
32079.	noob (rayat)	2	82.82	88.39	1	50.00
32080.	Ravi (ravioliolioli)	2	70.82	75.37	0	0.00
32081.	Ravi (ravi15a)	2	113.85	118.39	2	100.00
32082.	Varshinee (raventhunderblac...	2	72.46	79.93	2	100.00
32083.	Toby (ratolp)	2	62.85	64.06	0	0.00
32084.	Rasul (rasulyakhyaev)	2	62.26	64.49	1	50.00
32085.	Jack (raspyspartan)	2	94.75	101.96	2	100.00
32086.	Rashen (rashen33)	2	54.16	59.02	0	0.00
32087.	raptor (raptor233)	2	44.09	55.92	1	50.00
32088.	Benimaru (raphieldropout)	2	98.51	103.73	0	0.00
32089.	Ranger (rangerelk76)	2	96.65	104.46	0	0.00
32090.	randy (randy022)	2	88.11	98.79	1	50.00
32091.	No (randomnamehere)	2	73.92	73.96	1	50.00
32092.	Dorothy (randomhoomanbean)	2	95.60	97.03	1	50.00
32093.	RandomDraco (randomdraco)	2	90.15	93.80	1	50.00
32094.	Jason (randombananazz)	2	85.01	88.91	0	0.00
32095.	Kiet (random22)	2	69.76	69.93	1	50.00
32096.	Mark (rampagingmoose)	2	71.29	71.44	0	0.00
32097.	hritik (raj_veer)	2	36.60	37.13	0	0.00
32098.	Rajput (rajput77)	2	43.15	46.36	0	0.00
32099.	Raikyryu (raikyryu)	2	121.36	129.54	2	100.00
32100.	Rahid (rahid_)	2	73.84	74.34	2	100.00
32101.	Rafael (rafmonster)	2	110.24	110.86	1	50.00
32102.	rafał (rafixxx)	2	55.81	62.98	1	50.00
32103.	Rafiq (rafiq)	2	58.07	67.75	0	0.00
32104.	Rafid (rafid2908)	2	43.11	46.71	0	0.00
32105.	Rafid (rafid20)	2	62.37	64.63	0	0.00
32106.	rafew (rafew)	2	41.05	43.89	0	0.00
32107.	Rafa (raffab)	2	44.30	45.21	0	0.00
32108.	Rafal (rafaldrath)	2	66.23	72.63	2	100.00
32109.	Rachel (rachelbug)	2	90.46	91.55	1	50.00
32110.	Alfred (racer421)	2	64.65	64.82	0	0.00
32111.	Spring (rabeeh97)	2	111.43	115.54	1	50.00
32112.	Kumar (r3dcherry)	2	75.01	76.09	0	0.00
32113.	Angu (r3dcamo)	2	52.85	53.32	0	0.00
32114.	reebad (r33bad)	2	81.17	88.99	2	100.00
32115.	R2bEEaton (r2beeaton)	2	94.38	98.77	0	0.00
32116.	Rohit (r1walz)	2	93.62	98.91	1	50.00
32117.	qwerty (qwertyuser3)	2	111.51	118.29	1	50.00
32118.	qwer (qwertyuiop232)	2	96.07	97.85	0	0.00
32119.	QwertyQurht (qwertyqurht)	2	40.32	45.08	2	100.00
32120.	Nikhil (qwertyiop56)	2	95.32	101.88	0	0.00
32121.	Alex (qwertyesque)	2	106.31	114.13	0	0.00
32122.	Qwerty (qwerty91994)	2	148.37	148.89	2	100.00
32123.	Kirsten (qupidd)	2	106.70	115.09	2	100.00
32124.	Quittance (quittance)	2	109.61	120.55	0	0.00
32125.	Enrique (quiquenrique)	2	88.09	91.93	0	0.00
32126.	Nikhil (quill_workman)	2	95.68	95.92	1	50.00
32127.	Jack (quertx)	2	85.46	90.04	0	0.00
32128.	Quan (quan_2003)	2	22.87	23.16	1	50.00
32129.	Synth (quantum88)	2	86.72	93.29	0	0.00
32130.	Aniket (quantom_)	2	52.97	55.08	2	100.00
32131.	Andrew (quantified_null)	2	83.63	85.80	0	0.00
32132.	nvmabotthat (quack_yena)	2	44.70	44.86	1	50.00
32133.	q (qtyps)	2	124.06	133.05	2	100.00
32134.	Audrey (pytho556)	2	89.83	92.61	2	100.00
32135.	Fiel (pyel)	2	60.17	65.97	0	0.00
32136.	Franco (pussay_wizard)	2	98.54	106.94	0	0.00
32137.	Alex (punksalot04)	2	70.20	71.05	0	0.00
32138.	Sushruth (punkin04)	2	65.55	69.75	1	50.00
32139.	Cohleen (pumpkingirl)	2	73.22	73.70	1	50.00
32140.	don (publicenemyxii)	2	46.51	54.68	0	0.00
32141.	Suzie (psychosuzie)	2	148.89	149.66	2	100.00
32142.	just bored (psychosam1337)	2	85.31	91.77	0	0.00
32143.	UNTiTLED (pshy0)	2	88.95	95.24	2	100.00
32144.	danny (protyperdanner)	2	88.51	89.89	0	0.00
32145.	Proton (proton_rizing)	2	88.41	96.64	0	0.00
32146.	ProGamerXDFTW (progamerxdftw)	2	104.85	125.47	2	100.00
32147.	John (procrastinator4life)	2	59.77	61.12	0	0.00
32148.	Predator (predator_01)	2	46.52	48.93	0	0.00
32149.	N (precised_aim)	2	64.47	72.83	1	50.00
32150.	Prakul (prax99)	2	67.30	67.92	1	50.00
32151.	Prateek (prateekp987)	2	78.38	83.09	2	100.00
32152.	Pranaya (pranaya989)	2	75.82	78.81	1	50.00
32153.	Peter (ppeett11)	2	35.53	37.12	0	0.00
32154.	Brian (powerraider064)	2	84.75	95.47	1	50.00
32155.	potter (potterwastaken)	2	54.61	57.60	0	0.00
32156.	Jonathan (potatowned)	2	95.25	112.00	0	0.00
32157.	Ronny (poseidonhk)	2	130.43	133.66	2	100.00
32158.	Pooky! (poooooky)	2	87.48	96.96	2	100.00
32159.	POOKR (pookr)	2	83.13	89.41	0	0.00
32160.	Big (pookpok)	2	103.60	107.76	1	50.00
32161.	kannon (poobear40)	2	71.51	72.86	0	0.00
32162.	Pongo (pongofant)	2	76.22	82.00	1	50.00
32163.	pong (pongix)	2	100.00	107.70	2	100.00
32164.	Aubergine (pomergenes)	2	95.99	96.33	2	100.00
32165.	Pablo (poloniusz)	2	56.74	61.96	1	50.00
32166.	Polla (pollaz1)	2	81.41	88.55	0	0.00
32167.	Pogchamp (poggerchamps)	2	93.78	94.48	1	50.00
32168.	Panupong (pnp__)	2	53.47	54.85	0	0.00
32169.	Vein (pluflmufn)	2	101.27	119.67	1	50.00
32170.	Plordpai (plordpai)	2	68.26	74.28	1	50.00
32171.	Al (plnit)	2	72.33	84.10	1	50.00
32172.	Dauan (plexxx)	2	69.94	74.05	0	0.00
32173.	Star (playnslay69)	2	92.21	95.34	2	100.00
32174.	Venus (planet_venus)	2	58.06	60.34	0	0.00
32175.	7 wpm (plaayer17)	2	129.69	132.20	1	50.00
32176.	Miki (pkong001)	2	92.29	97.38	2	100.00
32177.	Balazs (pkobeast)	2	92.58	96.02	0	0.00
32178.	andre (pizzamista)	2	83.57	87.02	2	100.00
32179.	Pirated (piratedkeyboard)	2	35.78	39.80	0	0.00
32180.	bruh (pirate22)	2	36.91	37.42	0	0.00
32181.	failure (pipy26)	2	69.53	78.53	2	100.00
32182.	aj (pinoy_cebu7)	2	66.15	67.91	0	0.00
32183.	Pink (pinkfluffyllama)	2	73.93	73.99	1	50.00
32184.	Chadin (pinghuskar)	2	36.74	38.85	0	0.00
32185.	Pineapple711 (pineapple711)	2	58.48	73.71	0	0.00
32186.	Alejandro (pimpsogreasy)	2	95.80	98.84	0	0.00
32187.	PimpSlapper (pimpslapper)	2	76.60	77.49	0	0.00
32188.	Seed (pikubu)	2	82.86	92.76	1	50.00
32189.	Mateo (pikksaar)	2	95.16	99.34	0	0.00
32190.	Pikakid (pikakid_twitch)	2	55.71	60.76	0	0.00
32191.	Pikachu (pikachutron3000)	2	135.24	142.16	2	100.00
32192.	Paul (piece408)	2	71.53	75.47	0	0.00
32193.	Gunner (pie621)	2	123.83	134.19	0	0.00
32194.	Reuben (phyterjet)	2	82.59	85.42	0	0.00
32195.	Jak (phrl)	2	83.77	84.70	1	50.00
32196.	Jacob (phlid)	2	87.93	91.78	1	50.00
32197.	Philos (philos_1)	2	70.99	77.50	2	100.00
32198.	Phillip (phillardb)	2	103.18	112.08	2	100.00
32199.	July (phi4069)	2	85.37	92.53	0	0.00
32200.	pgfunny124 (pgfunny124)	2	77.68	89.32	0	0.00
32201.	H.Y. (periodology)	2	58.46	61.54	1	50.00
32202.	pepe (pepesaiko)	2	135.78	147.73	2	100.00
32203.	PenguKeith (pengukeith)	2	60.00	64.77	1	50.00
32204.	PenguJ (penguj)	2	80.60	83.73	0	0.00
32205.	Penguin (penguint)	2	62.85	69.11	1	50.00
32206.	PenguiNerd1000 (penguinerd1...	2	86.98	104.19	1	50.00
32207.	Serhii (pemakhov)	2	47.69	48.30	0	0.00
32208.	James (peeetah1)	2	66.58	71.61	1	50.00
32209.	Aakash (pedulal123)	2	43.10	44.06	0	0.00
32210.	Pedrocas420 (pedrocas420)	2	47.85	48.32	0	0.00
32211.	pc1400 (pc1400)	2	103.16	109.01	1	50.00
32212.	Aris! (pazturized)	2	105.02	109.66	1	50.00
32213.	Shermill Roger (paybtawsan)	2	64.87	65.77	2	100.00
32214.	paully7 (paully7)	2	75.47	76.78	0	0.00
32215.	Andrew (patatoed)	2	93.35	99.47	0	0.00
32216.	Antunisia (part0tet0d0)	2	53.24	53.26	1	50.00
32217.	paraluman (paraluman)	2	77.13	80.80	0	0.00
32218.	c (paradoxalpen)	2	117.73	126.67	2	100.00
32219.	rujipas (paopeaw)	2	57.29	63.55	1	50.00
32220.	blake (pandashasjoinedthegame)	2	48.37	48.93	0	0.00
32221.	Justin (pancakemaster216)	2	71.43	74.35	0	0.00
32222.	panagiotis (pana23161)	2	73.12	75.22	0	0.00
32223.	Pavle (pajle)	2	107.02	108.22	0	0.00
32224.	Eric (paiement)	2	97.77	109.09	0	0.00
32225.	PacaJack (pacajack)	2	74.79	78.89	1	50.00
32226.	Player (p1ayer_two)	2	98.68	103.94	1	50.00
32227.	Josh (p0mm)	2	101.57	113.17	2	100.00
32228.	Michael (ozquez)	2	46.76	50.87	0	0.00
32229.	Kori (oxymoronictruth)	2	90.61	92.97	2	100.00
32230.	Owl (owlhidepants)	2	89.51	95.97	1	50.00
32231.	Owen (owen5560)	2	113.26	125.98	2	100.00
32232.	🇧🇬️(⌐■_■) �...	2	48.78	51.76	0	0.00
32233.	SheepManiac (oversnyper)	2	76.14	80.93	1	50.00
32234.	Ainsley (outree)	2	60.82	61.86	1	50.00
32235.	typeO (otaku_ish)	2	84.56	91.26	0	0.00
32236.	ossama (oss123)	2	44.03	44.57	0	0.00
32237.	Stricky (oscar_foxtrot)	2	54.72	55.76	2	100.00
32238.	Oromis (oromis1)	2	113.63	115.04	2	100.00
32239.	OrneryCash (ornerycash)	2	57.60	60.17	1	50.00
32240.	iOrange (orangec)	2	75.30	77.45	0	0.00
32241.	orainchy (orainchy)	2	60.00	61.95	1	50.00
32242.	Filip (opticalswitches)	2	73.69	74.43	0	0.00
32243.	Alfred (opoy)	2	68.00	69.85	1	50.00
32244.	Albert (oomydoomers)	2	135.25	151.67	2	100.00
32245.	oomikeyboy (oomikeyboy)	2	94.93	95.72	1	50.00
32246.	reda (oncelearner)	2	46.49	50.81	0	0.00
32247.	Onat (onatozer)	2	57.43	57.89	1	50.00
32248.	Speed (omotola2004)	2	88.59	90.75	1	50.00
32249.	omejeyo (omejeyo)	2	97.79	106.50	1	50.00
32250.	Hao (omegazz)	2	126.71	128.14	1	50.00
32251.	Omar (omarmoralesjr810)	2	76.94	82.95	1	50.00
32252.	Nacio (olivier066)	2	90.64	99.95	1	50.00
32253.	Ole Bendik (olebanan)	2	60.58	62.06	0	0.00
32254.	Regular Plumbus (oldplumbus)	2	76.64	78.36	0	0.00
32255.	Yuklin (okinashii)	2	56.36	57.77	0	0.00
32256.	Oliver (okay_google)	2	47.77	52.42	0	0.00
32257.	Patrik (oishinek)	2	73.98	75.70	0	0.00
32258.	K (ohkat__)	2	90.34	94.16	0	0.00
32259.	Beebo (ohbeebo)	2	57.13	58.06	0	0.00
32260.	Odyn (odynlol)	2	102.49	110.92	0	0.00
32261.	odie (odiemoley)	2	109.00	117.05	0	0.00
32262.	odelll (ode_qwerty)	2	73.15	75.09	0	0.00
32263.	Octavian (octavianb)	2	49.71	51.42	0	0.00
32264.	OCD (ocdonedid)	2	59.32	64.78	0	0.00
32265.	Zach (obeiah)	2	71.99	84.77	0	0.00
32266.	「 n e X u s 」 ム (n_e_...	2	76.00	79.91	1	50.00
32267.	(◠‿◠✿) (nyafuu)	2	101.67	101.78	2	100.00
32268.	DK (nwbpwn9000)	2	60.79	62.87	1	50.00
32269.	MUHD (nvzvn)	2	33.98	34.65	0	0.00
32270.	nurse (nurse1)	2	123.79	124.13	2	100.00
32271.	R (nuoiea)	2	113.62	118.66	1	50.00
32272.	null (null_zjx)	2	74.95	79.41	1	50.00
32273.	nubby (nubbydawg)	2	72.79	76.98	1	50.00
32274.	Daniel (ntc1337)	2	53.00	53.80	2	100.00
32275.	Karan (no_one_special)	2	61.94	66.22	1	50.00
32276.	Lauri (nozlate)	2	84.62	87.54	1	50.00
32277.	shieru (nowelz)	2	54.63	69.27	2	100.00
32278.	Nova (nova_6178)	2	54.29	58.82	0	0.00
32279.	Aaron (novacado)	2	94.96	96.72	0	0.00
32280.	nougatsoup (nougatsoup)	2	85.30	86.75	0	0.00
32281.	Rocco (not_that_great)	2	83.43	85.39	0	0.00
32282.	Evan (notrabe)	2	85.42	86.44	0	0.00
32283.	Notis (notkatsa)	2	80.21	87.97	1	50.00
32284.	North (northtm)	2	64.43	75.75	0	0.00
32285.	NorthernNinja (northernninj...	2	85.86	86.64	1	50.00
32286.	Cinema (northernblues)	2	57.11	58.56	0	0.00
32287.	Nop (nopdop)	2	55.65	56.28	1	50.00
32288.	안녕하세요 (noogie13)	2	123.39	126.41	0	0.00
32289.	Noodle (noodle_master)	2	97.82	109.41	1	50.00
32290.	Oliver (noodle3)	2	109.25	111.45	2	100.00
32291.	Noobmau (noobmau)	2	66.90	71.70	0	0.00
32292.	Vinay (noob101098)	2	44.63	45.53	1	50.00
32293.	Slow (noob)	2	118.58	120.23	0	0.00
32294.	Atharva (non_geniosity)	2	94.80	97.10	0	0.00
32295.	MYMANIA (nongaim123)	2	48.32	55.47	0	0.00
32296.	Daniel (nomnomdaniel)	2	128.54	130.25	1	50.00
32297.	Nolie65 (nolie65)	2	109.27	124.05	1	50.00
32298.	Mythknight (nolfwin)	2	108.53	109.11	1	50.00
32299.	Nolan (nolan_f)	2	86.60	92.77	2	100.00
32300.	kax (nobodyl0vesme)	2	105.79	110.55	1	50.00
32301.	Noah (noah_o_n)	2	138.03	139.85	0	0.00
32302.	Noah (noahebe)	2	85.61	102.36	1	50.00
32303.	Nithish Kumar (nithish20)	2	63.34	64.51	0	0.00
32304.	nishank (nish4nk)	2	42.46	44.56	0	0.00
32305.	nirav (niravkaka)	2	47.39	53.16	0	0.00
32306.	aeris (nintendou)	2	61.89	64.57	2	100.00
32307.	bliss (ninjakk)	2	114.36	119.45	2	100.00
32308.	Shourya (ninja1918)	2	52.83	56.19	0	0.00
32309.	Nínive Letícia (ninive_le...	2	50.20	50.61	1	50.00
32310.	Periwinkle (niknik2121)	2	91.83	104.99	0	0.00
32311.	✧･ﾟ: * Kiks (nikki338)	2	46.05	46.26	0	0.00
32312.	NikBlox (nikblox)	2	57.76	61.36	1	50.00
32313.	Mohd (nihal2193)	2	77.45	77.79	1	50.00
32314.	NightOwl (nightowl2312)	2	145.63	151.52	2	100.00
32315.	Madison (nightlight17)	2	80.19	85.06	1	50.00
32316.	Nicu (nicuyay)	2	51.99	57.48	0	0.00
32317.	Nicole (nicolemt)	2	117.96	119.05	1	50.00
32318.	Nick (nickstar96)	2	92.23	94.12	1	50.00
32319.	Nick (nickoftime146)	2	122.86	127.35	1	50.00
32320.	Cole (nickocado)	2	99.05	99.19	0	0.00
32321.	Nick (nickh789)	2	77.72	84.68	2	100.00
32322.	Nick (nick12342)	2	101.04	114.04	1	50.00
32323.	Nicediceroll (nicediceroll)	2	57.71	61.65	0	0.00
32324.	Nissan (ni554n)	2	68.81	70.96	1	50.00
32325.	cimsunf (nhtai)	2	82.95	84.32	1	50.00
32326.	ngmhh (ngmh)	2	98.44	100.25	0	0.00
32327.	Cogan (ngcogan)	2	121.77	130.19	2	100.00
32328.	Isaac (newtion)	2	105.68	110.40	1	50.00
32329.	Newtan (newtan)	2	87.38	97.50	1	50.00
32330.	neuralscatted (neuralscatte...	2	96.26	100.34	1	50.00
32331.	Nessie (nessie14)	2	66.55	71.30	0	0.00
32332.	Hal (nerus)	2	97.88	102.71	1	50.00
32333.	Dee (nerdie_)	2	64.17	70.88	0	0.00
32334.	Brayden (nerbray)	2	47.18	47.69	0	0.00
32335.	Steve (nepets)	2	31.41	34.90	0	0.00
32336.	Neeschal (neeschal)	2	46.78	51.25	0	0.00
32337.	attractive monkey (necr01337)	2	61.85	64.63	1	50.00
32338.	Nave (naveboy34)	2	85.70	111.18	0	0.00
32339.	Liam (nattilife)	2	114.41	121.08	2	100.00
32340.	Nashpotato (nashpotat0)	2	86.02	86.63	1	50.00
32341.	Hsu (naruto60509)	2	71.97	83.02	2	100.00
32342.	Dejan (narandza)	2	71.42	73.76	1	50.00
32343.	Billie (nappy2000)	2	88.51	97.93	0	0.00
32344.	Nape (nape_)	2	82.38	84.14	0	0.00
32345.	Nam (namtran1205)	2	38.72	40.98	0	0.00
32346.	Namaztak (namaztak)	2	45.32	52.06	0	0.00
32347.	le (nail123)	2	69.88	76.95	1	50.00
32348.	alaon (nahbro123)	2	104.59	113.05	1	50.00
32349.	Joseph (nagster12)	2	64.36	65.36	1	50.00
32350.	Nadun (nadunys)	2	58.58	61.31	1	50.00
32351.	Christian (nadesuke)	2	79.10	86.56	0	0.00
32352.	Andrew (n3r3z)	2	35.94	36.93	0	0.00
32353.	Sang (m_sang)	2	49.24	53.65	0	0.00
32354.	James (mysticalentity)	2	76.78	77.61	0	0.00
32355.	Mykola (mykolatkachuk1231)	2	45.31	47.30	0	0.00
32356.	Рамеш від'я (myguy...	2	77.48	80.41	2	100.00
32357.	eljugadormejor (mxntal)	2	87.43	97.49	1	50.00
32358.	r.mzl (muzzzle)	2	98.55	109.67	2	100.00
32359.	Musty (muysty)	2	75.48	84.18	1	50.00
32360.	Lucas (mutenow)	2	92.73	101.27	1	50.00
32361.	PassionPanda (mustangpanda)	2	91.45	102.26	0	0.00
32362.	Mustafa (mushy_)	2	74.76	84.97	1	50.00
32363.	Jamal (murrsielago)	2	111.19	113.43	0	0.00
32364.	Cyka (murdocisgod2004)	2	69.92	70.96	0	0.00
32365.	Meredith (murdith)	2	83.21	90.45	0	0.00
32366.	Kirk (murb_)	2	107.22	111.81	2	100.00
32367.	muhsenG (muhseng)	2	54.56	57.20	1	50.00
32368.	Mubaarak (mubaarak_199)	2	40.78	47.92	0	0.00
32369.	Déádlý (muandmj)	2	58.59	64.02	1	50.00
32370.	Matthew (mttw)	2	77.68	83.43	1	50.00
32371.	mtj (mtj420)	2	67.32	71.30	2	100.00
32372.	MstrCoconut (mstrcoconut)	2	70.64	73.42	1	50.00
32373.	TC (mstngt)	2	102.26	106.39	1	50.00
32374.	M Stew (mstew354)	2	109.84	114.56	0	0.00
32375.	Muhammad Shobuz (mr_uranus)	2	45.16	51.96	0	0.00
32376.	Tommy (mr_max_dog)	2	64.57	71.99	2	100.00
32377.	Choon (mr_krab)	2	65.84	69.98	0	0.00
32378.	MrBoombastic (mr_boombaastic)	2	80.04	82.87	0	0.00
32379.	white (mrwhiteee)	2	113.57	113.78	2	100.00
32380.	T (mrtvigs)	2	59.34	62.13	1	50.00
32381.	Kevin (mrtrololo)	2	114.17	124.42	2	100.00
32382.	MrSteal (mrstealyospam)	2	78.04	87.55	1	50.00
32383.	Mike (mrskopelos27)	2	73.44	77.58	1	50.00
32384.	Julien (mrroy3)	2	100.97	101.79	0	0.00
32385.	Joseph (mrpuffels)	2	79.19	88.15	1	50.00
32386.	mrklein (mrklein)	2	81.75	91.14	2	100.00
32387.	mrid13211 (mrid1321)	2	85.12	97.02	2	100.00
32388.	@frn.fz (mrgumball)	2	101.70	107.13	2	100.00
32389.	Mr. (mrgoldenball)	2	63.06	63.23	1	50.00
32390.	Ian (mrfro)	2	69.82	77.73	1	50.00
32391.	Ryder (mrdrumsuno)	2	110.71	111.73	1	50.00
32392.	ur (mrchubbypancake)	2	41.84	41.90	0	0.00
32393.	Michel (mraskin)	2	68.09	69.53	0	0.00
32394.	Mason (mpk072)	2	53.44	55.23	1	50.00
32395.	Mo. (mo_rehan24)	2	86.15	89.33	1	50.00
32396.	Free Palestine (mo_dodo)	2	49.97	54.78	1	50.00
32397.	Kelly Blows Doods (moyyom2)	2	121.16	127.66	1	50.00
32398.	H. (mousegeek)	2	101.45	103.53	1	50.00
32399.	Minn Swan (motherlovesyou)	2	115.10	117.75	0	0.00
32400.	Ben (mossdeep)	2	90.32	97.49	1	50.00
32401.	mosharaf (mosharaf)	2	54.27	55.01	0	0.00
32402.	Biscuitised (morgan221)	2	58.07	59.85	0	0.00
32403.	Josh (mophii)	2	78.63	80.11	1	50.00
32404.	Warut (moowarut)	2	72.01	73.66	0	0.00
32405.	Dan (moochookaboo)	2	96.09	107.91	1	50.00
32406.	Montgomery (montgomery_oppe...	2	62.10	64.34	0	0.00
32407.	tstats[MonsterTaco] (monste...	2	107.64	118.53	2	100.00
32408.	Eldiar (monoluntik)	2	32.81	34.20	0	0.00
32409.	Monkey (monkeydee)	2	94.37	105.83	1	50.00
32410.	Francisco (mondragon2424)	2	78.32	78.47	1	50.00
32411.	smalkauzkoda (monarchist)	2	111.02	111.18	1	50.00
32412.	CreepySusie (mole22)	2	82.61	83.99	2	100.00
32413.	Mok (mokmoon)	2	138.35	146.30	0	0.00
32414.	Margulan (mokarelol)	2	43.40	47.22	0	0.00
32415.	Toon (mojohamz)	2	91.61	100.25	1	50.00
32416.	Mohit (mohit_singhal)	2	60.39	65.48	0	0.00
32417.	mohi (mohiri)	2	91.48	97.41	1	50.00
32418.	mohammad (mohammad_aub_1_9_...	2	44.12	48.71	0	0.00
32419.	Mohammad (mohammadkh)	2	47.68	49.74	0	0.00
32420.	Scott (mogyoon)	2	78.42	81.01	0	0.00
32421.	Ramit Inmah (moe_lester69_420)	2	99.05	101.64	0	0.00
32422.	Will (mockingod)	2	113.97	120.31	0	0.00
32423.	Joe (mobinman69)	2	121.90	123.62	2	100.00
32424.	Type (mm66)	2	86.04	88.54	1	50.00
32425.	Manthan (mkp28082003)	2	40.76	43.33	0	0.00
32426.	mko908 (mko908)	2	97.57	111.04	1	50.00
32427.	Matthew (mk07320)	2	99.84	111.60	2	100.00
32428.	Jermaine (mj_procuber)	2	81.69	85.03	0	0.00
32429.	Fearless (mjsuriya)	2	64.36	64.60	0	0.00
32430.	Minh (mjnhpzo)	2	65.45	66.53	0	0.00
32431.	Brown Bear (mjcortz)	2	98.47	104.24	2	100.00
32432.	Mitoyaa (mitoromu_)	2	67.36	69.26	0	0.00
32433.	Shaan (mitnick)	2	53.64	58.68	0	0.00
32434.	Joshua (mis_hurd)	2	62.27	64.36	0	0.00
32435.	Alex (mistaman10)	2	69.45	73.89	0	0.00
32436.	Rey (misscypher)	2	52.04	52.85	1	50.00
32437.	Cliff (misfortunes)	2	92.31	92.47	0	0.00
32438.	Danny (minwoo7690)	2	78.61	80.84	1	50.00
32439.	Mint (mintalchemist)	2	98.93	100.88	1	50.00
32440.	Mino (minoaslowtyper)	2	65.45	68.09	1	50.00
32441.	Minimatrix (minimatrix)	2	38.99	40.57	0	0.00
32442.	miniman1706 (miniman1706)	2	81.49	85.05	2	100.00
32443.	Samuel (minikloon)	2	133.33	141.16	1	50.00
32444.	Kay (miniaturepenguin)	2	122.94	127.77	1	50.00
32445.	minh huu (minhhuudoan)	2	57.35	60.58	1	50.00
32446.	MinetasticAR (minetasticar)	2	66.33	74.67	0	0.00
32447.	MindstormL (mindstorml)	2	95.74	106.95	1	50.00
32448.	Mina (minajacob)	2	59.81	64.77	0	0.00
32449.	fat ape (miltox)	2	105.13	113.06	2	100.00
32450.	Tin Pham (milkshake69)	2	79.45	81.87	0	0.00
32451.	Mile161 (mile161)	2	76.40	79.30	0	0.00
32452.	Mikhail (mikhail0620)	2	101.87	102.62	0	0.00
32453.	mikey (mikelikes)	2	85.49	98.79	0	0.00
32454.	mike (mike017)	2	63.17	66.02	1	50.00
32455.	midi (midija)	2	100.30	110.10	1	50.00
32456.	Michelangelo (michelangeio)	2	82.23	92.07	0	0.00
32457.	michael (michaelma)	2	80.47	81.20	0	0.00
32458.	Michael (michaelcox)	2	63.51	66.50	0	0.00
32459.	Micey (miceymyc)	2	43.19	45.11	2	100.00
32460.	Reckful RIP (micbee)	2	78.79	78.94	0	0.00
32461.	Mia (miadotcx)	2	101.76	102.70	0	0.00
32462.	Chatchai (mhoblack)	2	33.97	36.52	0	0.00
32463.	Martin (mfp02639)	2	83.48	114.22	1	50.00
32464.	Destory (mexicanpikeman)	2	115.43	120.91	1	50.00
32465.	Domo (mewto012)	2	78.42	80.88	1	50.00
32466.	Mew. (mewddth)	2	57.84	62.00	1	50.00
32467.	Meta (meta_x0)	2	15.71	23.01	1	50.00
32468.	Erik (merkinmeerkats)	2	113.57	125.16	1	50.00
32469.	g (merelymyself)	2	84.40	85.98	1	50.00
32470.	Tsukasa@dvorak (melot)	2	139.30	141.07	2	100.00
32471.	Julia (melonclementine)	2	70.05	73.84	0	0.00
32472.	Mel (mel7)	2	49.51	56.10	2	100.00
32473.	Megan (megy147)	2	84.63	85.78	1	50.00
32474.	Megu (meguminayaya)	2	68.76	78.46	2	100.00
32475.	Manny (mefinitelydanny)	2	110.18	114.89	2	100.00
32476.	Peter (meffisto420)	2	95.38	97.36	2	100.00
32477.	Meep (meeeep)	2	122.18	126.52	0	0.00
32478.	Alex (medalions)	2	69.12	80.47	1	50.00
32479.	Pang (meavel)	2	46.22	49.70	0	0.00
32480.	meandblackie (meandblackie)	2	96.03	100.44	1	50.00
32481.	Mohammad (mdunicorn)	2	65.22	67.04	0	0.00
32482.	William (mdracer)	2	61.30	65.18	0	0.00
32483.	Mcpizzaz (mcpizzaz)	2	67.66	69.58	0	0.00
32484.	maya (mclo)	2	73.20	81.67	0	0.00
32485.	Laurits (mclawrence)	2	90.25	94.98	0	0.00
32486.	Zo (mckinnie6245)	2	47.13	49.33	0	0.00
32487.	Moe (mbillah4797)	2	89.71	90.30	0	0.00
32488.	mayarixx (mayarixx)	2	82.51	84.31	0	0.00
32489.	Mark (max_2027_67)	2	80.68	81.15	1	50.00
32490.	Max (maxkillas)	2	69.62	72.78	2	100.00
32491.	maximo (maximoc04)	2	40.85	41.45	0	0.00
32492.	Farhan (maximaximaxi)	2	78.35	80.62	0	0.00
32493.	matyus (matyus)	2	81.63	81.76	0	0.00
32494.	Matthew (matt_dj)	2	89.24	89.39	0	0.00
32495.	matt (mattyyc)	2	84.28	86.58	1	50.00
32496.	Matthew (mattpeles)	2	128.87	130.90	0	0.00
32497.	Matthew (matt15151)	2	72.09	89.53	1	50.00
32498.	Matija (matija564)	2	60.00	62.20	1	50.00
32499.	matt (mathster09)	2	97.26	106.65	0	0.00
32500.	Haydn (mathlobster)	2	96.48	97.28	0	0.00
32501.	mathbook (mathbookpeace)	2	61.00	64.35	0	0.00
32502.	. (matetea)	2	85.85	88.40	1	50.00
32503.	Master (master_gossip)	2	56.79	58.82	0	0.00
32504.	Sergi (maspi)	2	60.85	61.29	0	0.00
32505.	marvelousman (marvelousman)	2	94.85	102.81	1	50.00
32506.	Maru (maruuu)	2	96.29	100.53	0	0.00
32507.	Martin (martin12249)	2	70.39	72.85	0	0.00
32508.	A (martian098)	2	70.25	70.83	1	50.00
32509.	Rajat (marklegan)	2	25.15	25.37	0	0.00
32510.	Mark (markidak)	2	83.57	99.47	0	0.00
32511.	Mark (markieisfast)	2	91.00	102.98	0	0.00
32512.	Marius (mariusbucur)	2	115.15	119.76	2	100.00
32513.	M (marinater)	2	70.02	73.39	1	50.00
32514.	Marcus (marcuseon)	2	84.90	86.40	1	50.00
32515.	Kristoffer (marcusaurelius99)	2	53.69	53.82	0	0.00
32516.	Marc Owen (marcowen20)	2	92.78	95.89	0	0.00
32517.	Marco (marcov641)	2	44.36	47.38	0	0.00
32518.	Marcos (marcos100)	2	67.73	73.60	0	0.00
32519.	Marcop (marcop_)	2	46.96	47.06	0	0.00
32520.	Marcus (marcmadd15)	2	91.92	97.56	1	50.00
32521.	Chutney 🏹 (marchtovalinor)	2	102.26	106.45	1	50.00
32522.	Marathon (marath0ngaming)	2	125.58	137.87	2	100.00
32523.	Manvir (manvir)	2	124.93	128.62	2	100.00
32524.	Emmanuel (manye)	2	80.32	85.86	2	100.00
32525.	Patrick (manualsearch)	2	95.77	96.58	1	50.00
32526.	Anthony (mantipula)	2	118.91	120.00	0	0.00
32527.	MANOJ Kumar (manoj_ku_rao)	2	27.78	31.62	0	0.00
32528.	Manny (manny_rm)	2	115.17	138.62	1	50.00
32529.	manikanta (manikanta35231)	2	46.95	48.58	0	0.00
32530.	Alexis (mang_)	2	50.98	52.64	1	50.00
32531.	gabriel (mangamole)	2	43.58	43.78	0	0.00
32532.	Brian (scorpyyy)	1	112.35	112.35	0	0.00
32533.	Scooby (scoobydoo0919)	1	82.99	82.99	0	0.00
32534.	Christopher (scizsors)	1	69.85	69.85	0	0.00
32535.	Nick (scienceman57)	1	75.73	75.73	0	0.00
32536.	Rodrigo (schoofielddawg1476)	1	51.16	51.16	0	0.00
32537.	Declan (schnup7)	1	55.68	55.68	1	100.00
32538.	⊂( ▀ ͜͞ʖ▀)つ (sch...	1	66.86	66.86	0	0.00
32539.	lol (scdwcd)	1	96.39	96.39	0	0.00
32540.	Scarrrz (scarrrz)	1	101.61	101.61	0	0.00
32541.	LivewireHush (scarlet_static)	1	81.48	81.48	0	0.00
32542.	Scalion (scalion)	1	57.42	57.42	0	0.00
32543.	Scadeer (scadeer)	1	60.05	60.05	1	100.00
32544.	sb (sb_unoriginal)	1	118.95	118.95	1	100.00
32545.	Kyle (sbm66)	1	93.08	93.08	0	0.00
32546.	Semyon (saymon211)	1	58.98	58.98	0	0.00
32547.	Saynon (saynon)	1	82.74	82.74	0	0.00
32548.	Cochet (saucyzzzz)	1	71.93	71.93	1	100.00
32549.	Vroom (saucypringle)	1	98.87	98.87	0	0.00
32550.	Andy (saucycedo)	1	88.20	88.20	1	100.00
32551.	satvik (satvikp)	1	47.91	47.91	0	0.00
32552.	🪐 (saturnus3)	1	77.19	77.19	0	0.00
32553.	Sabbir Ahmed Talukdar (sats...	1	10.18	10.18	0	0.00
32554.	Bart (satancat)	1	59.44	59.44	0	0.00
32555.	M (sasoriza)	1	113.24	113.24	1	100.00
32556.	sasolisa (sasolisa)	1	21.72	21.72	1	100.00
32557.	Alexandra (sashoela)	1	106.67	106.67	0	0.00
32558.	Sasa (sasamaster)	1	84.02	84.02	0	0.00
32559.	Sarthak (sarthak_dms)	1	45.47	45.47	0	0.00
32560.	Sarp (sarpo5512)	1	51.94	51.94	1	100.00
32561.	sarmasar (sarmasar)	1	61.19	61.19	1	100.00
32562.	sara (sarafeizyab)	1	35.42	35.42	0	0.00
32563.	Sara (saraakre)	1	94.23	94.23	0	0.00
32564.	sara (saraafr)	1	29.21	29.21	0	0.00
32565.	Sapnil (sapnil9)	1	65.26	65.26	0	0.00
32566.	CJ (sansaic)	1	100.54	100.54	0	0.00
32567.	Sannas (sannas)	1	120.89	120.89	1	100.00
32568.	Sanket (sanket30016)	1	78.63	78.63	0	0.00
32569.	Sanji (sanjiwatsuki)	1	143.97	143.97	1	100.00
32570.	Sambhav (sam_b_hav)	1	71.74	71.74	0	0.00
32571.	Sam (sam_0)	1	44.74	44.74	0	0.00
32572.	SamYouL (samyoul)	1	91.92	91.92	0	0.00
32573.	ZER039 (samyak039)	1	58.66	58.66	0	0.00
32574.	Samuel (samuel86)	1	109.85	109.85	1	100.00
32575.	Sammy (sammyaxel)	1	82.86	82.86	0	0.00
32576.	sam (samb2006)	1	57.61	57.61	0	0.00
32577.	Akshay (salty_nacho)	1	55.71	55.71	0	0.00
32578.	shane jus like that (sally_...	1	43.95	43.95	1	100.00
32579.	Sam (salinko)	1	68.33	68.33	0	0.00
32580.	P (salbeitee)	1	44.32	44.32	0	0.00
32581.	Sakko (sakko_)	1	45.15	45.15	0	0.00
32582.	S (saifxhatem)	1	142.11	142.11	1	100.00
32583.	PlanckPractice (sage_of_stu...	1	89.19	89.19	0	0.00
32584.	S (saga_db)	1	63.30	63.30	0	0.00
32585.	sages (sagesss)	1	76.62	76.62	1	100.00
32586.	sage (sage78)	1	99.97	99.97	1	100.00
32587.	sadsal12 (sadsal12)	1	27.86	27.86	0	0.00
32588.	sadra (sadraaa)	1	33.64	33.64	0	0.00
32589.	Sadiuh (sadiuh)	1	112.02	112.02	1	100.00
32590.	Sabyasachi (sabyasachi_048)	1	55.20	55.20	0	0.00
32591.	Sabrina (sabrinastangler)	1	115.51	115.51	0	0.00
32592.	Saaho (saaho)	1	24.24	24.24	0	0.00
32593.	j0 (s4ltys34l)	1	79.42	79.42	1	100.00
32594.	S1 (s1s1s1)	1	164.65	164.65	1	100.00
32595.	rylzu (rylzu)	1	106.61	106.61	1	100.00
32596.	Ryan (ryguyd505)	1	102.44	102.44	1	100.00
32597.	joi (ryerice)	1	42.76	42.76	0	0.00
32598.	Ryder (ryderodonnell)	1	56.92	56.92	0	0.00
32599.	Ryan (ryantanglikesmath)	1	108.44	108.44	0	0.00
32600.	ryan (ryanleung1029)	1	80.82	80.82	0	0.00
32601.	Ryan (ryanandros)	1	83.73	83.73	0	0.00
32602.	Hung (rxpython)	1	85.20	85.20	0	0.00
32603.	Rwu (rwu_)	1	70.69	70.69	0	0.00
32604.	Rohit (rvighne)	1	100.17	100.17	0	0.00
32605.	Rusty (rustyspicer)	1	70.57	70.57	0	0.00
32606.	Russel (russelxxv)	1	58.09	58.09	0	0.00
32607.	G (runnerbeany)	1	131.48	131.48	1	100.00
32608.	Varun (runat_10)	1	74.15	74.15	1	100.00
32609.	Runbo (rumboe)	1	96.14	96.14	0	0.00
32610.	M (rugg0064)	1	78.14	78.14	0	0.00
32611.	Peter (rudson)	1	59.11	59.11	1	100.00
32612.	Kenny (rtootskie)	1	84.52	84.52	0	0.00
32613.	Michael Jay (rsbluee)	1	70.92	70.92	1	100.00
32614.	rozan (rozenbk)	1	57.18	57.18	0	0.00
32615.	Jarod (rouleau)	1	51.05	51.05	1	100.00
32616.	Roland (rothaler)	1	28.19	28.19	1	100.00
32617.	roserayne (roserayne)	1	59.83	59.83	1	100.00
32618.	Lin (rorarola)	1	72.14	72.14	0	0.00
32619.	Atlas (ropsar)	1	89.19	89.19	0	0.00
32620.	rookie (rookiespade)	1	132.73	132.73	1	100.00
32621.	Rohan (ron_tesla)	1	56.55	56.55	0	0.00
32622.	John (ronjohnjamesbond)	1	97.98	97.98	1	100.00
32623.	Ronnie (ronierat123)	1	53.53	53.53	1	100.00
32624.	Rear (rolotomassi)	1	98.40	98.40	0	0.00
32625.	IHopeAndTry (rohitistyping)	1	61.32	61.32	1	100.00
32626.	Rohit (rohiitt)	1	82.30	82.30	0	0.00
32627.	Rohit (rogiti)	1	160.36	160.36	1	100.00
32628.	Roger (rogergnay)	1	75.34	75.34	0	0.00
32629.	Rogerboss (rogerboss)	1	65.09	65.09	0	0.00
32630.	Roger (roger670)	1	46.97	46.97	0	0.00
32631.	Aster (rodry37)	1	46.99	46.99	0	0.00
32632.	Rodrigo (rodrianton)	1	56.73	56.73	0	0.00
32633.	roderick (roderickang)	1	56.96	56.96	0	0.00
32634.	rodals (rodals)	1	56.46	56.46	0	0.00
32635.	Rock (rockfrock)	1	90.80	90.80	1	100.00
32636.	rocket (rocketmantyper)	1	109.00	109.00	1	100.00
32637.	Robert (robville804)	1	45.41	45.41	0	0.00
32638.	Rob (robreadger)	1	49.46	49.46	1	100.00
32639.	Rob (robocat)	1	99.03	99.03	0	0.00
32640.	robin (robin1919)	1	65.94	65.94	1	100.00
32641.	Robert (robertherrera13)	1	114.39	114.39	1	100.00
32642.	RobertDeMilho (robertdm)	1	66.44	66.44	0	0.00
32643.	Rovic (robecks)	1	61.74	61.74	1	100.00
32644.	Robin (robdernub)	1	56.53	56.53	1	100.00
32645.	Viet (robberviet)	1	58.24	58.24	0	0.00
32646.	Rohan (roankar)	1	95.00	95.00	1	100.00
32647.	Ryan (rmahon27)	1	104.60	104.60	0	0.00
32648.	Ryan (rlee20)	1	81.60	81.60	0	0.00
32649.	Rachel (rlau)	1	93.10	93.10	0	0.00
32650.	Rebekah (rkatter)	1	84.69	84.69	1	100.00
32651.	Joshua (rjmaligaya)	1	88.51	88.51	0	0.00
32652.	RJ (rjem)	1	131.32	131.32	1	100.00
32653.	Rivalnegro (rivalnegro)	1	100.88	100.88	1	100.00
32654.	Yogender (ritik159)	1	58.60	58.60	0	0.00
32655.	Horatius (rithkop)	1	72.13	72.13	0	0.00
32656.	risu (risuto)	1	93.98	93.98	0	0.00
32657.	rishi (rishiwho)	1	46.34	46.34	0	0.00
32658.	Go Easy on Me (ripparian)	1	141.90	141.90	1	100.00
32659.	Rin (rinthis)	1	68.88	68.88	0	0.00
32660.	Rikatoariki (rikatoariki)	1	44.15	44.15	0	0.00
32661.	Carter (rightwingextremist)	1	78.00	78.00	1	100.00
32662.	rifath (rifath1729)	1	58.45	58.45	0	0.00
32663.	Rick (rickga)	1	91.27	91.27	0	0.00
32664.	RiceStealer (ricefieldstealer)	1	62.10	62.10	0	0.00
32665.	Leo (ricecustomer)	1	90.92	90.92	0	0.00
32666.	Riaofsantos (riaofsantos)	1	58.59	58.59	1	100.00
32667.	Rezevic (rezevic)	1	100.41	100.41	1	100.00
32668.	Ide (reyybruh)	1	84.98	84.98	0	0.00
32669.	Rex (rexwb)	1	58.72	58.72	1	100.00
32670.	Shuuin (rexvir)	1	99.17	99.17	1	100.00
32671.	Ahnaf (reverse_typist)	1	96.12	96.12	1	100.00
32672.	Revan (revankarma)	1	51.46	51.46	0	0.00
32673.	retainerbox (retainerbox)	1	99.52	99.52	1	100.00
32674.	Charlie (requiem2048)	1	118.88	118.88	0	0.00
32675.	René (rene12vamrak)	1	65.94	65.94	0	0.00
32676.	remz (remzhacker)	1	60.42	60.42	0	0.00
32677.	Jacob (remoobekaj)	1	55.17	55.17	0	0.00
32678.	Remotay (remotay)	1	124.69	124.69	1	100.00
32679.	._. (remiiix)	1	103.92	103.92	1	100.00
32680.	Jacob (remence)	1	38.18	38.18	0	0.00
32681.	fasterthanu (reign_az_)	1	51.32	51.32	0	0.00
32682.	Regan (reginalld)	1	83.15	83.15	0	0.00
32683.	Regan (regantm)	1	53.79	53.79	0	0.00
32684.	d (reformatic)	1	97.49	97.49	1	100.00
32685.	REE (reeeeeeeeee3)	1	99.90	99.90	1	100.00
32686.	Reckt (reckt)	1	99.42	99.42	0	0.00
32687.	R a c u (rebbok2002)	1	89.24	89.24	1	100.00
32688.	wichael (realwichael)	1	76.12	76.12	0	0.00
32689.	Manmohan (reattempt)	1	44.88	44.88	0	0.00
32690.	Alex Rodriguez (realralex)	1	57.22	57.22	0	0.00
32691.	Ashish (reach_aashu)	1	57.61	57.61	1	100.00
32692.	Richard (rcasey88)	1	102.60	102.60	1	100.00
32693.	Ryan (rbrownie)	1	64.91	64.91	0	0.00
32694.	Rb (rbdota2)	1	84.35	84.35	1	100.00
32695.	timko (razorsharprust)	1	102.41	102.41	1	100.00
32696.	Rayyan (rayyanyusuph)	1	83.18	83.18	0	0.00
32697.	raysar (raysar)	1	44.27	44.27	0	0.00
32698.	Ra (rayl19)	1	40.93	40.93	0	0.00
32699.	Kentson (raykaa)	1	85.85	85.85	0	0.00
32700.	Bob (rayell)	1	83.64	83.64	0	0.00
32701.	Ray (raycaballero)	1	73.18	73.18	0	0.00
32702.	Neel (ravastar)	1	106.92	106.92	0	0.00
32703.	Rahul (raul_jr3)	1	73.16	73.16	1	100.00
32704.	Raul (raulziiiin)	1	48.48	48.48	0	0.00
32705.	Jacob (rath130)	1	85.31	85.31	1	100.00
32706.	The Fast (ratatuli)	1	95.46	95.46	0	0.00
32707.	Azimjon (rasulovazimjon)	1	37.21	37.21	0	0.00
32708.	Kyle (rasktastatur)	1	133.63	133.63	1	100.00
32709.	Naufal (rashifff)	1	98.01	98.01	1	100.00
32710.	Alex (rashicakes)	1	67.14	67.14	0	0.00
32711.	Derek (rasehead)	1	80.79	80.79	0	0.00
32712.	M4nk3y (raraownage)	1	90.13	90.13	0	0.00
32713.	Rafiq (rapqz)	1	51.64	51.64	0	0.00
32714.	Ra (rapenting)	1	45.05	45.05	0	0.00
32715.	Harsh (rao_shab2000)	1	62.63	62.63	1	100.00
32716.	Peter (randomperson927)	1	69.47	69.47	1	100.00
32717.	giu (rand34)	1	33.07	33.07	0	0.00
32718.	Santiago (ramstrykre)	1	71.89	71.89	0	0.00
32719.	Jay (rampagej5)	1	92.93	92.93	1	100.00
32720.	ramirozz (ramirozz)	1	94.24	94.24	0	0.00
32721.	Rami (ramb_)	1	65.90	65.90	0	0.00
32722.	rama (ramaseta)	1	117.57	117.57	1	100.00
32723.	raman (raman123)	1	56.65	56.65	0	0.00
32724.	Raledude (raledude)	1	131.69	131.69	1	100.00
32725.	Rakibul (rakib195)	1	36.81	36.81	0	0.00
32726.	roshan kumar paswan (rajros...	1	51.72	51.72	0	0.00
32727.	you (you) (rajeevkgp)	1	64.31	64.31	0	0.00
32728.	minerva (rajafathir)	1	69.31	69.31	1	100.00
32729.	Ahmed (raiyan369999)	1	62.93	62.93	0	0.00
32730.	Claudio (rainclaudio25)	1	54.27	54.27	0	0.00
32731.	Ajit (raiajit)	1	60.92	60.92	0	0.00
32732.	Rahmat (rahmatullah_anik)	1	72.58	72.58	0	0.00
32733.	rafy (rafybeatskids)	1	56.14	56.14	0	0.00
32734.	Rafi (rafi_levy)	1	90.04	90.04	1	100.00
32735.	rafe (raffeevs)	1	76.47	76.47	0	0.00
32736.	raf (raf55)	1	52.53	52.53	0	0.00
32737.	Radu (radutist)	1	63.12	63.12	0	0.00
32738.	RadicalMacaroni (radicalmac...	1	165.57	165.57	1	100.00
32739.	dann (raclino)	1	84.70	84.70	0	0.00
32740.	Kyle (rachel_camarena)	1	122.33	122.33	0	0.00
32741.	RabbitFood (rabbitfood)	1	99.55	99.55	0	0.00
32742.	Bill (raaydon)	1	84.26	84.26	0	0.00
32743.	Raiza (raaizar)	1	59.37	59.37	0	0.00
32744.	Tree (raaaaaaaku)	1	108.37	108.37	1	100.00
32745.	I24FA (r4ffa)	1	69.82	69.82	1	100.00
32746.	meh (qwertysux)	1	68.23	68.23	1	100.00
32747.	s (qurtle)	1	93.43	93.43	0	0.00
32748.	Lotad (quirkylotad)	1	107.33	107.33	1	100.00
32749.	Quiq (quiqmeng)	1	84.07	84.07	0	0.00
32750.	Quintes (quintez)	1	69.72	69.72	0	0.00
32751.	hv21ll (quinixod)	1	83.99	83.99	0	0.00
32752.	Tay (quiettoonix)	1	106.27	106.27	0	0.00
32753.	Quick (quick_finger)	1	55.19	55.19	0	0.00
32754.	Quick Fingers 69 (quickfing...	1	99.62	99.62	0	0.00
32755.	ttoki17 (queen5213)	1	97.38	97.38	0	0.00
32756.	Thierry (quatumboy)	1	71.29	71.29	0	0.00
32757.	James (quangos)	1	61.23	61.23	1	100.00
32758.	Quang (quang81191)	1	56.14	56.14	0	0.00
32759.	Ty (quachgiaty)	1	52.81	52.81	0	0.00
32760.	Krishnan (qrownora)	1	54.98	54.98	0	0.00
32761.	Kenai Liam (pyro_kun)	1	93.89	93.89	1	100.00
32762.	Hughie (pynfirnite)	1	72.94	72.94	0	0.00
32763.	Perry (pyam0419)	1	80.01	80.01	1	100.00
32764.	agent narwhal (puppyz)	1	54.95	54.95	0	0.00
32765.	Josh (punyo)	1	63.34	63.34	1	100.00
32766.	Ben (punkturkyy)	1	57.71	57.71	0	0.00
32767.	Kevin (punch1ine)	1	36.17	36.17	1	100.00
32768.	Pumpy (pumpytudors)	1	124.26	124.26	1	100.00
32769.	tstats[pumabvb] (pumabvb)	1	50.15	50.15	0	0.00
32770.	pulux (pulux)	1	84.31	84.31	0	0.00
32771.	Pu (pulak)	1	77.28	77.28	1	100.00
32772.	Pubordin (pubordin44)	1	38.14	38.14	0	0.00
32773.	PsychoSaeko (psychosaeko)	1	118.97	118.97	1	100.00
32774.	Pseudo (psuedo)	1	112.03	112.03	0	0.00
32775.	Pranav (ps0505)	1	93.71	93.71	0	0.00
32776.	Thomas (proff001)	1	46.03	46.03	0	0.00
32777.	Alexandre (profenom)	1	76.34	76.34	0	0.00
32778.	A (processivity)	1	111.23	111.23	0	0.00
32779.	Dinmukhamed (pro005)	1	94.59	94.59	0	0.00
32780.	privinit (privinit)	1	54.34	54.34	1	100.00
32781.	Ian (prince_zuko1)	1	43.96	43.96	0	0.00
32782.	Preston (prestomation)	1	108.44	108.44	0	0.00
32783.	premnath (premnath)	1	58.30	58.30	0	0.00
32784.	Eddie (premeditate)	1	85.53	85.53	0	0.00
32785.	Prem (prem6299)	1	13.40	13.40	0	0.00
32786.	Harshpreet (preetikaur12)	1	71.29	71.29	0	0.00
32787.	Hevesi (preeim)	1	41.72	41.72	0	0.00
32788.	Precarious, (precariousgray)	1	176.93	176.93	1	100.00
32789.	Prateek (prateek2112)	1	59.31	59.31	1	100.00
32790.	Sadman (prant0)	1	107.88	107.88	0	0.00
32791.	tstats[praneeth_07] (pranee...	1	98.06	98.06	1	100.00
32792.	parks (prakerr)	1	53.22	53.22	1	100.00
32793.	Pablo (praguevara)	1	87.71	87.71	0	0.00
32794.	petey (pr69)	1	92.79	92.79	1	100.00
32795.	Thanh (pr1metine)	1	95.84	95.84	0	0.00
32796.	Chris (pr1m3)	1	79.61	79.61	0	0.00
32797.	iguesspperson (ppersonas)	1	94.38	94.38	1	100.00
32798.	Ethan (pottatis)	1	81.11	81.11	1	100.00
32799.	Potato (potato_wink9)	1	56.75	56.75	0	0.00
32800.	Joshua (potatolemon123)	1	92.11	92.11	0	0.00
32801.	Oskar (postmanpott)	1	54.04	54.04	0	0.00
32802.	BigPoopBoy (posit1v3)	1	105.27	105.27	1	100.00
32803.	porson (porson)	1	36.77	36.77	0	0.00
32804.	Poppa (poppayons)	1	69.99	69.99	1	100.00
32805.	anatoly (popovanatoly)	1	81.63	81.63	1	100.00
32806.	Charles (pools_closed_due_t...	1	60.72	60.72	0	0.00
32807.	jj (ponygaryelow)	1	116.06	116.06	0	0.00
32808.	polt (poltt)	1	112.36	112.36	1	100.00
32809.	MikiX (polish_wonderboy)	1	65.63	65.63	0	0.00
32810.	Police (policecow)	1	73.57	73.57	0	0.00
32811.	Andrew (poler10)	1	109.17	109.17	1	100.00
32812.	Pokemon (pokemonkillr)	1	74.63	74.63	0	0.00
32813.	Sean (poisonlance)	1	141.27	141.27	1	100.00
32814.	PoisonDart (poisondart)	1	59.78	59.78	0	0.00
32815.	Pocong (pocongjomblo)	1	49.96	49.96	0	0.00
32816.	Xd (pm7373)	1	76.60	76.60	1	100.00
32817.	arsh (plutarsh)	1	59.25	59.25	1	100.00
32818.	Parth (plukhi17)	1	68.31	68.31	0	0.00
32819.	miss index (plorksauce)	1	153.26	153.26	1	100.00
32820.	plum (ploom)	1	90.78	90.78	0	0.00
32821.	Gianmarco (plagioclasio)	1	99.43	99.43	0	0.00
32822.	Cielo (pjocielo)	1	52.86	52.86	0	0.00
32823.	Florian (pixhd)	1	59.19	59.19	1	100.00
32824.	Carlisle (pixellexe)	1	49.91	49.91	1	100.00
32825.	Jeron (pivotwind)	1	110.25	110.25	1	100.00
32826.	pistil (pistilmen)	1	79.03	79.03	0	0.00
32827.	PiranhaPig (piranhapig)	1	94.16	94.16	1	100.00
32828.	Noname (pioustube)	1	78.13	78.13	0	0.00
32829.	Stella (ping470)	1	91.24	91.24	0	0.00
32830.	Fox (pineapplefun101)	1	96.84	96.84	1	100.00
32831.	pillow (pillowkiller)	1	70.05	70.05	1	100.00
32832.	lumpsofwheat (pileofpaper)	1	126.50	126.50	1	100.00
32833.	Pikshu (pikashu02)	1	104.85	104.85	1	100.00
32834.	Pika (pikalight)	1	52.22	52.22	0	0.00
32835.	Tony (piiscool)	1	68.73	68.73	0	0.00
32836.	Pieter Jelle (pieterjelle)	1	68.15	68.15	1	100.00
32837.	Pierre (pierre15)	1	57.24	57.24	1	100.00
32838.	Tauntpiersto (piercebigelow)	1	69.86	69.86	0	0.00
32839.	Jacob (pieceofjake)	1	144.90	144.90	1	100.00
32840.	Annabelle (pickle_jickle)	1	49.53	49.53	0	0.00
32841.	pickleify (pickleify)	1	60.74	60.74	0	0.00
32842.	P (pianomyn)	1	113.43	113.43	0	0.00
32843.	Chuck (phreoq)	1	93.74	93.74	0	0.00
32844.	Photastic (photastic)	1	79.36	79.36	0	0.00
32845.	Philipp (phimaster0303)	1	47.25	47.25	0	0.00
32846.	Phil (philosphyphil)	1	96.28	96.28	1	100.00
32847.	PhiBi2002 (phibi2002)	1	56.36	56.36	0	0.00
32848.	David (pherric0xide)	1	100.33	100.33	0	0.00
32849.	abdo (phcox_hunter)	1	73.66	73.66	0	0.00
32850.	akash (phantom_07)	1	102.00	102.00	1	100.00
32851.	PhantasmagoricBeef (phantas...	1	73.55	73.55	0	0.00
32852.	faith (phaithyy)	1	89.38	89.38	0	0.00
32853.	Patrick (pgosser01)	1	81.90	81.90	0	0.00
32854.	Trey (pgneal3)	1	106.11	106.11	1	100.00
32855.	Peyton (peytonhm)	1	72.85	72.85	0	0.00
32856.	Sander (pettersen3008)	1	53.08	53.08	1	100.00
32857.	Peter (peter12253)	1	85.66	85.66	0	0.00
32858.	PERO (pero_op)	1	84.61	84.61	1	100.00
32859.	Félix (percevent)	1	81.39	81.39	0	0.00
32860.	Colin (peppyduckling)	1	64.04	64.04	0	0.00
32861.	pepino (pepinerino)	1	40.27	40.27	0	0.00
32862.	Daddy (pep1)	1	55.71	55.71	0	0.00
32863.	PegaS (pegas)	1	106.31	106.31	1	100.00
32864.	p2 (peep0)	1	71.54	71.54	0	0.00
32865.	Pectuu (pectuu_)	1	57.16	57.16	0	0.00
32866.	PeckingNoob (peckingnoob)	1	54.69	54.69	0	0.00
32867.	peter (pbang)	1	119.91	119.91	0	0.00
32868.	marmonjen (pawnracer)	1	89.83	89.83	0	0.00
32869.	Edwin (pawncastle)	1	103.27	103.27	1	100.00
32870.	PaulC10333 (paul_c10333)	1	51.23	51.23	1	100.00
32871.	Paul (paulinka7217)	1	42.58	42.58	0	0.00
32872.	Jo (paulajoo)	1	37.53	37.53	0	0.00
32873.	Patrick (patrickmcd)	1	76.17	76.17	0	0.00
32874.	Pasta (pastayes)	1	65.80	65.80	1	100.00
32875.	Vanser (paskerdewdz)	1	75.07	75.07	0	0.00
32876.	Pasindu (pasindusandima)	1	44.46	44.46	0	0.00
32877.	parteek (parteek)	1	76.38	76.38	1	100.00
32878.	Tyler (pardue)	1	86.18	86.18	1	100.00
32879.	basic (paperscraps)	1	137.59	137.59	0	0.00
32880.	Nathan (papapapow)	1	87.85	87.85	0	0.00
32881.	your (papaheav)	1	56.00	56.00	1	100.00
32882.	Sumeo-Okami (paolo321)	1	128.69	128.69	1	100.00
32883.	Guiguizin (paodequeijomolhado)	1	28.86	28.86	1	100.00
32884.	panuto2 (panuto2)	1	91.86	91.86	1	100.00
32885.	isaac (pantsmcgee)	1	70.10	70.10	0	0.00
32886.	Panther (panthernerd)	1	90.73	90.73	0	0.00
32887.	Pannz (pannz)	1	105.67	105.67	1	100.00
32888.	Aayush (pandaayush)	1	85.84	85.84	1	100.00
32889.	Pacchan (panda892)	1	77.76	77.76	0	0.00
32890.	Panazios (panazios)	1	96.50	96.50	1	100.00
32891.	Peter (panalis)	1	48.44	48.44	0	0.00
32892.	Valtra (palap0n)	1	87.70	87.70	1	100.00
32893.	Paino (painogamingyt)	1	95.43	95.43	1	100.00
32894.	pagep (pagep)	1	65.60	65.60	0	0.00
32895.	padoru (padoru69)	1	88.58	88.58	1	100.00
32896.	Anthony (pacho_11)	1	46.47	46.47	0	0.00
32897.	Pablo (pabloberwig)	1	99.72	99.72	0	0.00
32898.	pablazo (pablazo)	1	73.15	73.15	1	100.00
32899.	PAGAN (p4gan)	1	84.84	84.84	1	100.00
32900.	p3t9a (p3t9a)	1	41.63	41.63	0	0.00
32901.	Pratik (p3nx1lz)	1	54.19	54.19	0	0.00
32902.	Jacob (p2kk96)	1	94.89	94.89	0	0.00
32903.	p1ng_speed (p1ng_)	1	42.00	42.00	0	0.00
32904.	Potato (p0tat0fri3s)	1	75.20	75.20	0	0.00
32905.	Oxoxrut (oxoxrut)	1	132.38	132.38	1	100.00
32906.	Raphael (oxidation)	1	75.12	75.12	0	0.00
32907.	over_loadcode (over_loadcode)	1	105.55	105.55	1	100.00
32908.	overlord_dude (overlord_dude)	1	51.97	51.97	0	0.00
32909.	bruh (ovecko)	1	95.66	95.66	1	100.00
32910.	Brian (outremonde)	1	89.91	89.91	1	100.00
32911.	dank nissan (osubora)	1	122.28	122.28	1	100.00
32912.	Justin (orthanek)	1	93.80	93.80	1	100.00
32913.	orgilmunh (orgilmunh)	1	60.89	60.89	1	100.00
32914.	Jeremy (orenthion)	1	75.28	75.28	1	100.00
32915.	Igor (orderil)	1	59.69	59.69	0	0.00
32916.	Beep (orange_capri_sun)	1	67.50	67.50	0	0.00
32917.	Buttjuice (orangebruce)	1	101.79	101.79	0	0.00
32918.	Ereal (oqutaorblx)	1	29.55	29.55	0	0.00
32919.	Owen (opw3319)	1	39.69	39.69	0	0.00
32920.	Optimize (optimizevfx)	1	66.65	66.65	0	0.00
32921.	Owen (opio2000)	1	87.10	87.10	0	0.00
32922.	Michael (onyxite)	1	129.77	129.77	0	0.00
32923.	ONI (oniboo)	1	36.26	36.26	0	0.00
32924.	Andrew (onetwoandyroo)	1	59.88	59.88	0	0.00
32925.	Christian (oneetian)	1	82.99	82.99	0	0.00
32926.	One (onebyte)	1	84.22	84.22	0	0.00
32927.	Ondřej (ondrfol)	1	51.77	51.77	0	0.00
32928.	Bibi (omusubee)	1	85.12	85.12	1	100.00
32929.	Shubham (omnissan)	1	88.08	88.08	0	0.00
32930.	Omer (omerrrr)	1	99.47	99.47	1	100.00
32931.	ΩmegaMan (omegaman)	1	109.82	109.82	1	100.00
32932.	omar (omarkasem)	1	77.25	77.25	0	0.00
32933.	Omar (omarkalii)	1	84.08	84.08	0	0.00
32934.	Omari (omari_)	1	54.43	54.43	0	0.00
32935.	Oliver (olliepop04)	1	56.81	56.81	0	0.00
32936.	Oliver (olliebe4r)	1	75.05	75.05	0	0.00
32937.	Olivia (oliviali)	1	103.38	103.38	1	100.00
32938.	Newland (oldwutter)	1	107.58	107.58	1	100.00
32939.	Eli (ok_eli)	1	71.52	71.52	0	0.00
32940.	lol (oknoted)	1	86.86	86.86	1	100.00
32941.	okkonishi (okkonishi)	1	85.50	85.50	0	0.00
32942.	Osama (ojscofield)	1	56.15	56.15	0	0.00
32943.	Toby (oisklet)	1	92.46	92.46	0	0.00
32944.	Brot (oh_brot)	1	50.84	50.84	0	0.00
32945.	OhMyTomat (ohmytomat)	1	54.46	54.46	0	0.00
32946.	Ryan (ohlegends)	1	96.98	96.98	0	0.00
32947.	zuramai (ogihek1)	1	94.60	94.60	1	100.00
32948.	Ody (odyxlala)	1	50.52	50.52	0	0.00
32949.	Octav (octavianro)	1	81.90	81.90	1	100.00
32950.	Vlad (obserrrver)	1	35.32	35.32	0	0.00
32951.	Osama (obokanan)	1	101.91	101.91	0	0.00
32952.	oatmilk (oatmilque)	1	73.28	73.28	0	0.00
32953.	Obada (oaah)	1	52.54	52.54	0	0.00
32954.	Potato (nyll)	1	59.50	59.50	0	0.00
32955.	Nycto (nycto_night)	1	40.03	40.03	0	0.00
32956.	Martin (nyborg)	1	84.14	84.14	1	100.00
32957.	Yan (nyanyan12_1)	1	112.98	112.98	0	0.00
32958.	Andy (nuudle)	1	85.30	85.30	0	0.00
32959.	Pen (nutty69)	1	70.28	70.28	1	100.00
32960.	Justin (nutmeg_0)	1	104.37	104.37	1	100.00
32961.	Stinkbean (nutloaf)	1	97.56	97.56	0	0.00
32962.	Dastan (nur_4_earth)	1	48.34	48.34	0	0.00
32963.	Nurasyl (nurrrrasyl)	1	71.00	71.00	0	0.00
32964.	Your (numiko)	1	45.58	45.58	0	0.00
32965.	Tyler (numbermunch3r)	1	108.23	108.23	1	100.00
32966.	AubReina (nta0789)	1	68.04	68.04	1	100.00
32967.	N (nsortur)	1	98.28	98.28	0	0.00
32968.	Alex (nr1771)	1	102.05	102.05	0	0.00
32969.	Nicolas (nqber)	1	59.90	59.90	1	100.00
32970.	Nate (npmaile)	1	88.89	88.89	1	100.00
32971.	Nathan (nparque03)	1	104.38	104.38	1	100.00
32972.	leon (notveryfast6)	1	53.87	53.87	0	0.00
32973.	Dexter (notundampeddex)	1	70.58	70.58	1	100.00
32974.	Not (notpeo)	1	87.58	87.58	0	0.00
32975.	Edison (notmercury)	1	92.11	92.11	0	0.00
32976.	Jared (notjard)	1	89.42	89.42	1	100.00
32977.	Filip (normalnie)	1	89.48	89.48	1	100.00
32978.	Zach (nordwez)	1	106.51	106.51	1	100.00
32979.	Nurlybek (noproblem29)	1	42.91	42.91	1	100.00
32980.	Chase (nootnamed)	1	112.31	112.31	1	100.00
32981.	Benj (noodlicious)	1	136.36	136.36	0	0.00
32982.	Crimson (noodle_fingers)	1	54.97	54.97	0	0.00
32983.	spy (noobtypebuddy)	1	59.99	59.99	0	0.00
32984.	Mariusz (nonton)	1	52.07	52.07	0	0.00
32985.	Wilmore (nonquitchad)	1	120.84	120.84	1	100.00
32986.	Nongus (nongus_42)	1	83.62	83.62	0	0.00
32987.	Tony (nomind)	1	87.47	87.47	0	0.00
32988.	Nomig (nomig)	1	81.53	81.53	0	0.00
32989.	nolan (nolantof)	1	41.67	41.67	0	0.00
32990.	luap (nocturnalzek)	1	131.01	131.01	1	100.00
32991.	Noct (nocturnally_)	1	114.42	114.42	1	100.00
32992.	ℕ (noctua)	1	73.21	73.21	0	0.00
32993.	Noah (noah_13)	1	78.84	78.84	0	0.00
32994.	KampiiTV (noahmarvin)	1	100.51	100.51	0	0.00
32995.	Zen (njpwstardomfan)	1	117.68	117.68	1	100.00
32996.	Nix (nix_)	1	84.17	84.17	0	0.00
32997.	Nixibeaver (nixibeaver)	1	118.62	118.62	1	100.00
32998.	Valentin (nivanpylte)	1	53.20	53.20	1	100.00
32999.	Niuqaoj (niuqaoj_life)	1	89.57	89.57	0	0.00
33000.	N (nitruo)	1	104.35	104.35	0	0.00
33001.	Mohamed (nitrousgamer)	1	99.78	99.78	0	0.00
33002.	Mitch (nitchmichols)	1	74.24	74.24	0	0.00
33003.	NinjaTurtleDude (ninjaturtl...	1	71.98	71.98	0	0.00
33004.	E (ninjanahtey)	1	66.37	66.37	0	0.00
33005.	Nina (ninapez)	1	91.34	91.34	1	100.00
33006.	Muhaiminul Islam (ninadgns)	1	72.43	72.43	0	0.00
33007.	Liang (nimble_ngo)	1	62.10	62.10	0	0.00
33008.	Becca (niknup)	1	89.52	89.52	1	100.00
33009.	Nikhil (nikhilk710)	1	57.99	57.99	0	0.00
33010.	Michael (niightgamez)	1	52.14	52.14	0	0.00
33011.	Nihilyst (nihilyst21)	1	80.36	80.36	0	0.00
33012.	tstats[nightisbad] (nightis...	1	80.91	80.91	0	0.00
33013.	Nidzi (nidzi)	1	88.02	88.02	1	100.00
33014.	Violet (nidtsg1113)	1	98.66	98.66	0	0.00
33015.	Saif (niconyte)	1	36.08	36.08	0	0.00
33016.	Nico (nicob_1212)	1	80.82	80.82	0	0.00
33017.	Nick (nickstoni)	1	87.68	87.68	0	0.00
33018.	Nicolas (nickolishous)	1	82.29	82.29	1	100.00
33019.	Nick (nickman666)	1	68.00	68.00	1	100.00
33020.	AJ-_- (nickelthemarcoman)	1	56.80	56.80	0	0.00
33021.	Nícolas (nickdev)	1	95.88	95.88	1	100.00
33022.	NickR (nicholasr)	1	59.65	59.65	0	0.00
33023.	Nicholas (nich42)	1	95.20	95.20	1	100.00
33024.	Nial (nialj618)	1	64.72	64.72	0	0.00
33025.	PriesaFire (nguyentriton)	1	64.47	64.47	0	0.00
33026.	Jan (nexxo)	1	60.25	60.25	0	0.00
33027.	Justin (nexoloft)	1	88.76	88.76	0	0.00
33028.	Neal (newbcake)	1	87.85	87.85	1	100.00
33029.	Matthew (neropuncher)	1	47.09	47.09	0	0.00
33030.	Nero (ner0plu3)	1	44.52	44.52	0	0.00
33031.	Reylo4Evr (neqailaz)	1	79.57	79.57	0	0.00
33032.	Neo (neonter)	1	51.41	51.41	0	0.00
33033.	Sage (neonfuz)	1	95.98	95.98	1	100.00
33034.	NELiXERY (nelixery)	1	83.47	83.47	1	100.00
33035.	negev (negev_lover)	1	103.37	103.37	0	0.00
33036.	Sean (nefhx3)	1	60.05	60.05	0	0.00
33037.	Use an appropriate name (ne...	1	87.88	87.88	0	0.00
33038.	︎ ︎ ︎ ︎ ︎ ︎ ︎...	1	81.05	81.05	1	100.00
33039.	Matthew (necroxity_2021)	1	60.52	60.52	0	0.00
33040.	Kai zheng (nebs_2ge)	1	42.72	42.72	0	0.00
33041.	Jpeg blue car (nebbeh)	1	102.59	102.59	0	0.00
33042.	Nolwen (neb0003)	1	105.63	105.63	0	0.00
33043.	Ndu (ndubizu19)	1	43.15	43.15	0	0.00
33044.	Nicholas (nchlslv)	1	78.77	78.77	0	0.00
33045.	Mandy (nchaiphuong)	1	78.61	78.61	1	100.00
33046.	Blake (navy23rd)	1	92.72	92.72	1	100.00
33047.	lee (navalta)	1	59.45	59.45	0	0.00
33048.	Natte (nattel)	1	104.89	104.89	1	100.00
33049.	Nat (natrose)	1	94.64	94.64	0	0.00
33050.	Nat (natenat)	1	46.78	46.78	0	0.00
33051.	Nason (nason420)	1	71.57	71.57	0	0.00
33052.	Nash (nashsauter)	1	56.30	56.30	0	0.00
33053.	Chris (nasageek)	1	90.57	90.57	0	0.00
33054.	Jonski (napalleum)	1	77.75	77.75	0	0.00
33055.	Rob (nanijau)	1	84.16	84.16	0	0.00
33056.	name999 (name_999)	1	104.71	104.71	1	100.00
33057.	Simonas (nags)	1	83.81	83.81	0	0.00
33058.	nadan (nadanfrenkiel)	1	37.24	37.24	0	0.00
33059.	france (nabyounab)	1	102.26	102.26	0	0.00
33060.	Nex (n3x7s)	1	57.53	57.53	1	100.00
33061.	Noob (n0013gam3r)	1	98.45	98.45	1	100.00
33062.	smell (mytoes)	1	68.77	68.77	0	0.00
33063.	Hunter (mythichunter758)	1	95.58	95.58	1	100.00
33064.	Spotter (mythical_spotter)	1	60.76	60.76	1	100.00
33065.	Jesse (myoga)	1	131.81	131.81	1	100.00
33066.	Dave Israel (mynameisdig)	1	70.03	70.03	1	100.00
33067.	yes (mymotherleftmewheniwas2)	1	77.94	77.94	0	0.00
33068.	mymodded (mymodded)	1	64.37	64.37	0	0.00
33069.	myle (myle_7894)	1	113.88	113.88	0	0.00
33070.	Joshua (myhoohasmells)	1	73.90	73.90	0	0.00
33071.	Christopher (mybudgiegus)	1	106.59	106.59	1	100.00
33072.	Mustafa (muzzy750)	1	68.22	68.22	0	0.00
33073.	muthukumar (muthukumarp)	1	65.33	65.33	0	0.00
33074.	Amanda (musseama)	1	99.70	99.70	1	100.00
33075.	Muslem (muslimomar)	1	97.27	97.27	0	0.00
33076.	abdelrahman (muslim21)	1	44.41	44.41	0	0.00
33077.	Musa Bedirhan (musajoker)	1	90.87	90.87	0	0.00
33078.	Nawar (murci)	1	51.34	51.34	0	0.00
33079.	ムラサメ (murasamechan)	1	97.36	97.36	0	0.00
33080.	Will (munce)	1	112.51	112.51	0	0.00
33081.	Alexander (mummenschanz)	1	41.42	41.42	0	0.00
33082.	zakilegs (mulgor)	1	105.42	105.42	0	0.00
33083.	Marco (msukhatme)	1	78.69	78.69	0	0.00
33084.	decent (mstersierra)	1	93.87	93.87	1	100.00
33085.	Morgan (mscoot)	1	58.75	58.75	1	100.00
33086.	Mahmud Sajjad (msabeer)	1	52.88	52.88	0	0.00
33087.	Mr (mr_otaku)	1	96.40	96.40	0	0.00
33088.	Yeshua (mr_inconsistent88)	1	37.89	37.89	0	0.00
33089.	Akshay (mr_dadwal)	1	66.33	66.33	1	100.00
33090.	MrWaffle (mrwaffle_)	1	54.70	54.70	0	0.00
33091.	Marvin (mrvn)	1	66.02	66.02	0	0.00
33092.	MR (mrsystem)	1	103.02	103.02	0	0.00
33093.	runicc (mrscrubbywaffle)	1	80.78	80.78	1	100.00
33094.	mrob2304 (mrob2304)	1	66.05	66.05	0	0.00
33095.	i like turtles (mrmlgturtle)	1	106.34	106.34	0	0.00
33096.	markzeras (mrkmat)	1	90.46	90.46	0	0.00
33097.	MrRidiculous (mrjacobj56)	1	58.57	58.57	1	100.00
33098.	Mister (mrgraie)	1	108.74	108.74	1	100.00
33099.	Dragon (mrdragonplays)	1	95.96	95.96	1	100.00
33100.	Diego (mrcatisgod)	1	81.11	81.11	0	0.00
33101.	Dat (mralex101)	1	82.23	82.23	0	0.00
33102.	Martin (mqrtyn)	1	51.16	51.16	0	0.00
33103.	Marek (mp4mero)	1	87.96	87.96	1	100.00
33104.	Mottures (mottures)	1	89.32	89.32	0	0.00
33105.	Moses (moses_)	1	125.43	125.43	1	100.00
33106.	Vlaviano (moryoka)	1	51.38	51.38	0	0.00
33107.	Morph (morpheus1008)	1	61.55	61.55	0	0.00
33108.	dsfdsf (moropopi)	1	61.69	61.69	0	0.00
33109.	Morgan (morgan_brooke_21)	1	25.70	25.70	1	100.00
33110.	morgan (morganidk)	1	117.29	117.29	0	0.00
33111.	mooshi (mooshituslo)	1	77.21	77.21	1	100.00
33112.	sergio (montyzing)	1	88.46	88.46	0	0.00
33113.	Florin (montecolumns)	1	66.10	66.10	0	0.00
33114.	lucho (monopolyy)	1	72.53	72.53	1	100.00
33115.	Feces (monkey_feces)	1	73.29	73.29	0	0.00
33116.	Caleb (monkeyboy1379)	1	72.52	72.52	1	100.00
33117.	saefwaqefr (monkethattypesf...	1	118.33	118.33	1	100.00
33118.	Dark (monevtna)	1	87.89	87.89	0	0.00
33119.	Breanna (monettheturtle)	1	92.89	92.89	0	0.00
33120.	MOMO (momo_20)	1	25.75	25.75	0	0.00
33121.	Chico (momothedoge)	1	55.43	55.43	0	0.00
33122.	Shour (momax)	1	31.85	31.85	1	100.00
33123.	Cameron (moliopp)	1	90.28	90.28	1	100.00
33124.	Mojave (mojave)	1	102.03	102.03	0	0.00
33125.	Mohamed (mohamedessam_52)	1	65.52	65.52	0	0.00
33126.	mogi (mogspls)	1	83.89	83.89	0	0.00
33127.	Boom (moeroach)	1	111.96	111.96	1	100.00
33128.	maaeab (moemenahmed)	1	62.56	62.56	0	0.00
33129.	Romir Basu (mod_rombus)	1	97.51	97.51	0	0.00
33130.	Arman (modares)	1	61.81	61.81	0	0.00
33131.	Chase (mobinn)	1	79.77	79.77	0	0.00
33132.	mo (mobeats)	1	90.48	90.48	0	0.00
33133.	Mnkx (mnkx)	1	74.34	74.34	0	0.00
33134.	Madison (mnbutler)	1	80.03	80.03	0	0.00
33135.	David (mm12345)	1	108.37	108.37	0	0.00
33136.	Michal (mlvy2589)	1	62.05	62.05	1	100.00
33137.	Matt (mlamm)	1	103.26	103.26	0	0.00
33138.	M (ml19)	1	56.41	56.41	0	0.00
33139.	Marcus (mjtsquared)	1	103.57	103.57	1	100.00
33140.	Elektra (mjpaark)	1	76.40	76.40	0	0.00
33141.	mizu (mizu0607)	1	59.88	59.88	0	0.00
33142.	James (miztrjriii)	1	98.30	98.30	0	0.00
33143.	Dennis (mizonex)	1	98.61	98.61	1	100.00
33144.	Mikkel (mixmox)	1	76.84	76.84	0	0.00
33145.	Paitpan (mixptp)	1	84.14	84.14	1	100.00
33146.	mitchy2093 (mitchy2093)	1	66.58	66.58	0	0.00
33147.	Mitch (mitchtin)	1	64.99	64.99	0	0.00
33148.	Mistah (mistahd)	1	87.77	87.77	0	0.00
33149.	Anna (misslua1)	1	118.56	118.56	1	100.00
33150.	tstats[mishrakunal012] Kuna...	1	62.96	62.96	0	0.00
33151.	Fizzman (mintyballs)	1	99.32	99.32	0	0.00
33152.	Daniel (minqz)	1	71.56	71.56	0	0.00
33153.	Việt Hùng (minkate)	1	91.51	91.51	0	0.00
33154.	Tom (minitom)	1	85.26	85.26	1	100.00
33155.	Herman (minions96)	1	40.48	40.48	0	0.00
33156.	Minhon (minhon23)	1	67.54	67.54	0	0.00
33157.	Henrik (minepro3004)	1	64.97	64.97	1	100.00
33158.	Wyatt (millybay)	1	102.35	102.35	1	100.00
33159.	milluki (milluki)	1	81.31	81.31	0	0.00
33160.	hugh jass (milkyxing)	1	133.19	133.19	0	0.00
33161.	brandon (milks0ck)	1	71.13	71.13	1	100.00
33162.	Mike (mikespits)	1	71.59	71.59	0	0.00
33163.	Michael (mikell)	1	85.14	85.14	0	0.00
33164.	Mika (mikakareefu)	1	73.11	73.11	0	0.00
33165.	Mihael (mihchina)	1	91.66	91.66	1	100.00
33166.	Miguel (migzkulitz05)	1	84.68	84.68	0	0.00
33167.	Migs (migbasilio)	1	72.51	72.51	0	0.00
33168.	Ben (midnitekuro)	1	47.38	47.38	1	100.00
33169.	Noman (middlero)	1	100.77	100.77	0	0.00
33170.	Mid9ht (mid9ht)	1	52.36	52.36	1	100.00
33171.	Microwave (microwave69420)	1	59.16	59.16	1	100.00
33172.	Vallabh (micronic)	1	66.09	66.09	0	0.00
33173.	m (microlmao)	1	117.50	117.50	1	100.00
33174.	DOS (microdos)	1	102.73	102.73	1	100.00
33175.	Mich2700 (mich2700)	1	77.97	77.97	0	0.00
33176.	Michael (micecheese)	1	115.70	115.70	1	100.00
33177.	Mice (micebishop)	1	67.80	67.80	0	0.00
33178.	Miad (miad_hasan)	1	49.77	49.77	0	0.00
33179.	noah (mhyrion)	1	21.58	21.58	1	100.00
33180.	Eunmin (mgood2)	1	75.51	75.51	0	0.00
33181.	Maddie (mfighter)	1	71.89	71.89	1	100.00
33182.	Method (method16)	1	68.26	68.26	0	0.00
33183.	Mewi (metalwihen)	1	100.62	100.62	0	0.00
33184.	S (messmind)	1	70.69	70.69	1	100.00
33185.	Cesar (messyces)	1	62.30	62.30	1	100.00
33186.	Brn (meslowlmao)	1	84.17	84.17	0	0.00
33187.	Dvorak (mesingel_dvorak)	1	95.33	95.33	1	100.00
33188.	Mert (mertkasikci)	1	48.78	48.78	1	100.00
33189.	♡ (meretricious)	1	99.50	99.50	0	0.00
33190.	Mephy (mephy)	1	123.47	123.47	1	100.00
33191.	pietro (mepeeper)	1	28.01	28.01	0	0.00
33192.	Meow (meowreaper)	1	80.98	80.98	1	100.00
33193.	Ben (men_biller)	1	59.76	59.76	0	0.00
33194.	carleel (menamesringo)	1	96.14	96.14	1	100.00
33195.	Luke (menace13)	1	130.50	130.50	1	100.00
33196.	i use membrane by the way (...	1	80.21	80.21	0	0.00
33197.	Melvin (melvinhedman)	1	104.20	104.20	0	0.00
33198.	mello (mellofiy)	1	59.75	59.75	0	0.00
33199.	Lorenz (meincrakker)	1	34.31	34.31	0	0.00
33200.	Michael (meikey)	1	83.14	83.14	1	100.00
33201.	Chen (megus)	1	92.03	92.03	0	0.00
33202.	goober (megumin00)	1	100.84	100.84	0	0.00
33203.	C (meektaco)	1	103.03	103.03	0	0.00
33204.	Mecha (mechadestroyer)	1	110.36	110.36	1	100.00
33205.	MeBookJava (mebookjava)	1	42.84	42.84	0	0.00
33206.	Mohd (md_shariq1)	1	63.62	63.62	0	0.00
33207.	Matthew (mdsauer53)	1	68.28	68.28	0	0.00
33208.	mdlu (mdlu)	1	125.47	125.47	0	0.00
33209.	Kaylee (mcpie87)	1	114.47	114.47	0	0.00
33210.	Brian (mcflobbergobber)	1	47.98	47.98	0	0.00
33211.	(mbwins10)	1	72.21	72.21	1	100.00
33212.	Maysa (maysa_27)	1	46.45	46.45	0	0.00
33213.	Maydup (maydup_naim)	1	147.64	147.64	1	100.00
33214.	Maya (mayam915)	1	67.65	67.65	1	100.00
33215.	Maxxxi420 (maxxxi420)	1	52.51	52.51	1	100.00
33216.	Max (maximusprime70)	1	82.80	82.80	1	100.00
33217.	Maximillian (maximillian_)	1	62.03	62.03	0	0.00
33218.	Max (maxiebond)	1	78.54	78.54	1	100.00
33219.	Lucas (maxicalcio)	1	87.67	87.67	0	0.00
33220.	Azar (maxentium)	1	110.03	110.03	1	100.00
33221.	Max (maxattack)	1	140.70	140.70	1	100.00
33222.	Marco (mauboru)	1	49.06	49.06	1	100.00
33223.	123 (matuska)	1	85.23	85.23	1	100.00
33224.	Matty (mattypatty)	1	68.30	68.30	0	0.00
33225.	Matt (mattyb15)	1	68.00	68.00	1	100.00
33226.	Mattin (mattinpeik)	1	68.12	68.12	0	0.00
33227.	Matthew (matthewmics77)	1	118.94	118.94	1	100.00
33228.	Matt 🐌 (mattg54321)	1	85.60	85.60	0	0.00
33229.	Matt (mattdowning91)	1	81.12	81.12	0	0.00
33230.	Mats (matserbedre)	1	61.88	61.88	1	100.00
33231.	Masuikai (masuikai)	1	100.78	100.78	1	100.00
33232.	Arman (masterilluminati)	1	94.32	94.32	0	0.00
33233.	James (mastakeyboard)	1	90.09	90.09	0	0.00
33234.	Abdullah (massucksagaming)	1	96.04	96.04	1	100.00
33235.	Sam (masamuel)	1	72.85	72.85	0	0.00
33236.	Matt (marvinhamlisch)	1	96.58	96.58	0	0.00
33237.	martinspp (martinspp)	1	70.71	70.71	1	100.00
33238.	Martin (martin3099)	1	54.36	54.36	0	0.00
33239.	Eric (martellen)	1	62.75	62.75	0	0.00
33240.	Martin (martafiixek)	1	105.47	105.47	1	100.00
33241.	marsha (marsha_socks)	1	127.40	127.40	1	100.00
33242.	Marrie (marriemitsu)	1	77.07	77.07	0	0.00
33243.	Bruno (marmota07)	1	63.64	63.64	1	100.00
33244.	Marla Marie (marla_17)	1	29.31	29.31	0	0.00
33245.	Markus (markusmanbro)	1	110.89	110.89	0	0.00
33246.	Mark (markovsy)	1	37.25	37.25	0	0.00
33247.	Marko (markocar22)	1	69.30	69.30	0	0.00
33248.	Andrew (markinandrew)	1	84.27	84.27	1	100.00
33249.	pearslice (mark42isawesome)	1	125.77	125.77	0	0.00
33250.	Vroom (mariotaughtmetyping)	1	98.12	98.12	1	100.00
33251.	hunter (marcyisthebestestgirl)	1	25.96	25.96	0	0.00
33252.	Marc (marcp3k)	1	63.11	63.11	1	100.00
33253.	Marck (marckyeee)	1	54.00	54.00	0	0.00
33254.	Mooriah (marblesgalore)	1	93.36	93.36	0	0.00
33255.	Jessica (marbilu)	1	54.07	54.07	0	0.00
33256.	M (maqqnus)	1	54.29	54.29	0	0.00
33257.	M4nu (manuqjapem)	1	37.61	37.61	0	0.00
33258.	Manu (manuwu)	1	91.95	91.95	1	100.00
33259.	Omar (manual_gears)	1	72.72	72.72	0	0.00
33260.	Julia (mantitties)	1	76.21	76.21	0	0.00
33261.	Mait (mangomaits)	1	59.64	59.64	1	100.00
33262.	ihatepunc (manbanana)	1	114.33	114.33	0	0.00
33263.	Malthus (malthusfb)	1	72.34	72.34	0	0.00
33264.	Malthe (malthesers)	1	75.52	75.52	0	0.00
33265.	Maloha (maloha7)	1	72.98	72.98	0	0.00
33266.	maliwan (maliwan)	1	91.47	91.47	1	100.00
33267.	maleika (maleika)	1	80.92	80.92	1	100.00
33268.	Makaila (makailaxx)	1	38.12	38.12	0	0.00
33269.	Alex (majorfontes)	1	100.29	100.29	0	0.00
33270.	maya (maiableeds)	1	113.80	113.80	1	100.00
33271.	Mahima (mahima_)	1	81.57	81.57	0	0.00
33272.	Aksel (magicrex)	1	80.83	80.83	0	0.00
33273.	Conor (magevonor)	1	93.27	93.27	0	0.00
33274.	Niels (magerkonijn)	1	70.10	70.10	1	100.00
33275.	Logan (maestrobroccoli)	1	106.60	106.60	1	100.00
33276.	mael (maelstrom00)	1	83.54	83.54	0	0.00
33277.	madmikexxl (madmikexxl)	1	127.08	127.08	0	0.00
33278.	madhukar (madhukar00)	1	56.76	56.76	0	0.00
33279.	Maday (maday)	1	92.87	92.87	1	100.00
33280.	Memer (macisasandwich)	1	121.39	121.39	1	100.00
33281.	Mohammad Abdul Ahad (maahad...	1	52.24	52.24	0	0.00
33282.	Rohit (m5ar123)	1	83.05	83.05	0	0.00
33283.	Paul (m4trixtr)	1	65.85	65.85	0	0.00
33284.	Metiro (m3t1r0)	1	35.77	35.77	0	0.00
33285.	M220 (m220)	1	47.79	47.79	0	0.00
33286.	Neculai (m1s1)	1	61.70	61.70	0	0.00
33287.	Moze (m0ze)	1	61.06	61.06	0	0.00
33288.	Charlie (l_plater)	1	63.43	63.43	0	0.00
33289.	Joshua (lysergicdie)	1	86.25	86.25	0	0.00
33290.	Levon (lyovandra)	1	50.02	50.02	0	0.00
33291.	lynn (lynno)	1	45.44	45.44	1	100.00
33292.	Lynne (lynne17)	1	57.83	57.83	0	0.00
33293.	Lvvy (lvvyy)	1	67.13	67.13	0	0.00
33294.	Musa (lupuspark)	1	54.17	54.17	0	0.00
33295.	Niels (luniejuul)	1	52.49	52.49	0	0.00
33296.	Benton (lunarknight219)	1	92.29	92.29	1	100.00
33297.	Luminescent (lumiines)	1	129.13	129.13	1	100.00
33298.	kenjorine canon (lumibea)	1	61.08	61.08	0	0.00
33299.	jr (lukrix)	1	105.76	105.76	1	100.00
33300.	Anthony (lukiilegend)	1	122.60	122.60	1	100.00
33301.	Lily (lukewarmwater)	1	72.10	72.10	0	0.00
33302.	Luke (luketorti)	1	66.44	66.44	0	0.00
33303.	luke (lukeritos)	1	82.69	82.69	0	0.00
33304.	Lukeface (lukeface)	1	91.35	91.35	0	0.00
33305.	lukasz (lukaszx)	1	59.41	59.41	0	0.00
33306.	Lukas (lukasdaisan)	1	80.18	80.18	1	100.00
33307.	luka (lukabrlek)	1	71.90	71.90	0	0.00
33308.	Lu-Wai (luhyphenwai)	1	87.34	87.34	1	100.00
33309.	Lugia (lugia_)	1	55.61	55.61	0	0.00
33310.	Ludicrous (ludicrouslevo)	1	105.74	105.74	1	100.00
33311.	Sim (luckytosnort)	1	101.97	101.97	0	0.00
33312.	Liao (luckykuy)	1	69.57	69.57	1	100.00
33313.	Tiffany (luckydaboss)	1	76.65	76.65	0	0.00
33314.	luckyapp (luckyapp)	1	54.68	54.68	0	0.00
33315.	Luke (luckersx)	1	75.48	75.48	0	0.00
33316.	Lucas (lucas_a04)	1	95.55	95.55	0	0.00
33317.	Lucas (lucasmoc47)	1	69.36	69.36	1	100.00
33318.	Luca (lucaro2708)	1	90.25	90.25	1	100.00
33319.	Luca (lucadwong)	1	125.42	125.42	1	100.00
33320.	BC (lspss99168)	1	36.29	36.29	0	0.00
33321.	lquenti (lquenti)	1	83.44	83.44	1	100.00
33322.	Nguyen (lqinfinity)	1	52.96	52.96	1	100.00
33323.	jellio (lo_mava)	1	51.93	51.93	0	0.00
33324.	ivano (lostmusician)	1	79.37	79.37	0	0.00
33325.	Lost (losthalo)	1	81.53	81.53	0	0.00
33326.	Louis (lorencoo)	1	59.54	59.54	0	0.00
33327.	Justin (loremasterginger)	1	107.20	107.20	1	100.00
33328.	Klenn C-zar (lordklenzki)	1	32.82	32.82	0	0.00
33329.	Bence (lordbenczor)	1	44.02	44.02	0	0.00
33330.	Ink (lordcubes)	1	111.02	111.02	0	0.00
33331.	LordBanana23 (lordbanana23)	1	124.04	124.04	1	100.00
33332.	JB (lookitsjb)	1	114.06	114.06	0	0.00
33333.	Derick (lolman1312)	1	106.69	106.69	1	100.00
33334.	Nicolas (lollipopmania)	1	99.85	99.85	0	0.00
33335.	Lorenzo (lolgab)	1	71.13	71.13	1	100.00
33336.	Serge (lolegend)	1	109.20	109.20	1	100.00
33337.	Loki (loki5611)	1	57.04	57.04	1	100.00
33338.	Nikita (loginezz)	1	86.56	86.56	1	100.00
33339.	Kevin (logia)	1	96.04	96.04	0	0.00
33340.	Zekus (loczx)	1	92.28	92.28	1	100.00
33341.	Jacky (lo2238)	1	59.53	59.53	0	0.00
33342.	Lmnoq (lmnoq)	1	63.66	63.66	1	100.00
33343.	Geoff (lmaousucksobad23)	1	32.84	32.84	0	0.00
33344.	lkary (lkary)	1	86.07	86.07	1	100.00
33345.	Laurie (lkampster)	1	38.91	38.91	0	0.00
33346.	Liz (lizzyshoe)	1	87.91	87.91	0	0.00
33347.	Liwamster (liwamster15)	1	102.03	102.03	0	0.00
33348.	Livacy (livacy)	1	47.21	47.21	0	0.00
33349.	ben (liubenjamin)	1	114.18	114.18	0	0.00
33350.	troy (little_bro)	1	74.71	74.71	0	0.00
33351.	Pastasciutta (littleppig)	1	65.01	65.01	0	0.00
33352.	SN (littlemaster)	1	52.60	52.60	0	0.00
33353.	George (lirick)	1	77.51	77.51	0	0.00
33354.	Liotom (liotom)	1	37.32	37.32	0	0.00
33355.	roy (lin_ring)	1	42.28	42.28	0	0.00
33356.	Lion (lionpride)	1	74.52	74.52	0	0.00
33357.	LingLingAlex (linglingalex)	1	73.89	73.89	0	0.00
33358.	lindee (lindee)	1	99.45	99.45	0	0.00
33359.	limeslime (limeslime_)	1	65.18	65.18	1	100.00
33360.	Tom (limera2nn)	1	91.16	91.16	0	0.00
33361.	Bradley (lil_mayoe)	1	103.41	103.41	1	100.00
33362.	Sriram (lil_india)	1	77.76	77.76	0	0.00
33363.	Aaron (lil_bamboo)	1	82.15	82.15	1	100.00
33364.	Alex (liltypist44)	1	89.55	89.55	0	0.00
33365.	Luka (lilsmole)	1	62.47	62.47	0	0.00
33366.	Gurgug (lilskrimp)	1	68.47	68.47	0	0.00
33367.	Lilly (lillymallory13)	1	61.76	61.76	1	100.00
33368.	Jackee (lilbully)	1	101.49	101.49	1	100.00
33369.	Likhon (likhon5)	1	64.02	64.02	0	0.00
33370.	Drake (likerofrisk)	1	91.42	91.42	1	100.00
33371.	andy (lihanou)	1	110.43	110.43	0	0.00
33372.	Light (lightpuma)	1	128.56	128.56	0	0.00
33373.	Muntasir Billah (lights_on_me)	1	82.99	82.99	1	100.00
33374.	lightlleaf (lightlleaf)	1	43.17	43.17	1	100.00
33375.	Steven (lifeinbronze)	1	87.63	87.63	0	0.00
33376.	khari (libsj)	1	59.00	59.00	0	0.00
33377.	Paweł (lewapkon)	1	94.84	94.84	0	0.00
33378.	levi (levi2)	1	46.34	46.34	1	100.00
33379.	Tâm (letam120300)	1	62.19	62.19	0	0.00
33380.	Matthew (lesterholster)	1	115.74	115.74	0	0.00
33381.	Leriut (leriut)	1	84.79	84.79	1	100.00
33382.	Lequim (lequim)	1	79.50	79.50	0	0.00
33383.	Alexander (leprechaun777)	1	78.89	78.89	1	100.00
33384.	Rui (leonsuper)	1	146.49	146.49	1	100.00
33385.	Leon (leonakerz)	1	85.46	85.46	1	100.00
33386.	M310N (leomelonseeds)	1	133.00	133.00	0	0.00
33387.	Leo (leoc)	1	99.10	99.10	0	0.00
33388.	Lenny (lenny227)	1	54.97	54.97	0	0.00
33389.	🍋 (lemoncrush)	1	120.64	120.64	1	100.00
33390.	Sinh (lekhanhsinhvn)	1	77.29	77.29	1	100.00
33391.	Leif (leif26)	1	59.53	59.53	0	0.00
33392.	Adilkhan (legolaz4ever)	1	31.03	31.03	0	0.00
33393.	Ice (legacyst)	1	111.84	111.84	1	100.00
33394.	fethy (lefty_dz)	1	69.71	69.71	1	100.00
33395.	lebron (lebron_mccain)	1	100.68	100.68	1	100.00
33396.	MrBusiness (leboii)	1	78.34	78.34	1	100.00
33397.	Lea (lea_134)	1	58.04	58.04	1	100.00
33398.	Prabuddha (learning2type1414)	1	43.67	43.67	0	0.00
33399.	Leander (leandertaler)	1	51.58	51.58	1	100.00
33400.	La Rana (la_rana_rene)	1	29.82	29.82	0	0.00
33401.	Lazi (lazi)	1	35.06	35.06	0	0.00
33402.	Raidon (laxprax)	1	74.55	74.55	0	0.00
33403.	Harvey (lawyer001)	1	48.87	48.87	0	0.00
33404.	ARGENTINA (lautixhx)	1	86.67	86.67	1	100.00
33405.	Lauro (laurorehr)	1	34.39	34.39	0	0.00
33406.	Laura (lauraab)	1	64.96	64.96	0	0.00
33407.	Liam (laum)	1	73.03	73.03	1	100.00
33408.	Laurits (laulaudk)	1	72.36	72.36	0	0.00
33409.	Sam (latenightsnacks)	1	60.88	60.88	0	0.00
33410.	Late Night Snack (latenight...	1	78.08	78.08	1	100.00
33411.	abhilash (lash_32768)	1	81.02	81.02	0	0.00
33412.	Andy (largahblarga)	1	76.43	76.43	0	0.00
33413.	taste (lan9erhans)	1	69.30	69.30	0	0.00
33414.	Lâm (lamisgosu11)	1	88.95	88.95	0	0.00
33415.	Cenk (lambdaa)	1	119.76	119.76	1	100.00
33416.	Ami (lambchop01)	1	89.93	89.93	1	100.00
33417.	Kuchiro (lalelilolu)	1	45.87	45.87	0	0.00
33418.	Laith (laith_gg)	1	81.07	81.07	1	100.00
33419.	Laird (lairdandrew)	1	83.71	83.71	0	0.00
33420.	Lagartixa (lagartixa16)	1	34.97	34.97	0	0.00
33421.	LotHtoJ (laessig)	1	65.95	65.95	0	0.00
33422.	LaBond (labond123)	1	59.50	59.50	0	0.00
33423.	Dust (l4sts0ul)	1	76.37	76.37	0	0.00
33424.	l1gh7vel (l1gh7vel)	1	61.28	61.28	0	0.00
33425.	Karl (kzlotn2)	1	121.08	121.08	0	0.00
33426.	kytan (kyte11)	1	112.82	112.82	1	100.00
33427.	Kyu (kyuche)	1	94.94	94.94	0	0.00
33428.	Kyotz (kyotz)	1	85.77	85.77	0	0.00
33429.	Vaidas (kybynas)	1	60.22	60.22	1	100.00
33430.	Ken (kyberken)	1	89.60	89.60	0	0.00
33431.	Katrina (kweinma)	1	76.87	76.87	1	100.00
33432.	Kwait (kwait)	1	109.38	109.38	1	100.00
33433.	Lucas (kuttey)	1	82.81	82.81	1	100.00
33434.	Lars (kung_fu_kenny)	1	109.87	109.87	1	100.00
33435.	halvard (kulsol02)	1	64.55	64.55	0	0.00
33436.	kulau (kulau04)	1	82.57	82.57	1	100.00
33437.	Andreas (kukkaa)	1	114.68	114.68	1	100.00
33438.	hyper riper viper typer (ku...	1	83.17	83.17	0	0.00
33439.	My dik is hard (kubatmoffic...	1	64.70	64.70	0	0.00
33440.	Antonek (kubanczyk)	1	42.33	42.33	0	0.00
33441.	Karis (ktoothman)	1	55.85	55.85	0	0.00
33442.	ksilentstorm (ksilentstorm)	1	71.47	71.47	0	0.00
33443.	Kieran (kshawarma)	1	101.84	101.84	1	100.00
33444.	Morgan (kryptik_boogie)	1	75.81	75.81	0	0.00
33445.	Kruxey (kruxey)	1	90.14	90.14	0	0.00
33446.	Krona (krona_)	1	62.09	62.09	0	0.00
33447.	Krisu (krisu_the_legend)	1	106.15	106.15	0	0.00
33448.	krisko_bg (krisko_bg)	1	61.15	61.15	0	0.00
33449.	Kriime (kriime)	1	105.72	105.72	1	100.00
33450.	Muhammad Dwi (krauchelli)	1	70.81	70.81	1	100.00
33451.	kralty ツ (kralty)	1	86.24	86.24	0	0.00
33452.	K (kqp3)	1	60.06	60.06	0	0.00
33453.	Kevin (kpark0421)	1	101.37	101.37	0	0.00
33454.	Jacob (kowalski_boi)	1	73.05	73.05	0	0.00
33455.	KouTypin (kou_typingood)	1	88.34	88.34	1	100.00
33456.	Aaron (kountervibe)	1	79.89	79.89	0	0.00
33457.	Kougrafighter (kougrafighter)	1	74.19	74.19	0	0.00
33458.	koscia (koscia)	1	73.26	73.26	0	0.00
33459.	Kareem (korosei)	1	95.18	95.18	0	0.00
33460.	Oscar (koppernatt)	1	52.87	52.87	0	0.00
33461.	ckaasfds (kopiipase)	1	77.39	77.39	0	0.00
33462.	kool (koolfiger)	1	81.35	81.35	1	100.00
33463.	Konstantinos (konstantop)	1	90.88	90.88	0	0.00
33464.	kitipat (kong0497)	1	92.55	92.55	1	100.00
33465.	Kuloa (koldou)	1	73.42	73.42	0	0.00
33466.	Koji (kojji)	1	117.92	117.92	1	100.00
33467.	Koga (koganeicchi)	1	121.02	121.02	0	0.00
33468.	Koen (koen1)	1	76.01	76.01	1	100.00
33469.	katy (koalatykaty)	1	92.53	92.53	0	0.00
33470.	Jemuel (koalatea)	1	108.48	108.48	1	100.00
33471.	triplealpha (knytehawke)	1	123.16	123.16	0	0.00
33472.	Raadek (knr24)	1	122.17	122.17	0	0.00
33473.	KnowItAllKing (knowitallking)	1	125.50	125.50	1	100.00
33474.	Kukk (knightpikachu)	1	110.72	110.72	0	0.00
33475.	Zerato (knaell)	1	68.45	68.45	0	0.00
33476.	Kitt (kmet5)	1	82.44	82.44	0	0.00
33477.	klystt (klystt)	1	116.35	116.35	1	100.00
33478.	Chloe (klohwii)	1	70.16	70.16	0	0.00
33479.	Keegan (klav)	1	110.60	110.60	0	0.00
33480.	Keshav (kksu278)	1	69.45	69.45	0	0.00
33481.	King (kjarr)	1	100.57	100.57	1	100.00
33482.	kiyeo (kiyeo)	1	134.27	134.27	1	100.00
33483.	Kiun (kiunkim)	1	86.71	86.71	0	0.00
33484.	Martin (kitikonti)	1	57.10	57.10	0	0.00
33485.	Kishan (kishan150)	1	54.54	54.54	0	0.00
33486.	Jon (kiryu610)	1	125.24	125.24	1	100.00
33487.	KirBei (kirbei)	1	130.27	130.27	1	100.00
33488.	kira (kirayes)	1	74.81	74.81	1	100.00
33489.	Henrique (kiraly2006)	1	69.47	69.47	0	0.00
33490.	imtrash (kipakers)	1	45.28	45.28	0	0.00
33491.	Zong (kingzong)	1	94.25	94.25	0	0.00
33492.	Kingz (kingzcostz)	1	66.77	66.77	0	0.00
33493.	Vincent (kingvince160)	1	68.44	68.44	0	0.00
33494.	Justin (kingtempo)	1	87.90	87.90	0	0.00
33495.	king (kingstealth)	1	144.95	144.95	1	100.00
33496.	Kingreformed (kingreformed)	1	137.38	137.38	1	100.00
33497.	Sarao Jeepney (kingoftheroad)	1	91.13	91.13	0	0.00
33498.	Nicolas (kingofpandas)	1	101.37	101.37	0	0.00
33499.	Justin (kinglebron23)	1	112.80	112.80	1	100.00
33500.	KPS (kingkps)	1	108.87	108.87	1	100.00
33501.	Mick (kingkasma24)	1	23.12	23.12	0	0.00
33502.	Max (kingjahan2)	1	70.36	70.36	0	0.00
33503.	King (king77)	1	94.57	94.57	1	100.00
33504.	KindledCroissant (kindledcr...	1	66.02	66.02	1	100.00
33505.	Sexy (kimochichinchin)	1	90.69	90.69	1	100.00
33506.	jason (kimjongdos)	1	57.83	57.83	0	0.00
33507.	kimi (kimix)	1	53.75	53.75	0	0.00
33508.	Kimberly (kimberlame)	1	92.92	92.92	1	100.00
33509.	Kill (killyourself1234)	1	115.82	115.82	0	0.00
33510.	Subhabrata (kikni)	1	33.64	33.64	0	0.00
33511.	Kiki (kikichan86)	1	126.42	126.42	1	100.00
33512.	karina (kiinqdom)	1	100.93	100.93	1	100.00
33513.	no (khomi)	1	44.54	44.54	0	0.00
33514.	Khong (khong_eiei)	1	98.81	98.81	1	100.00
33515.	khoa (khoa2k1)	1	31.67	31.67	0	0.00
33516.	Nouman (khanusama)	1	44.06	44.06	0	0.00
33517.	Khalid (khalidramadan)	1	49.17	49.17	0	0.00
33518.	keziah (keziah_p)	1	35.29	35.29	0	0.00
33519.	Jenny (key_board_cat)	1	62.40	62.40	1	100.00
33520.	B.A.D. (keylimeshortcake)	1	86.40	86.40	1	100.00
33521.	Kevin (kevinyeh)	1	92.67	92.67	0	0.00
33522.	Kevin (kevinrodas)	1	65.22	65.22	0	0.00
33523.	Kevin (kevinisgay)	1	115.15	115.15	1	100.00
33524.	Kevin (kevin6ooo)	1	100.05	100.05	1	100.00
33525.	Ketan (ketanprakash001)	1	58.73	58.73	0	0.00
33526.	. (kestrel342)	1	87.93	87.93	1	100.00
33527.	Marcin (keshy)	1	89.12	89.12	0	0.00
33528.	keshav (keshavsarraf)	1	48.43	48.43	0	0.00
33529.	Keshav (keshavjindaljp)	1	58.92	58.92	0	0.00
33530.	Kerolyte (kerolyte)	1	105.82	105.82	0	0.00
33531.	Sebastian (kernfusionator)	1	71.64	71.64	1	100.00
33532.	kepler1729 (kepler1729)	1	124.58	124.58	0	0.00
33533.	kent (kenttranle)	1	88.22	88.22	0	0.00
33534.	獣耳尻尾 (kemomimishippo)	1	103.56	103.56	0	0.00
33535.	Kelly (kellyhunter03)	1	89.98	89.98	1	100.00
33536.	KINA (keithisnotalive)	1	42.54	42.54	0	0.00
33537.	Keira (keiramc)	1	63.53	63.53	0	0.00
33538.	Keiji (keiji453)	1	71.22	71.22	1	100.00
33539.	keiko (keiiko)	1	99.62	99.62	0	0.00
33540.	kelvin (kefun)	1	111.93	111.93	0	0.00
33541.	Kiana (keeyahnajoyce)	1	108.60	108.60	1	100.00
33542.	keelsveb (keelsveb)	1	81.50	81.50	0	0.00
33543.	Kendra (kcviloria)	1	89.29	89.29	1	100.00
33544.	misumi (kazytypes)	1	125.66	125.66	1	100.00
33545.	Kaz (kazuerdos)	1	117.97	117.97	1	100.00
33546.	Kevin (kazhu)	1	77.39	77.39	0	0.00
33547.	kaya (kayax)	1	58.84	58.84	0	0.00
33548.	kawi (kawion)	1	84.87	84.87	0	0.00
33549.	Kavi (kavit)	1	64.51	64.51	0	0.00
33550.	blueberry (katie_18)	1	56.82	56.82	0	0.00
33551.	katie (katieee1)	1	48.18	48.18	0	0.00
33552.	kath (kath1104)	1	45.62	45.62	0	0.00
33553.	Timo (karuso33)	1	81.70	81.70	1	100.00
33554.	Tris (karma_nii)	1	45.43	45.43	0	0.00
33555.	Karolos (kariolos)	1	80.95	80.95	1	100.00
33556.	Karim (karim_ch)	1	47.76	47.76	0	0.00
33557.	Kyle (kapleer)	1	130.52	130.52	0	0.00
33558.	Mid Racer (kaosfear)	1	82.91	82.91	1	100.00
33559.	Azatbek (kanybekov66)	1	68.63	68.63	0	0.00
33560.	Benji (kannnix95)	1	35.13	35.13	0	0.00
33561.	Kanish (kanish)	1	38.68	38.68	0	0.00
33562.	presu (kanjotribe)	1	45.96	45.96	1	100.00
33563.	Greggory (kaneki26)	1	43.11	43.11	0	0.00
33564.	Brandon (kamisama_1)	1	99.63	99.63	0	0.00
33565.	kamincai (kamincai)	1	71.26	71.26	1	100.00
33566.	kamal nath (kamal3772)	1	69.31	69.31	1	100.00
33567.	yoshiki (kalog46)	1	76.32	76.32	0	0.00
33568.	Karl (kallekiwi)	1	51.25	51.25	0	0.00
33569.	Kaitlyn (kaitlyam)	1	109.04	109.04	1	100.00
33570.	Kaiserkaiser3 (kaiserkaiser3)	1	58.20	58.20	0	0.00
33571.	K (k3nl4w)	1	93.50	93.50	0	0.00
33572.	jaybird (j__j)	1	83.75	83.75	1	100.00
33573.	Jordan (j_kid)	1	56.42	56.42	0	0.00
33574.	HHKBest (jywh91)	1	116.90	116.90	1	100.00
33575.	JY (jy82828)	1	89.79	89.79	1	100.00
33576.	Jaden (jxden)	1	59.79	59.79	0	0.00
33577.	Jonathan (jwoo516)	1	56.14	56.14	0	0.00
33578.	juyvs (juyvss)	1	67.41	67.41	0	0.00
33579.	Juuzou (juuzou__)	1	113.85	113.85	1	100.00
33580.	JuaanNgemtod (juuaaaaan)	1	47.57	47.57	0	0.00
33581.	tromboner (just_tromboner42...	1	50.19	50.19	0	0.00
33582.	Luis (justluisb)	1	71.28	71.28	0	0.00
33583.	Justin (justinpatrick1011)	1	105.17	105.17	0	0.00
33584.	Justin (justinparra18)	1	65.50	65.50	0	0.00
33585.	Justin (justinliu2000)	1	110.62	110.62	1	100.00
33586.	JustBoyM8 (justboym8)	1	82.63	82.63	1	100.00
33587.	Michael (justatyperforfun)	1	114.13	114.13	1	100.00
33588.	Benjamin (justaregularnerd)	1	100.91	100.91	1	100.00
33589.	jus102res (jus102res)	1	89.26	89.26	1	100.00
33590.	Junch (junchoooo)	1	34.92	34.92	0	0.00
33591.	Jumbo (jumbolegend)	1	79.56	79.56	0	0.00
33592.	Julie (juliehuynh654252)	1	106.28	106.28	1	100.00
33593.	Julia (julia22202)	1	81.40	81.40	0	0.00
33594.	Julian (julbball)	1	87.91	87.91	0	0.00
33595.	Julian (judaslan)	1	27.19	27.19	0	0.00
33596.	Josh (jubskiko)	1	50.73	50.73	0	0.00
33597.	jubaer (jubaer_maruf)	1	7.36	7.36	0	0.00
33598.	Juan (juanma9191)	1	75.67	75.67	1	100.00
33599.	William (jt_001)	1	85.74	85.74	0	0.00
33600.	jTactics (jtactics)	1	95.43	95.43	0	0.00
33601.	System (jsystem75)	1	77.83	77.83	0	0.00
33602.	Jamie (jswain)	1	76.44	76.44	0	0.00
33603.	John (jstokes001)	1	79.52	79.52	0	0.00
33604.	Jalen (jsaucegawd)	1	58.94	58.94	0	0.00
33605.	Jared (jrod44)	1	99.79	99.79	0	0.00
33606.	matt (jrm8999)	1	55.73	55.73	1	100.00
33607.	Christopher (jr1995)	1	54.09	54.09	0	0.00
33608.	bruh (jqzz)	1	107.87	107.87	0	0.00
33609.	Jqmfg (jqmfg)	1	114.72	114.72	1	100.00
33610.	FJB (joyousmischief)	1	62.33	62.33	0	0.00
33611.	Josiah (josiahforever)	1	162.85	162.85	1	100.00
33612.	Josh (joshywashyy)	1	90.49	90.49	0	0.00
33613.	Josh (joshybigmac)	1	105.12	105.12	1	100.00
33614.	Joshua (joshuavtk)	1	72.70	72.70	0	0.00
33615.	Joshua (joshuajerremy)	1	78.71	78.71	1	100.00
33616.	Joshua (joshuagil23)	1	76.33	76.33	1	100.00
33617.	Josh (joshua798)	1	58.81	58.81	0	0.00
33618.	Joseph (josephyunzz)	1	110.14	110.14	1	100.00
33619.	juni (jooun)	1	83.45	83.45	0	0.00
33620.	Jones (jones72)	1	55.73	55.73	0	0.00
33621.	Jonathan (jonathantf2)	1	85.24	85.24	1	100.00
33622.	Jonas (jonasjuni)	1	47.57	47.57	0	0.00
33623.	Jonas (jonasjul)	1	63.54	63.54	0	0.00
33624.	Zhomart (jomakasi)	1	68.81	68.81	0	0.00
33625.	kazzi (jokerivy)	1	35.67	35.67	0	0.00
33626.	Jordan (jojo2ooo)	1	53.86	53.86	0	0.00
33627.	Bob (john_the_racer)	1	83.85	83.85	0	0.00
33628.	Keyser Söze (johnomaha)	1	73.58	73.58	0	0.00
33629.	John (johnmarquez1706)	1	134.94	134.94	1	100.00
33630.	Joey (joey_v)	1	100.01	100.01	0	0.00
33631.	Home (joeyhockey77)	1	77.59	77.59	0	0.00
33632.	Jxp (jodoe)	1	74.16	74.16	0	0.00
33633.	John (jodingus)	1	102.93	102.93	1	100.00
33634.	MRSICKOMODE (jodiddy)	1	90.27	90.27	0	0.00
33635.	Joao Antonio (joaoagouveia)	1	63.49	63.49	1	100.00
33636.	Jonas (jnshey)	1	70.77	70.77	0	0.00
33637.	Johnnie (jnednh)	1	91.99	91.99	0	0.00
33638.	JnanaDeep (jnana_deep8)	1	61.13	61.13	0	0.00
33639.	Meade (jmkling)	1	104.50	104.50	1	100.00
33640.	Jacquelin (jmillard821)	1	110.97	110.97	0	0.00
33641.	James (jmesyang)	1	80.80	80.80	0	0.00
33642.	jlxip (jlxip)	1	131.14	131.14	1	100.00
33643.	Jeydin (jjthejetship)	1	100.81	100.81	1	100.00
33644.	Jonathan (jjones0598)	1	97.59	97.59	0	0.00
33645.	Julia (jjin2005)	1	82.98	82.98	0	0.00
33646.	Jiten (jiten123)	1	126.02	126.02	0	0.00
33647.	Jio (jioo)	1	84.19	84.19	0	0.00
33648.	jin (jinyt911)	1	115.51	115.51	0	0.00
33649.	Jinkas (jinkas)	1	119.32	119.32	1	100.00
33650.	GodPeanut (jingtian)	1	90.46	90.46	1	100.00
33651.	Mashuke Alam (jim_99)	1	55.57	55.57	0	0.00
33652.	jimi (jimiwimi)	1	25.68	25.68	0	0.00
33653.	jiin (jiinko11)	1	101.34	101.34	0	0.00
33654.	Ramon (jick_wipe)	1	86.84	86.84	1	100.00
33655.	Julz (jhullzz)	1	94.43	94.43	0	0.00
33656.	Jhin (jhin4)	1	60.57	60.57	0	0.00
33657.	John (jgetachew)	1	77.18	77.18	0	0.00
33658.	JFuzion (jfuzion)	1	80.93	80.93	1	100.00
33659.	GodHimself (jesuschristtypes)	1	50.08	50.08	0	0.00
33660.	Victor (jesuschrist2003)	1	151.73	151.73	1	100.00
33661.	Jessia (jessia25)	1	56.70	56.70	0	0.00
33662.	Aayush (jerry_dank)	1	102.11	102.11	0	0.00
33663.	Tom (jeronex)	1	99.76	99.76	1	100.00
33664.	Jeriah (jeriahcariahmessiah)	1	113.51	113.51	1	100.00
33665.	Jeremy (jeremytreadway)	1	80.93	80.93	0	0.00
33666.	Jeoondra (jeoondra)	1	50.80	50.80	0	0.00
33667.	Jens (jenspenneman)	1	50.79	50.79	0	0.00
33668.	Joël (jenol)	1	85.02	85.02	1	100.00
33669.	Jenn (jenn_ahn)	1	96.25	96.25	1	100.00
33670.	Jenni (jenni02)	1	48.94	48.94	0	0.00
33671.	Enoch (jenks12)	1	88.23	88.23	1	100.00
33672.	Jenette (jenetttte)	1	86.55	86.55	0	0.00
33673.	George (jempii)	1	86.03	86.03	1	100.00
33674.	jelos0n (jelos)	1	45.92	45.92	1	100.00
33675.	Cory (jellygoku)	1	70.46	70.46	0	0.00
33676.	Jello (jellomoto)	1	83.52	83.52	0	0.00
33677.	JEHADUR (jehad)	1	20.30	20.30	0	0.00
33678.	Jeff (jeffzazzles)	1	83.84	83.84	0	0.00
33679.	Jeffrey (jeffreedom29)	1	53.45	53.45	1	100.00
33680.	Clarence (jeffdaddybezos)	1	94.54	94.54	1	100.00
33681.	Jed (jedski)	1	68.88	68.88	1	100.00
33682.	J (jebss)	1	83.17	83.17	1	100.00
33683.	Aleksi (jeboust)	1	68.34	68.34	0	0.00
33684.	nathan (jebaithan)	1	72.78	72.78	0	0.00
33685.	Jonathan (jdamico)	1	82.74	82.74	0	0.00
33686.	Josh (jctilton03)	1	102.12	102.12	1	100.00
33687.	Jonathan (jclausen05)	1	52.67	52.67	0	0.00
33688.	Joerg (jcgx)	1	38.75	38.75	0	0.00
33689.	tstats[jcagz] (jcagz)	1	70.32	70.32	0	0.00
33690.	James (jbrain3000)	1	90.31	90.31	0	0.00
33691.	Jason (jb33000)	1	99.25	99.25	1	100.00
33692.	João Pedro (jaydaltro)	1	66.03	66.03	0	0.00
33693.	jawnnyp (jawnnyp)	1	90.44	90.44	0	0.00
33694.	J.T. (javajohn29)	1	86.62	86.62	0	0.00
33695.	twitch.tv/cellytherosebush ...	1	118.06	118.06	0	0.00
33696.	Jasper (jasperclemente)	1	65.43	65.43	0	0.00
33697.	Jason (jason_yessir)	1	89.55	89.55	0	0.00
33698.	Jason (jasongog)	1	93.31	93.31	1	100.00
33699.	Jason (jasonf2001)	1	112.46	112.46	0	0.00
33700.	Jason (jason1994)	1	64.54	64.54	0	0.00
33701.	Jarvis (jarvistheai)	1	51.80	51.80	0	0.00
33702.	fajar (jarrrr)	1	47.93	47.93	0	0.00
33703.	Jarrett (jarrettedward)	1	87.66	87.66	0	0.00
33704.	James (jarmez)	1	84.60	84.60	0	0.00
33705.	Jappie (jappiegrappie)	1	46.49	46.49	1	100.00
33706.	Matt (januality)	1	53.93	53.93	0	0.00
33707.	micaela (janismine)	1	72.42	72.42	0	0.00
33708.	Jarrod (jandojanderson)	1	88.87	88.87	1	100.00
33709.	yavor (janb99)	1	95.74	95.74	0	0.00
33710.	Jamx (jamxjam)	1	105.16	105.16	1	100.00
33711.	James (james2021)	1	42.56	42.56	0	0.00
33712.	Jacob (jakedup)	1	74.49	74.49	1	100.00
33713.	Jared (jagunlimited81)	1	68.19	68.19	1	100.00
33714.	Jagger (jagswag28)	1	102.77	102.77	1	100.00
33715.	jacob (jacobshane)	1	45.50	45.50	0	0.00
33716.	Jack (jack_ery)	1	62.22	62.22	0	0.00
33717.	jacky (jacky32)	1	85.31	85.31	0	0.00
33718.	Jack (jackwitherell)	1	73.33	73.33	1	100.00
33719.	Jack (jackb1379)	1	84.43	84.43	1	100.00
33720.	Jack (jackaka)	1	62.04	62.04	0	0.00
33721.	jack (jack824)	1	44.01	44.01	0	0.00
33722.	QHadron (jack2980)	1	82.19	82.19	1	100.00
33723.	Jacob (jabub)	1	47.09	47.09	0	0.00
33724.	Jaan (jaans18)	1	85.29	85.29	1	100.00
33725.	James (j4mce)	1	74.14	74.14	0	0.00
33726.	DiscoveryAlpha (j2997)	1	89.48	89.48	0	0.00
33727.	Lea (j0s7_s0m3b0d7)	1	51.61	51.61	0	0.00
33728.	. (i_need_skillz)	1	90.16	90.16	0	0.00
33729.	Eugene (i_am_neo)	1	71.03	71.03	1	100.00
33730.	Not a dog (i_am_learning_to...	1	83.62	83.62	1	100.00
33731.	Joseph (iwsif)	1	62.07	62.07	0	0.00
33732.	J (iwantmedals)	1	144.09	144.09	1	100.00
33733.	Ivan (ivan_suvorov)	1	69.44	69.44	1	100.00
33734.	Ivan (ivan_m21)	1	69.44	69.44	1	100.00
33735.	Ivana (ivanab)	1	63.44	63.44	0	0.00
33736.	Josh (itztaayoooo)	1	118.81	118.81	1	100.00
33737.	SIlver (itzsilver)	1	51.48	51.48	0	0.00
33738.	ItzInstinct (itzinstinct)	1	47.40	47.40	0	0.00
33739.	Terrence (itzardtypes)	1	56.74	56.74	0	0.00
33740.	ken (itypeslowasf)	1	58.19	58.19	0	0.00
33741.	Ken (ittipat)	1	52.68	52.68	0	0.00
33742.	Vee (itveve)	1	67.16	67.16	0	0.00
33743.	John (ittakesavillage)	1	87.08	87.08	1	100.00
33744.	Ian (its_ianj)	1	49.01	49.01	0	0.00
33745.	I Be (itsthamista)	1	60.61	60.61	0	0.00
33746.	Zoljargal (itsnotzoloo)	1	81.56	81.56	0	0.00
33747.	Marko (itsmko)	1	79.10	79.10	1	100.00
33748.	Jasper (itsjasper)	1	84.96	84.96	1	100.00
33749.	ItsInsanity (itsinsanity)	1	86.74	86.74	0	0.00
33750.	Chris (itseverydaybro)	1	104.76	104.76	1	100.00
33751.	Kelvin (itscatsu)	1	86.37	86.37	0	0.00
33752.	Blessed (itsblessedxx)	1	58.04	58.04	0	0.00
33753.	Itay (itaylol)	1	84.18	84.18	1	100.00
33754.	Jj (issajacob)	1	86.99	86.99	1	100.00
33755.	IsMythic (ismythic)	1	70.15	70.15	0	0.00
33756.	islamb20 (islamb20)	1	66.94	66.94	0	0.00
33757.	Ish (ish_)	1	24.55	24.55	0	0.00
33758.	Ishark (ishark)	1	152.14	152.14	1	100.00
33759.	irsyad (irsyad99)	1	29.74	29.74	1	100.00
33760.	ireeg (ireeggg)	1	19.84	19.84	0	0.00
33761.	Islam (iotegaliyev)	1	47.74	47.74	0	0.00
33762.	Ben (intenex)	1	139.29	139.29	1	100.00
33763.	insxmnimaniac (insxmnimaniac)	1	60.69	60.69	0	0.00
33764.	Instinct_man (instinct_man)	1	72.06	72.06	0	0.00
33765.	Insight (insight)	1	99.10	99.10	0	0.00
33766.	InsaneBiff (insanebiff)	1	111.77	111.77	1	100.00
33767.	Akshay (ins4nity_god)	1	70.47	70.47	0	0.00
33768.	InnerPotat (innerpotat)	1	94.51	94.51	1	100.00
33769.	Victor (inkpiernofingla)	1	106.57	106.57	1	100.00
33770.	Omar (infus3d)	1	91.59	91.59	0	0.00
33771.	Shaiyaan (infinitysc)	1	85.18	85.18	0	0.00
33772.	InfernoHues (infernohues)	1	77.16	77.16	0	0.00
33773.	Kevin (infern0)	1	111.56	111.56	0	0.00
33774.	Inderpreet (indergnps)	1	90.68	90.68	1	100.00
33775.	Iñaki (inakigv)	1	79.86	79.86	0	0.00
33776.	Angelo (im_quasar)	1	74.25	74.25	0	0.00
33777.	Tyler (imthe13055)	1	84.01	84.01	1	100.00
33778.	A7md (implore)	1	99.12	99.12	0	0.00
33779.	Winston (imonlytypingwithtw...	1	96.64	96.64	0	0.00
33780.	Im (imkrypton)	1	61.65	61.65	0	0.00
33781.	J (imkidding)	1	71.41	71.41	0	0.00
33782.	jm (imjm)	1	55.23	55.23	1	100.00
33783.	Fries (imfriez)	1	64.14	64.14	1	100.00
33784.	Kun (imdavidboi)	1	68.03	68.03	0	0.00
33785.	Ima (ima_baka)	1	62.94	62.94	0	0.00
33786.	Imambek (imambek)	1	55.27	55.27	0	0.00
33787.	Ilz (ilzwalrus)	1	124.40	124.40	1	100.00
33788.	pee (iluvuhi)	1	100.36	100.36	0	0.00
33789.	Iluminuss (iluminuss)	1	59.63	59.63	0	0.00
33790.	Austin (illumi97)	1	84.98	84.98	0	0.00
33791.	ilias (iliasnik21)	1	70.92	70.92	0	0.00
33792.	yali (ilayali02)	1	52.04	52.04	0	0.00
33793.	Ikkue (ikkue)	1	64.17	64.17	1	100.00
33794.	Ike11000 (ike11000)	1	81.22	81.22	0	0.00
33795.	Ilmi (ikalam89)	1	69.34	69.34	0	0.00
33796.	John (ihavebigpen15)	1	87.59	87.59	0	0.00
33797.	🎃 (igorslow)	1	89.36	89.36	0	0.00
33798.	Igor (igorjosifoski)	1	119.73	119.73	1	100.00
33799.	Sean (igetass)	1	103.49	103.49	1	100.00
33800.	paul [nZk] (igaikaze)	1	103.43	103.43	0	0.00
33801.	IFo Hancroft (ifohancroft)	1	95.27	95.27	1	100.00
33802.	Sir (ieza)	1	61.81	61.81	1	100.00
33803.	Idrm (idrm)	1	69.81	69.81	1	100.00
33804.	(◕‿◕✿) (idkbruv)	1	98.34	98.34	0	0.00
33805.	Shivam (idi_cyka)	1	90.87	90.87	1	100.00
33806.	👀👀👀 (idakk)	1	161.70	161.70	1	100.00
33807.	ichbin (ichbin)	1	67.02	67.02	0	0.00
33808.	Icey (iceystars99)	1	68.15	68.15	0	0.00
33809.	aeriall (icebear123)	1	44.80	44.80	1	100.00
33810.	MD IBRAHIM (ibrahim827)	1	30.71	30.71	0	0.00
33811.	Ibo (ibosaka)	1	85.48	85.48	1	100.00
33812.	Joe (ibelaxin)	1	92.32	92.32	0	0.00
33813.	Anthony (ianozia)	1	100.65	100.65	1	100.00
33814.	Ian (ianlofland)	1	41.50	41.50	0	0.00
33815.	Laco (ian860824)	1	70.76	70.76	0	0.00
33816.	Ben (iamveryslowlol)	1	88.13	88.13	0	0.00
33817.	Thomas (iamstrategy)	1	64.86	64.86	1	100.00
33818.	IAmSpeed (iamspeed3015)	1	85.07	85.07	1	100.00
33819.	Lue (iamoofu)	1	128.99	128.99	1	100.00
33820.	Colemark (iamkenzo)	1	59.74	59.74	0	0.00
33821.	Denis (iamdenis03)	1	53.09	53.09	1	100.00
33822.	Brodie (iambrodie)	1	87.22	87.22	1	100.00
33823.	Eric (iamanormaldog)	1	61.83	61.83	1	100.00
33824.	vliv (hyte)	1	44.31	44.31	0	0.00
33825.	hypophrenia (hypophrenia_3)	1	69.26	69.26	0	0.00
33826.	hydratedcat (hydratedcat)	1	98.85	98.85	1	100.00
33827.	Houssen (huzzen)	1	52.36	52.36	0	0.00
33828.	Huskiez (husky123)	1	137.24	137.24	0	0.00
33829.	Husain (husain_id)	1	33.86	33.86	0	0.00
33830.	Hunter (huntstyperacer)	1	97.98	97.98	1	100.00
33831.	Hunter (huntercoolboi)	1	67.09	67.09	0	0.00
33832.	Carly (huniee)	1	106.36	106.36	1	100.00
33833.	Scott (humji)	1	80.36	80.36	0	0.00
33834.	B (hulk800)	1	100.76	100.76	1	100.00
33835.	Hugo (hugosaer)	1	45.49	45.49	1	100.00
33836.	Huberio (huberio)	1	91.59	91.59	0	0.00
33837.	Hudson (hubbons)	1	48.26	48.26	1	100.00
33838.	HTD (htdbarsii)	1	86.06	86.06	1	100.00
33839.	Han (hsujanet1527)	1	68.40	68.40	1	100.00
33840.	Albert (hsabove)	1	97.13	97.13	0	0.00
33841.	hristo (hritren)	1	43.74	43.74	0	0.00
33842.	Tareq Mahmud (hridoy_089)	1	54.82	54.82	0	0.00
33843.	QWERTY (howtfdoyoutype200wpm)	1	56.08	56.08	1	100.00
33844.	HotZin (hotzin)	1	111.93	111.93	1	100.00
33845.	foo (hotemup)	1	103.80	103.80	1	100.00
33846.	akira (hoshinoakira)	1	142.69	142.69	1	100.00
33847.	Horrendous (horrendousness)	1	104.60	104.60	1	100.00
33848.	Tork (hork)	1	109.58	109.58	0	0.00
33849.	ando (hophosho)	1	46.01	46.01	0	0.00
33850.	Hope (hopefullee)	1	86.32	86.32	1	100.00
33851.	hoonman (hoonman)	1	115.66	115.66	1	100.00
33852.	HonorTiltProof (honortiltpr...	1	77.02	77.02	1	100.00
33853.	Jan (honfi)	1	66.75	66.75	0	0.00
33854.	Honey_Beef (honey_beef)	1	128.96	128.96	0	0.00
33855.	homeslice (homeslic3)	1	89.29	89.29	0	0.00
33856.	Runescape Spam Bot (homer_s...	1	117.44	117.44	1	100.00
33857.	HolyHit (holyhit)	1	62.10	62.10	0	0.00
33858.	jirka2142 (holocaus_byl_ins...	1	69.70	69.70	0	0.00
33859.	Ian (hobbr)	1	99.66	99.66	1	100.00
33860.	Hoang (hoang26hoang)	1	87.70	87.70	1	100.00
33861.	Hkishi (hkishi)	1	101.44	101.44	0	0.00
33862.	chobo (hi_im_chobo)	1	131.76	131.76	1	100.00
33863.	Danel (hi_daniell)	1	82.22	82.22	0	0.00
33864.	Christoffer (hivefive)	1	73.71	73.71	0	0.00
33865.	hxroze (hirose1)	1	90.69	90.69	1	100.00
33866.	hinotori (hinotori)	1	52.05	52.05	0	0.00
33867.	▄︻̷̿┻̿═━一 (h...	1	85.21	85.21	0	0.00
33868.	Hilmoone (hilda_04)	1	34.52	34.52	0	0.00
33869.	milkfoam (hiireath7654)	1	91.83	91.83	0	0.00
33870.	Nate (highvoltage32)	1	46.27	46.27	0	0.00
33871.	Ryder (highryder18)	1	103.62	103.62	1	100.00
33872.	High (highbeach)	1	90.63	90.63	1	100.00
33873.	HiFli (hifli)	1	95.75	95.75	0	0.00
33874.	Hieu (hieu999)	1	52.28	52.28	1	100.00
33875.	Hide (hide_on_bush_ml)	1	146.53	146.53	1	100.00
33876.	Haider (hiderbider)	1	62.82	62.82	0	0.00
33877.	BadMeetsEvi1 (hgrgr43g12)	1	51.18	51.18	0	0.00
33878.	Hector (hg088)	1	83.41	83.41	0	0.00
33879.	HiImGosu (heyimgosu)	1	71.39	71.39	0	0.00
33880.	Heyhey898 (heyhey898)	1	69.22	69.22	1	100.00
33881.	hector (hexbreezy)	1	55.57	55.57	0	0.00
33882.	Hermione (hermione2291)	1	94.84	94.84	0	0.00
33883.	Luke (herding)	1	74.53	74.53	0	0.00
33884.	Zong (helpmeplsss)	1	95.15	95.15	0	0.00
33885.	helpjepp (helpjepp)	1	71.39	71.39	0	0.00
33886.	Helmut (helmutlang)	1	73.85	73.85	0	0.00
33887.	internet asian boy (hell0_i...	1	68.40	68.40	0	0.00
33888.	Helix (helixspiral)	1	128.78	128.78	1	100.00
33889.	Rico (hehel3x)	1	137.73	137.73	1	100.00
33890.	AerythM (hedgepenguin)	1	8.10	8.10	0	0.00
33891.	HedgeLow (hedgelow)	1	88.25	88.25	0	0.00
33892.	Patrick (healingtrout)	1	82.89	82.89	1	100.00
33893.	Dennis (he66pro)	1	79.35	79.35	1	100.00
33894.	gekyou (hbk_rain)	1	81.86	81.86	0	0.00
33895.	Harrison (hbguy1234)	1	111.06	111.06	0	0.00
33896.	Seph (hazedlol)	1	184.37	184.37	1	100.00
33897.	Harry (hazbogga)	1	42.79	42.79	0	0.00
33898.	Hayawardh (hayawardh)	1	97.98	97.98	0	0.00
33899.	Haxgeed (haxgeed)	1	49.68	49.68	0	0.00
33900.	Eines (hawkeines)	1	58.83	58.83	0	0.00
33901.	Ken (haseo_ken)	1	57.23	57.23	1	100.00
33902.	Hasen (hasen)	1	79.58	79.58	0	0.00
33903.	H (harshitos)	1	80.65	80.65	0	0.00
33904.	vernon (harsha90571)	1	47.41	47.41	0	0.00
33905.	Haroon (haroon_shah)	1	103.39	103.39	1	100.00
33906.	hariz (harizgong)	1	55.92	55.92	0	0.00
33907.	Harish (harish1995)	1	59.71	59.71	1	100.00
33908.	haraj (haraj)	1	70.35	70.35	0	0.00
33909.	Han (hantheautist)	1	96.17	96.17	0	0.00
33910.	hansvin (hans_vin)	1	61.34	61.34	0	0.00
33911.	Hang (hangben)	1	76.34	76.34	0	0.00
33912.	Halvor (halvornj)	1	49.41	49.41	0	0.00
33913.	Halo (halo06)	1	76.25	76.25	0	0.00
33914.	melina (halfxheart)	1	114.67	114.67	1	100.00
33915.	Gema (hakushoddd)	1	75.61	75.61	0	0.00
33916.	Hagibobo (hagibobo)	1	70.82	70.82	0	0.00
33917.	Haggis (haggis)	1	93.27	93.27	0	0.00
33918.	Aly UwU (h3mispher3)	1	95.58	95.58	1	100.00
33919.	atlas (h1ng3)	1	71.36	71.36	0	0.00
33920.	g (gvrmaine)	1	80.67	80.67	0	0.00
33921.	Guy (guyprws)	1	51.78	51.78	0	0.00
33922.	Adam (guynnoco)	1	79.84	79.84	0	0.00
33923.	Gustavo (gust4vodev)	1	77.86	77.86	0	0.00
33924.	Gunzo (gunzo_27)	1	56.03	56.03	0	0.00
33925.	guitar (guitarplayer_6)	1	50.04	50.04	0	0.00
33926.	andrea (guilkk)	1	69.64	69.64	0	0.00
33927.	sam (guest99898)	1	68.07	68.07	1	100.00
33928.	GucciHavarti (guccihavarti)	1	87.20	87.20	0	0.00
33929.	Nicolas (guaro_py)	1	74.68	74.68	1	100.00
33930.	Giovanni (gtrgio)	1	35.49	35.49	0	0.00
33931.	GTedZ (gtedz)	1	93.70	93.70	0	0.00
33932.	joe (gstakk)	1	94.71	94.71	0	0.00
33933.	Uroš (grujidis)	1	90.23	90.23	0	0.00
33934.	Grizzly (growling_grizzly)	1	114.30	114.30	1	100.00
33935.	Yes (grovymango)	1	62.24	62.24	0	0.00
33936.	Grosh (groshgoratz)	1	124.16	124.16	1	100.00
33937.	Gemlingur (grommsi)	1	90.73	90.73	1	100.00
33938.	Mike (groinofsteel)	1	53.11	53.11	1	100.00
33939.	GRNCheetah (grncheetah)	1	76.05	76.05	1	100.00
33940.	Jude (grixvous)	1	56.35	56.35	1	100.00
33941.	Giridhar (griffintaimer)	1	73.53	73.53	0	0.00
33942.	greytick (greytick)	1	79.98	79.98	0	0.00
33943.	Andrew (gremlinbaby)	1	101.02	101.02	1	100.00
33944.	Greg (greg605)	1	64.70	64.70	0	0.00
33945.	deshawn (greenspringer)	1	113.22	113.22	0	0.00
33946.	Liam (greensoldierman)	1	95.32	95.32	1	100.00
33947.	Chris (greenbomber)	1	74.59	74.59	0	0.00
33948.	Dimitri Yakovic (grazenburg_)	1	60.12	60.12	0	0.00
33949.	Gray (grayorgrey)	1	66.44	66.44	0	0.00
33950.	Andrew (grandpa2390)	1	92.24	92.24	1	100.00
33951.	Nick (grammynugx)	1	70.12	70.12	0	0.00
33952.	Graison (grais0n)	1	77.08	77.08	0	0.00
33953.	George (graddiences)	1	120.94	120.94	1	100.00
33954.	Graham (gracker)	1	95.67	95.67	0	0.00
33955.	Marek (gpro2005)	1	55.53	55.53	1	100.00
33956.	Ville (gowalski)	1	58.67	58.67	0	0.00
33957.	J (goshadow)	1	80.80	80.80	0	0.00
33958.	Goppo (goppo)	1	108.19	108.19	1	100.00
33959.	Emanuel (google_me)	1	92.20	92.20	0	0.00
33960.	Type (goodtoad)	1	68.18	68.18	1	100.00
33961.	Asriel (goodgodlygaming)	1	66.97	66.97	0	0.00
33962.	Trevor (goode_bag)	1	52.94	52.94	0	0.00
33963.	Gooby (goobytheturtle)	1	105.35	105.35	1	100.00
33964.	esther (golfetta)	1	41.96	41.96	0	0.00
33965.	Cal (golemite)	1	67.99	67.99	0	0.00
33966.	GoldenGamer9002 (goldengamer)	1	83.20	83.20	1	100.00
33967.	Jeff (golddragon4)	1	100.36	100.36	1	100.00
33968.	Nitesh (gokunik)	1	69.56	69.56	0	0.00
33969.	john (goinbr0ke)	1	144.60	144.60	1	100.00
33970.	Yu Chen (gohyuchen)	1	149.92	149.92	1	100.00
33971.	gofpopexe (gofpopexe)	1	76.78	76.78	0	0.00
33972.	Go6ko (go6koiba4a69xx)	1	65.81	65.81	0	0.00
33973.	Dimitris (glumfish)	1	77.95	77.95	1	100.00
33974.	J (glazingdonuts)	1	64.61	64.61	0	0.00
33975.	Johnny (glassharmonica)	1	113.39	113.39	1	100.00
33976.	Nathan (glanzer)	1	110.99	110.99	1	100.00
33977.	NiglaciousXII (glaedrlol)	1	124.45	124.45	0	0.00
33978.	Amazing (glabbss)	1	66.56	66.56	0	0.00
33979.	Gitxen (gitxen)	1	120.21	120.21	0	0.00
33980.	Giraffe (giraffelords36)	1	76.95	76.95	1	100.00
33981.	Håkon (gipper321)	1	56.64	56.64	0	0.00
33982.	Giorgio (gioac96)	1	60.32	60.32	1	100.00
33983.	Matt (gimmethekeys)	1	80.91	80.91	0	0.00
33984.	hugo (gikle)	1	98.28	98.28	1	100.00
33985.	Lupescu (gigabite13)	1	63.55	63.55	0	0.00
33986.	gia hân (giahannguyenhoang)	1	46.05	46.05	1	100.00
33987.	URDI (ghotifilet49)	1	73.77	73.77	1	100.00
33988.	Ghost (ghost999)	1	129.63	129.63	1	100.00
33989.	Gh0st (gh0sted_oo)	1	43.21	43.21	0	0.00
33990.	TheGoosinator (ggustavs)	1	66.71	66.71	1	100.00
33991.	Ggg243 (ggg243)	1	45.84	45.84	0	0.00
33992.	MAK (geotyper704)	1	72.31	72.31	1	100.00
33993.	George (georgewang615)	1	126.95	126.95	1	100.00
33994.	George (george9412)	1	81.29	81.29	0	0.00
33995.	Snide (genuineburrito)	1	60.51	60.51	0	0.00
33996.	Benjamin (genracemen)	1	86.50	86.50	0	0.00
33997.	geniusface1234 (geniusface1...	1	111.29	111.29	1	100.00
33998.	Ollie (geniegg)	1	41.53	41.53	0	0.00
33999.	Luke (generalna13)	1	101.22	101.22	0	0.00
34000.	Martin (generalkoski)	1	72.28	72.28	0	0.00
34001.	Brownie (generalbrownie)	1	100.75	100.75	1	100.00
34002.	Génesis (gen1310)	1	62.57	62.57	0	0.00
34003.	A Person (gelatintypist)	1	103.19	103.19	1	100.00
34004.	Matthew (gelahn)	1	87.02	87.02	1	100.00
34005.	Geis (geis)	1	73.33	73.33	0	0.00
34006.	GeekTek (geektek)	1	68.34	68.34	1	100.00
34007.	geek's (geekstfm)	1	52.02	52.02	0	0.00
34008.	Ggg (gdcomb)	1	72.42	72.42	1	100.00
34009.	gcdashsj (gcdashsj)	1	50.33	50.33	0	0.00
34010.	Gabriel (gbrl1)	1	72.00	72.00	1	100.00
34011.	Gábor (gazuru)	1	90.08	90.08	1	100.00
34012.	jay (gayjayy)	1	91.22	91.22	0	0.00
34013.	derp (gavzzz)	1	87.86	87.86	0	0.00
34014.	Gavin (gavinp)	1	118.54	118.54	1	100.00
34015.	Nicolas (gauzy)	1	63.20	63.20	0	0.00
34016.	Gaute (gaute_03)	1	57.51	57.51	0	0.00
34017.	Gaurav (gauravkr442)	1	25.26	25.26	0	0.00
34018.	Lemon (gauransh)	1	34.05	34.05	0	0.00
34019.	Gaz (garrickgsn)	1	118.95	118.95	1	100.00
34020.	Garik (garikhayrapetian)	1	32.77	32.77	1	100.00
34021.	audelyn (gaminghuskies)	1	70.14	70.14	1	100.00
34022.	_ (gamichan19)	1	58.31	58.31	0	0.00
34023.	Satakun (game_of_charging)	1	62.21	62.21	0	0.00
34024.	Bhisam (gameon617)	1	51.11	51.11	0	0.00
34025.	AgentGameknight (gameknight...	1	45.71	45.71	0	0.00
34026.	gamal (gamal123)	1	60.09	60.09	0	0.00
34027.	Alex (galaxp1)	1	93.37	93.37	0	0.00
34028.	galactic (galacticpig)	1	87.26	87.26	0	0.00
34029.	GaGi (gagiiiii)	1	85.92	85.92	0	0.00
34030.	Gabriel (gabrieldpg)	1	49.29	49.29	0	0.00
34031.	ptrickr (gabriel7patrick)	1	86.36	86.36	1	100.00
34032.	bog (gabongtenco)	1	103.25	103.25	1	100.00
34033.	Gabe (gabedal)	1	93.31	93.31	0	0.00
34034.	серб (gabagool__)	1	41.46	41.46	0	0.00
34035.	logitech g613 sucks (g613)	1	102.28	102.28	1	100.00
34036.	akisakura (fuyusakura)	1	75.33	75.33	0	0.00
34037.	fusionguy100 (fusionguy200)	1	110.14	110.14	1	100.00
34038.	Louis (funnyblouboi)	1	56.54	56.54	1	100.00
34039.	Marco (funfulin01)	1	42.37	42.37	0	0.00
34040.	Daniel (fun1905)	1	62.45	62.45	1	100.00
34041.	Juan (fullmetal474)	1	55.50	55.50	1	100.00
34042.	emuko (arju_12)	1	67.86	67.86	1	100.00
34043.	a (ariyuse)	1	24.57	24.57	0	0.00
34044.	Alice (arisuchan1)	1	83.00	83.00	0	0.00
34045.	Ariel (aricori21)	1	100.72	100.72	0	0.00
34046.	Gleb (ari10000krat)	1	45.68	45.68	0	0.00
34047.	Argo (argosteelshield)	1	82.49	82.49	0	0.00
34048.	rmholz (aremholz)	1	51.92	51.92	1	100.00
34049.	arctics (arctics)	1	93.88	93.88	1	100.00
34050.	no (archerypro459)	1	68.38	68.38	0	0.00
34051.	Alec (arcelock)	1	113.50	113.50	0	0.00
34052.	Araite (araite)	1	74.69	74.69	0	0.00
34053.	Arafat (arafat_islam)	1	30.02	30.02	0	0.00
34054.	Aqua (aquablitz11)	1	145.23	145.23	0	0.00
34055.	Tarek (aqertis)	1	113.96	113.96	0	0.00
34056.	Abdul Qayyum (aqal1003)	1	48.08	48.08	0	0.00
34057.	Artie (appskill)	1	53.87	53.87	0	0.00
34058.	August (appledoor)	1	99.12	99.12	1	100.00
34059.	Appel (appeltert)	1	108.67	108.67	1	100.00
34060.	apple (app1esauce)	1	85.36	85.36	0	0.00
34061.	M. (apolexius)	1	81.70	81.70	1	100.00
34062.	Apizza (apizzabear)	1	68.98	68.98	1	100.00
34063.	Apgan (apgan)	1	25.61	25.61	0	0.00
34064.	Arslan (apex0096)	1	54.69	54.69	0	0.00
34065.	Arjyom (apepenkov)	1	55.38	55.38	0	0.00
34066.	Alex (apasanta)	1	50.46	50.46	0	0.00
34067.	Abdallah (ap0lo)	1	99.01	99.01	0	0.00
34068.	Alex (aorliei)	1	106.94	106.94	1	100.00
34069.	Anomaly (an_anomaly)	1	83.53	83.53	0	0.00
34070.	jason (anybuzzin)	1	50.41	50.41	0	0.00
34071.	An (anvnh)	1	68.69	68.69	1	100.00
34072.	AntPlayz (antplayz)	1	115.16	115.16	1	100.00
34073.	antl_m (antl_m)	1	38.47	38.47	0	0.00
34074.	J (antiduckdude24)	1	112.05	112.05	0	0.00
34075.	Anshul (anshul_khangar)	1	59.97	59.97	0	0.00
34076.	Shawn (anotheronebitesthedust)	1	90.66	90.66	1	100.00
34077.	owlxx (anonymous1229)	1	91.82	91.82	1	100.00
34078.	Daniel (annyoung)	1	59.46	59.46	0	0.00
34079.	edisondotme (annuit02)	1	79.20	79.20	0	0.00
34080.	Prince (annardana)	1	32.86	32.86	0	0.00
34081.	annac777 (annachiang4)	1	154.12	154.12	1	100.00
34082.	anjerukare (anjerukare)	1	45.71	45.71	1	100.00
34083.	umun (animatedeffect)	1	41.46	41.46	0	0.00
34084.	anguelo (anguelo)	1	90.56	90.56	0	0.00
34085.	pail (angertyper)	1	82.87	82.87	1	100.00
34086.	angelo (angeloripple)	1	83.66	83.66	0	0.00
34087.	Angel (ange1zzzu)	1	68.47	68.47	0	0.00
34088.	Angara (angarariver)	1	52.01	52.01	0	0.00
34089.	BLitZioNiC (andyzhu68)	1	74.73	74.73	0	0.00
34090.	Andrew (andrwrbnsn)	1	88.95	88.95	0	0.00
34091.	RUConfuzzled (andre_raj)	1	101.98	101.98	1	100.00
34092.	Andrew (andrewhey)	1	70.02	70.02	0	0.00
34093.	andrew (andrew91vu)	1	81.26	81.26	1	100.00
34094.	Marco (andrefan69)	1	99.57	99.57	1	100.00
34095.	ANDREA (andreaak00)	1	161.38	161.38	1	100.00
34096.	a____________s (anavadya_13)	1	65.81	65.81	1	100.00
34097.	Aaron (anathanbruh)	1	39.14	39.14	0	0.00
34098.	Anas (anas11)	1	87.07	87.07	0	0.00
34099.	nxgraaha (amuza12)	1	46.55	46.55	1	100.00
34100.	Amsyar (amsyar44447)	1	51.82	51.82	1	100.00
34101.	Amos (amosbird)	1	106.29	106.29	1	100.00
34102.	Ammon (ammon21110)	1	28.07	28.07	0	0.00
34103.	Aaron (amares200)	1	109.82	109.82	0	0.00
34104.	Aman (aman7015)	1	33.64	33.64	0	0.00
34105.	amadda (amaddaps)	1	44.03	44.03	0	0.00
34106.	Alytoni (alytoni)	1	73.94	73.94	0	0.00
34107.	alvin (alvingogo)	1	38.16	38.16	1	100.00
34108.	Alva (alvath)	1	74.24	74.24	0	0.00
34109.	Alvan (alvansng)	1	75.18	75.18	0	0.00
34110.	Joe (alux)	1	101.17	101.17	0	0.00
34111.	Arun (alpha_mo)	1	65.48	65.48	1	100.00
34112.	gtyf10 (aloserthatcanonlyty...	1	101.12	101.12	1	100.00
34113.	Alonzo (alonrodrigu)	1	103.07	103.07	1	100.00
34114.	Simeon (alode)	1	73.44	73.44	0	0.00
34115.	Ali (aloche)	1	85.74	85.74	0	0.00
34116.	cheeks (almanfh)	1	59.82	59.82	0	0.00
34117.	mohammed (aljarrah)	1	33.60	33.60	0	0.00
34118.	Ariel (alil)	1	54.53	54.53	1	100.00
34119.	Ali (alibahrawy34)	1	53.69	53.69	0	0.00
34120.	Ali (aliansari)	1	30.86	30.86	0	0.00
34121.	Kelvin (algebrah)	1	80.59	80.59	0	0.00
34122.	Alfman (alfman)	1	52.83	52.83	0	0.00
34123.	alex (alexyan)	1	96.13	96.13	1	100.00
34124.	Alex (alexvesepog)	1	130.25	130.25	1	100.00
34125.	TypeTypeFox (alexsoldier122)	1	62.59	62.59	0	0.00
34126.	samer (alexozero)	1	37.64	37.64	0	0.00
34127.	Alex (alexkgarner)	1	73.18	73.18	0	0.00
34128.	bruh (alexe1093)	1	83.42	83.42	0	0.00
34129.	Alexdebassman (alexdebassman)	1	86.29	86.29	1	100.00
34130.	Alex (alexdallama)	1	66.87	66.87	1	100.00
34131.	alex (alexadimundi)	1	101.61	101.61	1	100.00
34132.	Sam (aleuznelav2)	1	120.81	120.81	1	100.00
34133.	Ezel (aldidoanta)	1	75.39	75.39	0	0.00
34134.	Alb (albinalbin)	1	96.05	96.05	0	0.00
34135.	Joseph (alatar)	1	100.71	100.71	0	0.00
34136.	Alan (alany411)	1	93.97	93.97	1	100.00
34137.	Alanna (alannafey)	1	87.60	87.60	0	0.00
34138.	Alvin (al12611975)	1	80.08	80.08	0	0.00
34139.	Claire (akward7ur7le)	1	49.23	49.23	0	0.00
34140.	Ako (akoisthenamee)	1	69.44	69.44	1	100.00
34141.	Mob (akmob)	1	43.27	43.27	0	0.00
34142.	Andrej (akithereaper8)	1	88.08	88.08	0	0.00
34143.	Tsuki (akirisakura)	1	105.84	105.84	1	100.00
34144.	akiesh (akiesh)	1	80.47	80.47	0	0.00
34145.	L (aka_l)	1	42.30	42.30	0	0.00
34146.	akari (akari223)	1	66.37	66.37	1	100.00
34147.	Aeron James (ajutzu)	1	58.50	58.50	0	0.00
34148.	monkaS (ajcsphotos)	1	148.41	148.41	1	100.00
34149.	Roger (aiyex)	1	83.21	83.21	1	100.00
34150.	AimFaze (aimfaze)	1	37.10	37.10	0	0.00
34151.	Ailton (ailtonn)	1	74.68	74.68	0	0.00
34152.	aidan (aidansamson)	1	64.49	64.49	1	100.00
34153.	a1dan (aidanxd)	1	55.21	55.21	0	0.00
34154.	Amelia (ahmillzah)	1	95.99	95.99	0	0.00
34155.	Ahmed (ahmedslayer123)	1	72.61	72.61	1	100.00
34156.	ahmed (ahmedfouad)	1	106.88	106.88	1	100.00
34157.	Ahmad (ahmahsen)	1	77.50	77.50	0	0.00
34158.	meme (ahchai)	1	107.33	107.33	1	100.00
34159.	Ahad (ahad_abd)	1	60.12	60.12	0	0.00
34160.	Agustin (agusvelisone)	1	104.29	104.29	1	100.00
34161.	Garfield (aguy27)	1	95.46	95.46	0	0.00
34162.	anubha (agoop)	1	101.31	101.31	1	100.00
34163.	S (agnimandur)	1	76.63	76.63	0	0.00
34164.	tstats[agarwaltanish10] (ag...	1	74.64	74.64	0	0.00
34165.	Aftiii (aftiii)	1	116.75	116.75	1	100.00
34166.	Rob (aftershock7)	1	50.96	50.96	0	0.00
34167.	Foyez (aflextra)	1	69.68	69.68	1	100.00
34168.	Adrian (afbslacker)	1	118.03	118.03	1	100.00
34169.	Averie (afbanix)	1	115.67	115.67	1	100.00
34170.	el (aeeia)	1	49.26	49.26	0	0.00
34171.	Zhenyu (adv000)	1	90.44	90.44	1	100.00
34172.	Adrian (adrian_sliacky)	1	48.56	48.56	0	0.00
34173.	Aditya (adityasood)	1	69.56	69.56	0	0.00
34174.	Proud (adityaqudaedah)	1	77.57	77.57	0	0.00
34175.	ade (adefiqri12)	1	65.04	65.04	0	0.00
34176.	Andreas (addekallstrom)	1	105.37	105.37	0	0.00
34177.	Adam (adam_sandler)	1	55.48	55.48	1	100.00
34178.	Adam (adamfriska)	1	104.54	104.54	1	100.00
34179.	@adamvd13 (ad13)	1	70.48	70.48	1	100.00
34180.	andrew (actuallysoup)	1	128.30	128.30	0	0.00
34181.	Antoni (acruz63)	1	70.21	70.21	1	100.00
34182.	Alexandre (acolavin)	1	101.56	101.56	1	100.00
34183.	Meor (acnolog1a)	1	91.41	91.41	1	100.00
34184.	Àngela (aciutat)	1	69.71	69.71	0	0.00
34185.	austin (acirelle)	1	67.67	67.67	0	0.00
34186.	Achyut (achyut69)	1	81.44	81.44	0	0.00
34187.	Alex (ace_alex)	1	83.42	83.42	0	0.00
34188.	Brian (ace213)	1	92.28	92.28	0	0.00
34189.	Angela (academicworkspace)	1	107.59	107.59	1	100.00
34190.	Abi (abz135)	1	107.07	107.07	0	0.00
34191.	Weiqi (abwuhd)	1	111.83	111.83	0	0.00
34192.	Abu Raziel (abu_raziel)	1	39.39	39.39	0	0.00
34193.	Ivy (above_averagez)	1	79.56	79.56	0	0.00
34194.	Henry (ablacksmoothie)	1	138.68	138.68	1	100.00
34195.	Abhi_Dvorak (abhyudaya_nair)	1	31.01	31.01	0	0.00
34196.	abetheunicorn (abetheunicorn)	1	89.83	89.83	1	100.00
34197.	Abdulrahman (abdulraman_q99)	1	35.71	35.71	0	0.00
34198.	abdullah (abdullahomg77)	1	45.72	45.72	1	100.00
34199.	الأصابع (abdoh)	1	90.41	90.41	1	100.00
34200.	Abigail (abby_yobby)	1	68.21	68.21	0	0.00
34201.	Alexander (abba64)	1	56.64	56.64	0	0.00
34202.	Abhishek (abazaz722)	1	65.82	65.82	1	100.00
34203.	Aayush (aayushm8)	1	82.44	82.44	0	0.00
34204.	Aaron (aaronrockindude)	1	76.96	76.96	0	0.00
34205.	Aaron (aaronjeng)	1	129.83	129.83	0	0.00
34206.	Aaron (aaronesc)	1	58.35	58.35	0	0.00
34207.	(╯°□°）╯ (aaltra)	1	130.28	130.28	1	100.00
34208.	stickyrice (aaawiiee)	1	62.32	62.32	0	0.00
34209.	Atte (aaaveetee)	1	80.55	80.55	0	0.00
34210.	AFourTeen (a14inc)	1	68.37	68.37	0	0.00
34211.	69wpm (a04a04283)	1	66.17	66.17	0	0.00
34212.	Nejc (9likediamonds)	1	98.92	98.92	0	0.00
34213.	Lucca (9fingersonly)	1	91.90	91.90	1	100.00
34214.	Anurag TypeRacer (9craft_)	1	40.18	40.18	0	0.00
34215.	Gordon (99m9)	1	83.81	83.81	0	0.00
34216.	Lily (8o7wer)	1	92.76	92.76	0	0.00
34217.	Jindřich (7xxf)	1	57.71	57.71	0	0.00
34218.	Bluem (7jcs)	1	80.04	80.04	1	100.00
34219.	Pooh (5i1ver1ining)	1	89.75	89.75	0	0.00
34220.	Dominic (5doum)	1	79.05	79.05	1	100.00
34221.	JustJie (570897055)	1	77.36	77.36	0	0.00
34222.	4n2h0ny (4n2h0ny)	1	96.83	96.83	1	100.00
34223.	--------- (4itch)	1	75.08	75.08	1	100.00
34224.	4D (4d2233)	1	114.10	114.10	1	100.00
34225.	Isahi (420blaziken_)	1	76.39	76.39	0	0.00
34226.	forty-one hex (41hex)	1	81.75	81.75	1	100.00
34227.	Judeisbad (4123)	1	114.34	114.34	0	0.00
34228.	Big (3igbrain)	1	82.16	82.16	1	100.00
34229.	slow (366665)	1	96.87	96.87	0	0.00
34230.	Nemo (35603560)	1	122.61	122.61	0	0.00
34231.	Yani (311yani)	1	88.03	88.03	0	0.00
34232.	Kriisp (2krispy)	1	108.04	108.04	0	0.00
34233.	Ahro (2easy)	1	111.77	111.77	1	100.00
34234.	Klaus26 (26klaus)	1	82.28	82.28	1	100.00
34235.	2115 to (2115togeng)	1	77.18	77.18	0	0.00
34236.	A (1s1t1r)	1	119.17	119.17	0	0.00
34237.	Sparsh (1nvariant)	1	35.26	35.26	0	0.00
34238.	Eldon (1ick_your_nan)	1	88.51	88.51	0	0.00
34239.	1 (1etmedie)	1	48.10	48.10	0	0.00
34240.	Stacy (1dk_sara)	1	41.88	41.88	0	0.00
34241.	Percaimond (1cedheroine)	1	98.77	98.77	0	0.00
34242.	adm (1adm1)	1	67.41	67.41	0	0.00
34243.	Borlagotch (19jonono)	1	96.44	96.44	1	100.00
34244.	ali (199901)	1	95.55	95.55	1	100.00
34245.	sleepyhead (1983civic)	1	86.72	86.72	0	0.00
34246.	Michael (1851917)	1	103.99	103.99	0	0.00
34247.	KJ (1648460)	1	55.81	55.81	0	0.00
34248.	Timothy (12tqian)	1	143.45	143.45	1	100.00
34249.	JersH (0zmank)	1	92.70	92.70	0	0.00
34250.	Ramkrishn Rai (0typing_beast)	1	21.76	21.76	1	100.00
34251.	Justin (05justino)	1	45.96	45.96	0	0.00
34252.	(0018)	1	178.99	178.99	1	100.00
34253.	Edward (eph91)	1	41.58	41.58	0	0.00
34254.	rafi (club86)	1	71.70	71.70	0	0.00
34255.	G (gffaza)	1	52.61	52.61	1	100.00
34256.	RKade (rkade99)	1	59.03	59.03	0	0.00
34257.	Pedro Seiji (pedroseiji)	1	60.73	60.73	1	100.00
34258.	orange (plorpus)	1	65.60	65.60	0	0.00
34259.	camred (camred)	1	44.84	44.84	0	0.00
34260.	Ernie (radiospank)	1	61.41	61.41	0	0.00
34261.	Dhiraj Kumar (thealgo)	1	51.87	51.87	0	0.00
34262.	Jay (jayten010)	1	65.59	65.59	0	0.00
34263.	Raymond (raymondphang)	1	50.81	50.81	0	0.00
34264.	Lunato (sambuca)	1	125.16	125.16	1	100.00
34265.	tstats[alfa_h2] (alfa_h2)	1	81.65	81.65	0	0.00
34266.	IamUseless (uselessname)	1	54.27	54.27	0	0.00
34267.	Kyrie (kyrie4215)	1	87.52	87.52	1	100.00
34268.	AlexEP (alexep)	1	60.59	60.59	0	0.00
34269.	Jimbo (booty_wizard)	1	59.11	59.11	0	0.00
34270.	Kyle (kylejli)	1	103.15	103.15	1	100.00
34271.	Matthew (mrc624)	1	60.02	60.02	0	0.00
34272.	tudor (tudorbogos)	1	65.80	65.80	1	100.00
34273.	Kerstin (heyitskerstin)	1	74.65	74.65	0	0.00
34274.	colemak_noob (vantroy)	1	46.18	46.18	0	0.00
34275.	Swaglord (swagoverlord69420)	1	81.32	81.32	1	100.00
34276.	jeandry (el_matatan)	1	69.29	69.29	0	0.00
34277.	Sid (sammy_sb)	1	53.69	53.69	0	0.00
34278.	Kris (da_typerr)	1	69.59	69.59	0	0.00
34279.	Milah (xxmgl)	1	39.46	39.46	0	0.00
34280.	NNinjaFury (nninjafury)	1	63.44	63.44	1	100.00
34281.	Tai (mega_weebo5)	1	33.33	33.33	0	0.00
34282.	Luke (lazaround_future)	1	70.36	70.36	0	0.00
34283.	Thermic (thermicfox_88864)	1	79.18	79.18	0	0.00
34284.	Cool (cool_dude01)	1	20.96	20.96	0	0.00
34285.	Ben (bonpopkon)	1	87.58	87.58	0	0.00
34286.	Alex (alxkeda)	1	77.15	77.15	1	100.00
34287.	Nolan (notnolan)	1	47.01	47.01	1	100.00
34288.	Nicholas (musicaloreo)	1	115.01	115.01	1	100.00
34289.	Penth (penth)	1	95.32	95.32	0	0.00
34290.	Adam (mumbledore)	1	82.81	82.81	0	0.00
34291.	Nick (nickster48)	1	40.83	40.83	0	0.00
34292.	Maximus (kingmaximus)	1	71.01	71.01	1	100.00
34293.	Arkaprobha (arkapro)	1	94.86	94.86	1	100.00
34294.	alex (itsskoots)	1	114.21	114.21	1	100.00
34295.	Septian (tyanpes)	1	62.71	62.71	0	0.00
34296.	Typo_Typer (typo_is_in_your...	1	58.58	58.58	0	0.00
34297.	Mattokaa (mattokaa)	1	66.89	66.89	1	100.00
34298.	joe (xxjoe61)	1	44.71	44.71	0	0.00
34299.	Arif (arif_500)	1	34.80	34.80	0	0.00
34300.	Izaac (izaaciwnl)	1	67.07	67.07	0	0.00
34301.	Sarah (dilpiklejelly)	1	83.05	83.05	0	0.00
34302.	anonimus (vibingorsum)	1	77.75	77.75	0	0.00
34303.	Jan (seberay)	1	84.27	84.27	0	0.00
34304.	kty (ktylolonlaptop)	1	65.29	65.29	0	0.00
34305.	Noir (noirsette)	1	64.44	64.44	0	0.00
34306.	Tomas (tomielordi)	1	50.36	50.36	0	0.00
34307.	Rea1Estate (rea1estate)	1	78.40	78.40	0	0.00
34308.	mahipal (mahilove)	1	43.28	43.28	0	0.00
34309.	Felias (felias)	1	56.26	56.26	0	0.00
34310.	Squidney (hieroolz97)	1	103.80	103.80	0	0.00
34311.	Texo (chocotexo)	1	45.58	45.58	0	0.00
34312.	Patrick (swissjeez)	1	85.03	85.03	0	0.00
34313.	Simon (boochicken)	1	109.65	109.65	0	0.00
34314.	Bestian (puzzlez)	1	113.73	113.73	1	100.00
34315.	Aymen (aymendn)	1	33.34	33.34	0	0.00
34316.	Aryaman (aryaman2004)	1	50.44	50.44	0	0.00
34317.	Tabita Morfin (tmorfin)	1	31.91	31.91	0	0.00
34318.	Nikki (_nikki)	1	49.30	49.30	0	0.00
34319.	andrew (andrewb3)	1	58.53	58.53	1	100.00
34320.	Remco (aapje1606)	1	58.25	58.25	0	0.00
34321.	Souplette (souplette)	1	95.00	95.00	1	100.00
34322.	Parracho (parracho)	1	109.37	109.37	1	100.00
34323.	Teenage (teenagenoob)	1	71.86	71.86	0	0.00
34324.	karl (karlaustria)	1	73.20	73.20	1	100.00
34325.	Lars (larsms)	1	59.58	59.58	1	100.00
34326.	Omar (omarsalah)	1	43.91	43.91	0	0.00
34327.	Justin (xxshompxx)	1	80.69	80.69	1	100.00
34328.	rohit mahala (mahala19)	1	43.64	43.64	0	0.00
34329.	Maynard (weekendtantrums)	1	106.03	106.03	0	0.00
34330.	Ahmet Eren (ahmeterent27)	1	90.81	90.81	0	0.00
34331.	John Hill (jhnhlldrms)	1	39.64	39.64	0	0.00
34332.	EOQ (rozok)	1	23.36	23.36	0	0.00
34333.	Ibrahim (cyasmix)	1	59.66	59.66	0	0.00
34334.	Hideki Reiven (hidekuchan)	1	100.43	100.43	1	100.00
34335.	Eliam (erg_el18)	1	34.57	34.57	0	0.00
34336.	the (sawdust10)	1	74.92	74.92	0	0.00
34337.	Andrej (techno1337)	1	95.85	95.85	1	100.00
34338.	Alex (alex_wee_b_flyball)	1	53.46	53.46	0	0.00
34339.	Luis (luis11152)	1	50.54	50.54	0	0.00
34340.	Marcelioo (marcelio)	1	72.48	72.48	0	0.00
34341.	Acie (syahzrie0809)	1	57.90	57.90	1	100.00
34342.	Obi (obi2605)	1	75.92	75.92	1	100.00
34343.	abel (abelkt)	1	63.15	63.15	0	0.00
34344.	Anon (subs)	1	73.72	73.72	0	0.00
34345.	Ale (ericum)	1	60.98	60.98	1	100.00
34346.	Ali (ezzomania)	1	89.84	89.84	0	0.00
34347.	capdee (captain_death)	1	89.92	89.92	1	100.00
34348.	omar (omaralbakri)	1	23.03	23.03	1	100.00
34349.	Salt (saltfactory)	1	98.87	98.87	0	0.00
34350.	ken (bappomet)	1	94.96	94.96	1	100.00
34351.	Daniel (zsour)	1	65.02	65.02	0	0.00
34352.	Hangry (kungfuhangry)	1	80.40	80.40	0	0.00
34353.	Archibald (homophobic_telet...	1	54.73	54.73	0	0.00
34354.	sugoi (sugoi_ne)	1	131.38	131.38	1	100.00
34355.	timebombed (timebombed)	1	106.58	106.58	0	0.00
34356.	George (korol)	1	36.89	36.89	0	0.00
34357.	Joaco (cacos_pl)	1	58.10	58.10	0	0.00
34358.	Nibzmeister (nibzmeister)	1	110.75	110.75	1	100.00
34359.	J (plumbus_typer)	1	48.50	48.50	0	0.00
34360.	Ethan (mystii)	1	79.54	79.54	1	100.00
34361.	Anders (andeeeers)	1	42.50	42.50	0	0.00
34362.	Thomas (mrmystery100)	1	125.16	125.16	0	0.00
34363.	Owolabi (esam17)	1	32.90	32.90	0	0.00
34364.	Juancar (jotas)	1	43.02	43.02	0	0.00
34365.	Goose (friendlygoose)	1	80.48	80.48	1	100.00
34366.	Kale (kalebroth)	1	78.20	78.20	0	0.00
34367.	Charlie (davee3)	1	46.87	46.87	0	0.00
34368.	gabe (pxo_null)	1	77.21	77.21	0	0.00
34369.	Doctor (drxionel)	1	105.52	105.52	0	0.00
34370.	T (tkk64)	1	92.64	92.64	0	0.00
34371.	Jerry (foxyphoton)	1	88.57	88.57	0	0.00
34372.	Denel (denel)	1	70.02	70.02	0	0.00
34373.	Owen (owen_type)	1	52.54	52.54	0	0.00
34374.	marine (thegoatmarine)	1	73.86	73.86	1	100.00
34375.	TrumpSucks (bremu)	1	43.30	43.30	0	0.00
34376.	Johnnydepinguin (johnnydepi...	1	44.58	44.58	0	0.00
34377.	Xin (xinzhao12345)	1	101.66	101.66	1	100.00
34378.	ToverTractor (tovertractor)	1	57.23	57.23	0	0.00
34379.	Nara (crazyasian640)	1	88.82	88.82	0	0.00
34380.	Jari (thesadcat)	1	63.63	63.63	0	0.00
34381.	Ethan (ethanxvii)	1	79.69	79.69	0	0.00
34382.	-_- (trollinglobster)	1	56.96	56.96	0	0.00
34383.	Mae (pinkcustard2)	1	48.85	48.85	0	0.00
34384.	yes (azkuo)	1	80.79	80.79	1	100.00
34385.	a (1268640026)	1	88.76	88.76	1	100.00
34386.	Matt (zevikan)	1	56.19	56.19	0	0.00
34387.	Luka (type_master_123)	1	88.59	88.59	1	100.00
34388.	WIPEOUT (gabe112310)	1	59.12	59.12	0	0.00
34389.	Kevin (xrocca)	1	106.24	106.24	1	100.00
34390.	Alex (flamealex)	1	78.06	78.06	1	100.00
34391.	Nahte (uhop123)	1	71.57	71.57	0	0.00
34392.	jimmy (luas)	1	32.18	32.18	0	0.00
34393.	Tobias (saibot148)	1	45.96	45.96	0	0.00
34394.	Mayonnaise (blueraider)	1	81.90	81.90	0	0.00
34395.	Vishal Teotia (vishalteotia)	1	39.75	39.75	0	0.00
34396.	Royz (4noni3us)	1	74.50	74.50	0	0.00
34397.	Bruv (robloxianmaster)	1	61.50	61.50	0	0.00
34398.	Bro (broproguo)	1	97.51	97.51	1	100.00
34399.	Nitin (nitin12384)	1	30.31	30.31	0	0.00
34400.	Brett (zephron)	1	106.97	106.97	1	100.00
34401.	COSMiC (cosmicojus)	1	35.69	35.69	0	0.00
34402.	Leowo (dragonduelist)	1	96.96	96.96	1	100.00
34403.	James (nodox)	1	80.10	80.10	1	100.00
34404.	Kathi (kathipacket)	1	118.17	118.17	1	100.00
34405.	Derrick (derrickjdn)	1	73.06	73.06	1	100.00
34406.	dejawhoosh (dejawhoosh)	1	48.24	48.24	0	0.00
34407.	Doble (bn_doble_16)	1	69.51	69.51	0	0.00
34408.	Tubbo (i_like_bees_dsmp_)	1	31.68	31.68	0	0.00
34409.	Allen (a5chan)	1	144.85	144.85	0	0.00
34410.	Choccy (choccymolk)	1	74.58	74.58	0	0.00
34411.	Daniel (dsbaule)	1	83.94	83.94	1	100.00
34412.	vs-123 (vs123)	1	89.82	89.82	0	0.00
34413.	Rage (ragecatalyst)	1	71.48	71.48	0	0.00
34414.	Sorrow (zxcv51523)	1	141.90	141.90	0	0.00
34415.	ARNA~S (arnas_07)	1	39.60	39.60	0	0.00
34416.	Aimee (clefaimee)	1	92.99	92.99	0	0.00
34417.	Aura (auraeevee431)	1	55.75	55.75	0	0.00
34418.	Seán (blondietypes)	1	76.60	76.60	0	0.00
34419.	Vincent (craatlantic7)	1	53.62	53.62	1	100.00
34420.	Michał (mixss)	1	49.15	49.15	0	0.00
34421.	Omar (omarhawwash)	1	141.44	141.44	1	100.00
34422.	shotgun (shotgun901)	1	32.19	32.19	0	0.00
34423.	Sanders (tpcsanders)	1	93.88	93.88	1	100.00
34424.	Tyarel (tyarel)	1	56.27	56.27	0	0.00
34425.	Drake (_sneax_)	1	59.73	59.73	0	0.00
34426.	Adarsh (oblivious_paradigm)	1	66.48	66.48	1	100.00
34427.	Tony (imperfects)	1	64.77	64.77	1	100.00
34428.	Nuclear (nuclearmissile)	1	62.88	62.88	1	100.00
34429.	KillSwitch (killswitch248)	1	73.31	73.31	0	0.00
34430.	Jesse (stealthybeef)	1	69.21	69.21	0	0.00
34431.	. (roriwood)	1	83.16	83.16	1	100.00
34432.	Orb (orb_sans)	1	65.55	65.55	0	0.00
34433.	Jack (sickplayer124)	1	36.14	36.14	0	0.00
34434.	Ger (gertyper)	1	49.23	49.23	1	100.00
34435.	Baraa (kholoki)	1	74.52	74.52	0	0.00
34436.	AlfredPlayz (alfredplayz)	1	67.01	67.01	1	100.00
34437.	ShaneezOnFire (shaneezonfire)	1	78.38	78.38	1	100.00
34438.	schuii (schuii)	1	45.72	45.72	0	0.00
34439.	darkness (dwu1011)	1	104.53	104.53	1	100.00
34440.	Sean (itsstealthb)	1	91.10	91.10	1	100.00
34441.	Michael (bubzybubs)	1	111.97	111.97	1	100.00
34442.	Chrys (s4ltyweeb)	1	83.99	83.99	1	100.00
34443.	Nick (nbadal)	1	106.18	106.18	1	100.00
34444.	Joseph (shion264)	1	61.91	61.91	1	100.00
34445.	taylor (daogwhiteboy)	1	75.79	75.79	1	100.00
34446.	Conner (conn3rrrr)	1	67.54	67.54	0	0.00
34447.	CopyRited (copyrited)	1	67.80	67.80	1	100.00
34448.	Adam (adamfb2511)	1	57.46	57.46	1	100.00
34449.	Jaimin (jimjamerplayz)	1	34.21	34.21	0	0.00
34450.	Daniel (ibravedaniel24)	1	33.93	33.93	0	0.00
34451.	deez (mintynitroxpresso)	1	48.72	48.72	0	0.00
34452.	qboIodp (qboiodp)	1	68.48	68.48	0	0.00
34453.	Ivan (ladiladia)	1	118.39	118.39	1	100.00
34454.	beescoot (beescoot)	1	87.58	87.58	0	0.00
34455.	ah! (tangykumquat)	1	70.62	70.62	1	100.00
34456.	Rojo (rojoflash)	1	83.91	83.91	1	100.00
34457.	Yugal (yugal_kishore_v)	1	27.69	27.69	0	0.00
34458.	Madhav (sigma_code_monkey)	1	91.46	91.46	0	0.00
34459.	lohkachu (lohkachu)	1	64.58	64.58	1	100.00
34460.	Anton (antonh123)	1	140.29	140.29	1	100.00
34461.	Momo (momokartofa)	1	77.56	77.56	1	100.00
34462.	Adham (enkrad)	1	42.76	42.76	0	0.00
34463.	Adiel (adielpf)	1	65.82	65.82	1	100.00
34464.	kervin (kervinramen)	1	62.15	62.15	1	100.00
34465.	Moaiad (mhm555)	1	81.35	81.35	1	100.00
34466.	Baile (thebltsandwich)	1	55.59	55.59	0	0.00
34467.	Chiyu (jasonkush)	1	50.09	50.09	0	0.00
34468.	Blake (eastexodus)	1	93.91	93.91	1	100.00
34469.	Michael (idheretic)	1	47.17	47.17	0	0.00
34470.	Clinton (clintonyo)	1	55.99	55.99	0	0.00
34471.	urwrstkn8mare (urwrstkn8mare)	1	73.38	73.38	0	0.00
34472.	Rocketgirlygirl (rocketgirl...	1	55.27	55.27	0	0.00
34473.	Sanani (sananirajabov)	1	70.06	70.06	0	0.00
34474.	poexv (poex)	1	119.56	119.56	1	100.00
34475.	Samantha (yellagirlswag)	1	75.59	75.59	0	0.00
34476.	Zaza (urdoomishere)	1	86.14	86.14	1	100.00
34477.	ok (ok_0)	1	63.40	63.40	1	100.00
34478.	Alex (smartalexg)	1	78.93	78.93	1	100.00
34479.	Lauren (laurenmontyyyyy)	1	82.65	82.65	1	100.00
34480.	fear (fearl3ss)	1	102.21	102.21	1	100.00
34481.	Merili (merkake123)	1	44.85	44.85	0	0.00
34482.	Olzhas (howardat)	1	69.98	69.98	0	0.00
34483.	ADM (adamzainuri01)	1	73.71	73.71	0	0.00
34484.	Sam (saha_)	1	64.09	64.09	0	0.00
34485.	Golgibody (golgibody)	1	39.66	39.66	0	0.00
34486.	Haukur (haukur06)	1	42.88	42.88	0	0.00
34487.	Tre (guysy)	1	75.73	75.73	0	0.00
34488.	Lebron James (gossip_)	1	85.00	85.00	1	100.00
34489.	NIKHIL (nikkkhil_16)	1	23.71	23.71	0	0.00
34490.	3phat (bosscus)	1	71.44	71.44	1	100.00
34491.	Swim (swwimmingbird)	1	67.14	67.14	1	100.00
34492.	alex (lxbrdly)	1	68.19	68.19	1	100.00
34493.	HL (pantsguy)	1	45.96	45.96	0	0.00
34494.	Slav (slavocado)	1	98.26	98.26	1	100.00
34495.	Jizdan (jizdan)	1	23.76	23.76	0	0.00
34496.	Allen (illintin)	1	89.24	89.24	1	100.00
34497.	Gedvillllllle (geddy)	1	46.96	46.96	0	0.00
34498.	New (duahautv378)	1	26.67	26.67	1	100.00
34499.	Ty (dgtc99)	1	31.16	31.16	0	0.00
34500.	Bharat (bharatpandey88)	1	61.95	61.95	0	0.00
34501.	Daniil (demolice)	1	66.50	66.50	0	0.00
34502.	MercyXTD (mercyxtd)	1	66.89	66.89	0	0.00
34503.	Luke (kioa)	1	55.42	55.42	0	0.00
34504.	Ammaar (ammaar_1)	1	41.61	41.61	0	0.00
34505.	ccgibson (ccgibson)	1	157.36	157.36	1	100.00
34506.	rendon (rendons2)	1	58.08	58.08	0	0.00
34507.	Jack (draxlind)	1	93.91	93.91	1	100.00
34508.	KeybrdNewbie (keyboardnewbie)	1	72.49	72.49	0	0.00
34509.	kangbap (canyounott)	1	126.10	126.10	1	100.00
34510.	Fatemeh (fatemeh_ek)	1	35.98	35.98	0	0.00
34511.	Joe (casketer)	1	60.57	60.57	1	100.00
34512.	Damax (damax)	1	64.30	64.30	0	0.00
34513.	Brandon (brandong22)	1	51.82	51.82	0	0.00
34514.	Warcat (thepowerofj)	1	85.02	85.02	1	100.00
34515.	Minty (minty57)	1	82.64	82.64	1	100.00
34516.	hawk (hawkmeeuw)	1	74.57	74.57	0	0.00
34517.	incredible (incrediblelizard)	1	60.12	60.12	1	100.00
34518.	Vishal (godshal)	1	106.08	106.08	1	100.00
34519.	dief (dief21)	1	26.90	26.90	0	0.00
34520.	Joss (jijots)	1	67.56	67.56	1	100.00
34521.	D20z (ricwork88)	1	74.52	74.52	0	0.00
34522.	a (magmafps_)	1	94.53	94.53	1	100.00
34523.	heidi (snail_iz_slow)	1	27.27	27.27	0	0.00
34524.	jason (jjasxn)	1	70.02	70.02	0	0.00
34525.	maciek (macientux)	1	52.23	52.23	1	100.00
34526.	Alonso (lonsoag2)	1	54.04	54.04	0	0.00
34527.	223RuDe (223rude)	1	35.05	35.05	0	0.00
34528.	Random (learningtyping123)	1	73.02	73.02	0	0.00
34529.	TheBlueMonarch (foul_bronze)	1	45.17	45.17	0	0.00
34530.	cameron (runcam)	1	39.89	39.89	0	0.00
34531.	Sidharth (dj_panda69)	1	71.74	71.74	0	0.00
34532.	Sam (varga16975)	1	93.65	93.65	1	100.00
34533.	Terra (terramorpher)	1	58.82	58.82	0	0.00
34534.	jake (urboijacob)	1	87.83	87.83	1	100.00
34535.	Fei (zerofei)	1	35.59	35.59	0	0.00
34536.	Heber (ache_m)	1	86.11	86.11	0	0.00
34537.	Krlja (thewebster19)	1	53.11	53.11	0	0.00
34538.	Trevor (texan5)	1	75.96	75.96	1	100.00
34539.	Terry (z0mmine)	1	71.83	71.83	1	100.00
34540.	mish3al (mish3al)	1	66.77	66.77	0	0.00
34541.	MavGoose6 (zyphalopagus)	1	40.47	40.47	0	0.00
34542.	Nogen (zarkiwni)	1	51.41	51.41	0	0.00
34543.	joe (revemc)	1	67.11	67.11	0	0.00
34544.	EddyBer (eddyber16)	1	83.92	83.92	1	100.00
34545.	PuddingSenator (fluc02)	1	117.36	117.36	1	100.00
34546.	Radosław (puszkiss)	1	43.37	43.37	0	0.00
34547.	buzzwuzzfuzz (buzzwuzzfuzz)	1	77.35	77.35	1	100.00
34548.	Sarah (sarah36854)	1	66.60	66.60	1	100.00
34549.	Airogene (qualpotato)	1	74.43	74.43	0	0.00
34550.	Julie (juliach7)	1	27.78	27.78	0	0.00
34551.	Joko (joko100)	1	80.42	80.42	0	0.00
34552.	Adrián (adrianv45)	1	40.48	40.48	0	0.00
34553.	kakeninja (kakeninja)	1	104.49	104.49	1	100.00
34554.	Musa (moose_the_goose)	1	82.72	82.72	1	100.00
34555.	ainun (ainunnisa)	1	32.30	32.30	0	0.00
34556.	Catarina (marhc)	1	36.60	36.60	0	0.00
34557.	Hussain (safaroo)	1	77.87	77.87	1	100.00
34558.	Stoned (stoned_raccoon)	1	58.97	58.97	0	0.00
34559.	dozent (1985dozent)	1	73.24	73.24	1	100.00
34560.	Harriet (harrietjosephinemary)	1	73.53	73.53	0	0.00
34561.	Breon (scowl_)	1	76.37	76.37	0	0.00
34562.	ItsKevin183 (kevin183)	1	82.93	82.93	0	0.00
34563.	Krisztián (kkoves)	1	92.90	92.90	1	100.00
34564.	Otis (eutiss)	1	45.54	45.54	0	0.00
34565.	Kevin (beaterofmeat)	1	74.34	74.34	0	0.00
34566.	Sir (sireiji)	1	35.26	35.26	0	0.00
34567.	Wency (wencydeng)	1	71.02	71.02	1	100.00
34568.	Kartik (tenten93)	1	75.81	75.81	1	100.00
34569.	MatShroom (matshroom)	1	44.53	44.53	0	0.00
34570.	Name (parmak)	1	52.11	52.11	0	0.00
34571.	Chadwin (apexlosers)	1	71.58	71.58	1	100.00
34572.	Adam (xizall)	1	55.77	55.77	0	0.00
34573.	js (searsino)	1	61.28	61.28	0	0.00
34574.	Jamie (nelzen)	1	72.52	72.52	1	100.00
34575.	Elmi_Moso (licenciado)	1	55.16	55.16	1	100.00
34576.	MJ (ermory)	1	55.17	55.17	0	0.00
34577.	Rafaella (rbarahona)	1	61.94	61.94	1	100.00
34578.	Awertho (awertho)	1	87.19	87.19	0	0.00
34579.	stelios (stelakisss)	1	65.87	65.87	1	100.00
34580.	Sai (saifiji)	1	79.63	79.63	1	100.00
34581.	KUNTAL MONGAL (kunnu420)	1	44.10	44.10	0	0.00
34582.	Kevin (chivasregal18)	1	74.72	74.72	1	100.00
34583.	MrMilka (mrmilka)	1	38.37	38.37	0	0.00
34584.	Harshit Kumar (harshitkumar__)	1	32.40	32.40	0	0.00
34585.	Neil (duckguy)	1	64.00	64.00	0	0.00
34586.	Slow Boys Club 🗿 (the_ch...	1	75.89	75.89	0	0.00
34587.	Liberum (freeformedto)	1	79.97	79.97	0	0.00
34588.	Sven (saytama)	1	62.97	62.97	0	0.00
34589.	Zom (zom_db)	1	92.37	92.37	0	0.00
34590.	dspr (dspr)	1	101.78	101.78	0	0.00
34591.	Werhakon (werhakon)	1	105.87	105.87	0	0.00
34592.	kalle (kallew34)	1	74.77	74.77	1	100.00
34593.	Tyrone (onetjw)	1	76.27	76.27	0	0.00
34594.	Stef (tappelpaart)	1	53.53	53.53	0	0.00
34595.	Jacob (rexiedexy)	1	63.87	63.87	1	100.00
34596.	Austin (risherak)	1	59.29	59.29	0	0.00
34597.	Popo (ianneee)	1	30.56	30.56	0	0.00
34598.	Bence (bcheese)	1	78.04	78.04	1	100.00
34599.	grah (glossslynie)	1	53.31	53.31	0	0.00
34600.	Errick (errick10)	1	63.18	63.18	1	100.00
34601.	shu chi (pumpkinbear)	1	85.84	85.84	1	100.00
34602.	Grape (imma_grape)	1	45.19	45.19	0	0.00
34603.	drain (hentaifackerman)	1	32.72	32.72	1	100.00
34604.	L (saucethe2nd)	1	30.97	30.97	0	0.00
34605.	sadone (sadonefn)	1	30.74	30.74	0	0.00
34606.	Paul_Walker (matthew68)	1	67.41	67.41	1	100.00
34607.	Johnny (jly1202)	1	73.60	73.60	0	0.00
34608.	Derick (cheapdubs)	1	65.98	65.98	0	0.00
34609.	Jasmine (jaassmmiinne)	1	38.03	38.03	0	0.00
34610.	kai (hnkks)	1	94.88	94.88	0	0.00
34611.	heyitsjshere (heyitsjshere)	1	57.47	57.47	1	100.00
34612.	Drew (drew_angell)	1	89.57	89.57	0	0.00
34613.	Jay (urname9999)	1	84.38	84.38	0	0.00
34614.	smash (smash1231)	1	45.04	45.04	0	0.00
34615.	mroreoman (mroreoman)	1	92.43	92.43	1	100.00
34616.	Jordan (aphrosu)	1	107.13	107.13	0	0.00
34617.	Pheakthra (psoeun_562_kpop)	1	62.52	62.52	0	0.00
34618.	Pingin (peegin)	1	86.88	86.88	0	0.00
34619.	Patrick (iambadatthis00)	1	61.81	61.81	0	0.00
34620.	N (gummyfrog)	1	123.72	123.72	1	100.00
34621.	Suzune (sxzxne)	1	87.46	87.46	1	100.00
34622.	Franklin (franklinchessstar)	1	57.63	57.63	1	100.00
34623.	zombiepoep (zombiepoep)	1	84.25	84.25	1	100.00
34624.	Ashley (kanashirei)	1	98.55	98.55	0	0.00
34625.	TypingPanther (typingpanther)	1	36.98	36.98	0	0.00
34626.	noob_boy15 (anikettyper)	1	43.36	43.36	1	100.00
34627.	Jon (zshadowjon)	1	105.67	105.67	1	100.00
34628.	joe (joemama2020)	1	97.54	97.54	0	0.00
34629.	Hank (henhentyper)	1	59.94	59.94	1	100.00
34630.	Colin (nilxoc)	1	74.83	74.83	1	100.00
34631.	Ryan (rmarcus19)	1	34.03	34.03	0	0.00
34632.	ambersands (mnurrreza)	1	56.50	56.50	0	0.00
34633.	Carlo (canuling16)	1	85.13	85.13	1	100.00
34634.	Austin (hamilogre)	1	102.88	102.88	0	0.00
34635.	phis_her (rikhard111)	1	59.34	59.34	0	0.00
34636.	:) (painfullyless)	1	71.91	71.91	0	0.00
34637.	Bartłomiej (bartox856_2)	1	24.80	24.80	0	0.00
34638.	Jack (jpw142)	1	96.86	96.86	1	100.00
34639.	somericeasian (somericeasian)	1	63.46	63.46	1	100.00
34640.	KitKat (kitkatattackk)	1	40.44	40.44	1	100.00
34641.	Maco (macoooo)	1	95.48	95.48	0	0.00
34642.	yung (yungparish)	1	74.35	74.35	1	100.00
34643.	Neil (annualdegree99)	1	73.97	73.97	0	0.00
34644.	Henry (hendogthebomb)	1	99.52	99.52	0	0.00
34645.	Icikiwir Pemula (highfatmilk)	1	32.19	32.19	0	0.00
34646.	Andre (gg0andre)	1	60.25	60.25	0	0.00
34647.	Someone (infinity_a)	1	102.96	102.96	1	100.00
34648.	Keshav (ksavdulal)	1	62.23	62.23	0	0.00
34649.	dnbull (dnbull)	1	82.11	82.11	0	0.00
34650.	Big Devil (shamsulalambony)	1	27.42	27.42	0	0.00
34651.	Sleepi (sleepiqueen)	1	82.12	82.12	0	0.00
34652.	wyapyro (theglowingpyro)	1	115.98	115.98	1	100.00
34653.	Jazz (frostfire132)	1	54.68	54.68	0	0.00
34654.	Tanvir (tanvir4784)	1	26.79	26.79	0	0.00
34655.	Louie (louie691471)	1	67.09	67.09	0	0.00
34656.	AweSam (awesam07)	1	77.04	77.04	0	0.00
34657.	Soheil__.Dh (darkhyper)	1	42.40	42.40	0	0.00
34658.	Jetblade (jetblade221)	1	73.97	73.97	0	0.00
34659.	Ryan (qcoldwater)	1	43.33	43.33	0	0.00
34660.	Frederick (pencilrex)	1	106.75	106.75	0	0.00
34661.	Hive69 (hive69)	1	101.96	101.96	0	0.00
34662.	art2 (artk2)	1	76.36	76.36	0	0.00
34663.	Onyx (onyxstars)	1	77.38	77.38	0	0.00
34664.	Petro (petrut)	1	43.74	43.74	0	0.00
34665.	a (bye_man)	1	96.52	96.52	0	0.00
34666.	Seojin (sjink)	1	53.16	53.16	0	0.00
34667.	Neel (neell)	1	33.32	33.32	0	0.00
34668.	XM06 (xm06)	1	105.51	105.51	1	100.00
34669.	mojana (mojana)	1	35.21	35.21	0	0.00
34670.	Ward (editicalu)	1	74.43	74.43	1	100.00
34671.	Wayne (tetrisk)	1	105.42	105.42	0	0.00
34672.	Fiel (syzygy_)	1	43.08	43.08	0	0.00
34673.	LackOfHobbies (lackofhobbies)	1	88.18	88.18	1	100.00
34674.	kacper (sznycel)	1	50.59	50.59	1	100.00
34675.	sibi (sibivel)	1	73.48	73.48	0	0.00
34676.	Hala (halab)	1	21.66	21.66	0	0.00
34677.	mark (markd2)	1	72.82	72.82	0	0.00
34678.	john (fwoochyt)	1	73.23	73.23	0	0.00
34679.	shadow (jjjshadow)	1	40.67	40.67	0	0.00
34680.	Marc (moomanmarc)	1	74.65	74.65	1	100.00
34681.	amber (angeljr777)	1	26.66	26.66	0	0.00
34682.	Me (kermitthefrog123)	1	41.02	41.02	0	0.00
34683.	Raymond (handicast)	1	83.28	83.28	1	100.00
34684.	Raymond (pumpalump)	1	49.93	49.93	0	0.00
34685.	Slasher (slasher_2130)	1	31.38	31.38	0	0.00
34686.	Jason (jasondnguyen)	1	96.95	96.95	0	0.00
34687.	Rishabh (rish1)	1	69.18	69.18	0	0.00
34688.	Emils (em1lzs)	1	28.62	28.62	0	0.00
34689.	xplo1t (xplo1t)	1	63.29	63.29	0	0.00
34690.	Tiger (tigere)	1	33.34	33.34	0	0.00
34691.	Elliot (zaperino)	1	60.79	60.79	0	0.00
34692.	Cecelia (okaeyyy)	1	69.92	69.92	0	0.00
34693.	jrodbatv (jrodbatv)	1	74.61	74.61	0	0.00
34694.	DoDo (gloritown)	1	67.36	67.36	1	100.00
34695.	laskit (laskit)	1	56.45	56.45	0	0.00
34696.	Paul (pauljs)	1	103.71	103.71	0	0.00
34697.	R. Shreyas (witheryleorsh)	1	55.36	55.36	0	0.00
34698.	Niko (peanutbudder)	1	66.77	66.77	0	0.00
34699.	Shubham (thepunisherx69)	1	39.95	39.95	0	0.00
34700.	Nathan (njllanes2317)	1	49.46	49.46	0	0.00
34701.	Sanchit (tichnas)	1	70.27	70.27	0	0.00
34702.	Aldian (aldiandf)	1	53.31	53.31	0	0.00
34703.	Jacob (jacobroumanos)	1	96.27	96.27	1	100.00
34704.	TheSlowTyper (theuselessper...	1	48.77	48.77	0	0.00
34705.	George (hostilereality)	1	28.70	28.70	0	0.00
34706.	nilatos (nilatos13)	1	45.43	45.43	0	0.00
34707.	Oliver (breolfalot)	1	47.15	47.15	0	0.00
34708.	Emerson (schmiller)	1	92.17	92.17	1	100.00
34709.	Sparrowman (sparowman)	1	51.89	51.89	0	0.00
34710.	Sizzukie (sizzukie)	1	102.29	102.29	0	0.00
34711.	Fahad (fahadthebest1)	1	46.26	46.26	1	100.00
34712.	Elliot Hong (seanyup)	1	75.89	75.89	0	0.00
34713.	Mike (mikerouoeuou)	1	75.27	75.27	0	0.00
34714.	Commander (superhans)	1	84.92	84.92	0	0.00
34715.	Blue (whyamiblue)	1	56.06	56.06	0	0.00
34716.	K (wolfgorl)	1	67.21	67.21	0	0.00
34717.	Lucy (lucynuhaa)	1	58.82	58.82	1	100.00
34718.	Johnny (johnnybravo121)	1	97.82	97.82	0	0.00
34719.	Tho (thomemes4)	1	55.52	55.52	0	0.00
34720.	Ian (ianlin0719)	1	76.53	76.53	0	0.00
34721.	very slowly typing... (vani...	1	103.50	103.50	0	0.00
34722.	Oskar (collinary)	1	83.93	83.93	0	0.00
34723.	Mike (neumatikz)	1	97.60	97.60	1	100.00
34724.	SAMurai (samuelpyj)	1	96.00	96.00	1	100.00
34725.	Mohit (shrestha437)	1	29.69	29.69	0	0.00
34726.	STS93 (sts_93)	1	61.70	61.70	0	0.00
34727.	ninosimp (ninosimp)	1	75.01	75.01	1	100.00
34728.	Colin (cstew26)	1	55.72	55.72	0	0.00
34729.	Jim (jimbob313)	1	96.34	96.34	1	100.00
34730.	Blarghh (blarghh)	1	62.01	62.01	0	0.00
34731.	Usama (usamajatala)	1	63.89	63.89	0	0.00
34732.	Mayank (mayankraj)	1	86.24	86.24	0	0.00
34733.	Thinam (thinam_0)	1	40.28	40.28	0	0.00
34734.	shaarad (shaaraddalvi)	1	72.02	72.02	0	0.00
34735.	White (whitepudding)	1	78.51	78.51	0	0.00
34736.	fast (type_maste7)	1	71.47	71.47	1	100.00
34737.	Zack (zackoconnor)	1	84.56	84.56	1	100.00
34738.	Xperks (xperks)	1	64.57	64.57	0	0.00
34739.	Harry (workisgood)	1	88.61	88.61	0	0.00
34740.	Ahmado (abdoshark)	1	28.42	28.42	0	0.00
34741.	Chris (chrisbender)	1	83.30	83.30	0	0.00
34742.	Jimmy (brazen938)	1	59.35	59.35	0	0.00
34743.	Felipe (felip6)	1	73.61	73.61	0	0.00
34744.	Mystery (fisehagebriel)	1	60.64	60.64	0	0.00
34745.	Alfie (pastyluveer)	1	73.81	73.81	0	0.00
34746.	Dennis (th1cket)	1	57.82	57.82	0	0.00
34747.	Ivan (4aner)	1	68.86	68.86	0	0.00
34748.	Vasyl (n4x20n4x)	1	47.91	47.91	0	0.00
34749.	Mihovil (mikroskop)	1	65.10	65.10	0	0.00
34750.	allen88787 (allen88787)	1	32.66	32.66	0	0.00
34751.	William (williamormous)	1	60.30	60.30	1	100.00
34752.	Khaled (khaledrezk)	1	59.54	59.54	0	0.00
34753.	Thomas (serbian_mafioso)	1	79.29	79.29	0	0.00
34754.	Sean (rhus_rhadicans)	1	46.77	46.77	0	0.00
34755.	James (chihwks13)	1	42.54	42.54	0	0.00
34756.	Flappy (flappy23)	1	128.00	128.00	1	100.00
34757.	Xeli (xeliexia)	1	83.25	83.25	0	0.00
34758.	em :) (ratkangaroo)	1	77.94	77.94	0	0.00
34759.	Andrew (trash6854)	1	55.37	55.37	1	100.00
34760.	killercrafto3 (killercrafto3)	1	95.01	95.01	1	100.00
34761.	16thofApril (althome)	1	59.56	59.56	0	0.00
34762.	Greg (dildno)	1	67.70	67.70	1	100.00
34763.	ZakiDaBest (zakidabest)	1	64.98	64.98	0	0.00
34764.	Amber (ambrealla)	1	132.62	132.62	1	100.00
34765.	Aditya (adirev)	1	88.22	88.22	0	0.00
34766.	Isak (isakts)	1	64.55	64.55	0	0.00
34767.	Ruju (karngu)	1	109.51	109.51	0	0.00
34768.	Evan (sacrigrape)	1	95.18	95.18	0	0.00
34769.	Pablo (pgzimm)	1	48.98	48.98	0	0.00
34770.	:) (username387545)	1	65.32	65.32	0	0.00
34771.	Don (hatt730)	1	65.20	65.20	0	0.00
34772.	Cherry (cherryboikwai)	1	42.70	42.70	0	0.00
34773.	SwordFishArvid (swordfishar...	1	75.74	75.74	0	0.00
34774.	nareik (nareik)	1	60.31	60.31	0	0.00
34775.	An (chrisdolmeth)	1	78.67	78.67	0	0.00
34776.	Tom (tomission)	1	53.84	53.84	0	0.00
34777.	Nathan (veroah)	1	53.41	53.41	1	100.00
34778.	vavkav (vavkav)	1	45.65	45.65	0	0.00
34779.	Ruspah (ruspah)	1	48.48	48.48	0	0.00
34780.	Joshua (joshyexe)	1	49.22	49.22	1	100.00
34781.	PainlessKarma (painlesskarma)	1	62.89	62.89	0	0.00
34782.	seraph (xseraph)	1	71.69	71.69	0	0.00
34783.	bass (benna_san)	1	35.18	35.18	0	0.00
34784.	Pepe (pedroporro)	1	47.01	47.01	0	0.00
34785.	Ayatullah (ayata_asyrafi)	1	52.82	52.82	1	100.00
34786.	Anneliese (anjennin)	1	67.75	67.75	1	100.00
34787.	RabbitsFoot (rabbitsfoot)	1	77.03	77.03	0	0.00
34788.	snackrunner (typer54235)	1	73.13	73.13	0	0.00
34789.	Abdelrahman (crb1998)	1	58.40	58.40	0	0.00
34790.	Zinc (zinczinc)	1	73.62	73.62	1	100.00
34791.	Stanley (itsstannnn)	1	88.60	88.60	0	0.00
34792.	tourist (tourist2369)	1	36.69	36.69	0	0.00
34793.	Andrea (ahasselbach)	1	83.86	83.86	0	0.00
34794.	Lotsoftypos (lotsoftypos)	1	72.23	72.23	0	0.00
34795.	Elias (monkeybrain)	1	82.25	82.25	1	100.00
34796.	aakk (thegreatkid)	1	84.27	84.27	0	0.00
34797.	Nilang (nilang333)	1	45.99	45.99	0	0.00
34798.	Lore (prinssi)	1	42.69	42.69	0	0.00
34799.	Riley (cringeykidriley)	1	63.69	63.69	0	0.00
34800.	Bruce (brucejamesmonge)	1	72.59	72.59	0	0.00
34801.	kada (kadaa)	1	66.10	66.10	0	0.00
34802.	goofyahhtypist (keyzeyy)	1	105.03	105.03	1	100.00
34803.	JD (jdllim)	1	82.64	82.64	1	100.00
34804.	HenryTheAce (henrytheace)	1	71.25	71.25	0	0.00
34805.	Michael (tomanio92)	1	52.47	52.47	0	0.00
34806.	Corey (cannolis_dad)	1	85.82	85.82	0	0.00
34807.	Click Clack (onyxz28)	1	100.20	100.20	1	100.00
34808.	lucas (mrredam)	1	59.70	59.70	0	0.00
34809.	Joy (joyshi)	1	95.87	95.87	1	100.00
34810.	aki (vampireweekend)	1	79.11	79.11	1	100.00
34811.	crimolf (crimolf)	1	41.16	41.16	1	100.00
34812.	Giovi88 (giovi88)	1	47.30	47.30	0	0.00
34813.	Pupumates (pupumates)	1	55.32	55.32	1	100.00
34814.	Tim (huaishuo)	1	59.59	59.59	0	0.00
34815.	Electricity (brokenskyline)	1	44.30	44.30	0	0.00
34816.	Dav (ahjins)	1	81.76	81.76	0	0.00
34817.	Diego (coryfax)	1	57.03	57.03	0	0.00
34818.	Jeff (thejeff365)	1	34.80	34.80	0	0.00
34819.	real (real346)	1	47.58	47.58	0	0.00
34820.	Aleey (aleyys)	1	48.07	48.07	0	0.00
34821.	Ben (magic_typer12)	1	28.89	28.89	0	0.00
34822.	BraveSoul2110 (braveboi2110)	1	57.17	57.17	0	0.00
34823.	Zedix (_zedix_)	1	92.48	92.48	0	0.00
34824.	dippyflippy (_xtremeultra_)	1	73.06	73.06	0	0.00
34825.	Simon (_wolfram)	1	70.57	70.57	1	100.00
34826.	WhaLeS (_whal3s)	1	72.02	72.02	0	0.00
34827.	Try (_tryhard_)	1	43.66	43.66	0	0.00
34828.	Sujal (_sujal_panwar_)	1	58.39	58.39	0	0.00
34829.	Gustave (_stavegu_)	1	44.77	44.77	0	0.00
34830.	ALi (_octopus_)	1	53.37	53.37	0	0.00
34831.	mel (_melissa9_)	1	50.39	50.39	0	0.00
34832.	Liv (_liiv_)	1	34.23	34.23	0	0.00
34833.	Miles (_kilometers_)	1	91.95	91.95	1	100.00
34834.	kelly:)) (_kelly)	1	91.68	91.68	0	0.00
34835.	Jan (_jan_)	1	41.28	41.28	0	0.00
34836.	donkey (_donkey)	1	105.16	105.16	1	100.00
34837.	Connor (_cyber_)	1	72.30	72.30	1	100.00
34838.	cyberrex aka (_cyberrex)	1	55.33	55.33	0	0.00
34839.	adelina (zzzyawn)	1	111.90	111.90	0	0.00
34840.	zzzr (zzzr)	1	175.47	175.47	1	100.00
34841.	zulueta (zzxjoanw)	1	93.27	93.27	1	100.00
34842.	Ian (zzstatixzz)	1	84.45	84.45	0	0.00
34843.	Hayden (zylixer)	1	94.04	94.04	0	0.00
34844.	joe (zyas)	1	69.93	69.93	0	0.00
34845.	Mohammad (zxelrate)	1	93.99	93.99	1	100.00
34846.	Nikolaus (zweehn)	1	74.13	74.13	0	0.00
34847.	Mokhirjon (zvermafia)	1	61.32	61.32	0	0.00
34848.	John (ztriplez)	1	129.14	129.14	0	0.00
34849.	Daniele (zspida)	1	34.86	34.86	0	0.00
34850.	Alex (zoggthefantastic)	1	52.84	52.84	0	0.00
34851.	lev (zoevespa)	1	59.94	59.94	0	0.00
34852.	Matthew (zoddiak)	1	99.45	99.45	1	100.00
34853.	Boof (zmoney0805)	1	86.56	86.56	0	0.00
34854.	zlyzah (zlyzah123)	1	120.39	120.39	1	100.00
34855.	zizu08 (zizu08)	1	62.11	62.11	0	0.00
34856.	Dan (zizochefe)	1	85.35	85.35	1	100.00
34857.	ZIRRO (zirro7825)	1	48.86	48.86	0	0.00
34858.	zion=overrated (ziongotnohops)	1	92.89	92.89	0	0.00
34859.	noodle (zhyua001)	1	64.88	64.88	1	100.00
34860.	Aleksandra (zhisniacova)	1	48.48	48.48	0	0.00
34861.	Zhen (zhenshin)	1	61.96	61.96	0	0.00
34862.	z (zhempal)	1	68.30	68.30	0	0.00
34863.	zHekLeR (zhekler)	1	115.65	115.65	0	0.00
34864.	Zhan (zhanzhaksylyk)	1	67.66	67.66	0	0.00
34865.	Zeus (zeuseus)	1	71.02	71.02	1	100.00
34866.	(zeoxsys)	1	72.36	72.36	0	0.00
34867.	Zen (zen_xs)	1	67.39	67.39	0	0.00
34868.	zach (zdub25)	1	45.02	45.02	0	0.00
34869.	Mikhail The Greatest (zdaro...	1	34.32	34.32	1	100.00
34870.	RJ (zayles)	1	49.61	49.61	0	0.00
34871.	Chariko (zardula)	1	69.48	69.48	0	0.00
34872.	Zan (zanimeyt)	1	23.52	23.52	1	100.00
34873.	Zambrix (zambrix)	1	129.69	129.69	1	100.00
34874.	zakkayyy (zakkayyy)	1	56.89	56.89	1	100.00
34875.	Zain (zainali23)	1	109.56	109.56	1	100.00
34876.	Zagorath (zagorath)	1	138.86	138.86	1	100.00
34877.	zealody (zackrobot)	1	147.55	147.55	0	0.00
34878.	zahra (zaaahra)	1	40.93	40.93	0	0.00
34879.	mike (yyu2017)	1	59.26	59.26	0	0.00
34880.	No (yygt777)	1	106.28	106.28	0	0.00
34881.	will (ywhh)	1	114.77	114.77	1	100.00
34882.	Yu Zhe (yuzhetang)	1	58.20	58.20	1	100.00
34883.	Yuvraj (yuvisinghie)	1	108.28	108.28	1	100.00
34884.	Yuval (yuvf)	1	62.70	62.70	1	100.00
34885.	Keith (yung_hep)	1	78.22	78.22	1	100.00
34886.	ultra (yurm)	1	40.14	40.14	0	0.00
34887.	Ben (yungmartyb)	1	80.75	80.75	0	0.00
34888.	Tommy (yungleeee)	1	92.06	92.06	0	0.00
34889.	Yuh (yuhboydeath)	1	69.42	69.42	0	0.00
34890.	Sebastian (yugireo)	1	103.35	103.35	0	0.00
34891.	Yash (ys07)	1	19.65	19.65	0	0.00
34892.	Brennen (you_arent_my_type)	1	104.85	104.85	0	0.00
34893.	yt etherlol (youtube_etherlol)	1	37.04	37.04	0	0.00
34894.	Avsome (youtooz_sellout)	1	55.67	55.67	0	0.00
34895.	Rui (youngjaerui)	1	116.62	116.62	0	0.00
34896.	Youc (youc_tagh)	1	45.23	45.23	0	0.00
34897.	transcontinentalrailroad (y...	1	96.71	96.71	0	0.00
34898.	Jack (yolomcswag56)	1	100.53	100.53	1	100.00
34899.	YoGurt (yogurt026)	1	96.80	96.80	0	0.00
34900.	Lawrence (yogaisbc)	1	80.97	80.97	1	100.00
34901.	print("Desconocid0h")#0482 ...	1	81.61	81.61	1	100.00
34902.	Park Shin Hye (yipaepaen)	1	89.05	89.05	0	0.00
34903.	Yes (yesyesman)	1	57.05	57.05	0	0.00
34904.	Yeraen (yeraen)	1	71.58	71.58	0	0.00
34905.	Owen (yellzy)	1	66.92	66.92	1	100.00
34906.	Bruh (yeetzy)	1	81.30	81.30	1	100.00
34907.	FoundSquid (yeetpp)	1	83.07	83.07	0	0.00
34908.	dukranli (yeetmen)	1	94.72	94.72	0	0.00
34909.	Yeesh (yeesh)	1	82.48	82.48	0	0.00
34910.	yata (yatapvd)	1	65.19	65.19	0	0.00
34911.	Yasmin (yasminrusty)	1	95.21	95.21	1	100.00
34912.	Yaroslav (yasi04)	1	44.76	44.76	1	100.00
34913.	Yape (yape)	1	71.27	71.27	0	0.00
34914.	Skathi (yangnakz)	1	41.88	41.88	0	0.00
34915.	Ming (yangming)	1	128.64	128.64	1	100.00
34916.	tstats[yam] (yammagar)	1	49.90	49.90	0	0.00
34917.	Yambo (yamboyam)	1	65.98	65.98	0	0.00
34918.	Jake (yakoubhachimi)	1	76.99	76.99	0	0.00
34919.	Yakend (yakend)	1	89.28	89.28	0	0.00
34920.	yahya (yahya121)	1	39.23	39.23	0	0.00
34921.	YourDeath (yabeach)	1	42.64	42.64	0	0.00
34922.	Yaaaawn (yaaawn)	1	36.04	36.04	0	0.00
34923.	M (xyx2x)	1	75.49	75.49	0	0.00
34924.	Artur (xxxartikxxx)	1	64.60	64.60	0	0.00
34925.	Sam (xxdiggyxx)	1	81.17	81.17	0	0.00
34926.	Nea (xurnub)	1	80.38	80.38	0	0.00
34927.	Xumo (xumovoid)	1	71.17	71.17	1	100.00
34928.	Sugma (xpholio)	1	81.01	81.01	0	0.00
34929.	Greg (xpec824)	1	96.04	96.04	1	100.00
34930.	Bryan (xoticfate)	1	62.88	62.88	1	100.00
34931.	Xontez (xontez)	1	68.95	68.95	0	0.00
34932.	Thomas (xnefas)	1	68.98	68.98	0	0.00
34933.	Gamer (xmph)	1	90.89	90.89	1	100.00
34934.	Martin (xmerticx)	1	69.80	69.80	0	0.00
34935.	XLASh (xlash)	1	32.20	32.20	0	0.00
34936.	matthew (xhiffer)	1	67.53	67.53	0	0.00
34937.	Gustavo (xevki)	1	109.66	109.66	1	100.00
34938.	Ru (xeruu)	1	65.58	65.58	0	0.00
34939.	Bradley (xerius1234)	1	101.22	101.22	0	0.00
34940.	Ksawery (xenzy)	1	65.54	65.54	0	0.00
34941.	nyep (xd_tdm)	1	72.36	72.36	1	100.00
34942.	you touch my (xdidox)	1	76.00	76.00	0	0.00
34943.	Tanel (xax1)	1	88.05	88.05	0	0.00
34944.	Xavier Rich (xavier_0818)	1	82.39	82.39	0	0.00
34945.	XaRuXu (xaruxu)	1	91.81	91.81	0	0.00
34946.	Sean (xanxusgao14)	1	106.85	106.85	1	100.00
34947.	Saptarsi (xanxian)	1	31.21	31.21	0	0.00
34948.	xandi (xandic)	1	74.79	74.79	0	0.00
34949.	Xander (xanderthegreater)	1	66.28	66.28	0	0.00
34950.	Xander (xander93)	1	74.46	74.46	0	0.00
34951.	Xanafer (xanafer630)	1	102.58	102.58	1	100.00
34952.	Marcus (x5starmodding)	1	103.06	103.06	0	0.00
34953.	Aj (x2happy123)	1	87.61	87.61	0	0.00
34954.	person (w_person)	1	29.29	29.29	0	0.00
34955.	Wybie (wybiehamster)	1	103.49	103.49	1	100.00
34956.	Captain Constance (wyattcs)	1	111.74	111.74	1	100.00
34957.	sm (wwmon)	1	63.39	63.39	1	100.00
34958.	TJ (wtfitst2daj)	1	130.44	130.44	1	100.00
34959.	Will (wsger)	1	105.13	105.13	1	100.00
34960.	William (wrneale)	1	84.66	84.66	0	0.00
34961.	TheVictor (wrmor)	1	58.27	58.27	0	0.00
34962.	Ella (wrenegadecath)	1	72.67	72.67	1	100.00
34963.	candice (wotah_zonea_8)	1	48.33	48.33	0	0.00
34964.	Won (wontong)	1	60.87	60.87	0	0.00
34965.	Jin (wongzi)	1	81.91	81.91	0	0.00
34966.	Olle (wolle)	1	53.42	53.42	0	0.00
34967.	WolfTypist (wolftypist)	1	92.70	92.70	0	0.00
34968.	Empurrer Meow (wolfbream)	1	109.00	109.00	0	0.00
34969.	Wok (wok_e)	1	87.35	87.35	0	0.00
34970.	matt (wokpikmin555)	1	76.69	76.69	1	100.00
34971.	Wokboi (wokboi)	1	87.61	87.61	1	100.00
34972.	William (wmpmills)	1	64.57	64.57	0	0.00
34973.	Luciano (wizing)	1	87.96	87.96	1	100.00
34974.	omar (wizard24h)	1	113.14	113.14	0	0.00
34975.	James (withdraw)	1	96.71	96.71	0	0.00
34976.	death zigoq (winzu44)	1	61.83	61.83	0	0.00
34977.	Winternet (winternet)	1	52.19	52.19	0	0.00
34978.	Wint3rr (wint3r)	1	104.32	104.32	0	0.00
34979.	Winni (winnii26)	1	40.47	40.47	1	100.00
34980.	Anne-Sophie (winniethepooh2...	1	69.39	69.39	0	0.00
34981.	Mateo (winggomateo)	1	107.18	107.18	1	100.00
34982.	Winged (winged_shell)	1	89.00	89.00	0	0.00
34983.	aaaaaaa (windpiggy)	1	132.50	132.50	1	100.00
34984.	... (willnyeasianguy)	1	59.83	59.83	0	0.00
34985.	willmtx (willmtx)	1	109.14	109.14	0	0.00
34986.	William (william_wonka)	1	91.11	91.11	0	0.00
34987.	William (williamyang94)	1	96.00	96.00	1	100.00
34988.	William (williamxu78)	1	96.01	96.01	0	0.00
34989.	William (williamjr2004)	1	70.12	70.12	0	0.00
34990.	William (willhyt)	1	92.63	92.63	0	0.00
34991.	Will (willchristian00)	1	70.59	70.59	0	0.00
34992.	WH (will0wisp1)	1	61.87	61.87	0	0.00
34993.	wcbyte (wileyc19)	1	65.33	65.33	0	0.00
34994.	(wildlife)	1	154.67	154.67	0	0.00
34995.	David (wiiun)	1	50.89	50.89	0	0.00
34996.	William (wiigocadee)	1	81.36	81.36	0	0.00
34997.	stephan (wierdio)	1	77.57	77.57	0	0.00
34998.	Sha (wieng423)	1	47.38	47.38	0	0.00
34999.	Emma (whyitsjustatypingsite)	1	99.65	99.65	0	0.00
35000.	Sam (whotoldyouthat)	1	94.74	94.74	0	0.00
35001.	Alex (whitehoundd)	1	62.84	62.84	0	0.00
35002.	Lee (whaocool)	1	59.58	59.58	0	0.00
35003.	Will (wgomez1025)	1	112.92	112.92	1	100.00
35004.	David (westie)	1	86.20	86.20	0	0.00
35005.	andrew (weirdna)	1	104.98	104.98	0	0.00
35006.	Frank (weetbixkid)	1	99.26	99.26	1	100.00
35007.	Jia Quan (weejiaquan)	1	90.41	90.41	0	0.00
35008.	WeariedCoffee2 (weariedcoff...	1	96.02	96.02	0	0.00
35009.	Jakob (wcd1)	1	59.86	59.86	0	0.00
35010.	storm-gg (waytooclose)	1	81.41	81.41	0	0.00
35011.	Wawa (wawa286)	1	96.30	96.30	0	0.00
35012.	Matt (wavytypesfastafbrah)	1	115.70	115.70	1	100.00
35013.	Watson (watson0115)	1	34.05	34.05	0	0.00
35014.	4Palestine (wassim321)	1	77.28	77.28	0	0.00
35015.	Warren (warrudd)	1	95.05	95.05	1	100.00
35016.	warm (warmlettuce)	1	90.52	90.52	0	0.00
35017.	hoang viet (waniku)	1	87.80	87.80	1	100.00
35018.	Adam (wallboy)	1	119.64	119.64	1	100.00
35019.	Walker (walkerthehat)	1	81.89	81.89	0	0.00
35020.	Keshav (waldotheonlyone)	1	87.83	87.83	0	0.00
35021.	Big Boy Diamonds (waist)	1	83.07	83.07	1	100.00
35022.	Bean (waialiki)	1	61.45	61.45	0	0.00
35023.	Najmul (wahid99)	1	51.30	51.30	0	0.00
35024.	LMFAOOOOOOOOOOOOOOOOOOOOOOO...	1	158.72	158.72	1	100.00
35025.	Wade (wadewilson)	1	111.92	111.92	1	100.00
35026.	Waddles (waddles_)	1	80.17	80.17	0	0.00
35027.	Vee (v_typer)	1	53.27	53.27	0	0.00
35028.	Vyom (vyomk27)	1	77.52	77.52	0	0.00
35029.	i choke too much (vxnd_ttxa)	1	63.97	63.97	0	0.00
35030.	vvvvvvv (vvtzvv)	1	68.83	68.83	1	100.00
35031.	vurple (vurple)	1	119.90	119.90	0	0.00
35032.	Mike (vual_)	1	114.91	114.91	1	100.00
35033.	vtopfam (vtopfam)	1	58.64	58.64	0	0.00
35034.	tstats[vrooooom1337] (vrooo...	1	97.90	97.90	0	0.00
35035.	Voob (voobit)	1	77.99	77.99	0	0.00
35036.	Volta (volta_xty)	1	58.05	58.05	0	0.00
35037.	Arun (voidvortex)	1	67.07	67.07	0	0.00
35038.	meryou (vmerv)	1	22.98	22.98	0	0.00
35039.	Vlad (vlad_bizin)	1	37.39	37.39	0	0.00
35040.	V (vladk0)	1	70.10	70.10	0	0.00
35041.	Vlaad (vladiii)	1	58.30	58.30	0	0.00
35042.	Duzzy (vladieboi)	1	111.58	111.58	1	100.00
35043.	varuvaru (vividkun)	1	85.58	85.58	0	0.00
35044.	Indiastopsww3 (vivekpjoshy)	1	36.44	36.44	0	0.00
35045.	coen (vivalad)	1	75.07	75.07	1	100.00
35046.	visual (visual9)	1	86.56	86.56	0	0.00
35047.	Viraj (viruthefire)	1	70.72	70.72	1	100.00
35048.	Niggo (virtualnick)	1	62.90	62.90	0	0.00
35049.	Chase (viper681)	1	107.15	107.15	0	0.00
35050.	Patrick (viperpat)	1	69.90	69.90	0	0.00
35051.	Xx_DiwaliGaming_xX (violert)	1	98.06	98.06	0	0.00
35052.	Yeoh (vinylsen)	1	31.68	31.68	0	0.00
35053.	Vintus_Pancere (vintus_panc...	1	76.05	76.05	0	0.00
35054.	UwU (vintiny)	1	94.85	94.85	0	0.00
35055.	Vinoth (vinoth46)	1	65.96	65.96	1	100.00
35056.	Vinny's (vinnymason928)	1	62.11	62.11	0	0.00
35057.	Vinka (vinka_anggita)	1	55.41	55.41	1	100.00
35058.	2SCucumber (vincicheung361)	1	59.27	59.27	0	0.00
35059.	VinceFX (vincefx)	1	95.99	95.99	1	100.00
35060.	Vincent (vinc20w)	1	53.68	53.68	0	0.00
35061.	mhtnx (vim_sen)	1	77.07	77.07	0	0.00
35062.	vile11s (vile11s)	1	73.19	73.19	1	100.00
35063.	Viktor (viktorpisatelq)	1	53.67	53.67	0	0.00
35064.	Viktordido (viktor_dido27)	1	59.80	59.80	0	0.00
35065.	Viktor (viksaniksa)	1	78.56	78.56	1	100.00
35066.	Erik (vike92)	1	73.26	73.26	0	0.00
35067.	Vignesh (vigneshc)	1	165.79	165.79	1	100.00
35068.	Ian (vidar11)	1	51.97	51.97	0	0.00
35069.	Vinicius (vidal404)	1	45.49	45.49	1	100.00
35070.	Victor (victors3n34)	1	51.45	51.45	0	0.00
35071.	David (vicksdawg)	1	110.52	110.52	1	100.00
35072.	Victoria (vghanma)	1	80.52	80.52	0	0.00
35073.	Vexisu (vexisu)	1	54.45	54.45	0	0.00
35074.	Toby (vestrax)	1	71.29	71.29	0	0.00
35075.	Very Noob (very_noob)	1	63.86	63.86	1	100.00
35076.	joshua728 real (veryslowracer)	1	150.63	150.63	1	100.00
35077.	Greg (vertcanard)	1	140.68	140.68	1	100.00
35078.	Eram (verstecken)	1	64.30	64.30	1	100.00
35079.	vck3000 (vck3000)	1	137.21	137.21	1	100.00
35080.	Ian but less cool (vcap36)	1	108.22	108.22	0	0.00
35081.	Sambath (vatana7)	1	80.57	80.57	0	0.00
35082.	Varun (varun2)	1	84.49	84.49	1	100.00
35083.	varitox (varitox)	1	36.84	36.84	0	0.00
35084.	Vhae (variesg25)	1	34.57	34.57	0	0.00
35085.	Farbod (varbov)	1	75.40	75.40	1	100.00
35086.	vaquinha (vaquinha)	1	31.07	31.07	1	100.00
35087.	deicius (vantaclock)	1	100.85	100.85	0	0.00
35088.	Miguel (vansterrgod)	1	109.37	109.37	0	0.00
35089.	Vanq5 (vanquisher5)	1	109.03	109.03	1	100.00
35090.	Vanessa (vanessad6379)	1	68.99	68.99	0	0.00
35091.	J (valorantjoon)	1	43.79	43.79	0	0.00
35092.	vain (vaininsanity)	1	112.01	112.01	0	0.00
35093.	Vagrant Niff (vagrantniff)	1	66.59	66.59	0	0.00
35094.	🤟 Aguero 😁 (vadamulu)	1	74.27	74.27	0	0.00
35095.	Roh (uzu23)	1	83.41	83.41	1	100.00
35096.	Utmarteas (utmarteas)	1	78.09	78.09	0	0.00
35097.	usually (usually99)	1	60.85	60.85	0	0.00
35098.	Yunus (usslang)	1	79.78	79.78	1	100.00
35099.	TheAcc (use_r_name)	1	104.36	104.36	1	100.00
35100.	Evelyn (username0531)	1	67.85	67.85	1	100.00
35101.	Carlos (user0x539)	1	74.94	74.94	1	100.00
35102.	Sophie (ururunwolf)	1	119.82	119.82	0	0.00
35103.	crooow (urrmomscockroach)	1	63.47	63.47	0	0.00
35104.	kerokero (urechila)	1	100.68	100.68	0	0.00
35105.	mak (urhg66)	1	76.51	76.51	0	0.00
35106.	Kai (uploz)	1	118.76	118.76	0	0.00
35107.	Josh (upaymeifixit)	1	89.24	89.24	1	100.00
35108.	Uniphy (unitatoruler)	1	115.92	115.92	1	100.00
35109.	DreamTheater (uniplayer)	1	75.91	75.91	0	0.00
35110.	pablo (unicorngaming)	1	85.98	85.98	1	100.00
35111.	Alex (unggoy2235)	1	128.16	128.16	0	0.00
35112.	Laith (unclezebra)	1	64.76	64.76	1	100.00
35113.	RunniNose (unbread)	1	102.16	102.16	1	100.00
35114.	unboundx (unboundxzackk)	1	60.57	60.57	0	0.00
35115.	albert (umibozu666)	1	41.30	41.30	1	100.00
35116.	Ultra (ultra_1001)	1	26.73	26.73	0	0.00
35117.	UltimaTech (ultimatech_)	1	80.03	80.03	1	100.00
35118.	potatu (ulgyscptato)	1	93.87	93.87	0	0.00
35119.	Yosa (uknowyosa)	1	63.65	63.65	1	100.00
35120.	Ujjwal (ujjwal_choudhary)	1	43.72	43.72	0	0.00
35121.	Ujjwal (ujjwal3756)	1	65.88	65.88	0	0.00
35122.	ujai (ujai)	1	74.29	74.29	0	0.00
35123.	Bianca (uhbia)	1	58.31	58.31	1	100.00
35124.	Michael Hunt (uhohpoopies)	1	92.25	92.25	0	0.00
35125.	uchka (uchka0826)	1	90.53	90.53	1	100.00
35126.	Ayyoob M (ub114)	1	65.95	65.95	0	0.00
35127.	Fire (tytysoeng)	1	74.46	74.46	0	0.00
35128.	Bob (typocheck)	1	103.85	103.85	1	100.00
35129.	aidan (typingusername)	1	109.14	109.14	0	0.00
35130.	Kelvin (typingkelvin)	1	121.52	121.52	1	100.00
35131.	Duy Anh (typingisgod)	1	74.00	74.00	0	0.00
35132.	Yo (typin)	1	66.60	66.60	0	0.00
35133.	Joshua (type_god_1466)	1	110.15	110.15	0	0.00
35134.	Tom (typewritertom)	1	124.69	124.69	1	100.00
35135.	Victor (typetwister)	1	40.43	40.43	1	100.00
35136.	Robert (typeson)	1	88.91	88.91	0	0.00
35137.	Ian (typer_goose)	1	107.83	107.83	0	0.00
35138.	naraha (typer_anu_layout)	1	50.71	50.71	0	0.00
35139.	Joe (typer_1_2_3)	1	39.84	39.84	0	0.00
35140.	Yango (typerix)	1	120.27	120.27	1	100.00
35141.	Adarax (typerax)	1	60.43	60.43	0	0.00
35142.	I'm fast (typeracerboisadge)	1	91.94	91.94	0	0.00
35143.	Quitalot (tylertylerooo)	1	93.84	93.84	0	0.00
35144.	OSUUUUUUUUUUUUUUUUUUUUU (ty...	1	92.19	92.19	0	0.00
35145.	Tony (tyin)	1	96.02	96.02	1	100.00
35146.	TW (twwu)	1	106.72	106.72	1	100.00
35147.	Minori (twoautumnleaf)	1	89.29	89.29	0	0.00
35148.	buntly (twitch_knighthamtv)	1	76.42	76.42	0	0.00
35149.	Noel (twicetzuyu)	1	118.72	118.72	0	0.00
35150.	22Raptors (twentytworaptors)	1	159.68	159.68	1	100.00
35151.	Aaryan (tvirus)	1	74.98	74.98	1	100.00
35152.	Moe (tux101)	1	90.48	90.48	0	0.00
35153.	Tushar (tusharsingh)	1	112.17	112.17	0	0.00
35154.	Kady's Tofu (turtlespeedster)	1	82.84	82.84	1	100.00
35155.	Peyton (turtledude48)	1	114.06	114.06	0	0.00
35156.	turtle45 (turtle45)	1	41.50	41.50	0	0.00
35157.	Envy (turbo_envy)	1	116.08	116.08	1	100.00
35158.	turbosprezarka (turbospreza...	1	73.38	73.38	1	100.00
35159.	Tumpor (tumpor)	1	67.76	67.76	0	0.00
35160.	Fetoora (tuhnsoo)	1	78.40	78.40	1	100.00
35161.	Victor (tucky50)	1	58.69	58.69	0	0.00
35162.	anh (tuananhq9)	1	32.38	32.38	0	0.00
35163.	Chinatsu (tsuremodose_jp)	1	125.67	125.67	1	100.00
35164.	EJ (tsukairin)	1	94.52	94.52	1	100.00
35165.	rea (trying_to_get_better)	1	46.38	46.38	0	0.00
35166.	Conor (tryingtotchtype)	1	80.12	80.12	1	100.00
35167.	TruwChainz (truwchainz)	1	58.63	58.63	1	100.00
35168.	Christopher (truestarsense)	1	72.70	72.70	0	0.00
35169.	Leo (truckerdeluxe)	1	52.49	52.49	0	0.00
35170.	Troy (troyvimala)	1	134.21	134.21	1	100.00
35171.	tstats[troutmaan] (troutmaan)	1	84.06	84.06	0	0.00
35172.	Tristan (trist4n2005)	1	45.22	45.22	0	0.00
35173.	Trinity (trinitysam)	1	98.23	98.23	0	0.00
35174.	Behind (trigstur)	1	51.94	51.94	0	0.00
35175.	Trey (treytech3)	1	102.96	102.96	0	0.00
35176.	martin (tredecies)	1	74.85	74.85	0	0.00
35177.	Travis (travis3372)	1	111.94	111.94	1	100.00
35178.	Alexander (traveler_exe)	1	60.24	60.24	0	0.00
35179.	David (traummann2157)	1	84.91	84.91	1	100.00
35180.	- (trashmanvlogs)	1	122.02	122.02	1	100.00
35181.	Jason (transcendentaltypist)	1	119.76	119.76	0	0.00
35182.	000557A (tr1pl0)	1	88.69	88.69	0	0.00
35183.	Travis (tr4v1sty)	1	59.69	59.69	0	0.00
35184.	timo (tpkq)	1	46.75	46.75	1	100.00
35185.	Can (tpcm)	1	70.13	70.13	0	0.00
35186.	Tony (tpark1218)	1	141.22	141.22	1	100.00
35187.	Toxi (toxi)	1	95.99	95.99	0	0.00
35188.	andrewski (toxic127)	1	76.31	76.31	0	0.00
35189.	xdxd (townpregic)	1	83.96	83.96	1	100.00
35190.	Jorge (toweringdoor)	1	127.34	127.34	0	0.00
35191.	Vanshaj (torque_i_alpha)	1	96.25	96.25	1	100.00
35192.	Tur (tops620)	1	82.25	82.25	1	100.00
35193.	yong (topcool)	1	99.46	99.46	0	0.00
35194.	tonymmm1 (tonymmm1)	1	90.24	90.24	0	0.00
35195.	Tom_09 (tommytuan009)	1	68.56	68.56	1	100.00
35196.	Tommy (tomcrott)	1	74.16	74.16	0	0.00
35197.	[YT] toby (toby_is_fluffy)	1	152.22	152.22	0	0.00
35198.	Toblaz (toblaz)	1	65.05	65.05	0	0.00
35199.	Daniyar (tobirama_senju)	1	56.46	56.46	0	0.00
35200.	Toby (tobiasharry)	1	47.04	47.04	0	0.00
35201.	Toasted (toastedsunglasses)	1	87.54	87.54	1	100.00
35202.	Tony (toanie)	1	56.66	56.66	0	0.00
35203.	Adam (toaadam)	1	101.36	101.36	0	0.00
35204.	Warden (tmt_warden)	1	71.72	71.72	0	0.00
35205.	Tony (tmor2012)	1	110.84	110.84	1	100.00
35206.	ChenTK (tklife1209)	1	34.00	34.00	0	0.00
35207.	Jai (tjpv)	1	57.00	57.00	0	0.00
35208.	Thomas (tjavi)	1	63.70	63.70	0	0.00
35209.	Angry Birds (tixwmmy)	1	135.22	135.22	1	100.00
35210.	Vroom 🚗🏍️🏎️�...	1	37.86	37.86	0	0.00
35211.	Timothy (timothyqwerty)	1	66.61	66.61	0	0.00
35212.	Alexander (timmy542)	1	133.75	133.75	1	100.00
35213.	S (time_limit)	1	37.69	37.69	1	100.00
35214.	Chen (timew8s4no1)	1	40.93	40.93	0	0.00
35215.	Jojo (timerz)	1	50.99	50.99	0	0.00
35216.	TiltClock (tiltclock)	1	95.15	95.15	1	100.00
35217.	rajendra (tillaraj)	1	119.79	119.79	1	100.00
35218.	Tiger_Pop (tiger_pop)	1	97.32	97.32	1	100.00
35219.	alex (tieiech)	1	111.07	111.07	1	100.00
35220.	Kai (tidalove)	1	113.43	113.43	0	0.00
35221.	Tiantoes (tiantoes)	1	79.76	79.76	0	0.00
35222.	teh (tiancheng)	1	40.91	40.91	1	100.00
35223.	Rosinante D. (thusspokegappy)	1	81.37	81.37	1	100.00
35224.	Chris (thunderhawk14)	1	95.51	95.51	1	100.00
35225.	Thug (thugboat)	1	111.88	111.88	1	100.00
35226.	Thomas (thomasconnector)	1	80.81	80.81	1	100.00
35227.	Random (thisistheusername0)	1	75.94	75.94	0	0.00
35228.	Ben (thisisbenmanley)	1	123.48	123.48	0	0.00
35229.	Thighology (thighology)	1	54.82	54.82	1	100.00
35230.	Nikita (thicc_not_thick)	1	50.04	50.04	0	0.00
35231.	Nightwong (thfw00)	1	107.74	107.74	1	100.00
35232.	Roman (the__one)	1	85.90	85.90	0	0.00
35233.	Rick (the_rick_astley)	1	96.96	96.96	1	100.00
35234.	turbos996 (the_puffduff)	1	68.90	68.90	0	0.00
35235.	Gavin (the_gavin12)	1	43.62	43.62	0	0.00
35236.	Evan (the_evanator)	1	73.95	73.95	0	0.00
35237.	Yoel (the_dog)	1	69.90	69.90	1	100.00
35238.	Yousef (the_beast_007)	1	30.66	30.66	0	0.00
35239.	Bashar (theyoungthunder)	1	57.09	57.09	0	0.00
35240.	Miguel (thewittywarlock)	1	107.56	107.56	1	100.00
35241.	Ethan (theweirdo1924)	1	53.37	53.37	0	0.00
35242.	Cat (theveryboredcat)	1	84.63	84.63	0	0.00
35243.	sh4rkatt4ck (thethicckid)	1	70.74	70.74	1	100.00
35244.	Marc (thespy7)	1	90.60	90.60	0	0.00
35245.	_Eclipse (thesolareclipse)	1	92.58	92.58	1	100.00
35246.	Keanu (thesinistershadow)	1	119.43	119.43	1	100.00
35247.	Torpor (thesilliest)	1	124.39	124.39	1	100.00
35248.	TheRyanatorGames (theryanat...	1	63.68	63.68	0	0.00
35249.	Andrei (therain)	1	54.31	54.31	0	0.00
35250.	Samuel (theodoruss)	1	42.25	42.25	1	100.00
35251.	Karl (themoopavra)	1	111.54	111.54	1	100.00
35252.	Tom (thekryken)	1	106.52	106.52	1	100.00
35253.	William (thekraken412)	1	80.36	80.36	0	0.00
35254.	The Cult Leader (thekingrises)	1	93.18	93.18	1	100.00
35255.	Zero (theking410)	1	66.43	66.43	0	0.00
35256.	Anderson Verajao (thekandyc...	1	106.68	106.68	1	100.00
35257.	thehiep (thehiep8x)	1	58.72	58.72	0	0.00
35258.	CHOO (thefuturist)	1	80.33	80.33	0	0.00
35259.	thefoodboi (thefoodboi)	1	57.66	57.66	0	0.00
35260.	Aritouch (theekung_69)	1	61.52	61.52	0	0.00
35261.	FlamingPhoenix40 (thedoctor40)	1	93.30	93.30	0	0.00
35262.	Christopher (thecybernile)	1	35.88	35.88	0	0.00
35263.	TheCrazyTree (thecrazytree)	1	98.23	98.23	1	100.00
35264.	Vaishnav (thecookingcardsman)	1	107.70	107.70	0	0.00
35265.	Stanislav (theboystan)	1	33.64	33.64	0	0.00
35266.	Chris (theavocado)	1	169.93	169.93	1	100.00
35267.	Bob (theasiansherlock)	1	120.48	120.48	1	100.00
35268.	Ethan (thatprogrammer)	1	98.33	98.33	0	0.00
35269.	Willy (thatboywilly149)	1	66.46	66.46	0	0.00
35270.	Darix (tf_light)	1	105.96	105.96	0	0.00
35271.	Seif Eldin (terrascoper)	1	79.93	79.93	0	0.00
35272.	Terminator (terminator_01)	1	43.01	43.01	0	0.00
35273.	terdywerks (terdywerks)	1	103.72	103.72	1	100.00
35274.	Moni (tentwashere)	1	70.27	70.27	1	100.00
35275.	Temirlan (temirlan178)	1	44.06	44.06	0	0.00
35276.	Alex (teflondon361)	1	74.17	74.17	0	0.00
35277.	Tee (teegenius196)	1	72.50	72.50	0	0.00
35278.	Edgey (tedge)	1	84.69	84.69	0	0.00
35279.	teddy (teddyweaber)	1	75.66	75.66	0	0.00
35280.	Tuffy. (teddytaffy)	1	72.83	72.83	0	0.00
35281.	Ted (ted21)	1	101.54	101.54	1	100.00
35282.	Techy504 (techy504)	1	76.89	76.89	0	0.00
35283.	Soua (technogunn)	1	44.62	44.62	0	0.00
35284.	t (teaxnuba)	1	58.24	58.24	1	100.00
35285.	Mike (teamwolf11)	1	53.49	53.49	1	100.00
35286.	Trystan (tdude_37)	1	57.75	57.75	0	0.00
35287.	Toastify (tcatechofficial)	1	64.75	64.75	1	100.00
35288.	Badr (tbadr)	1	68.41	68.41	0	0.00
35289.	Tawan (tawans)	1	45.94	45.94	0	0.00
35290.	Tauske (tauske)	1	79.82	79.82	0	0.00
35291.	Nithish (tasten_drucker)	1	48.37	48.37	1	100.00
35292.	Tara (tarav21h)	1	95.32	95.32	0	0.00
35293.	tanon (tanon710s)	1	41.84	41.84	1	100.00
35294.	Mushfiq (talha76)	1	49.83	49.83	0	0.00
35295.	Sherman (takozuchi)	1	82.13	82.13	0	0.00
35296.	Eugene (takahashi19)	1	67.23	67.23	0	0.00
35297.	Taetra (taetra)	1	110.86	110.86	0	0.00
35298.	Payton (taeilz)	1	76.20	76.20	0	0.00
35299.	Marianne (taebvm)	1	27.95	27.95	0	0.00
35300.	Heet (tadu21)	1	60.74	60.74	0	0.00
35301.	Tabitha (tabi87)	1	75.64	75.64	0	0.00
35302.	lukas (s_lukas)	1	48.56	48.56	0	0.00
35303.	Alessio (syrius00)	1	84.30	84.30	0	0.00
35304.	Ayush (syndrome_)	1	76.69	76.69	0	0.00
35305.	Ba Viet (sweetweet)	1	64.40	64.40	0	0.00
35306.	Ron (swavyron)	1	75.31	75.31	0	0.00
35307.	Peter (swankypete)	1	61.32	61.32	0	0.00
35308.	swag (swaglord1)	1	114.88	114.88	0	0.00
35309.	Davinti (swaggaming)	1	63.85	63.85	0	0.00
35310.	Harvey (sw99)	1	103.16	103.16	1	100.00
35311.	Svan (svanstedt)	1	104.34	104.34	0	0.00
35312.	Suzaku (suzakucrono)	1	23.00	23.00	0	0.00
35313.	Alex (suyggyu)	1	78.13	78.13	0	0.00
35314.	Harry (sutherland7321)	1	65.20	65.20	0	0.00
35315.	Enrique (supraphysiological)	1	68.86	68.86	0	0.00
35316.	Artem (suplexxx)	1	71.58	71.58	0	0.00
35317.	bram (super_r23)	1	108.13	108.13	0	0.00
35318.	Superwoedi (superwoedi)	1	94.29	94.29	1	100.00
35319.	melonkng (melonkng)	1	73.64	73.64	0	0.00
35320.	i am the slowest typer in t...	1	97.32	97.32	0	0.00
35321.	RIP Byron (superfrik)	1	94.39	94.39	0	0.00
35322.	Ccori (superfifi930970)	1	52.63	52.63	1	100.00
35323.	superepic (superepicpig)	1	86.15	86.15	0	0.00
35324.	scary (superdry)	1	87.84	87.84	1	100.00
35325.	Harry (superdickson)	1	66.46	66.46	0	0.00
35326.	Trevor (super64guy)	1	79.58	79.58	0	0.00
35327.	redzic (super33)	1	132.63	132.63	1	100.00
35328.	Sun_Biel (sun_biel)	1	30.34	30.34	0	0.00
35329.	Alex (sunzu432)	1	105.72	105.72	0	0.00
35330.	Amy (sunnyaim)	1	47.95	47.95	0	0.00
35331.	Sumzar (sumzar)	1	46.59	46.59	0	0.00
35332.	sultan (sultan_sasangka)	1	107.12	107.12	0	0.00
35333.	nav (sugondese123)	1	83.32	83.32	0	0.00
35334.	Jack (sugarryboi)	1	30.09	30.09	0	0.00
35335.	Subramanya (subramanya)	1	80.89	80.89	1	100.00
35336.	Subarno (subarno)	1	83.00	83.00	0	0.00
35337.	1 (su304)	1	53.71	53.71	0	0.00
35338.	Striker21 (striker21)	1	55.00	55.00	0	0.00
35339.	Jerry (stopgetalife)	1	79.70	79.70	1	100.00
35340.	Ross (stoltay)	1	94.27	94.27	1	100.00
35341.	FREE Palestine (stilllobste...	1	29.98	29.98	0	0.00
35342.	Sawah :3 (sth2127)	1	108.29	108.29	1	100.00
35343.	Stevie (stevie81572)	1	72.53	72.53	0	0.00
35344.	dvorak64 (steveoc64)	1	77.48	77.48	0	0.00
35345.	Steven (stevenxie)	1	122.08	122.08	1	100.00
35346.	steven (steventran334)	1	126.27	126.27	0	0.00
35347.	Steven (stevensenjaya8)	1	105.08	105.08	0	0.00
35348.	Stephan (stephanvdmerwe)	1	60.25	60.25	1	100.00
35349.	May (stenotbest)	1	44.37	44.37	0	0.00
35350.	Pepa (stefanborca)	1	92.36	92.36	0	0.00
35351.	Steel9volt (steel9volty)	1	25.82	25.82	0	0.00
35352.	Milan (starzzdrak)	1	74.71	74.71	1	100.00
35353.	Johnathan (starydy)	1	97.81	97.81	1	100.00
35354.	Starwy (starwy)	1	68.40	68.40	1	100.00
35355.	star (starstrider10)	1	90.96	90.96	0	0.00
35356.	HoloCorp (starmaster)	1	52.73	52.73	0	0.00
35357.	Darwin (starfosh)	1	78.17	78.17	1	100.00
35358.	jojo (starboi_)	1	47.01	47.01	0	0.00
35359.	emmy (stannisbaratheon)	1	83.80	83.80	1	100.00
35360.	Stanislav🍆 (stanislav2000)	1	107.04	107.04	0	0.00
35361.	St1ngX (st1ngx)	1	78.28	78.28	0	0.00
35362.	Daniel (ssund)	1	153.11	153.11	1	100.00
35363.	Shaurya (ssen12)	1	109.38	109.38	1	100.00
35364.	Guido (ssawuschka)	1	65.45	65.45	0	0.00
35365.	Samuel (sroh8140)	1	124.15	124.15	1	100.00
35366.	Joe (srittenhouse)	1	113.19	113.19	1	100.00
35367.	Spyros (spyrosmk)	1	54.57	54.57	0	0.00
35368.	spudnick (spudnick47)	1	55.83	55.83	1	100.00
35369.	spowell398 (spowell398)	1	97.79	97.79	1	100.00
35370.	spocky (spocky_cheeto)	1	78.27	78.27	0	0.00
35371.	Bemysword (spligam3r)	1	69.25	69.25	0	0.00
35372.	nitewaver (spita)	1	100.55	100.55	1	100.00
35373.	Spire (spire20)	1	60.49	60.49	1	100.00
35374.	Fred (spicesouls)	1	90.39	90.39	1	100.00
35375.	SpicyAsianBoy (spicyasianboy)	1	105.31	105.31	0	0.00
35376.	Alex (sphincture)	1	147.34	147.34	1	100.00
35377.	SP (spharish)	1	74.53	74.53	0	0.00
35378.	Gabriel (spellingisstupid)	1	110.24	110.24	0	0.00
35379.	speedy (speedy_speedster)	1	89.51	89.51	0	0.00
35380.	Ben (speedysnail2005)	1	49.68	49.68	0	0.00
35381.	Conor (speedyscientist)	1	103.15	103.15	0	0.00
35382.	Vinay (spedman)	1	90.84	90.84	1	100.00
35383.	Edward (sp4rxxx)	1	42.08	42.08	0	0.00
35384.	ur mom (soysaucesparkle)	1	46.93	46.93	0	0.00
35385.	200iq man (sovietgoose)	1	97.69	97.69	0	0.00
35386.	Dave (sourcreamcun)	1	29.43	29.43	0	0.00
35387.	guts (soupyguts)	1	63.54	63.54	0	0.00
35388.	Sultan (sosa_102)	1	81.09	81.09	0	0.00
35389.	CLICKCLACKCLICKCLACK (sophi...	1	78.55	78.55	0	0.00
35390.	Sophie (sophbee)	1	46.14	46.14	0	0.00
35391.	Darius (soo_hoo)	1	97.80	97.80	0	0.00
35392.	Oliver (soonsy)	1	112.28	112.28	1	100.00
35393.	Sonny (sonny3d)	1	98.43	98.43	0	0.00
35394.	Hammad (sonic_slow)	1	62.42	62.42	1	100.00
35395.	Soni (soni801)	1	63.08	63.08	0	0.00
35396.	Soma (soma_shirei)	1	77.33	77.33	0	0.00
35397.	Solst (solst)	1	96.02	96.02	1	100.00
35398.	SolidSonicTH (solidsonicth)	1	103.64	103.64	1	100.00
35399.	soleus (soleusplantaris)	1	61.99	61.99	0	0.00
35400.	Kawsa (sold_mom_for_rp)	1	77.76	77.76	0	0.00
35401.	Sola (solaonix)	1	71.07	71.07	1	100.00
35402.	Bennett (sol4rflare)	1	49.68	49.68	0	0.00
35403.	Erik (soggybutter)	1	85.29	85.29	0	0.00
35404.	sofy (sofym3sa)	1	36.48	36.48	0	0.00
35405.	John (soegnam)	1	57.59	57.59	0	0.00
35406.	enzo (sockenzo)	1	73.28	73.28	0	0.00
35407.	soadsuey (soadsuey)	1	126.28	126.28	1	100.00
35408.	xX-St3voNY-Xx (snuggets619)	1	82.08	82.08	1	100.00
35409.	Niilo (snowyz)	1	95.80	95.80	0	0.00
35410.	SNovaK (snovak)	1	55.79	55.79	0	0.00
35411.	Oliver (snorkypant)	1	41.72	41.72	0	0.00
35412.	Jamie (sneepdeep)	1	70.87	70.87	0	0.00
35413.	Snactus (snactus)	1	119.63	119.63	1	100.00
35414.	Daniel (sn1054)	1	83.58	83.58	1	100.00
35415.	filthy (smargobot)	1	81.06	81.06	1	100.00
35416.	Julia (smallone4130)	1	95.51	95.51	1	100.00
35417.	Slyther (slyth3r_)	1	66.64	66.64	0	0.00
35418.	Alex (slybilia)	1	53.55	53.55	1	100.00
35419.	Dylan (slumpgod)	1	91.45	91.45	0	0.00
35420.	SluggardBark444 (sluggardba...	1	51.20	51.20	0	0.00
35421.	snails (slow_learner_2000)	1	79.26	79.26	0	0.00
35422.	tstats[slowtyperider] (slow...	1	94.50	94.50	1	100.00
35423.	APMAPMAPM (slowtyperbtw)	1	106.03	106.03	0	0.00
35424.	jp (slowpractice)	1	115.37	115.37	1	100.00
35425.	Colm (slowandslow22)	1	41.66	41.66	0	0.00
35426.	Slicklikedat (slicklikedat)	1	69.35	69.35	0	0.00
35427.	Slacky (slackyisbacky)	1	75.25	75.25	1	100.00
35428.	Sprout (skyshedbloxian)	1	74.57	74.57	0	0.00
35429.	Byungil (skylord418)	1	62.34	62.34	0	0.00
35430.	Skullition (skullition)	1	89.79	89.79	0	0.00
35431.	Skrub (skrub_bot)	1	68.61	68.61	0	0.00
35432.	Alper (skroas)	1	100.84	100.84	1	100.00
35433.	Zach (skoopy)	1	120.20	120.20	0	0.00
35434.	Luke (skkywalker62)	1	17.74	17.74	0	0.00
35435.	Xavier (skittlez11)	1	89.17	89.17	0	0.00
35436.	Skinny (skinnysausage)	1	80.49	80.49	0	0.00
35437.	Sabrina (skatingprincess)	1	69.01	69.01	1	100.00
35438.	Karthik (skarthik01)	1	110.95	110.95	1	100.00
35439.	Kevin (skarl)	1	131.29	131.29	1	100.00
35440.	Paskal (skapalpaskal)	1	71.88	71.88	0	0.00
35441.	Nikos (skalkoto)	1	53.55	53.55	0	0.00
35442.	Sjoerd (sjoerdofferhaus)	1	88.46	88.46	0	0.00
35443.	sixfalls (sixfalls)	1	105.98	105.98	1	100.00
35444.	Wouter (sirwout)	1	56.92	56.92	0	0.00
35445.	Luis (sirkarpador)	1	57.91	57.91	1	100.00
35446.	SinglePaper (singlepaper)	1	88.43	88.43	0	0.00
35447.	sinchan (sinchan_rai)	1	56.92	56.92	0	0.00
35448.	Simp (simplisticbubble)	1	46.41	46.41	0	0.00
35449.	Skye (simpleskye)	1	54.04	54.04	0	0.00
35450.	simpull (simpl)	1	77.86	77.86	0	0.00
35451.	Raffael (simonraffael)	1	92.12	92.12	0	0.00
35452.	• simon • (simonnjr)	1	53.36	53.36	1	100.00
35453.	Manh Nguyen Sy (simonnguyen)	1	40.48	40.48	0	0.00
35454.	Siming (simingrox)	1	106.18	106.18	1	100.00
35455.	Simeon08 (simeon08)	1	37.98	37.98	0	0.00
35456.	Simber (simber)	1	80.49	80.49	1	100.00
35457.	Nicolas (silwr)	1	87.18	87.18	0	0.00
35458.	Silve (silve_)	1	69.79	69.79	1	100.00
35459.	Silver (silveryue)	1	101.11	101.11	1	100.00
35460.	Jayden (silvernote)	1	71.39	71.39	1	100.00
35461.	Kristof (silentreveries)	1	102.32	102.32	1	100.00
35462.	Shaun (silentfate)	1	63.96	63.96	0	0.00
35463.	Bernard (siko_lick)	1	118.86	118.86	1	100.00
35464.	Signical (signicial)	1	59.61	59.61	0	0.00
35465.	Sigurdur (siggimatti)	1	80.01	80.01	0	0.00
35466.	siddharta (sid_123)	1	38.15	38.15	0	0.00
35467.	Sid (sidch)	1	102.62	102.62	0	0.00
35468.	Siddhesh (sid20)	1	70.35	70.35	0	0.00
35469.	Sid (sid121212)	1	66.80	66.80	0	0.00
35470.	siceon7 (siceon7)	1	59.16	59.16	1	100.00
35471.	Sarah (sh_milk)	1	95.64	95.64	1	100.00
35472.	swaggin (shuutori)	1	111.70	111.70	1	100.00
35473.	Xander (shuuk1)	1	107.53	107.53	1	100.00
35474.	Shuncey (shuncey)	1	58.94	58.94	0	0.00
35475.	🌈 (shug_op)	1	134.04	134.04	1	100.00
35476.	Tsubaki (shtoo7)	1	53.43	53.43	0	0.00
35477.	Shrulk (shrulk)	1	76.49	76.49	0	0.00
35478.	Shriyans (shriyanspatnaik)	1	58.93	58.93	0	0.00
35479.	Shreyash (shreystar32)	1	66.68	66.68	0	0.00
35480.	Shrey (shrey4869)	1	60.77	60.77	0	0.00
35481.	Markus Solem (shrexy)	1	92.69	92.69	1	100.00
35482.	Shrekcob (shrekcob)	1	48.85	48.85	0	0.00
35483.	Shorba (shorba)	1	85.78	85.78	1	100.00
35484.	Matt (shootposting)	1	70.99	70.99	0	0.00
35485.	SHO (shoganeko)	1	134.01	134.01	1	100.00
35486.	Kevin (shocky79420)	1	119.29	119.29	0	0.00
35487.	Shoaib Sajid (shoaibsajid)	1	69.60	69.60	0	0.00
35488.	shmuel (shmuel555)	1	61.06	61.06	0	0.00
35489.	Alex (shmixers)	1	110.95	110.95	1	100.00
35490.	Zwe (shizzlemanizzle_)	1	103.17	103.17	0	0.00
35491.	Shivinder (shivindernarr)	1	88.30	88.30	1	100.00
35492.	Shivansh (shivansh_up)	1	57.13	57.13	0	0.00
35493.	Shivam (shivamgoyal241)	1	46.60	46.60	0	0.00
35494.	Shion (shionaster)	1	115.62	115.62	0	0.00
35495.	Bazingas (shinyy)	1	84.78	84.78	0	0.00
35496.	Shinuki (shinukiayato)	1	63.61	63.61	0	0.00
35497.	Shinixsan (shinixsan)	1	64.78	64.78	1	100.00
35498.	Shiftoss (shiftoss)	1	77.44	77.44	0	0.00
35499.	Shierwin (shierwin)	1	55.75	55.75	0	0.00
35500.	Uhhhhhhh (shidlord)	1	70.41	70.41	0	0.00
35501.	Sias (shiasu)	1	64.00	64.00	0	0.00
35502.	poggers (shezzerk)	1	24.42	24.42	0	0.00
35503.	Shervin (shervin_typing)	1	62.31	62.31	0	0.00
35504.	Sherlock (sherlock_homies)	1	69.17	69.17	0	0.00
35505.	sherimori (sherimori)	1	130.26	130.26	1	100.00
35506.	Isaac (shepisaac)	1	91.22	91.22	1	100.00
35507.	Cease (shellahfellah)	1	143.44	143.44	0	0.00
35508.	Shehab (shehab_is_legendary)	1	76.61	76.61	0	0.00
35509.	Genie (shazamrockshake)	1	68.28	68.28	0	0.00
35510.	Seamus (shaydogga)	1	59.00	59.00	0	0.00
35511.	Shawdowv(Guest) (shawdowv)	1	51.50	51.50	1	100.00
35512.	Shaun (shaunjohnathon)	1	105.10	105.10	1	100.00
35513.	Hiro-X (shaum257)	1	76.05	76.05	1	100.00
35514.	sharnice (shar_j)	1	53.87	53.87	0	0.00
35515.	tai (sharpblader)	1	83.55	83.55	0	0.00
35516.	Shark (sharktornado)	1	70.97	70.97	0	0.00
35517.	Jack (sharku)	1	85.88	85.88	0	0.00
35518.	Jim (shampoobottle14)	1	54.45	54.45	0	0.00
35519.	disheyo (shakura)	1	143.94	143.94	1	100.00
35520.	Brendan (shagsterrodgers)	1	58.23	58.23	0	0.00
35521.	Max (shaforodowntown)	1	74.24	74.24	0	0.00
35522.	ShadowTenshii (shadowtenshii)	1	118.14	118.14	1	100.00
35523.	Shadow (shadowenesakif)	1	56.15	56.15	1	100.00
35524.	Shader (shader_zxa)	1	33.57	33.57	0	0.00
35525.	shack (shacklos)	1	133.23	133.23	1	100.00
35526.	shaad (shaaad)	1	73.75	73.75	0	0.00
35527.	Batuhan (sh4yn)	1	51.78	51.78	0	0.00
35528.	Mackenzie (sgxserenity)	1	100.01	100.01	1	100.00
35529.	Sam (sf424)	1	154.19	154.19	1	100.00
35530.	Jinna (se_sean)	1	31.69	31.69	0	0.00
35531.	MCowSevt (sevt)	1	78.51	78.51	1	100.00
35532.	sherry (serulii)	1	139.65	139.65	1	100.00
35533.	Sergio (sertheveteran)	1	74.46	74.46	0	0.00
35534.	Sergio (sergi910)	1	49.77	49.77	0	0.00
35535.	sun (september28)	1	88.32	88.32	0	0.00
35536.	Michael (sephknowhim)	1	71.21	71.21	0	0.00
35537.	seon (seon123)	1	94.68	94.68	1	100.00
35538.	slowass (senseyf)	1	117.28	117.28	0	0.00
35539.	Senpai (senpaisenpai)	1	78.27	78.27	0	0.00
35540.	a (semperamico)	1	49.57	49.57	0	0.00
35541.	perfvil (sellected)	1	57.39	57.39	1	100.00
35542.	Ed (selfe)	1	100.20	100.20	0	0.00
35543.	insane (sejal)	1	94.42	94.42	0	0.00
35544.	Alex (sefader)	1	73.10	73.10	1	100.00
35545.	Sorbble (sebby122)	1	95.78	95.78	0	0.00
35546.	Searchsr555 (searchsr555)	1	33.56	33.56	1	100.00
35547.	Sean (sean33333)	1	109.73	109.73	1	100.00
35548.	Angel (seal_gel)	1	81.97	81.97	0	0.00
35549.	Shreyan (sdutta4)	1	46.21	46.21	0	0.00
35550.	basil (screamingsavannah)	1	82.65	82.65	0	0.00
35551.	prophet muhammad (fucboi)	1	93.14	93.14	0	0.00
35552.	Daniel (fsajijkt)	1	50.82	50.82	0	0.00
35553.	joey (fryhyi)	1	78.45	78.45	0	0.00
35554.	Lol (fryed)	1	61.65	61.65	0	0.00
35555.	Raveon (frozenpriest)	1	90.73	90.73	1	100.00
35556.	Frostx (frostx)	1	74.25	74.25	0	0.00
35557.	sdfsdf (frogchan)	1	139.99	139.99	1	100.00
35558.	Frans (frns)	1	52.87	52.87	0	0.00
35559.	yi hein (friends)	1	100.41	100.41	0	0.00
35560.	Diddy (friedrichzzz)	1	47.26	47.26	0	0.00
35561.	Surendra (frensuren)	1	90.91	90.91	0	0.00
35562.	Ashutosh (free_electron)	1	45.71	45.71	0	0.00
35563.	freezefreeze (freezefreeze)	1	111.46	111.46	1	100.00
35564.	anthony (freesubs)	1	85.21	85.21	0	0.00
35565.	Doctor (freakahontas)	1	95.39	95.39	0	0.00
35566.	eevee (frazyx)	1	67.45	67.45	0	0.00
35567.	Frank (frankyfrank)	1	68.53	68.53	1	100.00
35568.	Frank (franktank840)	1	84.58	84.58	0	0.00
35569.	Brian (franklybrian)	1	59.27	59.27	0	0.00
35570.	Fragobert (fragobert)	1	51.38	51.38	0	0.00
35571.	Fr33 (fr33_wifi)	1	99.10	99.10	1	100.00
35572.	chris (founduman)	1	24.53	24.53	0	0.00
35573.	Forrest (forrest_p)	1	102.35	102.35	0	0.00
35574.	Artis (formoned)	1	62.88	62.88	1	100.00
35575.	Alex (fordalex)	1	78.30	78.30	1	100.00
35576.	Jello (foolishfacade)	1	65.69	65.69	0	0.00
35577.	Vincent (foolguy13)	1	99.61	99.61	1	100.00
35578.	PikaChris (foforin112)	1	83.85	83.85	1	100.00
35579.	Huy (fobo911)	1	150.03	150.03	1	100.00
35580.	Quinn (flyinfox)	1	82.40	82.40	1	100.00
35581.	Tony (fluttersparkl)	1	155.83	155.83	1	100.00
35582.	llama (flulululu)	1	88.76	88.76	0	0.00
35583.	Florian (florianfor3)	1	62.43	62.43	0	0.00
35584.	Alan (fleekeazy)	1	94.77	94.77	0	0.00
35585.	Lazy (flashinlazer)	1	75.38	75.38	0	0.00
35586.	Dog (flash2victory)	1	95.26	95.26	1	100.00
35587.	Cristian (flanzeta)	1	89.26	89.26	1	100.00
35588.	Ash (flamingo_god)	1	72.52	72.52	1	100.00
35589.	Anirudh (flaes)	1	75.56	75.56	0	0.00
35590.	Fizh (fizh29)	1	65.98	65.98	0	0.00
35591.	Devn (fishology)	1	94.34	94.34	1	100.00
35592.	FireKing8877 (fireking8877)	1	39.11	39.11	0	0.00
35593.	Joseph (fireguy1920)	1	94.04	94.04	1	100.00
35594.	omar (fireclaw5)	1	53.03	53.03	0	0.00
35595.	Anthony (fireant131)	1	47.52	47.52	0	0.00
35596.	Finn (finnph)	1	64.54	64.54	0	0.00
35597.	Minh (fingies_thingies)	1	134.41	134.41	1	100.00
35598.	Filth (filthyslush)	1	49.27	49.27	0	0.00
35599.	Shawn (filipinofriend)	1	55.86	55.86	0	0.00
35600.	Filip (fifal)	1	86.66	86.66	0	0.00
35601.	Manolo (fiendz)	1	55.55	55.55	0	0.00
35602.	SambelB2P (fianjansen)	1	49.18	49.18	0	0.00
35603.	falco.gs (fhoover)	1	71.67	71.67	0	0.00
35604.	Tyler (fffish)	1	100.03	100.03	1	100.00
35605.	Andrew (fffire)	1	63.17	63.17	0	0.00
35606.	Mohammed (fermatslastaccount)	1	81.57	81.57	0	0.00
35607.	fe (ferkoaa)	1	88.79	88.79	0	0.00
35608.	Ill (fencing)	1	60.27	60.27	0	0.00
35609.	Jack (feloniousshmuck)	1	89.19	89.19	0	0.00
35610.	Steffen (fellroy)	1	66.02	66.02	0	0.00
35611.	Felix (felixthefroggo)	1	70.96	70.96	0	0.00
35612.	Felipe (felipegomes)	1	87.18	87.18	0	0.00
35613.	Felipe (feglex)	1	50.33	50.33	1	100.00
35614.	Heitor (fearlessss)	1	59.79	59.79	0	0.00
35615.	Fayr (fayr)	1	114.88	114.88	1	100.00
35616.	Asher (fastwack)	1	31.60	31.60	0	0.00
35617.	fast (fasttyper3256)	1	45.75	45.75	0	0.00
35618.	Andreee (farskyz)	1	81.34	81.34	0	0.00
35619.	Farey (farey0633)	1	93.53	93.53	0	0.00
35620.	FaptasticFingers (faptastic...	1	59.95	59.95	0	0.00
35621.	Trixie (fantoro)	1	89.92	89.92	1	100.00
35622.	Frantisek (fandaa7)	1	50.66	50.66	0	0.00
35623.	falsz (falsz)	1	106.95	106.95	0	0.00
35624.	huacheng (fallingfeather)	1	97.29	97.29	1	100.00
35625.	sdjikalmd (falcony)	1	106.38	106.38	1	100.00
35626.	Fake (fake_hooman)	1	65.21	65.21	1	100.00
35627.	Timix (faketimix)	1	86.21	86.21	1	100.00
35628.	Otimos (faketaxiia)	1	67.80	67.80	1	100.00
35629.	Faizan (faizan1)	1	79.23	79.23	1	100.00
35630.	fair (fairpixa)	1	76.38	76.38	0	0.00
35631.	Matteo (fail_2000)	1	51.63	51.63	1	100.00
35632.	fady (fady1)	1	27.64	27.64	0	0.00
35633.	John (fadedrunner)	1	47.49	47.49	0	0.00
35634.	Fabio (fabiososo)	1	82.91	82.91	1	100.00
35635.	Fabio (fabiom26)	1	74.27	74.27	0	0.00
35636.	Ville (f1ftw123)	1	74.11	74.11	0	0.00
35637.	Emlyn (e_typist_112)	1	85.56	85.56	0	0.00
35638.	Mackwein (e_p_i_c)	1	39.05	39.05	0	0.00
35639.	Elif (e_gamer)	1	74.15	74.15	0	0.00
35640.	Icarus (ezzeldeen_27)	1	74.01	74.01	0	0.00
35641.	Ezequiel (ezequiel102)	1	70.03	70.03	1	100.00
35642.	Evan (ezb2661)	1	130.80	130.80	1	100.00
35643.	Eyas (eyasmodhesh)	1	123.94	123.94	1	100.00
35644.	Exsuz (exsuz)	1	75.74	75.74	1	100.00
35645.	Dylan (exordium)	1	82.17	82.17	1	100.00
35646.	Mehedi (exilour)	1	76.21	76.21	1	100.00
35647.	Exhessity (exhessity)	1	79.74	79.74	0	0.00
35648.	Exelendary (exelendary)	1	57.04	57.04	0	0.00
35649.	evsk (evsk)	1	76.17	76.17	1	100.00
35650.	Evan (evndude)	1	122.38	122.38	0	0.00
35651.	EvilNoodle (evilnoodle)	1	88.98	88.98	0	0.00
35652.	Adam (eveve05)	1	59.20	59.20	0	0.00
35653.	Evan =) (evantyper)	1	51.68	51.68	0	0.00
35654.	Alex (eu_dk)	1	106.10	106.10	1	100.00
35655.	ali (ethyl_ethanoate)	1	94.63	94.63	0	0.00
35656.	Ethan (ethan_w_c)	1	71.51	71.51	0	0.00
35657.	Ethan (ethanthecuber)	1	115.85	115.85	1	100.00
35658.	Ikuya (eternal198)	1	85.39	85.39	0	0.00
35659.	Nezih (etck)	1	54.26	54.26	0	0.00
35660.	George (esvee)	1	82.00	82.00	0	0.00
35661.	Kasey (estrobe)	1	115.67	115.67	1	100.00
35662.	Ed (essencerato)	1	79.09	79.09	1	100.00
35663.	Thomas (eshes)	1	87.06	87.06	0	0.00
35664.	Ewan (erytzz)	1	76.06	76.06	0	0.00
35665.	Magnus Madsen (ersti)	1	96.71	96.71	0	0.00
35666.	Dave (erose524)	1	102.94	102.94	1	100.00
35667.	Nacho! (ernestl_lalo)	1	100.86	100.86	0	0.00
35668.	Erlan (erlansaputra)	1	49.46	49.46	0	0.00
35669.	Erion (erionz)	1	107.31	107.31	0	0.00
35670.	eriktarek (erikabd)	1	59.07	59.07	0	0.00
35671.	Erfan (erfan_hedayati)	1	79.45	79.45	0	0.00
35672.	Erdo (erdo897)	1	107.90	107.90	1	100.00
35673.	Joakim (eraji)	1	87.49	87.49	0	0.00
35674.	William (epwill)	1	56.30	56.30	0	0.00
35675.	Barış (epokhe)	1	102.36	102.36	0	0.00
35676.	ShadowBoy (epicshadowboy)	1	63.81	63.81	0	0.00
35677.	epicgdog (epicgdog)	1	76.64	76.64	0	0.00
35678.	Jovel (enyalio)	1	122.17	122.17	1	100.00
35679.	Entrook (entrook)	1	66.36	66.36	0	0.00
35680.	Nocturnal_Tofu (entity_01)	1	109.40	109.40	1	100.00
35681.	Uran (enderlordyt)	1	79.84	79.84	0	0.00
35682.	emule (emily2h)	1	106.85	106.85	1	100.00
35683.	Osteo (emiglio)	1	124.45	124.45	1	100.00
35684.	Harris (emagemag)	1	90.58	90.58	0	0.00
35685.	mong (el_tecla)	1	74.00	74.00	0	0.00
35686.	Will (elwoodbear7)	1	114.65	114.65	1	100.00
35687.	Tomasz (elpero)	1	82.10	82.10	0	0.00
35688.	Elon (elonzenub)	1	135.40	135.40	1	100.00
35689.	Lks (elluki)	1	63.46	63.46	1	100.00
35690.	Tingaling (ellehebe)	1	64.51	64.51	0	0.00
35691.	Element (elementnl)	1	128.54	128.54	1	100.00
35692.	electricas (electricas)	1	131.71	131.71	1	100.00
35693.	Daniel (eldian)	1	95.72	95.72	0	0.00
35694.	eiko (eikomaniac)	1	182.58	182.58	1	100.00
35695.	(eikig)	1	118.49	118.49	1	100.00
35696.	Eiji (eijin)	1	63.73	63.73	0	0.00
35697.	Jeff (eggdropsoup3)	1	82.86	82.86	1	100.00
35698.	Eugenio (efrias21)	1	66.86	66.86	0	0.00
35699.	Maria (efbnko)	1	53.97	53.97	0	0.00
35700.	eeya (eeya)	1	87.48	87.48	0	0.00
35701.	Edy (edyz)	1	97.77	97.77	1	100.00
35702.	Edward (edwoodxd)	1	107.81	107.81	1	100.00
35703.	edweenie (edweenie)	1	143.47	143.47	1	100.00
35704.	Edward (edwardtw92)	1	69.44	69.44	0	0.00
35705.	Edward (eduward0_)	1	59.93	59.93	0	0.00
35706.	god (edgy14yearold)	1	91.88	91.88	0	0.00
35707.	Edge (edgekaos)	1	116.51	116.51	1	100.00
35708.	Eddie (eddiesn)	1	94.53	94.53	1	100.00
35709.	Evan (edawg525)	1	95.58	95.58	0	0.00
35710.	edamame88 (edamame88)	1	42.15	42.15	0	0.00
35711.	Nick (eco_frendly)	1	112.50	112.50	1	100.00
35712.	Zailent (eclipse_zailent)	1	53.90	53.90	0	0.00
35713.	jason (echefcy)	1	92.51	92.51	1	100.00
35714.	Eric (ec052002)	1	77.61	77.61	0	0.00
35715.	bruh (easiwin2)	1	89.34	89.34	0	0.00
35716.	Discord Bot: tinyurl.com/Ty...	1	157.83	157.83	1	100.00
35717.	Daniel (d_nny)	1	132.48	132.48	1	100.00
35718.	DamarFathan (d_fathan)	1	27.16	27.16	0	0.00
35719.	Dzulfikar (dzulfikaraf)	1	63.10	63.10	0	0.00
35720.	Doyle (dzhsck)	1	144.13	144.13	1	100.00
35721.	aniM (dymek)	1	71.98	71.98	0	0.00
35722.	Dylan (dyllin)	1	103.42	103.42	1	100.00
35723.	Dylan (dylanthenerd)	1	84.53	84.53	0	0.00
35724.	Dylan (dylanlikescake)	1	93.46	93.46	0	0.00
35725.	Dwat (dwat13)	1	99.30	99.30	0	0.00
35726.	Norm (dwagner8)	1	96.69	96.69	1	100.00
35727.	Dux (duxviii)	1	83.76	83.76	0	0.00
35728.	Dustin (dustywusty)	1	92.22	92.22	0	0.00
35729.	David (dusanlp_69)	1	62.12	62.12	1	100.00
35730.	Dusan (dusancar)	1	99.06	99.06	0	0.00
35731.	Dusan (dusan321)	1	58.79	58.79	0	0.00
35732.	Alan (durland)	1	120.72	120.72	1	100.00
35733.	Grace (duriangray)	1	113.14	113.14	1	100.00
35734.	Tilm (duqq)	1	109.53	109.53	1	100.00
35735.	Duck (duok)	1	96.65	96.65	0	0.00
35736.	Ewan (dungcatcher)	1	90.00	90.00	0	0.00
35737.	Learner (dumb_waste)	1	55.69	55.69	0	0.00
35738.	Ethel Cain (dumb_alec)	1	84.46	84.46	1	100.00
35739.	Donovan (dudieusmaximus)	1	69.34	69.34	1	100.00
35740.	Steve (duckmuscles)	1	63.32	63.32	0	0.00
35741.	Duck (duckmedic)	1	85.79	85.79	1	100.00
35742.	David (dtowers)	1	104.39	104.39	0	0.00
35743.	Daniel (dsun23)	1	120.96	120.96	1	100.00
35744.	Chad (dr_salfish)	1	119.85	119.85	1	100.00
35745.	pablo (druglord)	1	90.70	90.70	0	0.00
35746.	Dr. Typer (drtypergamer)	1	69.83	69.83	1	100.00
35747.	Dr. (drtulung)	1	102.78	102.78	1	100.00
35748.	Steven (drominar)	1	101.13	101.13	0	0.00
35749.	Sniper (drjustbrick)	1	57.85	57.85	1	100.00
35750.	Drizzle (drizzle671)	1	98.02	98.02	0	0.00
35751.	Dri (dri96)	1	93.37	93.37	1	100.00
35752.	andy (drewpickett)	1	85.52	85.52	1	100.00
35753.	Chinmay (dreamscorcherx)	1	136.46	136.46	0	0.00
35754.	Andrii (dreamay)	1	78.95	78.95	1	100.00
35755.	Alexa (drawnblue)	1	114.60	114.60	0	0.00
35756.	dramorak (dramorak)	1	98.82	98.82	0	0.00
35757.	Jawad (dragonrot)	1	48.11	48.11	0	0.00
35758.	DragonChasto846 (dragonchat...	1	51.15	51.15	0	0.00
35759.	Chhanun (dragonasia6)	1	57.75	57.75	0	0.00
35760.	A (dragon02)	1	116.97	116.97	0	0.00
35761.	Drabberfox (drabberfox)	1	63.93	63.93	1	100.00
35762.	Presidente (dr0g4d0)	1	68.20	68.20	1	100.00
35763.	Josh (dpjoshy)	1	123.14	123.14	1	100.00
35764.	Dovi (dovi1337)	1	101.41	101.41	0	0.00
35765.	ange (doveyange)	1	78.32	78.32	0	0.00
35766.	Doron (doron)	1	74.56	74.56	0	0.00
35767.	door (door_qwerty)	1	123.28	123.28	1	100.00
35768.	Thomas (door_kun)	1	60.83	60.83	0	0.00
35769.	doorcrasher (doorcrasher)	1	88.79	88.79	0	0.00
35770.	Mathias (doomthunder)	1	100.73	100.73	0	0.00
35771.	George (dooglplex)	1	116.99	116.99	0	0.00
35772.	Stephen (dondodedondi)	1	77.38	77.38	0	0.00
35773.	Daniel (doctorfm3)	1	83.12	83.12	0	0.00
35774.	Dobby (dobbycb)	1	76.49	76.49	0	0.00
35775.	DuhMarquis (dmy3)	1	96.80	96.80	0	0.00
35776.	Dev (dmookerjee)	1	85.66	85.66	1	100.00
35777.	DLaiy (dlaiy)	1	70.52	70.52	0	0.00
35778.	Dkoctro (dkoctro)	1	67.19	67.19	0	0.00
35779.	Douglas (djwtheman)	1	89.65	89.65	0	0.00
35780.	Charles (djexecutioner)	1	67.93	67.93	0	0.00
35781.	DIVYANSHU (divyanshu310)	1	33.95	33.95	0	0.00
35782.	D'Oracle (divinelyfearless)	1	75.99	75.99	0	0.00
35783.	Divine (divine123)	1	49.27	49.27	0	0.00
35784.	Divyanshu (div7s)	1	54.67	54.67	0	0.00
35785.	Divyanshu (div34357)	1	48.83	48.83	0	0.00
35786.	Jaden (dissolver)	1	87.60	87.60	0	0.00
35787.	Gianfranco (discordes)	1	92.26	92.26	0	0.00
35788.	DisclosedVector (disclosed_...	1	105.32	105.32	1	100.00
35789.	the goat (disciple_yt)	1	141.28	141.28	1	100.00
35790.	Disambiguous (disambiguous)	1	117.48	117.48	1	100.00
35791.	Kaeble (dirtyearl)	1	123.06	123.06	1	100.00
35792.	Diogo (diogob)	1	62.04	62.04	1	100.00
35793.	Đức (dinhduc2601)	1	95.07	95.07	1	100.00
35794.	Timothy (dingamer)	1	103.61	103.61	0	0.00
35795.	rhamy (dilldoee)	1	61.39	61.39	0	0.00
35796.	Dilectiss (dilektislav)	1	102.27	102.27	0	0.00
35797.	Aaron (diesirae91)	1	113.38	113.38	1	100.00
35798.	Muhammad (diehardboi)	1	92.39	92.39	0	0.00
35799.	Diego (diego12719)	1	113.61	113.61	1	100.00
35800.	Dickerlicker (dickerlicker)	1	115.69	115.69	1	100.00
35801.	Diar322 (diar322)	1	65.59	65.59	0	0.00
35802.	diana (dianatran)	1	112.66	112.66	0	0.00
35803.	Abod (dhr_abod)	1	92.13	92.13	0	0.00
35804.	Daniel (dhaaq)	1	92.61	92.61	1	100.00
35805.	Daner (dferha2)	1	96.48	96.48	0	0.00
35806.	dewy (dewy03)	1	53.49	53.49	0	0.00
35807.	dev (devsick)	1	48.52	48.52	0	0.00
35808.	Dev (devsaluja15)	1	70.94	70.94	0	0.00
35809.	Юрий (devilvslife)	1	68.50	68.50	1	100.00
35810.	Davide (deviltube98)	1	91.98	91.98	1	100.00
35811.	DevChris (devchris1314)	1	64.39	64.39	0	0.00
35812.	typegud (desun)	1	93.19	93.19	0	0.00
35813.	Jeffrey (descraton)	1	149.94	149.94	1	100.00
35814.	Gabe (derumisis)	1	122.76	122.76	0	0.00
35815.	Sam (derpysquidboy)	1	57.40	57.40	0	0.00
35816.	chloe (derpfacedan)	1	103.87	103.87	1	100.00
35817.	dominique (derangedwedding)	1	107.28	107.28	0	0.00
35818.	Solomon (deputycommissioner...	1	56.10	56.10	0	0.00
35819.	Jere (depressedone)	1	74.71	74.71	1	100.00
35820.	David (depgai)	1	83.24	83.24	1	100.00
35821.	Damian (depek)	1	92.72	92.72	0	0.00
35822.	Duh-vorak (denys_147)	1	69.38	69.38	0	0.00
35823.	Wayne (dennynukes)	1	116.11	116.11	1	100.00
35824.	Dennis (dennis_lehmann)	1	50.88	50.88	0	0.00
35825.	Denis (denissined)	1	98.44	98.44	1	100.00
35826.	Denish (denishkayastha)	1	66.12	66.12	1	100.00
35827.	DemPlayz (demplayz)	1	95.86	95.86	0	0.00
35828.	Diego (demo5567)	1	59.69	59.69	0	0.00
35829.	Baris (demir2k)	1	64.85	64.85	1	100.00
35830.	Matt (demigod2005yr)	1	81.27	81.27	0	0.00
35831.	Delta (deltarl)	1	91.80	91.80	1	100.00
35832.	Dibyajyoti sarkar (delex)	1	22.03	22.03	0	0.00
35833.	Dekita (dekita123)	1	81.52	81.52	0	0.00
35834.	Jacob (deety)	1	67.39	67.39	0	0.00
35835.	deema (deema9)	1	68.87	68.87	1	100.00
35836.	Dracule (deelipsingh77)	1	46.83	46.83	0	0.00
35837.	Void (decusd)	1	56.48	56.48	0	0.00
35838.	Declan (decmasta)	1	97.06	97.06	0	0.00
35839.	Quack Werty (decadance)	1	95.54	95.54	1	100.00
35840.	Debunked (debunked)	1	150.87	150.87	1	100.00
35841.	shubhkarman (death_zeal)	1	58.85	58.85	0	0.00
35842.	spira (ddlcld)	1	69.13	69.13	0	0.00
35843.	David (ddas445)	1	79.06	79.06	0	0.00
35844.	Marko (dbshard)	1	91.50	91.50	0	0.00
35845.	da_B0mba (da_b0mba)	1	94.01	94.01	1	100.00
35846.	Assassin (dawson19)	1	33.36	33.36	1	100.00
35847.	David (davidzocker3)	1	98.00	98.00	1	100.00
35848.	Dav (davidskarm)	1	48.13	48.13	0	0.00
35849.	Davidsito (davidsito)	1	34.52	34.52	0	0.00
35850.	david (davidisthebest48)	1	53.97	53.97	0	0.00
35851.	david (davidbeshay)	1	62.79	62.79	0	0.00
35852.	David (davida693)	1	90.87	90.87	1	100.00
35853.	Dave (davethewave1234)	1	52.28	52.28	0	0.00
35854.	Dave (davekane)	1	80.29	80.29	0	0.00
35855.	Dauletbek (dauksh)	1	41.94	41.94	0	0.00
35856.	utaaaa (datwuzuzerland)	1	57.36	57.36	0	0.00
35857.	Salle (dating92)	1	113.11	113.11	1	100.00
35858.	rtr (darxidemlg)	1	60.40	60.40	1	100.00
35859.	Darth (darthbetterthanyou)	1	117.48	117.48	1	100.00
35860.	Darro (darro)	1	49.17	49.17	0	0.00
35861.	Tushar (dark_thunder)	1	50.78	50.78	0	0.00
35862.	Dominic (dark_demon)	1	76.33	76.33	0	0.00
35863.	tobiah (darktilrisen)	1	65.42	65.42	0	0.00
35864.	Darko (darkec)	1	80.07	80.07	0	0.00
35865.	XΣЯӨ (darius_dragon)	1	33.59	33.59	1	100.00
35866.	Darius (dariussgt22)	1	41.45	41.45	0	0.00
35867.	Concreap (dareapyboi)	1	67.53	67.53	0	0.00
35868.	Luis (dardon)	1	43.50	43.50	0	0.00
35869.	DAPAT (dapat)	1	58.48	58.48	0	0.00
35870.	Dan (dan_is_garbo)	1	32.39	32.39	1	100.00
35871.	Dany (dany191)	1	76.24	76.24	0	0.00
35872.	Daniel (dantheman0509)	1	105.51	105.51	1	100.00
35873.	Dan (danodin)	1	39.29	39.29	0	0.00
35874.	Danny ak7 (dannymr28)	1	46.62	46.62	0	0.00
35875.	Dallas (danki)	1	56.07	56.07	0	0.00
35876.	Jed (dankravioli)	1	79.77	79.77	1	100.00
35877.	Daniel (danighosyyt)	1	38.04	38.04	0	0.00
35878.	Daniel (danielrk)	1	106.79	106.79	0	0.00
35879.	Danee (danee929)	1	94.26	94.26	1	100.00
35880.	Damien (damiien)	1	57.17	57.17	1	100.00
35881.	dakszaksmom (dakszaksmom)	1	98.55	98.55	0	0.00
35882.	DAJ (daj8112)	1	50.13	50.13	0	0.00
35883.	Daisy (daiyu_)	1	36.02	36.02	1	100.00
35884.	Grant (dahl192)	1	49.95	49.95	0	0.00
35885.	Daggy (daggygod)	1	62.90	62.90	0	0.00
35886.	Alec (daftpain)	1	55.06	55.06	0	0.00
35887.	DaFluffyOwl (dafluffyowl)	1	60.65	60.65	0	0.00
35888.	Ryan (dab_city)	1	102.88	102.88	0	0.00
35889.	DABBER (dabber2)	1	45.56	45.56	0	0.00
35890.	Dallin (d4llin)	1	93.43	93.43	1	100.00
35891.	d1r3ct0r (d1r3ct0r)	1	47.56	47.56	0	0.00
35892.	fluffy (d0nuts)	1	73.89	73.89	0	0.00
35893.	Danial (d0d1ek)	1	48.15	48.15	0	0.00
35894.	Kacper (czolgista007)	1	66.41	66.41	1	100.00
35895.	Michael (czapka)	1	99.74	99.74	0	0.00
35896.	cyriled (cyriled)	1	64.51	64.51	0	0.00
35897.	Cynical (cynicalentity)	1	114.79	114.79	1	100.00
35898.	M (cymiyabe)	1	104.22	104.22	0	0.00
35899.	LEGO (cymiao2014)	1	97.94	97.94	0	0.00
35900.	Clare (cygrnt)	1	134.10	134.10	0	0.00
35901.	Martin (cydrox)	1	114.16	114.16	1	100.00
35902.	Cole (cwburke)	1	76.40	76.40	0	0.00
35903.	Humberto (curvekiller)	1	54.95	54.95	0	0.00
35904.	Cuprian (cuprian)	1	55.12	55.12	0	0.00
35905.	Brudda (cumlord57)	1	35.59	35.59	1	100.00
35906.	Cam (cukelllz)	1	64.36	64.36	0	0.00
35907.	Rico (cujodog09)	1	53.89	53.89	0	0.00
35908.	Cauê (cue_fran)	1	36.59	36.59	0	0.00
35909.	Emma (cuddleeee)	1	100.15	100.15	0	0.00
35910.	CuddleCookie (cuddlecookie)	1	87.93	87.93	1	100.00
35911.	Achintya (cubefreak777)	1	63.18	63.18	0	0.00
35912.	Cristina (csnyder934)	1	53.41	53.41	0	0.00
35913.	Cole (csl2000)	1	88.40	88.40	1	100.00
35914.	seasaara (csawmer_)	1	80.26	80.26	0	0.00
35915.	Rjay (crustybacon)	1	77.21	77.21	0	0.00
35916.	cruderustle (cruderustle)	1	108.16	108.16	1	100.00
35917.	The Bishop (crucifix_)	1	81.60	81.60	1	100.00
35918.	Crowbot (crowbot)	1	91.67	91.67	0	0.00
35919.	Cross (crosscarrier)	1	86.81	86.81	0	0.00
35920.	Ted (crompnickton)	1	82.40	82.40	0	0.00
35921.	Jared (creepywizard)	1	67.24	67.24	0	0.00
35922.	Izor (creator_12)	1	53.74	53.74	1	100.00
35923.	Stuart (crazystu)	1	138.34	138.34	1	100.00
35924.	mahmood (crazyiv)	1	95.24	95.24	0	0.00
35925.	Freddy (crazyfreddy)	1	69.51	69.51	0	0.00
35926.	Blair (cratman9)	1	86.48	86.48	0	0.00
35927.	Pat (cranytorso)	1	29.81	29.81	0	0.00
35928.	cpt (cpt_chucky)	1	50.42	50.42	0	0.00
35929.	Snipers (cozyshack)	1	124.91	124.91	0	0.00
35930.	cowsaysmoo2 (cowsaysmoo1)	1	151.21	151.21	1	100.00
35931.	Tommy (cowgoesbawk)	1	143.40	143.40	1	100.00
35932.	cow (cowerino)	1	128.26	128.26	0	0.00
35933.	Matthew (courtreporter)	1	132.01	132.01	1	100.00
35934.	Cosmos (cosmosatlas)	1	82.12	82.12	0	0.00
35935.	Cosmic (cosmicuser)	1	76.54	76.54	1	100.00
35936.	Mohammed Afeef (cosmicpegas...	1	49.39	49.39	0	0.00
35937.	Cormac (cormacdaman57)	1	65.99	65.99	1	100.00
35938.	Coco (copilot17)	1	115.96	115.96	1	100.00
35939.	Hakan (cooperdevi)	1	114.77	114.77	1	100.00
35940.	Abraham (coolbro3451)	1	70.20	70.20	0	0.00
35941.	Cookies (cookies523)	1	54.41	54.41	1	100.00
35942.	sync (convictedfelon123)	1	124.74	124.74	1	100.00
35943.	Connor (connorking)	1	72.05	72.05	1	100.00
35944.	Connor (connorjh)	1	94.99	94.99	1	100.00
35945.	Connor (connordege)	1	34.24	34.24	0	0.00
35946.	Chingsung (conelead)	1	111.15	111.15	1	100.00
35947.	Conor (conargh)	1	93.47	93.47	0	0.00
35948.	complexcherry (complexcherry)	1	48.63	48.63	0	0.00
35949.	Keen (commander_keen)	1	66.45	66.45	1	100.00
35950.	Seraphine (commandernoypi)	1	43.71	43.71	0	0.00
35951.	Jonathan (comeonet)	1	109.04	109.04	1	100.00
35952.	arstdhneio (colemak_arst)	1	114.00	114.00	1	100.00
35953.	Nemanja (coldsiemens)	1	81.24	81.24	0	0.00
35954.	Coitado (coitado_man)	1	79.15	79.15	0	0.00
35955.	Josh (coherentwalrus)	1	102.39	102.39	1	100.00
35956.	coffeebottle (coffeebottle1)	1	83.45	83.45	0	0.00
35957.	Cod Of Ages (codofages)	1	94.73	94.73	1	100.00
35958.	The (codingazn)	1	86.35	86.35	0	0.00
35959.	codeless (codeless)	1	63.01	63.01	0	0.00
35960.	Cobri420 (cobrili420)	1	81.55	81.55	0	0.00
35961.	Brendan (coalie)	1	68.29	68.29	0	0.00
35962.	cn_vbs (cn_vbs)	1	75.32	75.32	0	0.00
35963.	Ethan (cmfridays)	1	81.59	81.59	0	0.00
35964.	Anas (cloudo)	1	63.76	63.76	0	0.00
35965.	Eric (cloud99)	1	55.85	55.85	0	0.00
35966.	clobre (clobro)	1	60.61	60.61	0	0.00
35967.	cloasies (cloasies)	1	82.87	82.87	0	0.00
35968.	Jeffrey (clickk)	1	107.75	107.75	0	0.00
35969.	Chardiggity (clehmann)	1	43.40	43.40	0	0.00
35970.	Joe (clauser)	1	108.65	108.65	1	100.00
35971.	Claudia (claudia215)	1	98.59	98.59	0	0.00
35972.	Alyssa (clarrissa)	1	87.84	87.84	1	100.00
35973.	Rodolfo (clamchowder_)	1	59.89	59.89	0	0.00
35974.	Chris (ckim11)	1	83.16	83.16	1	100.00
35975.	Mihajlo (ckicka2005)	1	81.01	81.01	1	100.00
35976.	1,3,7-Trimethylpurine-2,6-d...	1	105.36	105.36	0	0.00
35977.	jsc (cjs0712)	1	142.36	142.36	1	100.00
35978.	Eli (citrus_eel)	1	42.87	42.87	0	0.00
35979.	Citrus (citrus08)	1	64.59	64.59	0	0.00
35980.	Eric (circador)	1	121.97	121.97	1	100.00
35981.	Marcin (cinekw)	1	46.56	46.56	0	0.00
35982.	Simon (cimon423)	1	69.51	69.51	0	0.00
35983.	ciccox (ciccox)	1	54.32	54.32	0	0.00
35984.	Chynna (chynnatown)	1	117.72	117.72	0	0.00
35985.	Churr0s (churr0s)	1	79.80	79.80	1	100.00
35986.	chupapi (chupapimunyanyo69420)	1	115.22	115.22	1	100.00
35987.	Chun (chunni)	1	72.06	72.06	1	100.00
35988.	Big (chunky_chunga)	1	73.02	73.02	0	0.00
35989.	shut (chunkypeanutbutter)	1	63.83	63.83	0	0.00
35990.	Isaac (chunkyipa)	1	78.54	78.54	0	0.00
35991.	Christine (christinebostrom9)	1	77.25	77.25	0	0.00
35992.	Chris (chriss777)	1	76.36	76.36	1	100.00
35993.	Chris (chrisdave)	1	116.14	116.14	1	100.00
35994.	Kaguluman (chrischaostf2)	1	98.74	98.74	1	100.00
35995.	Chris (chris89233)	1	90.12	90.12	1	100.00
35996.	Chris (chris4285)	1	43.08	43.08	0	0.00
35997.	J'hamed (chouthe2nd)	1	102.04	102.04	0	0.00
35998.	chopper (chopper111)	1	166.04	166.04	1	100.00
35999.	Teddy (chookee)	1	103.21	103.21	1	100.00
36000.	wonderbubble (chom_chu_)	1	77.54	77.54	1	100.00
36001.	Gabriel (chocolate_dude)	1	87.35	87.35	0	0.00
36002.	Chirdis (chirdis)	1	60.56	60.56	0	0.00
36003.	Chip (chip_king)	1	102.45	102.45	0	0.00
36004.	Kevin (chips1337)	1	62.78	62.78	1	100.00
36005.	Oikawa (chillypeppermint)	1	112.84	112.84	0	0.00
36006.	Chilly (chillycloth)	1	80.84	80.84	0	0.00
36007.	sam (chillfilter)	1	93.61	93.61	0	0.00
36008.	Tyrone (chidorimove)	1	82.41	82.41	0	0.00
36009.	Chicken (chickendinnr)	1	77.66	77.66	1	100.00
36010.	Chew (chewyixin99)	1	99.70	99.70	0	0.00
36011.	Chewing (chewingtinfoil)	1	64.86	64.86	0	0.00
36012.	Shînta (chengos)	1	89.88	89.88	1	100.00
36013.	Chelsea (chelseaaaa)	1	66.36	66.36	1	100.00
36014.	chefshatonyou (chefshatonyou)	1	135.53	135.53	0	0.00
36015.	Ben Dover (cheeesehoe)	1	80.91	80.91	0	0.00
36016.	Chester (cheddafps)	1	40.20	40.20	0	0.00
36017.	Andrey (cheaterkin)	1	93.19	93.19	1	100.00
36018.	Chaz (chazmus)	1	72.01	72.01	1	100.00
36019.	Nicky (charskun)	1	63.36	63.36	0	0.00
36020.	Charlie (charliehuang24)	1	54.01	54.01	0	0.00
36021.	Wsthms (charlesseo)	1	76.58	76.58	0	0.00
36022.	Charkz (charkz)	1	70.73	70.73	0	0.00
36023.	Clifton (charcoalfiltered)	1	90.62	90.62	0	0.00
36024.	Charles (charcharryu)	1	80.50	80.50	0	0.00
36025.	chaos (chaos0312)	1	103.78	103.78	1	100.00
36026.	Andrew (chanmandrew)	1	79.19	79.19	0	0.00
36027.	storm trooper (chandu998)	1	73.05	73.05	1	100.00
36028.	chandamandal (chandamandal)	1	76.29	76.29	1	100.00
36029.	Noah (champion8795)	1	53.14	53.14	0	0.00
36030.	J (chalcha)	1	59.09	59.09	0	0.00
36031.	cetewyn (cetewyn_)	1	143.98	143.98	0	0.00
36032.	Cessa (cessactdm)	1	96.28	96.28	1	100.00
36033.	Mars (cerullo)	1	62.54	62.54	0	0.00
36034.	CeriumG (ceriumg)	1	86.65	86.65	1	100.00
36035.	Barack (ceo_of_communism)	1	64.07	64.07	1	100.00
36036.	Celios (celios)	1	108.63	108.63	1	100.00
36037.	V (celestialparfait)	1	39.56	39.56	0	0.00
36038.	Ceejay (ceejay3626)	1	63.26	63.26	0	0.00
36039.	Cédrik Paquin (cedpaq01)	1	82.69	82.69	0	0.00
36040.	thapakazi (ceasors)	1	62.08	62.08	0	0.00
36041.	cc (cclin130)	1	116.30	116.30	1	100.00
36042.	Tano (ccastro123)	1	47.35	47.35	0	0.00
36043.	Callum (cblake2205)	1	46.27	46.27	0	0.00
36044.	David (cavestoryking64)	1	89.98	89.98	0	0.00
36045.	cat (catnigga)	1	60.05	60.05	0	0.00
36046.	Catia (catiarin)	1	33.53	33.53	0	0.00
36047.	HandyManny (casteristic)	1	58.92	58.92	0	0.00
36048.	Cary (cary2060)	1	57.15	57.15	0	0.00
36049.	Carter (carter04julian)	1	64.73	64.73	1	100.00
36050.	Carrot (carrotocn)	1	118.63	118.63	1	100.00
36051.	Joe (carrotdrill)	1	129.29	129.29	1	100.00
36052.	Carokins (carokins)	1	66.74	66.74	0	0.00
36053.	Carlos (carloscruz42)	1	43.93	43.93	0	0.00
36054.	Carissa (carissarks)	1	51.57	51.57	0	0.00
36055.	Nicolás (carcamo)	1	93.15	93.15	0	0.00
36056.	CaptainVR (captainvr)	1	48.06	48.06	0	0.00
36057.	Temos (captainteemo)	1	66.01	66.01	0	0.00
36058.	Akash (captaindroid)	1	68.81	68.81	1	100.00
36059.	Caleb (captaincujab)	1	43.89	43.89	0	0.00
36060.	Lino (captaincrack)	1	61.95	61.95	0	0.00
36061.	Toan (caotoan999)	1	49.39	49.39	0	0.00
36062.	Alex (cantthingofusernameyay)	1	117.62	117.62	1	100.00
36063.	cam (cam_fung)	1	50.56	50.56	0	0.00
36064.	Cameron (camchang)	1	110.46	110.46	1	100.00
36065.	Pabo (camahthegiant)	1	38.35	38.35	1	100.00
36066.	Gabriel (caluya)	1	105.13	105.13	1	100.00
36067.	Weng (calmturtle)	1	66.10	66.10	1	100.00
36068.	Callum (calleazyy)	1	48.56	48.56	0	0.00
36069.	Calistus (calistus)	1	144.17	144.17	0	0.00
36070.	caleb the twig (caleb_the_t...	1	63.40	63.40	0	0.00
36071.	Cal (calbar)	1	128.53	128.53	1	100.00
36072.	Caio (caiobatman)	1	84.70	84.70	0	0.00
36073.	Cha (cafedossa)	1	116.39	116.39	0	0.00
36074.	Caesium0810 (caesium0810)	1	112.01	112.01	0	0.00
36075.	Caeden (caeden2008)	1	93.04	93.04	1	100.00
36076.	Cadspen (cadspen)	1	125.22	125.22	1	100.00
36077.	eri (cactus622)	1	107.14	107.14	1	100.00
36078.	FortnutGamur69 (c0ck_n_ba11s)	1	90.30	90.30	1	100.00
36079.	Val (bxl_vie_1212gordon)	1	74.33	74.33	0	0.00
36080.	bwandyn (bwandyn)	1	115.09	115.09	1	100.00
36081.	Butu (butu)	1	47.81	47.81	1	100.00
36082.	Gianluca (butter_waffle)	1	62.40	62.40	0	0.00
36083.	Gingy (busterchoppie)	1	73.69	73.69	0	0.00
36084.	Busali (busali2008)	1	53.59	53.59	0	0.00
36085.	Burhanuddin Merchant (burza)	1	45.31	45.31	0	0.00
36086.	steline (burntscones)	1	91.64	91.64	0	0.00
36087.	Luis (burningpsycho)	1	86.39	86.39	1	100.00
36088.	Alex (burningpain)	1	63.54	63.54	0	0.00
36089.	BruhBruh (burningbird999)	1	51.41	51.41	0	0.00
36090.	Burger (burger_man)	1	103.55	103.55	0	0.00
36091.	burgerhex (burgerhex)	1	121.00	121.00	1	100.00
36092.	Glenn (burappi)	1	76.95	76.95	0	0.00
36093.	Josh (bumbull)	1	98.03	98.03	1	100.00
36094.	Đức (buinguyendinhduc96)	1	69.32	69.32	0	0.00
36095.	becca (buhbecca)	1	69.32	69.32	0	0.00
36096.	Rahul (bug_addict)	1	69.79	69.79	0	0.00
36097.	Joshua (bubulone)	1	43.47	43.47	0	0.00
36098.	john (bubbles_tv)	1	64.22	64.22	0	0.00
36099.	David (bubberducky)	1	116.73	116.73	0	0.00
36100.	Brent (btent)	1	99.72	99.72	1	100.00
36101.	Brendan (btdevine)	1	91.72	91.72	0	0.00
36102.	bsbs (bsbs03)	1	58.93	58.93	0	0.00
36103.	Kimmie (bryan_kimmie)	1	100.05	100.05	0	0.00
36104.	Bryan (bryan6734)	1	95.16	95.16	1	100.00
36105.	LmaoUrTrash (bruhmoment2341...	1	107.93	107.93	1	100.00
36106.	Jacob (bruh3323)	1	87.32	87.32	1	100.00
36107.	Rafi (brownvitalik)	1	85.63	85.63	0	0.00
36108.	brotherelric (brotherelric)	1	90.38	90.38	1	100.00
36109.	John (brodros)	1	55.92	55.92	1	100.00
36110.	Brocli (brocli)	1	135.68	135.68	1	100.00
36111.	Anderson (broccoliman)	1	104.74	104.74	0	0.00
36112.	Brill (brill85)	1	49.05	49.05	1	100.00
36113.	Brie (briemobiel)	1	98.41	98.41	0	0.00
36114.	Briana (briana169)	1	80.05	80.05	0	0.00
36115.	brendon (brend0n)	1	71.52	71.52	1	100.00
36116.	Brandon (branthrax123)	1	42.03	42.03	0	0.00
36117.	Branimir (brankeros_17)	1	72.05	72.05	0	0.00
36118.	Bracklet (bracklet)	1	76.42	76.42	0	0.00
36119.	Bracador (bracador)	1	127.85	127.85	1	100.00
36120.	Erich (br3ad)	1	88.66	88.66	0	0.00
36121.	deric (bplo)	1	89.40	89.40	0	0.00
36122.	Blake (bpermenter)	1	88.10	88.10	0	0.00
36123.	Bpandu (bpandu)	1	88.79	88.79	1	100.00
36124.	Jian Feng (bosprimigenius)	1	119.32	119.32	0	0.00
36125.	Borna (borna433)	1	55.56	55.56	1	100.00
36126.	Cristobal Zarco (boomer_tor...	1	96.74	96.74	1	100.00
36127.	Boo_layout_noob (boolayoutn...	1	57.33	57.33	0	0.00
36128.	Charlie (boogiememeboi)	1	59.88	59.88	1	100.00
36129.	Bonbon (bonbontherabbit)	1	82.98	82.98	1	100.00
36130.	Boltcrasher (boltcrasher)	1	92.72	92.72	0	0.00
36131.	bool3max (bolemax_accuracy)	1	116.33	116.33	1	100.00
36132.	Indiance (bois_sux_101)	1	127.90	127.90	1	100.00
36133.	Daniel (boichoi137)	1	91.12	91.12	0	0.00
36134.	Bohdan (bogdanr)	1	72.93	72.93	0	0.00
36135.	Matthew (boebie)	1	94.45	94.45	0	0.00
36136.	Slimesito (bodhisteel)	1	93.46	93.46	1	100.00
36137.	dominic (bobomopre)	1	76.41	76.41	0	0.00
36138.	Bobbie (bobbieshroom)	1	112.26	112.26	0	0.00
36139.	Robert (bobbert_63)	1	62.68	62.68	0	0.00
36140.	Bobae (bobaec)	1	146.70	146.70	1	100.00
36141.	BlumberKid (blumberkid)	1	78.27	78.27	0	0.00
36142.	== Klub (blueclub)	1	122.66	122.66	0	0.00
36143.	Blox (bloxid)	1	61.03	61.03	0	0.00
36144.	Juri (bloodych)	1	43.79	43.79	0	0.00
36145.	Fakrul (blizzardwind)	1	76.94	76.94	0	0.00
36146.	Blitz (blitzwanker)	1	54.34	54.34	0	0.00
36147.	Juan (blindspot)	1	77.40	77.40	0	0.00
36148.	Daniel (blazin_)	1	127.41	127.41	1	100.00
36149.	Ayden (blaze_adawg)	1	42.32	42.32	0	0.00
36150.	Ricky (blazed_ricardo)	1	113.69	113.69	1	100.00
36151.	Gabriel (blastergnc)	1	52.03	52.03	0	0.00
36152.	Hello (blakeiv)	1	103.37	103.37	1	100.00
36153.	astro (black_astro)	1	58.91	58.91	1	100.00
36154.	nipple (blackmokeys)	1	62.36	62.36	0	0.00
36155.	Brayden (blackbat1645)	1	59.63	59.63	1	100.00
36156.	Björn Orri (bjornorri)	1	100.88	100.88	1	100.00
36157.	Travis (bizmos)	1	53.47	53.47	0	0.00
36158.	Jacob (bizarrecake)	1	133.76	133.76	1	100.00
36159.	Alex (bissector)	1	77.19	77.19	1	100.00
36160.	Biplob (biplob_phukan)	1	62.45	62.45	0	0.00
36161.	bipin (bipin2019)	1	51.00	51.00	0	0.00
36162.	Star (bintangsatwika)	1	86.70	86.70	1	100.00
36163.	Bill (billxnye)	1	84.57	84.57	0	0.00
36164.	Takumi (bilbobaggins440)	1	98.35	98.35	0	0.00
36165.	Salvador (bigsalvador)	1	44.20	44.20	0	0.00
36166.	Maidenless (bigguy12)	1	102.74	102.74	1	100.00
36167.	Niklas (bigerius)	1	130.57	130.57	1	100.00
36168.	Haydn (bigdickclimber5_12)	1	69.30	69.30	0	0.00
36169.	Jace (bigboyjones69)	1	92.53	92.53	1	100.00
36170.	kylie (bibiq)	1	100.29	100.29	1	100.00
36171.	Venkata Sai Bhanu Sachin (b...	1	63.46	63.46	1	100.00
36172.	Olivia (bgts)	1	33.80	33.80	0	0.00
36173.	Jack (bgbfurey)	1	126.76	126.76	1	100.00
36174.	Betül (betull)	1	69.84	69.84	0	0.00
36175.	monkeytypebeast (bestworldw...	1	75.14	75.14	0	0.00
36176.	Bence (beta_hun)	1	53.93	53.93	1	100.00
36177.	Nicola (bertucciagialla)	1	71.43	71.43	0	0.00
36178.	Beryl (berrr16)	1	33.58	33.58	0	0.00
36179.	Warren (berkshire)	1	91.93	91.93	0	0.00
36180.	Bentusian (bentusian)	1	67.66	67.66	0	0.00
36181.	Lammy (benstickobi595)	1	71.52	71.52	1	100.00
36182.	Benjamin (bennegrus)	1	77.13	77.13	0	0.00
36183.	Benjamin (benjaminlaptop)	1	94.11	94.11	0	0.00
36184.	HK (bengal_tiger)	1	33.17	33.17	0	0.00
36185.	Bella (bella_lasagna)	1	53.37	53.37	0	0.00
36186.	Say1 (beenzino)	1	99.65	99.65	1	100.00
36187.	ERMT (beefwong)	1	70.38	70.38	0	0.00
36188.	Bearrick (bearrick)	1	65.07	65.07	0	0.00
36189.	bean (bean_man123)	1	80.33	80.33	0	0.00
36190.	beans (beansrandy)	1	98.68	98.68	1	100.00
36191.	Jenna (beannie22)	1	90.74	90.74	0	0.00
36192.	Bean (beanervibez)	1	74.55	74.55	0	0.00
36193.	Adam (beakerthe1st)	1	102.38	102.38	0	0.00
36194.	bdam (bdam)	1	106.49	106.49	1	100.00
36195.	Brian (bchoy1994)	1	130.52	130.52	1	100.00
36196.	Alfredo (bc762147)	1	52.80	52.80	0	0.00
36197.	雪 (bbgotme)	1	81.35	81.35	0	0.00
36198.	bawty rippa (bbbrandon)	1	67.34	67.34	0	0.00
36199.	Marek (baumeef)	1	81.97	81.97	0	0.00
36200.	David - Robert (batedcrayon)	1	77.31	77.31	1	100.00
36201.	Brandon (basukaviru)	1	117.28	117.28	0	0.00
36202.	Bas (basoomen10)	1	69.54	69.54	0	0.00
36203.	Basil (basil2077)	1	83.51	83.51	0	0.00
36204.	Brendan (barefootcatfish)	1	100.92	100.92	1	100.00
36205.	Benjo (barbanzo)	1	85.66	85.66	0	0.00
36206.	baqazan (baqazan)	1	83.31	83.31	0	0.00
36207.	Banzz (banzz05)	1	54.50	54.50	0	0.00
36208.	Ryan (bankzzy)	1	81.37	81.37	0	0.00
36209.	anna (bananatan)	1	53.65	53.65	1	100.00
36210.	Annie (bampy08)	1	94.30	94.30	1	100.00
36211.	Amjad (baigsap)	1	36.40	36.40	0	0.00
36212.	hengoat (bagnana)	1	138.65	138.65	1	100.00
36213.	babi (baggymist22063)	1	76.36	76.36	0	0.00
36214.	Slerpasaur (bagasfirdaus)	1	105.48	105.48	1	100.00
36215.	Jaxon (baenayeon)	1	86.51	86.51	1	100.00
36216.	BadScam (badscam)	1	100.90	100.90	0	0.00
36217.	Juan (badluck_guan)	1	54.04	54.04	0	0.00
36218.	Nobody (badd0)	1	69.48	69.48	0	0.00
36219.	Mehdi (badcrc)	1	125.98	125.98	1	100.00
36220.	Fra (bachoseven)	1	75.25	75.25	1	100.00
36221.	Elijah (bacchus1)	1	70.45	70.45	1	100.00
36222.	Babyoven (babyoven)	1	147.53	147.53	1	100.00
36223.	Carlos (babageniuz007)	1	101.76	101.76	1	100.00
36224.	Azure (b1izzard)	1	82.24	82.24	0	0.00
36225.	AJ (a__j)	1	66.13	66.13	0	0.00
36226.	Ardhendu (a_0vi)	1	54.59	54.59	1	100.00
36227.	Bloodcraze (azraef)	1	35.46	35.46	0	0.00
36228.	MOIST (aznboy578)	1	118.10	118.10	1	100.00
36229.	Azka (azka_s)	1	72.87	72.87	0	0.00
36230.	Alex (azheng)	1	96.86	96.86	1	100.00
36231.	Azharly (azharlyxx)	1	43.24	43.24	0	0.00
36232.	Azael (azael69)	1	79.06	79.06	0	0.00
36233.	Ayush (ayush123460)	1	94.74	94.74	1	100.00
36234.	Phreakyx (axsali)	1	48.58	48.58	0	0.00
36235.	Geoff (axorted)	1	64.87	64.87	0	0.00
36236.	Axel (axox)	1	106.79	106.79	1	100.00
36237.	Marek (axolotl720)	1	39.23	39.23	0	0.00
36238.	Axe (axe_bicycle)	1	76.16	76.16	0	0.00
36239.	axe (axeh)	1	122.67	122.67	1	100.00
36240.	Andrew (axcelcr)	1	83.18	83.18	1	100.00
36241.	Stian (awpchicken)	1	50.87	50.87	1	100.00
36242.	AwesomeAsian69 (awesomeasia...	1	79.83	79.83	0	0.00
36243.	Misia (avolvage)	1	54.69	54.69	1	100.00
36244.	panzer (avitastic)	1	83.61	83.61	0	0.00
36245.	Chayanne (avila760)	1	51.00	51.00	0	0.00
36246.	Slim (avietnamesedude)	1	82.00	82.00	0	0.00
36247.	Avery (averyiscoolish)	1	55.09	55.09	0	0.00
36248.	aveda (aveda)	1	46.49	46.49	0	0.00
36249.	(avazl)	1	102.40	102.40	0	0.00
36250.	Auzem (auzem)	1	45.20	45.20	0	0.00
36251.	Poon (auxin001)	1	41.28	41.28	0	0.00
36252.	JS (automaticquail)	1	73.36	73.36	0	0.00
36253.	Austin (austincolibaba)	1	79.99	79.99	0	0.00
36254.	Noah (ausnoa)	1	72.04	72.04	1	100.00
36255.	Nguyen Phuoc (aurasync)	1	26.70	26.70	0	0.00
36256.	Augmas (augmas)	1	82.25	82.25	0	0.00
36257.	Shikhar (at_the_shikhar)	1	48.89	48.89	0	0.00
36258.	atypicallegend ahmed aziz j...	1	13.63	13.63	0	0.00
36259.	StAtomic (atomicplay)	1	69.59	69.59	1	100.00
36260.	AtomRong (atomrong)	1	72.51	72.51	1	100.00
36261.	ONCEbot (atomiconce)	1	53.67	53.67	0	0.00
36262.	Atlas (atlaskd)	1	62.99	62.99	0	0.00
36263.	Arjun (atc6505)	1	119.88	119.88	0	0.00
36264.	Eufil (asuna_kirito25)	1	51.57	51.57	0	0.00
36265.	An Tri (astronimical)	1	73.23	73.23	0	0.00
36266.	Ray (astray_ray)	1	52.69	52.69	0	0.00
36267.	fiji water (astranger24)	1	71.74	71.74	1	100.00
36268.	Andy (astraay)	1	74.97	74.97	1	100.00
36269.	Bigass (assfart)	1	55.00	55.00	0	0.00
36270.	Ethan (assassindgn)	1	93.98	93.98	0	0.00
36271.	assaf297 (assaf297)	1	50.24	50.24	0	0.00
36272.	. (aspens)	1	113.34	113.34	1	100.00
36273.	Bagus (asparagoes)	1	104.53	104.53	0	0.00
36274.	Asil (asilkhalifa)	1	51.82	51.82	0	0.00
36275.	asian (asian219381)	1	74.79	74.79	1	100.00
36276.	ashwin (ashwin_m)	1	31.58	31.58	0	0.00
36277.	Ashwin (ashwinkey04)	1	87.15	87.15	0	0.00
36278.	Ashtra (ashtra)	1	77.37	77.37	0	0.00
36279.	Ashish (ashish_jnvm)	1	54.37	54.37	0	0.00
36280.	Ashish (ashish4563)	1	22.37	22.37	0	0.00
36281.	ashish (ashis0013shaw)	1	48.46	48.46	0	0.00
36282.	Nurdaulet (ashimbekov)	1	47.85	47.85	0	0.00
36283.	AshKetchup (asheketchup)	1	113.66	113.66	1	100.00
36284.	asd (asdasd4)	1	58.66	58.66	0	0.00
36285.	asd (asd135795jack)	1	92.90	92.90	1	100.00
36286.	asburton (asburtongrove)	1	59.61	59.61	0	0.00
36287.	asayla (asayla)	1	77.47	77.47	0	0.00
36288.	arz (arzr)	1	81.53	81.53	0	0.00
36289.	Aryan (aryanp)	1	89.99	89.99	1	100.00
36290.	Arya (aryas)	1	133.21	133.21	1	100.00
36291.	kian (aryanboy)	1	62.60	62.60	0	0.00
36292.	Art (art_licis)	1	96.13	96.13	0	0.00
36293.	gyani (arugyani)	1	114.56	114.56	1	100.00
36294.	Vasja (artemis358)	1	88.67	88.67	0	0.00
36295.	Alex (arslans)	1	71.75	71.75	0	0.00
36296.	Skeletons (arsen4500)	1	49.74	49.74	0	0.00
36297.	John (armon99)	1	71.70	71.70	0	0.00
36298.	armenn (armenn)	1	122.06	122.06	1	100.00