One day soon, man is going to be able to harness incredible energies, maybe even the atom... energies that could ultimately hurl us to other worlds in... in some sort of spaceship. And the men that reach out into space will be able to find ways to feed the hungry millions of the world and to cure their diseases. They will be able to find a way to give each man hope and a common future. And those are the days worth living for.
—from Star Trek, a other by Gene Roddenberry
Active since June 26, 2017.
429 total characters in this text.
View Pit Stop page for this text
Rank | Username | WPM | Accuracy | Date |
---|---|---|---|---|
2878. | Grey (nautili) | 110.77 | 98% | 2021-09-20 |
2879. | Daniel (dbinette03) | 110.76 | 98.7% | 2023-11-22 |
2880. | Cat (catcatcatcatcatcatcatcat) | 110.75 | 98% | 2021-11-15 |
2881. | Fishation (fishation) | 110.75 | 97% | 2023-11-15 |
2882. | Nutty (ryanand1) | 110.75 | 99% | 2022-03-19 |
2883. | Reaching (breakingpoint1) | 110.74 | 98.7% | 2024-06-23 |
2884. | ^-^ (monte123) | 110.74 | 98% | 2017-12-20 |
2885. | AHomieNucleus (galaxxyn1) | 110.73 | 98.1% | 2024-11-09 |
2886. | Snarky (snarkyp) | 110.73 | 99% | 2019-02-07 |
2887. | Mac (rubixgeek101) | 110.72 | 96.6% | 2025-04-11 |
2888. | Jimmy (jimbozeub128) | 110.72 | 99% | 2022-05-11 |
2889. | John (molotov5) | 110.72 | 98% | 2022-06-14 |
2890. | David (dcoh91) | 110.71 | 98% | 2020-04-20 |
2891. | Loic (99loic) | 110.71 | 98% | 2022-10-22 |
2892. | Tyrel (trothlol) | 110.70 | 99% | 2019-01-18 |
2893. | HD (thetruehd) | 110.70 | 99% | 2019-12-04 |
2894. | Murk (marchell0) | 110.69 | 96.3% | 2024-03-09 |
2895. | Cols (cols1) | 110.69 | 97.2% | 2023-06-18 |
2896. | Delgerskhn (thege) | 110.68 | 99% | 2021-11-25 |
2897. | The cute girl likes pink (o... | 110.68 | 97% | 2020-10-03 |
2898. | Randy (randylee) | 110.67 | 97% | 2023-05-03 |
2899. | quipo (quipo) | 110.67 | 97% | 2020-12-23 |
2900. | Nikolai (nikovertus) | 110.65 | 97.9% | 2023-08-24 |
2901. | Blondie (shirase_) | 110.65 | 99% | 2020-12-25 |
2902. | Alex (alexinfinity) | 110.65 | 98% | 2022-11-05 |
2903. | Brandon (ivantt) | 110.65 | 98% | 2022-05-09 |
2904. | OuttaCtrl (outtactrl) | 110.65 | 97% | 2017-08-17 |
2905. | Vince (xxxvintacion) | 110.64 | 97% | 2019-08-18 |
2906. | Joshua (buwan) | 110.64 | 97% | 2022-02-14 |
2907. | Shuyu (stevenqi) | 110.64 | 98% | 2022-05-15 |
Universe | Races | Average WPM | First Race |
---|---|---|---|
Default (English) | 32,730 | 91.75 | June 26, 2017 |
Long Texts | 93 | 89.71 | July 16, 2017 |
Instant Death Mode | 31 | 97.96 | August 13, 2017 |
ᗜ Stenography | 1 | 90.66 | May 2, 2021 |
Sean Wrona's Universe | 1 | 140.82 | April 4, 2023 |