We know that there is not one person who, after hearing these words, would deny their truth and say that he wanted something else, but he would believe that he had heard exactly what he had desired for a long time - namely, to be melted in unison with his beloved, and the two of them become one. The reason is that our ancient nature was thus and we were whole. And so love is merely the name for the desire and pursuit of the whole.
—from Symposium, a book by Plato, translated by Unknown
Active since April 19, 2019.
434 total characters in this text.
View Pit Stop page for this text
Rank | Username | WPM | Accuracy | Date |
---|---|---|---|---|
1615. | Jamie Muir (nalarium) | 125.75 | 99.3% | 2024-07-07 |
1616. | Zane (thebigkekerino) | 125.75 | 99% | 2025-01-12 |
1617. | G (gc3shadow) | 125.75 | 99% | 2021-12-27 |
1618. | some dude (medio02) | 125.72 | 98% | 2024-07-04 |
1619. | MUDAMUDAMUDA (likevin) | 125.72 | 97% | 2020-05-02 |
1620. | Savaroni (savaroni) | 125.70 | 96% | 2023-02-19 |
1621. | Joseph (racecar56) | 125.70 | 99% | 2023-02-22 |
1622. | Julien Galons (jugalons) | 125.66 | 98% | 2024-04-21 |
1623. | PsychoSaeko (psychosaeko) | 125.64 | 98% | 2022-08-31 |
1624. | how? (haotingz) | 125.62 | 98.5% | 2023-06-08 |
1625. | Agung (udapalito) | 125.61 | 99.3% | 2023-10-19 |
1626. | PR (mrprx) | 125.60 | 99% | 2020-02-16 |
1627. | (zealindaus) | 125.58 | 99% | 2021-05-05 |
1628. | Qi (whathaha) | 125.58 | 98% | 2022-02-11 |
1629. | Skrami (skramie) | 125.57 | 97% | 2023-04-22 |
1630. | Gene (mckuletzz) | 125.56 | 97% | 2021-10-21 |
1631. | Ivan (assaultbearer) | 125.55 | 99.3% | 2021-02-03 |
1632. | Minä (arabwinner) | 125.55 | 98% | 2021-11-28 |
1633. | A (blobair) | 125.55 | 99% | 2022-02-04 |
1634. | Cat (catcatcatcatcatcatcatcat) | 125.53 | 99% | 2021-11-18 |
1635. | A (dragon02) | 125.51 | 99% | 2020-12-05 |
1636. | Laggy (thefitfatass) | 125.50 | 99% | 2021-03-08 |
1637. | Disturbed (disturbed_accuracy) | 125.49 | 96% | 2022-04-30 |
1638. | Gifty (gifty_asmr) | 125.49 | 97.6% | 2025-03-06 |
1639. | Marcus (marcusmandarin) | 125.48 | 98% | 2021-09-15 |
1640. | Loui (benesso_) | 125.47 | 98% | 2022-09-10 |
1641. | Suge (lightofday) | 125.47 | 98% | 2022-12-17 |
1642. | Ethan (nobodyj22) | 125.46 | 99% | 2020-11-15 |
1643. | Tuan (tuan_nguyen) | 125.44 | 100% | 2021-01-06 |
1644. | Lato (bop98) | 125.44 | 98.4% | 2025-02-24 |
Universe | Races | Average WPM | First Race |
---|---|---|---|
Default (English) | 32,196 | 96.61 | April 19, 2019 |
Instant Death Mode | 24 | 109.73 | April 24, 2020 |
ᗜ Stenography | 3 | 81.46 | March 27, 2021 |