Text #3811356

One day soon, man is going to be able to harness incredible energies, maybe even the atom... energies that could ultimately hurl us to other worlds in... in some sort of spaceship. And the men that reach out into space will be able to find ways to feed the hungry millions of the world and to cure their diseases. They will be able to find a way to give each man hope and a common future. And those are the days worth living for.

—from Star Trek, a other by Gene Roddenberry

Active since June 26, 2017.
429 total characters in this text.

View Pit Stop page for this text

Leaders

View ranks through of 16,665
Rank Username WPM Accuracy Date
2428. Cat (catcatcatcatcatcatcatcat) 110.75 98% 2021-11-15
2429. Fishation (fishation) 110.75 97% 2023-11-15
2430. Nutty (ryanand1) 110.75 99% 2022-03-19
2431. ^-^ (monte123) 110.74 98% 2017-12-20
2432. Snarky (snarkyp) 110.73 99% 2019-02-07
2433. Jimmy (jimbozeub128) 110.72 99% 2022-05-11
2434. John (molotov5) 110.72 98% 2022-06-14
2435. David (dcoh91) 110.71 98% 2020-04-20
2436. Loic (99loic) 110.71 98% 2022-10-22
2437. Tyrel (trothlol) 110.70 99% 2019-01-18
2438. HD (thetruehd) 110.70 99% 2019-12-04
2439. Colson (cols1) 110.69 97% 2023-06-18
2440. Delgerskhn (thege) 110.68 99% 2021-11-25
2441. The cute girl likes pink (o... 110.68 97% 2020-10-03
2442. Randy (randylee) 110.67 97% 2023-05-03
2443. quipo (quipo) 110.67 97% 2020-12-23
2444. Blondie (shirase_) 110.65 99% 2020-12-25
2445. Nikolai (nikovertus) 110.65 98% 2023-08-24
2446. Alex (alexinfinity) 110.65 98% 2022-11-05
2447. Brandon (ivantt) 110.65 98% 2022-05-09
2448. OuttaCtrl (outtactrl) 110.65 97% 2017-08-17
2449. Joshua (buwan) 110.64 97% 2022-02-14
2450. Shuyu (stevenqi) 110.64 98% 2022-05-15
2451. Vince (xxxvintacion) 110.64 97% 2019-08-18
2452. InsertNameHere (1ns3rtn4m3h... 110.63 98% 2021-10-26
2453. Susan (pfpigs) 110.63 97% 2022-04-13
2454. Lark (sirhaxbard) 110.63 98% 2021-12-14
2455. Violet Evergarden (eizen) 110.63 98% 2019-07-07
2456. amberserpent (amberserpent) 110.61 100% 2022-08-06
2457. ð’…ƒ (hdgamez) 110.60 97.2% 2021-02-03

Universes

Universe Races Average WPM First Race
Default (English) 27,692 90.98 June 26, 2017
Long Texts 75 87.23 July 16, 2017
Instant Death Mode 27 98.52 August 13, 2017
ᗜ Stenography 1 90.66 May 2, 2021
Sean Wrona's Universe 1 140.82 April 4, 2023